Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te / sc r

Stem Cell Research (2013) 11, 587–600

Neurogenic potential of hESC-derived humanradial glia is amplified by human fetal cells

Gisela Reinchisi, Pallavi V. Limaye, Mandakini B. Singh,Srdjan D. Antic, Nada Zecevic⁎

Department of Neuroscience, University of Connecticut Health Center, Farmington, CT 06030, USA

Received 8 November 2012; received in revised form 20 March 2013; accepted 25 March 2013Available online 3 April 2013

Abstract The efficient production of human neocortical neurons from human embryonic stem cells (hESC) is the primaryrequirement for studying early stages of human cortical development. We used hESC to obtain radial glial cells (hESC-RG) andthen compared them with RG cells isolated from human fetal forebrain. Fate of hESC-RG cells critically depends on intrinsicand extrinsic factors. The expression of Pax6 (intrinsic factor) has a similar neurogenic effect on hESC-RG differentiation asreported for human fetal RG cells. Factors from the microenvironment also play a significant role in determining hESC-RG cellfate. In contrast to control cultures, wherein hESC-RG generate mainly astroglia and far fewer neurons, in co-cultures withhuman fetal forebrain cells, the reverse was found to be true. This neurogenic effect was partly due to soluble factors fromhuman fetal brain cultures. The detected shift towards neurogenesis has significance for developing future efficientneuro-differentiation protocols. Importantly, we established that hESC-RG cells are similar in many respects to human fetal RGcells, including their proliferative capacity, neurogenic potential, and ability to generate various cortical neuronal sub-types.Unlike fetal RG cells, the hESC-RG cells are readily available and can be standardized, features that have considerablepractical advantages in research and clinics.

Published by Elsevier B.V.

differentiated cells including motoneurons (Li et al., 2005),

Introduction

Human embryonic stem cells (hESC) provide an ideal systemfor understanding brain development under both healthy anddiseased conditions. They represent a potentially unlimitedsource of transplantable cells for the therapy of neurodegen-erative disorders, and provide an alternative to drug screeningand toxicology assays. Numerous studies have investigated theneurogenic potential of embryonic stem cells and demon-strated that they could be the source of a wide variety of

⁎ Corresponding author at: Department of Neuroscience, Universityof Connecticut Health Center, 263 Farmington Ave., Farmington, CT06030, USA. Fax: +1 860 679 8766.

E-mail address: nzecevic@neuron.uchc.edu (N. Zecevic).URL: http://zecevic.uchc.edu/ (N. Zecevic).

1873-5061/$ - see front matter. Published by Elsevier B.V.http://dx.doi.org/10.1016/j.scr.2013.03.004

dopaminergic and serotoninergic neurons (Belinsky et al.,2011; Yan et al., 2005), glutaminergic and GABAergic neurons(Li et al., 2009), peripheral neurons (Mizuseki et al., 2003),astrocytes and oligodendrocytes (Brustle et al., 1999), andradial glial (RG) cells (Nat et al., 2007).

Radial glial cells are formed from neuroepithelial cells inthe early stages of the nervous system development. Alongwith neuroepithelial markers such as the intermediate fila-ment protein nestin (Hartfuss et al., 2001; Pollard et al., 2006)and stem cell markers, such as transcription factors Sox2 (Suhet al., 2007) and Pax6 (Bibel et al., 2004; Götz et al., 1998),they also express astroglia markers such as astrocyte-specificglutamate aspartate transporter (GLAST), brain lipid-bindingprotein (BLBP), vimentin, RC2, and glial fibrillary acidic protein(GFAP) (Campbell and Gotz, 2002; Noctor et al., 2001). It is the

588 G. Reinchisi et al.

astroglial features that distinguish RG cells from neuroepithelialcells. A surface marker Lex1/CD15, an extracellular matrix-associated carbohydrate, is expressed both in mouse embryonicstem cells (Kim and Morshead, 2003; Capela and Temple, 2006)and human fetal radial glia (Mo et al., 2007). In the presentstudy we identified RG cells in vivo and in vitro by astroglialprogenitor/stem markers combined with their typical bipolarshape.

RG cells have been generated from a variety of differentsources of embryonic and adult brains, and embryonic stemcells (Conti et al., 2005; Liour and Yu, 2003; Bibel et al., 2004;Malatesta et al., 2000). In addition to isolating RG cells fromhuman fetal tissue (Mo et al., 2007), it has recently beenshown that RG cells can be generated from hESC (Nat et al.,2007). We have used the abbreviation hESC-RG to refer toradial glial cells generated in this manner.

Originally, RG cells were demonstrated to be important inguiding radial migration of neurons (Bentivoglio and Mazzarello,1999; Rakic, 2003). However, it has been well-documentedrecently that RG cells are also multipotent progenitor/stemcells, and that they account for the majority of neurogenesis inthe developing and postnatal rodent brain (Malatesta et al.,2000; Noctor et al., 2001; Miyata et al., 2001; Götz andHuttner,2005). In the human brain RG cells express GFAP in early stagesof the emerging cerebral cortex (Zecevic, 2004; Howard et al.,2006, 2008), in contrast to rodents where this happens muchlater in corticogenesis. Human RG cells serve as multipotentneural progenitors generating both neurons and glial cells (Mo etal., 2007; Mo and Zecevic, 2008, 2009; Hansen et al., 2010).Transcription factor Pax6 (Pair Box 6) plays a significant role inneurogenetic capabilities of human fetal radial glial cells (Moand Zecevic, 2008).

The objective of the present investigation was to compareRG cells in the human fetal forebrain (Mo et al., 2007; Mo andZecevic, 2008) with hESC-RG cells with the idea that thesecells can become an unlimited source of neurons available forresearch.

Our findings suggest that hESC-RG share many antigencharacteristics, proliferative capacity, and differentiationpattern with human fetal RG cells and thus are suitable forfurther research on human brain development.

Material and methods

Human ESC culture

Human ES cell line H9 (Stem Cell Core, UCONN) and H9 stablytransfected with EGFP (enhanced green fluorescent protein)under a constitutively active CAG promoter, a gift from Dr. Cai,University of Connecticut Health Center, passages 30–45,were passaged weekly on a feeder layer of irradiated mouseembryonic fibroblasts (MEFs) as previously described (Zhang etal., 2001). The culturemediumconsisted of Dulbecco'smodifiedEagle's medium (DMEM)/F12 (GIBCO-BRL) with 20% knockoutserum replacement, 1 mM glutamine, 1% nonessential aminoacid (all from GIBCO-BRL), 0.1 mM β-mercaptoethanol, and4 ng/ml bFGF2 (basic fibroblast growth factor; PeproTech, LakePlacid, NY).

The colonies were differentiated into neural cells usinga protocol previously described by Nat et al. (2007). Forimmunostaining, flow cytometry and magnetic-activated

cell separation, the floating aggregates were treated withAccutase™ (Chemicon) in 37 °C incubator for ~10 min toobtain single cells.

Co-culture experiments

The hESC-RG expressing EGFP (3 × 103 cells/well) were platedover mixed cell cultures (1 × 105 cells/1.7 cm2 well of a 4-wellchamber slide, BD Falcon) from the human fetal forebrain (17 to20 gestational weeks—gw) containing both telencephalon anddiencephalon, obtained from the Brain Bank repositories.Human tissue has been collected following rules of appropriateinstitutions, withwritten consent, fromunidentifiable subjects.The cultures were maintained and processed as previouslydescribed (Howard et al., 2006; Zecevic, 2004; Mo et al., 2007).To study the effects of secreted factors from human fetal cells,conditioned medium (CM) was collected every 2 days fromthese primary cultures, filtered through a 0.22-μm membraneand stored at −20 °C. This medium was added in the same wayas commercially available medium was added to controlcultures.

