new class of cargo protein in tetrahymena thermophila ... · to detect new granule proteins, we...

EUKARYOTIC CELL, Aug. 2002, p. 583–593 Vol. 1, No. 41535-9778/02/$04.00�0 DOI: 10.1128/EC.1.4.583–593.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved.

New Class of Cargo Protein in Tetrahymena thermophilaDense Core Secretory Granules

Alex Haddad,† Grant R. Bowman, and Aaron P. Turkewitz*Department of Molecular Genetics and Cell Biology, The University of Chicago, Chicago, Illinois 60637

Received 10 January 2002/Accepted 2 May 2002

Regulated exocytosis of dense core secretory granules releases biologically active proteins in a stimulus-dependent fashion. The packaging of the cargo within newly forming granules involves a transition: solublepolypeptides condense to form water-insoluble aggregates that constitute the granule cores. Following exocy-tosis, the cores generally disassemble to diffuse in the cell environment. The ciliates Tetrahymena thermophilaand Paramecium tetraurelia have been advanced as genetically manipulatable systems for studying exocytosisvia dense core granules. However, all of the known granule proteins in these organisms condense to form thearchitectural units of lattices that are insoluble both before and after exocytosis. Using an approach designedto detect new granule proteins, we have now identified Igr1p (induced during granule regeneration). Bystructural criteria, it is unrelated to the previously characterized lattice-forming proteins. It is distinct in thatit is capable of dissociating from the insoluble lattice following secretion and therefore represents the firstdiffusible protein identified in ciliate granules.

Eukaryotic cells export proteins constitutively by the fusionof secretory vesicles with the plasma membrane. All cells ap-pear to have a constitutive pathway for protein secretion. Inaddition, some specialized cell types maintain a separate res-ervoir of vesicles that secrete their contents only in response tospecific stimuli, a phenomenon called regulated exocytosis.The contents of such vesicles, which are called dense coregranules (DCGs), are highly concentrated for storage as mac-romolecular aggregates. Regulated exocytosis allows for arapid secretory response to changes in the cellular environ-ment (29).

DCGs are complex organelles. Their formation involves theassociation of a subset of luminal proteins in the trans-Golginetwork. This process separates these proteins from othersthat remain soluble (2, 3, 12, 50). This condensate exits thetrans-Golgi network in the form of an immature DCG andtypically undergoes reorganization and further condensationduring a maturation period. In this process, an aggregate withno apparent organization can be transformed into one withordered contents (2, 37, 38). Upon exocytosis, the cores de-condense and the cargo is dispersed, an event shaped by theinteractions between core components. The soluble polypep-tide cargo of adrenal chromaffin granules is condensed on aninsoluble proteoglycan core (55). Upon exocytosis, the proteo-glycan core rapidly expands and, in doing so, performs animportant function in cargo release (39, 44). Both the gener-ation and function of DCGs are based on compartment-spe-cific cargo condensation and decondensation. For these rea-sons, the cargo can be considered to function as an activeparticipant rather than as a mere passenger.

DCGs arose early in eukaryotic evolution and are well de-

veloped in the ciliates. The strength of classical and moleculargenetics approaches in Tetrahymena thermophila and Parame-cium tetraurelia makes these organisms attractive model sys-tems for mechanistic analysis of regulated secretion. In bothorganisms, DCGs have received attention at the molecularlevel. Whereas DCG contents in many multicellular organismswere initially identified by their physiological activities (e.g.,neuropeptides), the largely unknown functions of ciliate DCGsprecluded this approach, and contents were identified based ontheir abundances in stimulated-cell supernatants (8, 35, 48, 53)or by screening for gene products essential for exocytosis (7).DCG cargo in T. thermophila consists principally of a family ofgranule lattice (Grl) proteins. These are derived by proteolyti-cally processing soluble precursors. During this transition, theyform an insoluble lattice (52). Upon exocytosis, the latticeremains intact but undergoes expansion to propel the DCGcargo from the cell (25). The Grl family is orthologous to thetmp protein family (trichocyst matrix proteins) in P. tetraurelia(34). The disruption or silencing of any one of the core proteingenes blocks normal core formation, and each core protein canthus be considered an essential structural element of the gran-ule cores (8, 46) (D. C. Chilcoat and A. P. Turkewitz, unpub-lished data).

If Grls/tmps constitute a core structure that remains insol-uble, what are the molecules that are being released and howare they targeted to DCGs? Although there is no direct evi-dence, behavioral observations hint that ciliate DCGs releasesoluble cargo. For example, some predatory ciliates use regu-lated exocytosis to immobilize prey: the paralysis of the haplessvictim implies the delivery of toxins (26). DCGs in other cili-ates appear to serve defensive functions (24, 30).