Immunostaining

Cell cultures were fixed with 4% paraformaldehyde andimmunostaining was performed as previously described (Moand Zecevic, 2008). Primary antibodies against the followingproteins were diluted in the blocking solution and appliedovernight: vimentin 1:200, GABA 1:300, andMAP2 1:200 (Sigma,Saint Louis, MO), GFAP 1:2000 and BrdU (Bromo-deoxyuridine)1:100 (Dako, Denmark), calretinin 1:500 (Millipore, Temecula,CA), doublecortin 1:200 (Santa Cruz, CA), β-III-tubulin 1:2000and Pax6 1:1000 (Covance, CA), Ki67 1:25 (Beckman Coulter,France), phosphorylated vimentin 4A4 1:500 (MBL), tyrosinehydroxylase 1:1000 (Pel-Freez Biological, Rogers, Arkansas),SMI32 1:1000 (Sternberger Monoclonals Inc., Baltimore,Maryland), SV2 1:500 (Developmental Studies HybridomaBank, IA), PDGFRα 1:500 (Pharmingen, San Diego, CA), GFP1:500 and Foxg1 1:1000 (Abcam, Cambridge, MA), LeX/CD151:100 (Thermo Fisher Scientific, Temecula, CA), Tbr1 1:500(Chemicon, Billerica, MA), Tbr2 1:500 (Gift from Dr Hevner,University of Washington, WA), and NKx2.1 1:250 (Epitomics,Burlingame, CA).

Primary antibodies were followed by secondary antibodies(Jackson ImmunoResearch Laboratories, PA) for 1 h and ashort incubation in the nuclear stain bisbenzamide (Sigma).Coverslips were viewed with the Axioskop microscope (Zeiss,Germany).

Flow cytometric analysis

Flow cytometric analysis was performed by standard stainingprocedures on BD-FACS Aria (BD Biosciences, San Jose, CA)using APC Mouse Anti-Human CD15 (BD Biosciences). Deadcells were excluded from our analysis by their ability toincorporate propidium iodide (PI) and background fluores-cence by using unlabeled cells and isotype controls. Data wereanalyzed using FlowJo Software (Tree Star, Inc., Ashland, OR).

589Radial glia derived from human-ESC

Magnetic-activated cell sorting

To enrich RG cells for our in vitro studies, we applied a methodbased on the expression of LeX carbohydrate epitope (fucoseN-acetyl lactosamine, an extracellular matrix-associated car-bohydrate also known as LewisX, SSEA-1 or CD15) on the cellsurface (Mo et al., 2007). We first generated dorsal forebrainprogenitor cells from hESCs and then isolated a LeX+ populationof hESC-RG cells using a magnetic cell separation system withLeX (CD15+) isolation kit (MACS, Miltenyi Biotec, Germany)according to manufacturer's instructions. Selected cells wereplated onto poly-L-ornithine-laminin-coated 12 mm coverslips(Carolina Biological Supply, Burlington, NC) and cultured ineither a proliferation medium (DMEM/F12/B27 supplementedwith 20 ng/ml FGF2) or a differentiation medium (DMEM/F12/B27 supplemented with 10 ng/ml brain derived neurotrophicfactor-BDNF; PeproTech), as indicated. Subsequently, the cellswere immuno-labeled with cell-type specific antibodies, asdescribed above.

Pax6 loss-of-function experiments

Knockdown of Pax6 was achieved as previously describedfor fetal RG cells (Mo and Zecevic, 2008). hESC-RG cellswere electroporated with 5 μg of either interference Pax6siRNA or scrambled RNA (control) using Amaxa system(Nucleofection, Lonza, Gaithersburg, MD) according tomanufacturer's instructions.

Proliferation assay

A thymidine analog, bromodeoxyuridine (BrdU, 20 μM, Sigma,St Louis, MO) that incorporates into DNA of dividing cellswas added to the cell cultures in the proliferation medium forthe last 6 h before fixing and immunostaining as previouslydescribed (Mo et al., 2007).

Cell viability analysis

Ethidiumhomodimer-1 (EthD-1 Live/DeadViability/Cytotoxicitykit; Invitrogen) was used in co-culture experiments to quantifycell death as the ratio of EthD-1+ cells to the total cell count.

Patch clamp

Whole-cell patch recordings were performed in the secondweek of neurodifferentiation (days 7, 8, and 9) and in thefourth week (days 21, 22, and 23). Patch clamp equipment,and physiological solutions were described previously (Belinskyet al., 2011). Before patching, the GFP-positive cells wereidentified by fluorescence; standard Olympus GFP filter cube.In one set of experiments, rhodamine-dextran 3000 (50 μM)was added to the intracellular solution. In voltage-clampconfiguration, cells were given a series of voltage steps(duration, 50 ms) from −90 to +30 mV from a holding po-tential of −70 mV. In current-clamp configuration, afterdetermining the actual resting membrane potential, all cellswere first clamped at −60 mV using negative direct current(range 5–15 pA) and then a series of current steps from −20to +120 pA was applied to test action potential (AP) firing

pattern. Electrical traces were analyzed using Clampfit 9.2(Molecular Devices). Data are expressed as means ± SEMs.

Quantitative real-time PCR analysis

Total RNA was extracted from cells using TRIZOL® reagent(Invitrogen, Carlsbad, CA) according to the manufacturer'sinstructions. Approximately 1 μg of RNAwas used in the reversetranscription reaction using M-MuLV reverse transcriptase withrandom hexamers (Fermentas, Vilnus, Lithuania) according tothe manufacturer's instructions. Real-time PCR was performedin a Realplex2 Mastercycler (Eppendorf, Hamburg, Germany)using 96-well reaction plates (Eppendorf, Hamburg, Germany).The reactions were prepared according to the standardprotocol for one-step QuantiTect SYBR Green RT-PCR (AppliedBiosystems, Cheshire, UK). The sequences 5′ → 3′ of theforward (F) and reverse (R) primers were as follows:

GAPDH: (F) ACCACCATGGAGAAGGC/(R) GGCATGGACTGTGGTCATGASox1: (F) CAATGCGGGGAGGAGAAGTC/(R) CTCTGGACCAAACTGTGGCGPax6: (F) AACAGACACAGCCCTCACAAACA/(R) CGGGAACTTGAACTGGAACTGACOtx2: (F) CCACAGCAGAATGGAGGTCA/(R) CTGGGTGGAAAGAGAAGCTGPax7: (F) CCAAGATTCTTTGCCGCTAC/(R) CAGGATGCCGTCGATGCTGTHoxC8: (F) TTTATGGGGCTCAGCAAGAGG/(R) TCCACTTCATCCTTCGGTTCTGGsx2: (F) ACTTCGCACCTGCACTCCTC/(R) ACTTCGCACCTGCACTCCTCNkx2.1: (F) ATTGCTAGCGCCACCATGTCGATGAGTCCAAAG/(R) TTAGAATTCACCAGGTCCGACCATA. Olig2: (F) AGTCATCCTCGTCCAGCACC/(R) TCCATGGCGATGTTGAGGT.

The thermal cycle conditions were 95 °C for 2 minfollowed by 40 cycles of 15 s at 95 °C, 15 s at 55 °C and 20 sat 68 °C. All assays were performed in triplicates. Averagedcycle of threshold (Ct) values of GAPDH triplicates weresubtracted from Ct values of target genes to obtain ΔCt, andthen relative gene expression was determined as 2−ΔCt. Theresults were presented relative to the control value, whichwas arbitrarily set to 1.

Cell counting and statistical analysis

Cells stained with the nuclear stain bisbenzamide andvarious cellular markers were visualized with a ZeissAxiovision fluorescence microscope. Before quantification,10 predesignated, adjacent optical fields of view were se-lected in each culture and examined at magnification 40×(one field has a surface area of 0.5 mm2). The percentageof immunolabeled cells of total bisbenzamide+ (BB) or GFP+

cells was calculated. Data are presented as a mean ± SEM.Statistical differences between the groups were evaluatedwith a Student's t-test for unpaired data; level of significancewas set at p ≤ 0.05.

590 G. Reinchisi et al.

Results

Generation of hESC-radial glial cells

To generate RG cells from hESCweused a H9 cell line (passages30–45) and a protocol from Nat et al. (2007). In our H9 cellcultures, neural tube-like structures became positive forPax6 at 21 DIV (days in vitro) (Figs. 1A, B). After mechanical

isolation and enzymatic dissociation of these neural tube-likestructures, immunocytological analysis revealed the homoge-neous expression of diagnostic markers of RG cells (Campbelland Gotz, 2002; Noctor et al., 2001; Mo and Zecevic, 2008,2009), including nestin, Sox1 (Fig. 1C) and vimentin (Fig. 1D) aswell as the surface marker LeX.

Immunocytochemical analysis of LeX expression in culturescarried out at 38, 43, and 72 DIV revealed that at 43 DIV the

591Radial glia derived from human-ESC

expression of LeX plateaued (Fig. 1H). Hence all subsequentexperiments were commenced at 43 DIV (Fig. 1A). Flowcytometric analysis at 43 DIV established that 70 ± 2% ofcultured cells were immunopositive for LeX (Fig. 1I). Prolifer-ation analysis with Ki67, a nuclear protein expressed in allphases of the cell cycle, in combination with BrdU, expressedin the S phase of the cell cycle, revealed that the majorityof cells (92.5 ± 0.3%) were proliferating. Furthermore, onefourth (25 ± 0.11%) of all Ki67+ cells were in the S phase of thecell cycle as seen by co-labeling with BrdU (Figs. 1F, G).

To study whether the cells in our cultures belong to theforebrain, we labeled them with Foxg1, a forebrain transcrip-tion factor (Tao and Lai, 1992). The expression of Foxg1 wasdetected at 21 DIV, 30 DIV and is present in 90% of all cells at43 DIV, consistent with the time line of Foxg1 expressionpreviously described by Li et al. (2009).

We found that the initially observed expression of Foxg1 inradial glia at 43 DIV (Fig. 1D) was maintained after cultureswere kept in the differentiation medium for additional 7 DIV*(Fig. 1A), when cells differentiated in β-III-tubulin+ youngneurons (Fig. 1E). Moreover, 90% of these cells were positivefor dorsal telencephalic markers such as Pax6 and Tbr2, andonly about 1% expressed ventral marker Nkx2.1 (SupplementalFig. 1). The rostro-caudal identity was confirmed by quantita-tive RT-PCR analysis (qPCR). Figs. 1J, K show the expression ofneuroectodermal marker Sox1, the transcriptional activationof other forebrain markers such as Otx2, but also Pax7, a dorsalmarker of mesencephalon and spinal cord and thoracic markerHoxC8. Dorsal–ventral patterning was revealed by a strongexpression of dorsalmarker Pax6, but also two ventralmarkers,Gsx2 (lateral ganglionic eminence, LGE marker) and Olig2,whereas Nkx2.1 (marker of themedial GE) was not expressed inhESC-RG. Olig2 expression in these cells is in agreementwith itsexpression in both ventral and dorsal regions of the human fetalforebrain (Jakovcevski and Zecevic, 2005). Our results demon-strate the heterogeneity of hESC-RG cell population, with bothventral and dorsal genes being present.

Enrichment of LeX+ cells

Wehave previously reported that RG cells can be enriched fromhuman fetal brain tissue on the basis of the surface marker LeX(Mo et al., 2007). Using the same criteria and magnetic cellseparation method (MACS), we isolated and characterized RGcells produced during in vitro neural differentiation of hESC(Fig. 2A).

After MAC separation, flow cytometry analysis of the LeX+

cell fraction indicated a purity of 95.5% (Fig. 2G). The MACS

Figure 1 Radial glial cells generated from hESC (hESC-RG cellexperiments were performed; 43 DIV was a starting point for further(B) Neural tube-like structures labeled with Pax6 at 21 DIV. (C) Thewell as a forebrain marker Foxg1 in (D) vimentin+ radial glia and inBrdU and Ki67 at 72 DIV. (G) Histogram showing that the majority oBrdU+ and Ki67. (H) The percentage of LeX+ cells at three time poinLeX+ (empty); isotype control antibody was used for background detedivided by the number of cells in the bin that contains the largestanalysis showing the transcriptional profiling of neural and rostroCX) and ganglionic eminence (FH-GE) were used as a positive contcells. BB—bisbenzamide stained cell nuclei. BrdU/Ki67—cells in phKi67/BB—Ki67+ calculated as a percentage from all cells labeled with

enriched LeX+ cells were plated under adherent conditionsand 24 h later these cells had bipolar morphology of RG cells(Fig. 2A). Antigen characteristics of these cells confirmedtheir astroglia (GFAP, vimentin) and stem/progenitor fate(nestin, Pax6). The immunostaining experiments have shownthat RG-like cells co-expressed the intermediate filamentprotein nestin, reported in mitotic RG cells (Hockfield andMcKay, 1985; Noctor et al., 2001) and the astroglia markerGFAP (Figs. 2B–D). After 2 DIV* (Fig. 1A) in the proliferationmedium, the cells could be double labeled with a marker ofdividing RG cells (phosphorylated vimentin, antibody 4A4) andGFAP (Figs. 2E–F), Pax6 and GFAP (Figs. 2I–J), and vimentin(Fig. 2H). Overall these findings indicate that hESC-RG cellsexhibit the same astroglia and stem/progenitor markers as RGcells isolated from human fetal tissue (Zecevic, 2004; Howardet al., 2006; Mo et al., 2007).

Proliferation and differentiation of hESC-RG cellsin vitro

To evaluate the proliferative ability of hESC-RG cells, we addedBrdU to cultures after LeX MAC sorting isolation. Immunostain-ing after 2 DIV* in the proliferation medium demonstrated that14.7% (118/803) of the LeX+ cells incorporated BrdU (Fig. 3A).Within the BrdU+ cells, 9.3% (3/32) were co-labeled withβ-III-tubulin and 7.1% (3/42) with DCX (doublecortin),suggesting the presence of neuron-restricted-progenitors.

To assess the differentiation potential of hESC-RG cells, wecultured them in the differentiationmedium for 7 DIV* (Fig. 1A)and applied cell-type specific markers. hESC-RG cells changedtheir morphology to more mature cell types, and differentiatedpredominantly (93 ± 1.5%) into GFAP+ cells (Figs. 3B–C), far less(7 ± 0.3%) into neurons labeled by immature neuron markers,βIII-tubulin (Figs. 3C–G) or the microtubule-associated pro-teins, DCX (Fig. 3D) and MAP2 (Fig. 3E). Few cells wereimmunolabeled with PDGFRα, a marker for immature oligo-dendrocyte progenitors (Fig. 3F). These results indicated thathESC-RG cells maintained pluripotency, differentiating mainlyinto astroglia and less often into neurons or oligodendrocytes,similar to reports on human fetal RG (Mo et al., 2007; Mo andZecevic, 2008, 2009).

The role of transcription factor Pax6

Pax6 transcription factor (Pair Box 6) promotes the neurogenicfate of RG cells both in rodents (Götz et al., 1998) and inhuman fetal cortical cultures (Mo and Zecevic, 2008). Here we

s). (A) Experimental design of the time points at which theexperiments that were done at 2 DIV*, 7 DIV*, 21 DIV* after that.se cells express neural progenitor markers, Sox1 and Nestin, as(E) β-III-tubulin+ young neurons. (F) Cell proliferation seen withf cells at 72 DIV were labeled with Ki67 whereas 25% were bothts in culture. (I) Flow cytometry analysis: majority of cells werermination (solid). The % of Max is the number of cells in each binnumber of cells (FlowJo software). (J,K) Quantitative RT-PCR-caudal markers at 21 DIV. Fetal human cerebral cortex (FH-rol. Insets provide higher magnification of the double-labeledase S calculated as a percentage of BrdU+ from all Ki67+ cells.nuclear stain (BB). Scale bars: 50 μm, 10 μm (inset).

Figure 2 Characterization of hESC-RG cells isolated by magnetic activated cell separation system (MACS). (A) On adherentconditions the cells have bipolar morphology with long processes. (B–F) Cells co-labeled with nestin (B), GFAP (C), merged image (D)phosphorylated vimentin (4A4 antibody) (E) and GFAP (F). (G)The purity of LeX+ cells after MACS isolation in the stained sample (solid)vs the unstained sample (empty) demonstrates that LeX+ cells represent the majority of purified cells. (H–J) Bipolar cells expressradial glial markers: vimentin (H), and co-labeled with GFAP (I) and Pax6 (J) (arrows indicate double-labeled cells). Nuclei werestained with bisbenzamide (blue). Scale bars: 50 μm, 10 μm.

592 G. Reinchisi et al.

study the role of Pax6 in the proliferation and differentiationof hESC-RG by knocking down Pax6 expression.

Progeny of hESC-RG transfected with either interferencesiRNA Pax6 or control, scrambled RNA (cRNA) was compared.Three days after transfection with siRNA, Pax6 protein was notdetected in hESC-RG cells (Supplemental Fig. 2), whereasvimentin expression was unaffected (data not shown). Controltransfected cells kept their Pax6 expression (SupplementalFig. 2). These results indicate successful knock-down of Pax6gene in siRNA Pax6 transfected cells that retained their RGidentity. Next, we studied the effect of Pax6 on proliferationof hESC-RG as demonstrated with Ki67 labeling. The prolifer-ation rate of cells transfected with siRNA Pax6 was reduced bya factor of 3 (25 ± 10%) compared to control transfected cells(75 ± 13%). This indicates that knocking down Pax6 reducesthe proliferation capacity of hESC-RG cells.

We further investigated the role of Pax6 in hESC-RG cell fatedetermination after culturing transfected cells for 7 DIV* in thedifferentiation medium. The number of Pax6 knock-down cells(15.5%; 11/71) that differentiated into neurons co-labeledwithβ-III-tubulin was half of that in control transfected cells (34.4%;21/16). In contrast, the number of GFAP co-labeled cells was81.4% (22/27) in Pax-6 knockdown cells versus 53.5% (15/28) in

control transfected cells. Since transfection efficiency isaround 10%, these numbers are not absolute values butrather estimates which illustrate the ratio between neuronsand astroglia generated from transfected cells. Overall, theseresults are similar to the ones reported for human fetal RG (Moand Zecevic, 2008) and support the idea that Pax6 regulatesthe proliferation and neurogenic fate of hESC-RG cells in asimilar manner.

The effect of the microenvironment on hESC-RG fate

The effect of the microenvironment on the neurogenicproperties of hESC-RG was examined by co-culturing LeX+

hESC-RG on fetal human brain cells. Fetal brain cultures weremade from two different forebrains at mid-gestation (17 and22 gw) obtained from the Brain Bank repositories. Similar humanfetal cultures at mid-gestation were described in more detail inour previous reports (Howard et al., 2006; Zecevic et al., 2005;Mo et al., 2007). After 7 DIV two cell types, neurons andastroglia, can be recognized based on immunomarkers in thesecultures. GFAP+ cells accounted for 45 ± 4.4% and β-III-tubulin+

neurons for 52 ± 3% of total cells (Supplemental Fig. 3).

Figure 3 Sorted hESC-RG cells are multipotent in vitro. (A) BrdU incorporation after 2 DIV* in the proliferation medium. (B–F) Inthe differentiation medium hESC-RG cells generate mainly mature-looking GFAP+ astrocytes (B), neurons labeled with β-III-tubulin(C), DCX+ (D) or MAP2 antibody (E), and rarely PDGFR-α+ oligodendrocyte progenitors (F). (G) Quantification of hESC-RG progeny after7 DIV* in the differentiation medium. Data represent three independent experiments. ⁎⁎⁎p b 0.0001. Nuclei were stained withbisbenzamide (blue). Scale bars: 50 μm, 10 μm.

593Radial glia derived from human-ESC

In co-culture system we used stably transfected hESC withrobust levels of EGFP (enhanced green fluorescent protein),which permitted their identification after plating on humanfetal cells. Similar to previous experiments, MACS was usedto enrich green GFP+ hESC-RG before plating them over eitherhuman fetal brain cultures or on poly-L-ornithine-laminin(control cultures).

First, we measured the proliferation rate of GFP+ hESC-RGcells co-cultured with human fetal cells in the proliferationmedium. After 2 DIV*, the proliferative marker Ki67 was de-tected in 24% of all GFP+ cells (64 out of 271). To assessdifferentiation of GFP+ hESC-RG, both control cultures (GFP+

hESC-RG cultured on poly-L-ornithine-laminin) and co-cultureswere kept in the differentiation medium for 7 DIV*, fixed,and double-labeled with cell-type specific markers, GFAP,β-III-tubulin or MAP2 (Fig. 4). In the co-cultures, themajority ofcells differentiated into β-III-tubulin+ (79 ± 2.5%) and MAP2+

(80 ± 3.1%) neurons (Fig. 4). Only 14 ± 2.2% of GFP+ hESC-RGcells differentiated into GFAP+ cells (Figs. 4B, F, I). In contrastto this, in control cultures the number of β-III-tubulin+ neuronswas 9.0 ± 1% and GFAP+ cells 87.0 ± 2.2% (Fig. 4I) similar toresults obtained earlier.

Hence, in the presence of the same differentiationmedium,the number of neurons derived from GFP+ hESC-RG had in-creased by a factor of 9 in co-cultures with human fetalforebrain cells, whereas the number of GFAP+ astroglia de-creased by a factor of more than 6 in comparison to controlcultures kept on poly-L-ornithine-laminin.

The obvious question is whether the above mentionedneurogenic effect is due to cell–cell interaction, agentssecreted in the cultures, or both. We thus investigated the

differentiation fate of GFP+ hESC-RG cells in conditionedmedium (CM) from human fetal cells. After 7 DIV* in CM, GFP+

hESC-RG cells generated significantly more β-III-tubulin+ cells(52 ± 2.5% vs. 9 ± 1%) and fewer GFAP+ cells (28 ± 2.7% vs.87 ± 2.2%) than those treated with the standard differentia-tion medium (control) (Fig. 4J). Thus, soluble factors fromhuman fetal brain cell cultures are capable of promotingneuronal cell fate of GFP+ hESC-RG cells. However, theneuron/glia ratio in CM alone was 1.67 compared to 5.33 inco-culture conditions (Fig. 4K). Hence, although CM pro-motes neurogenesis compared to the control medium, thecombined effect of cell–cell interaction and soluble factors,was significantly more powerful than the effect of solublefactors alone (Fig. 4K).

Next, we tested whether specific neuronal sub-types canbe generated from green GFP+ hESC-RG in co-cultures. Thepredominant neuronal cell type generated fromGFP+ hESC-RGwas pyramidal glutaminergic neurons labeled with SMI-32 (55 ±7.2%) and Tbr1 (40 ± 4.4%), and fewer cells were positive forinterneuron markers GABA (17 ± 4%), calretinin (3.5 ± 1.5%),and TH+ (tyrosine hydroxylase) dopaminergic neurons (15.4 ±2.3%) (Fig. 5). By 21 DIV* (Fig. 1A), the beginning of syn-aptogenesis was indicated by the expression of the synapticvesicle protein 2 (SV2) in some presynaptic terminals (Fig. 5F).

Cell culture viability was validated with the EthD-1kit(Invitrogen). After 7 DIV*, a relatively low cell death rate of7.5 ± 0.84% was observed (Supplemental Fig. 4). Moreover,5.5% (21 out of 380 GFP+ cells) were still proliferating (Ki67+).The remaining cells had exited the cell cycle and differenti-ated as confirmedby a lack of nestin (immature neural protein)labeling.

Figure 4 Co-culture experiments with GFP+ hESC-RG and human fetal brain cells. GFP+ hESC-RG cells differentiated into neuronsco-labeled with β-III-tubulin (A) and astroglia cells co-labeled with GFAP (arrows) (B). Higher magnification of GFP+ hESC-RG cellsco-labeled with neuronal marker MAP2 (C–E, arrows) or GFAP (F–H, arrows). (I) Quantification shows that more neurons thanastroglia are produced from GFP+ hESC-RG cells in the co-culture and treated with conditioned medium (CM). In co-culture, thenumber of immune-labeled cells is calculated as a percentage of GFP+ cells, whereas in CM and control as a percentage from all cellsin the culture. Data represent three independent experiments. ⁎⁎⁎p b 0.0001. Scale bars: 50 μm, 10 μm.

594 G. Reinchisi et al.

Physiological characterizations

Neuronal fate of GFP-hESC-RG was not based only onimmunocytochemistry with class specific markers, but alsoon their physiological properties. Individual neurons were

selected for patching by alternating between fluorescence(Fig. 6A1) and infrared (Fig. 6A2) video microscopy. The cellbodies of GFP+ cells were bright, but their thin neuronalprocesses were not satisfactorily resolved (Fig. 6A1). Tenneurons were injectedwith rhodamine via the recording patch

Figure 5 Differentiation of various neuronal cell types from GFP+ hESC-RG in co-cultures after 7 DIV*. Co-expression of GFP and theinterneuronal markers, GABA (A), calretinin-CalR (B), dopaminergic marker tyrosine hydroxylase (TH) (C), pyramidal cell markersSMI-32 (D) and Tbr1 (E). Arrows in A–E point to co-labeled cells. (F) Synaptic vesicle labeled with SV2 antibody at 21 DIV (arrows).(G) Percentages of cell-type specific cells. Scale bar: 10 μm.

595Radial glia derived from human-ESC

pipette revealing elaborate axo-dendritic trees consisting ofprimary, secondary, and tertiary branches (Fig. 6A3). In somecases, thin axon collaterals were documented branchingat 90° (Fig. 6A3, arrows). Patch electrode recordings weremade on days 7, 8, and 9 (Week-2) and days 21, 22, and 23(Week-4) after the initial seeding on human fetal mix cellculture of GFP-hESC-RG cells isolated at 43 DIV. The averageresting membrane potential from days 7/8/9 to 21/22/23 were

−21.9, −29.0, −20.0 mV and −25.0 mV, −26.8, −34.9 mV,respectively. The sodium current amplitude almost doubled asGFP+ neurons transitioned from the 2nd to the 4th differenti-ation week (Fig. 6B1). In response to a depolarizing current, theGFP+ neurons generated 5 types of voltagewaveforms (Fig. 6C2,AP firing pattern). Cells with a passive electrical response(unable to generate AP) were only found in the 2nd week ofneuro-differentiation (Fig. 6C1, Week-2, white bars). Voltage

Figure 6 Physiological properties of cells derived from hESC-RG. A1) GFP+ hESC-RG viewed on the electrophysiology station using

green fluorescence channel. Scale, 20 μm. A2) Same cells as in A1 viewed using infrared DIC video microscopy. “Patch” marks thecontours of a patch electrode used for recordings and injection of red fluorescent dye rhodamine. A3) Only the injected cell is visiblein red channel. Arrows indicate axon collateral branch points. B1) Average peak sodium current on six recording days. B2)Representative membrane currents in response to voltage steps from −90 to +30 mV, obtained in the second (Week-2) and fourthweeks (Week-4) of neurodifferentiation. C1) All cells in the present study (n = 38) aligned according to the order of patching, fromleft to right. Each bar corresponds to one cell. The height of the bar indicates the category of AP firing pattern. C2) Representativevoltage waveforms in response to a 1 s-long depolarizing current pulse.

596 G. Reinchisi et al.

597Radial glia derived from human-ESC

waveforms representative of mature neurons (Repetitive-2)were only encountered in the 4th week of neuro-differentiation(Week-4). Neurons are the only cell type in the brain endowedwith a fast sodium current and ability to generate regenerativespikes. Human postmitotic neurons begin to generate nonlinearvoltage waveforms (abortive spikes, Fig. 6C2) when their peaksodium current exceeds 200 pA (Moore et al., 2009). Sodiumcurrent greater than 200 pA was found in 8 out of 19 neuronstested in Week-2; and in 18 out of 19 neurons tested inWeek-4. The electrophysiological recordings of transmem-brane currents (Fig. 6B2) and depolarization-induced voltagewaveforms (Fig. 6C2), together with elaborate axo-dendritictrees (Fig. 6A3), clearly indicate that hESC-RG gave rise to aneuronal lineage.

Combined results from molecular and physiological mea-surements (Figs. 1–6) demonstrate that the human fetal brainmicroenvironment was efficient in promoting neurogenic fateover gliogenic fate of the hESC-RG cells.

Discussion

The main findings of this study are that hESC-derived RGcells share numerous properties with human fetal RG cells.Neurogenic fate of these cells is promoted by transcriptionfactor Pax6 as well as by the microenvironment of humanfetal brain.

This is important since unlike human fetal brain tissue,the hESC-RG cells are easily accessible, can be standardizedand applied in research related to human brain developmentand neural tissue repair.

RG cells can be isolated and expanded from mouse andhuman-derived ES cells or fetal brain and adult subventricularzone (SVZ) (Gregg and Weiss, 2003; Conti et al., 2005; Glaserand Brustle, 2005; Pollard et al., 2006; Pollard and Conti,2007). However, RG cells from different species can displaydifferent properties (Conti et al., 2005; Hansen et al., 2010).For example, whereas, GFAP is expressed early in the humanRG-like cells, it is undetectable in mouse-derived RG-like cellsin vitro. Thus, it is necessary to characterize RG cells derivedfrom hESC.

In our earlier work (Mo et al., 2007) the surface markerLeX has been used to enrich human fetal RG cells in vitro. Inthe present study, we found that the same marker can besuccessfully used to isolate hESC-RG cells. Moreover, thesecells are similar to the fetal cortical RG cells in their antigencharacteristics, as well as their proliferation and differen-tiation potentials. Although not all hESC-RG express the LeXantigen, all LeX+ cells were found to express the RG markers(Fig. 1). This is consistent with the heterogeneity of theantigenic characteristics of RG in rodents (Hartfuss et al.,2001; Malatesta et al., 2003) and human fetal brain (Howardet al., 2006). Their differentiation into Foxg1+ forebraincells was similar to previous reports that in the absence ofknown morphogens, hESC differentiate into cells with dorsaltelencephalic characteristics (Li et al., 2009).

LeX+-RG cells generated from hESC are mitotically activeprogenitors, with astroglial and stem cell/progenitor charac-teristics. They are also multipotent cells that can differentiateinto all three neural lineages: astrocytes, neurons and oligo-dendrocytes. In these aspects, hESC-RG cells are similar to whathas been reported for RG cells in the mouse (Abramova et al.,

2005; Capela and Temple, 2006; Liour et al., 2006) and in thehuman fetal brain (Mo et al., 2007; Mo and Zecevic, 2008,2009).

Several lines of evidence suggest that Pax6 transcriptionfactor promotes the neurogenic fate of RG cells in rodents(Götz et al., 1998). Most of the pyramidal neurons in thedeveloping telencephalon are derived from Pax6 positive RGcells (Malatesta et al., 2003). Forced expression of Pax6 inrodent astrocytes is sufficient to drive neurogenesis in thesecells (Heins et al., 2002). Moreover, Pax6 is necessary andsufficient for neuroepithelial differentiation from hESC (Zhanget al., 2010). We now demonstrate that transcription factorPax6 influences proliferation and the number of neurons gen-erated from hESC-RG cells.

This finding is consistent with our observations in humanfetal RG cells (Mo and Zecevic, 2008), indicating that in bothcell populations Pax6 affects proliferation as well as neuronalfate.

Numerous studies have reported the successful trans-plantation of hESC into rodent brains (Kelly et al., 2004; Royet al., 2006; Yang et al., 2008). However, far less is knownabout how hESC behave when transplanted into the humanbrain (Lindvall and Kokaia, 2006). This knowledge, however,is very important for the development of future therapies.

In the present study, we created a co-culture system in anattempt tomimic the cellular interactions thatmay occur upontransplantation of hESC-RG cells in the human fetal forebrain.Our experiments demonstrated that the microenvironment ofthe human fetal forebrain (17–22 gw) promotes neurogenesisin hESC-RG cells when compared to the commonly-usedsubstrate, poly-L-ornithine-laminin (control). In the presenceof the same differentiation medium, the number of neuronsderived from hESC-RG cells was nine fold higher in co-culturescompared to the control cultures. At the same time thenumber of derived astroglia decreased more than six foldcompared to control cultures. This is in line with our previousreport that RG isolated from mid-gestational human fetalforebrain generate more neurons than glia (Mo et al., 2007).

Neuronal fate of co-cultured hESC-RG was determined bygeneral neuronal markers, such as βIII-tubulin and MAP2.Notably, these cells were functionally evaluated by patch-clamp recordings. Three lines of evidence strongly indicatethat cells derived from hESC-RG are committed to theneuronal fate. First, these cells exhibited typical neuronalmorphologies (Fig. 6A3). Second, the peak sodium currentexceeded 200 pA (Fig. 6B2) (Moore et al., 2009). Third, upondepolarization, the GFP+ cells produced regenerative spikes(abortive AP, full-size AP, and repetitive APs, Fig. 6C2). Witheach day of in vitro cultivation, the two parameters (sodiumcurrent and AP firing pattern) clearly shifted towards valuescharacteristic of more mature neurons (Figs. 6B1C1).

Mature forebrain neurons can be separated between GABA-ergic inhibitory and non-GABA-ergic neuron types solely basedon their characteristic action potential firing pattern (Connorsand Gutnick, 1990). In immature human neurons (4 weeks invitro), such separation is considerably less reliable because thesodium and potassium channels are not fully expressed in theplasma membrane (Moore et al., 2009; Belinsky et al., 2011).As a consequence of low channel density the AP amplitudesdo not overshoot in repetitive firing (Fig. 6C2, Repetitive-1and Repetitive-2). We think that voltage waveforms termed“Single AP” and “Repetitive-2” (Fig. 6C2) pertain to young

598 G. Reinchisi et al.

glutamatergic neurons, while a delayed-onset high-frequencyAP-firing pattern (Repetitive-1) is more indicative of immaturefast-spiking GABA-ergic interneurons (Gupta et al., 2000).

Significantly, various neuronal subtypes were generatedfrom hESC-RG in our co-culture system. More than half ofthe generated neurons by their molecular markers wereprojection, pyramidal neurons (SMI-32+ and Tbr1+),but other subtypes, such as interneurons (GABA+ andcalretinin+) and dopaminergic neurons (TH+) were alsoderived from hESC-RG under these conditions. Based on theexpression of various patterning markers, such as rostraland dorsal forebrain markers (Foxg1, Otx2, Pax6 and Tbr2),but also caudal and ventral markers (Pax7 and HoxC8)(Figs. 1J, K), the hESC-RG cell population is likely a mixedpopulation of both dorsal and ventral progenitors. This isfurther confirmed by their differentiation into variousneuronal cell types of either dorsal (SMI-32, Tbr1) orventral (TH, GABA, calretinin) origin (Fig. 5).

In our hESC-RG cultures, the observed increase in neuro-genesis was, at least partially, due to secreted factors,because the neurogenic effect was produced with themedium conditioned with the human fetal forebrain alone.The major difference between media collected from controlcultures (grown on poly-L-ornithine-laminin) and CM fromco-cultures, is the presence of astrocytes and neurons inco-cultures; both cell types can release factors, includinggrowth factors and cytokines, that may have a role in theobserved increase in the neurogenic fate of GFP hESC-RG.

This is in accord with previous reports, that astrocytesinfluence both proliferation and differentiation of embryonicand adult neural stem cells, and specifically promote neuro-genic fate of neural stem cells (Roy et al., 2006; Nakayama etal., 2003; Song et al., 2002). Factors that affect neural stemcells range from bone morphogenetic protein (BMPs) (Li et al.,1998), Wnt signaling (Muroyama et al., 2004; Li et al., 2009), toSonic Hedgehog (Shh) and ciliary neurotrophic factor (CNTF)(Zhu et al., 1999). Not only astrocytes, but also neurons releasefactors, such as BMPs, that promote neurogenesis from stemcells (Chang et al., 2003). In addition, inhibition of Notchsignaling by the γ-secretase inhibitor increases neurogenesis ofcultured hESC (Borghese et al., 2010). One cannot, however,exclude the contribution of the regulatory signals provided bycell extracellular matrix (ECM) interaction during this process.Poly-L-ornithine is a non-ECM positively charged polymer,whereas laminin is a component of the ECM which is expressedin the human cortex during developmental stages (Anlar et al.,2002; Flanagan et al., 2006). Laminin/integrin signaling is veryimportant for ECM–cell interactions regulating the fate ofneural progenitors (Flanagan et al., 2006; Tate et al., 2004;Ma et al., 2008). Thus, the effect of the entire ECM on theprogenitors needs to be taken into account, since they caninfluence each other and consequently change the finaloutcome.

The finding that co-culturing hESC-RG with the human fetalbrain tissue or with conditioned media can accelerate produc-tion of specific neuronal subtypes, might have relevance fordevelopment of cell-replacement therapies for various neuro-logical disorders from Parkinson's, Huntington's to Alzheimer'sdisease (Lindvall and Kokaia, 2006, 2009).

In Parkinson's disease, a progressive loss of dopaminergic(DA) neurons occurs and transplantation of fetal derived DAneurons has shown some promise, but the use of human stem

cells has yet to be accomplished (Lindvall and Kokaia, 2006,2009; Politis and Lindvall, 2012). Particularly, a recent studyshowed that radial glial cells are the neural progenitors ofDA neurons in the human ventral midbrain (Hebsgaard et al.,2009).

In summary, we compared fetal human RG cells andradial glial cells generated by hESC and concluded thatthese two cell populations share numerous antigen charac-teristics as well as proliferative capacity and differentia-tion pattern.

Transcription factor Pax6 influences their neurogeniccapability, whereas, the environment of the human fetalforebrain significantly increases the genesis of several neuronalsub-types fromhESC-RG cells. These findingsmay have practicalimplications in research related to human brain developmentand to cell replacement therapies for neurological disorders,where it is necessary to generate a sufficient number ofneurons.

Supplementary data to this article can be found online athttp://dx.doi.org/10.1016/j.scr.2013.03.004.

Acknowledgments

This study was supported by NIH grant NS041489-10A and ConnecticutStem Cell grants 2008-013 to NZ and 09-SCA-UCHC-13 to SDA. Humanfetal tissue was obtained from StemExpress, CA. Patch clamp re-cordings were performed in the Stem Cell Physiology and ChemistryCore at UConn Health Center, supported by the Connecticut Stem CellInitiative/Connecticut Innovations grant No. 10-SCD-01. We thankUCHC Stem Cell Core and UCHC FACS facility, Drs J-A Ortega and NRadonjic for help with qPCR, Dr Xiu-Jun Li for valuable suggestions onthe manuscript, Nicole Glidden and Greg Wark for technical supportand editing.

References

Abramova, N., Charniga, C., Goderie, S.K., Temple, S., 2005. Stage-specific changes in gene expression in acutely isolated mouseCNS progenitor cells. Dev. Biol. 283 (2), 269–281.

Anlar, B., Atilla, P., Cakar, A.N., Kose, M.F., Beksaç, M.S., Dagdeviren,A., Akçören, Z., 2002. Expression of adhesion and extracellularmatrix molecules in the developing human brain. J. Child Neurol.17 (9), 707–713.

Belinsky, G.S., Moore, A.R., Short, S.M., Rich, M.T., Antic, S.D., 2011.Physiological properties of neurons derived from human embry-onic stem cells using a dibutyryl cyclic AMP-based protocol. StemCells Dev. 20 (10), 1733–1746.

Bentivoglio, M., Mazzarello, P., 1999. The history of radial glia.Brain Res. Bull. 49 (5), 305–315.

Bibel, M., Richter, J., Schrenk, K., Tucker, K.L., Staiger, V., Korte,M., Goetz, M., Barde, Y.A., 2004. Differentiation of mouseembryonic stem cells into a defined neuronal lineage. Nat.Neurosci. 7 (9), 1003–1009.

Borghese, L., Dolezalova, D., Opitz, T., Haupt, S., Leinhaas, A.,Steinfarz, B., Koch, P., Edenhofer, F., Hampl, A., Brüstle, O.,2010. Inhibition of notch signaling in human embryonic stem cell-derived neural stem cells delays G1/S phase transition andaccelerates neuronal differentiation in vitro and in vivo. StemCells 28 (5), 955–964.

Brustle, O., Jones, K.N., Learish, R.D., Karram, K., Choudhary, K.,Wiestler, O.D., Duncan, I.D., McKay, R.D., 1999. Embryonic stemcell-derived glial precursors: a source of myelinating trans-plants. Science 285 (5428), 754–756.

599Radial glia derived from human-ESC

Campbell, K., Gotz, M., 2002. Radial glia: multi-purpose cellsfor vertebrate brain development. Trends Neurosci. 25 (5), 235–238.

Capela, A., Temple, S., 2006. LeX is expressed by principle progenitorcells in the embryonic nervous system, is secreted into theirenvironment and binds Wnt-1. Dev. Biol. 291 (2), 300–313.

Chang, M.Y., Son, H., Lee, Y.S., Lee, S.H., 2003. Neurons andastrocytes secret factors that cause stem cells to differentiateinto neurons and astrocytes respectively. Mol. Cell. Neurosci. 23(3), 414–426.

Connors, B.W., Gutnick, M.J., 1990. Intrinsic firing patterns ofdiverse neocortical neurons. Trends Neurosci. 13 (3), 99–104.

Conti, L., Pollard, S.M., Gorba, T., Reitano, E., Toselli, M., Biella,G., Sun, Y., Sanzone, S., Ying, Q.L., Cattaneo, E., Smith, A.,2005. Niche-independent symmetrical self-renewal of a mam-malian tissue stem cell. PLoS Biol. 3, e283.

Flanagan, L.A., Rebaza, L.M., Derzic, S., Schwartz, P.H., Monuki,E.S., 2006. Regulation of human neural precursor cells by lamininand integrins. J. Neurosci. Res. 83 (5), 845–856.

Glaser, T., Brustle, O., 2005. Retinoic acid induction of ES-cell-derived neurons: the radial glia connection. Trends Neurosci. 28(8), 397–400.

Götz, M., Huttner, W.B., 2005. The cell biology of neurogenesis.Nat. Rev. Mol. Cell Biol. 6 (10), 777–788.

Götz, M., Stoykova, A., Gruss, P., 1998. Pax6 controls radial gliadifferentiation in the cerebral cortex. Neuron 21 (5), 1031–1044.

Gregg, C., Weiss, S., 2003. Generation of functional radial glial cellsby embryonic and adult forebrain neural stem cells. J. Neurosci.23 (37), 11587–11601.

Gupta, A., Wang, Y., Markram, H., 2000. Organizing principles for adiversity of GABAergic interneurons and synapses in the neocor-tex. Science 287 (5451), 273–278.

Hansen, D.V., Lui, J.H., Parker, P.R., Kriegstein, A.R., 2010.Neurogenic radial glia in the outer subventricular zone of humanneocortex. Nature 464 (7288), 554–561.

Hartfuss, E., Galli, R., Heins, N., Götz, M., 2001. Characterizationof CNS precursor subtypes and radial glia. Dev. Biol. 229 (1),15–30.

Hebsgaard, J.B., Nelander, J., Sabelström, H., Jönsson, M.E., Stott,S., Parmar, M., 2009. Dopamine neuron precursors within thedeveloping human mesencephalon show radial glial characteris-tics. Glia 57 (15), 1648–1658.

Heins, N., Malatesta, P., Cecconi, F., Nakafuku, M., Tucker, K.L.,Hack, M.A., Chapouton, P., Barde, Y.A., Götz, M., 2002. Glialcells generate neurons: the role of the transcription factor Pax6.Nat. Neurosci. 5 (4), 308–315.

Hockfield, S., McKay, R.D., 1985. Identification of major cell classesin the developing mammalian nervous system. J. Neurosci. 5(12), 3310–3328.

Howard, B., Chen, Y., Zecevic, N., 2006. Cortical progenitor cells inthe developing human telencephalon. Glia 53 (1), 57–66.

Jakovcevski, I., Zecevic, N., 2005. Olig transcription factors areexpressed in oligodendrocyte and neuronal cells in human fetalCNS. J. Neurosci. 25 (44), 10064–10073.

Kelly, S., Bliss, T.M., Shah, A.K., Sun, G.H., Ma, M., Foo, W.C.,Masel, J., Yenari, M.A., Weissman, I.L., Uchida, N., Palmer, T.,Steinberg, G.K., 2004. Transplanted human fetal neural stemcells survive, migrate, and differentiate in ischemic rat cerebralcortex. Proc. Natl. Acad. Sci. 101 (32), 11839–11844.

Kim, M., Morshead, C.M., 2003. Distinct populations of forebrainneural stem and progenitor cells can be isolated using side-population analysis. J. Neurosci. 23 (33), 10703–10709.

Li, W., Cogswell, C.A., LoTurco, J.J., 1998. Neuronal differentiationof precursors in the neocortical ventricular zone is triggeredby BMP. J. Neurosci. 18 (21), 8853–8862.

Li, X.J., Du, Z.W., Zarnowska, E.D., Pankratz, M., Hansen, L.O.,Pearce, R.A., Zhang, S.C., 2005. Specification of motoneuronsfrom human embryonic stem cells. Nat. Biotechnol. 23 (2),215–221.

Li, X.J., Zhang, X., Johnson, M.A., Wang, Z.B., Lavaute, T., Zhang,S.C., 2009. Coordination of sonic hedgehog and Wnt signalingdetermines ventral and dorsal telencephalic neuron typesfrom human embryonic stem cells. Development 136 (23),4055–4063.

Lindvall, O., Kokaia, Z., 2006. Stem cell for treatment of neurologicaldisorders. Nature 441 (7097), 1094–1096.

Liour, S.S., Yu, R.K., 2003. Differentiation of radial glia-like cellsfrom embryonic stem cells. Glia 42 (2), 109–117.

Liour, S.S., Kraemer, S.A., Dinkins, M.B., Su, C.Y., Yanagisawa, M.,Yu, R.K., 2006. Further characterization of embryonic stem cell-derived radial glial cells. Glia 53 (1), 43–56.

Ma, W., Tavakoli, T., Derby, E., Serebryakova, Y., Rao, M.S.,Mattson, M.P., 2008. Cell–extracellular matrix interactionsregulate neural differentiation of human embryonic stem cells.BMC Dev. Biol. 8, 90.

Malatesta, P., Hartfuss, E., Götz, M., 2000. Isolation of radial glialcells by fluorescent-activated cell sorting reveals a neuronallineage. Development 127 (24), 5253–5263.

Malatesta, P., Hack, M.A., Hartfuss, E., Kettenmann, H.,Klinkert, W., Kirchhoff, F., Götz, M., 2003. Neuronal or glialprogeny: regional differences in radial glia fate. Neuron 37(5), 751–764.

Miyata, T., Kawaguchi, A., Okano, H., Ogawa, M., 2001. Asymmetricinheritance of radial glial fibers by cortical neurons. Neuron 31(5), 727–774.

Mizuseki, K., Sakamoto, T., Watanabe, K., Muguruma, K., Ikeya, M.,Nishiyama, A., Arakawa, A., Suemori, H., Nakatsuji, N., Kawasaki,H., Murakami, F., Sasai, Y., 2003. Generation of neural crest-derived peripheral neurons and floor plate cells from mouse andprimate embryonic stem cells. Proc. Natl. Acad. Sci. 100 (10),5828–5833.

Mo, Z., Zecevic, N., 2008. Is Pax6 critical for neurogenesis in thehuman fetal brain? Cereb. Cortex 18 (6), 1455–1465.

Mo, Z., Zecevic, N., 2009. Human fetal radial glia cells generateoligodendrocytes in vitro. Glia 57 (5), 490–498.

Mo, Z., Moore, A.R., Filipovic, R., Ogawa, Y., Kazuhiro, I., Antic,S.D., Zecevic, N., 2007. Human cortical neurons originate fromradial glia and neuron-restricted progenitors. J. Neurosci. 27(15), 4132–4145.

Moore, A.R., Filipovic, R., Mo, Z., Rasband, M.N., Zecevic, N., Antic,S.D., 2009. Electrical excitability of early neurons in the humancerebral cortex during the second trimester of gestation. Cereb.Cortex 19 (8), 1795–1805.

Muroyama, Y., Kondoh, H., Takada, S., 2004. Wnt proteins promoteneuronal differentiation in neural stem cell culture. Biochem.Biophys. Res. Commun. 313 (4), 915–921.

Nakayama, T., Momoki-Soga, T., Inoue, N., 2003. Astrocyte-derivedfactors instruct differentiation of embryonic stem cells intoneurons. Neurosci. Res. 46 (2), 241–249.

Nat, R., Nilbratt, M., Narkilahti, S., Winblad, B., Hovatta, O.,Nordberg, A., 2007. Neurogenic neuroepithelial and radial glialcells generated from six human embryonic stem cell lines in serum-free suspension and adherent cultures. Glia 55 (4), 385–399.

Noctor, S.C., Flint, A.C., Weissman, T.A., Dammmerman, R.S.,Kriegstein, A.R., 2001. Neurons derived from radial glia cellsestablish radial units in neocortex. Nature 409 (6821), 714–720.

Politis, M., Lindvall, O., 2012. Clinical application of stem celltherapy in Parkinson's disease. BMC Med. 10, 1.

Pollard, S.M., Conti, L., 2007. Investigating radial glia in vitro. Prog.Neurobiol. 83 (1), 53–67.

Pollard, S.M., Conti, L., Sun, Y., Goffredo, D., Smith, A., 2006.Adherent neural stem (NS) cells from fetal and adult forebrain.Cereb. Cortex 16 (Suppl. 1), i112–i120.

Rakic, P., 2003. Developmental and evolutionary adaptations ofcortical radial glia. Cereb. Cortex 13 (6), 541–549.

Roy, N.S., Cleren, C., Singh, S.K., Yang, L., Beal, M.F., Goldman,S.A., 2006. Functional engraftment of human ES cell-derived

600 G. Reinchisi et al.

dopaminergic neurons enriched by coculture with telomerase-immortalized midbrain astrocytes. Nat. Med. 12 (11), 1259–1268.

Song, H., Stevens, C.F., Gage, F.H., 2002. Astroglia induceneurogenesis from adult neural stem cells. Nature 417 (6884),39–44.

Suh, H., Consiglio, A., Ray, J., Sawai, T., D'Amour, K.A., Gage, F.H.,2007. In vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2+ neural stem cells in the adulthippocampus. Cell Stem Cell 1 (5), 515–528.

Tao, W., Lai, E., 1992. Telencephalon-restricted expression of BF-1,a new member of the HNF-3/fork head gene family, in thedeveloping rat brain. Neuron 8 (5), 957–966.

Tate, M.C., García, A.J., Keselowsky, B.G., Schumm, M.A., Archer,D.R., LaPlaca, M.C., 2004. Specific beta1 integrins mediateadhesion, migration, and differentiation of neural progenitorsderived from embryonic striatum. Mol. Cell. Neurosci. 27 (1),22–31.

Yan, Y., Yang, D., Zarnowska, E.D., Du, Z., Werbel, B., Valliere, C.,Pearce, R.A., Thomson, J.A., Zhang, S.C., 2005. Directed differ-entiation of dopaminergic neuronal subtypes from human embry-onic stem cells. Stem Cells 23 (6), 781–790.

Yang, D., Zhang, Z.J., Oldenburg, M., Ayala, M., Zhang, S.C., 2008.Human embryonic stem cell-derived dopaminergic neuronsreverse functional deficit in parkinsonian rats. Stem Cells 26(1), 55–63.

Zecevic, N., 2004. Specific characteristic of radial glia in the humanfetal telencephalon. Glia 48 (1), 27–35.

Zecevic, N., Chen, Y., Filipovic, R., 2005. Contributions of corticalsubventricular zone to the development of the human cerebralcortex. J. Comp. Neurol. 491 (1), 109–122.

Zhang, S.C., Wernig, M., Duncan, I.D., Brustle, O., Thompson, J.A.,2001. In vitro differentiation of transplantable neural precursorsfrom human embryonic stem cells. Nat. Biotechnol. 19 (12),1129–1133.

Zhang, X., Huang, C.T., Chen, J., Pankratz, M.T., Xi, J., Li, J., Yang, Y.,Lavaute, T.M., Li, X.J., Ayala, M., Bondarenko, G.I., Du, Z.W., Jin,Y., Golos, T.G., Zhang, S.C., 2010. Pax6 is a human neuroectodermcell fate determinant. Cell Stem Cell 7 (1), 90–100.

Zhu, G., Mehler, M.F., Zhao, J., Yu Yung, S., Kessler, J.A., 1999.Sonic hedgehog and BMP2 exert opposing actions on proliferationand differentiation of embryonic neural progenitor cells. Dev.Biol. 215 (1), 118–129.