Here we have addressed the task of identifying novel cargoproteins that may play roles distinct from those of the knowncomponents, taking advantage of the ability of DGCs in T.thermophila to undergo synchronous exocytosis. We havecloned genes whose transcription is stimulated by exocytosis

* Corresponding author. Mailing address: 920 E. 58th St., Chicago,IL 60637. Phone: (773) 702-4374. Fax: (773) 702-3172. E-mail:[email protected].

† Present address: Institute for Environmental Medicine, The Uni-versity of Pennsylvania, Philadelphia, PA 19104-6068.

583

on March 29, 2021 by guest

http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

and have characterized the product of IGR1 (induced duringgranule regeneration 1).

MATERIALS AND METHODS

All reagents were from Sigma Chemical Co. (St. Louis, Mo.) unless otherwisenoted.

Cells and cell culture. Cells were grown at 30°C with moderate agitation in amixture containing 1% Proteose Peptone, 0.2% dextrose, and 0.1% yeast extract(all from Difco Laboratories, Detroit, Mich.) and 0.003% ferric EDTA. T.thermophila strains are designated by their micronuclear diploid genotype, fol-lowed by their macronuclear phenotype in parentheses (41). The heterokaryonstrains CU428.1 mpr1-1/mpr1-1 (mp-s, VII) and B2086 mprs/mprs (mp-s, II) werefrom Peter Bruns (Cornell University, Ithaca, N.Y.) (41). Exocytosis-deficient(exo�) mutant SB281 was a gift from Ed Orias (University of California, SantaBarbara, Calif.) (42). The exo� strain MN173 (V) has been described previously(36). Strains harboring pVGF-derived vectors (28) were maintained in 120 �g ofparomomycin sulfate/ml.

Genetic nomenclature for T. thermophila has recently been formalized and isfollowed in this paper (1).

Differential-display PCR. Stimulation of exocytosis with Alcian blue and sub-sequent recovery were performed as described previously by using a wild-type(CU428.1) and an exo� (MN173) strain (22). Total RNA preparations wereisolated as described previously (22) and were subsequently treated with RNase-free DNase I (Genehunter, Nashville, Tenn.) according to the manufacturer’sspecifications. First-strand cDNA synthesis was performed using 2 �g of totalRNA in a reaction mixture containing 50 mM Tris-Cl, pH 8.3, 75 mM KCl, 3 mMMgCl2, 10 mM dithiothreitol, 20 �M deoxynucleoside triphosphates (dNTPs), 1�M single degenerate poly(dT) oligonucleotide primer (four total 14-mers,T12MA, T12MT, T12MC, and T12MG, where M � A, G, or C; Genehunter), and200 U of Superscript II RNase H� reverse transcriptase (Life Technologies,Rockville, Md.), which was incubated at 65°C for 5 min and then at 37°C for 1 h.One-tenth of a single reaction mixture was then used for the PCR: 50 mM KCl,10 mM Tris-Cl (pH 9.0 at 25°C), 0.1% Triton X-100, 1.5 mM MgCl2, 2 �MdNTPs, 21 �Ci [�-33P]ATP (2,000 Ci/mmol; NEN Life Science Products, Boston,Mass.), 2 U of Taq polymerase (Promega, Madison, Wis.), 1 �M T12MN, usedfor the cDNA synthesis, and a 1 �M 10-mer oligonucleotide primer (A1, AGCCAGCGAA, A2, GACCGCTTGT, A3, AGGTGACCGT, A4, GGTACCCAC,and A5, GTTGCGATCC [Genehunter], and O1, CAGGCCCTTC, O2, TGCCGAGCTG, O3, AGTCAGCCAC, O4, AATCGGGCTG, O5, AGGGGTCTTG,O6, GGTCCCTGAC, O7, GAAACGGGTG, O8, GTGACGTAGG, O9, GGGTAACGCC, O10, GTGATCGCAG, O11, CAATCGCCGT, O12, TCGGCGATAG, O13, CAGCACCCAC, O14, TCTGTGCTGG, O15, TTCCGAACCC,and O19, CAAACGTCGG [Operon, Alameda, Calif.]). Reaction mixtures weresubjected to the following: 94°C for 30 s, 40°C for 2 min, and 72°C for 30 s for 40cycles and then 72°C for 5 min. Approximately one-fourth of the reaction mixturewas resolved on a 6% denaturing polyacrylamide gel. Gels were first analyzedwith a phosphorimager (Storm 860; Molecular Dynamics, Sunnyvale, Calif.) andthen exposed to X-ray film. DNA from a particular gel position was cloned byfirst repeating the PCR described above (omitting the radionucleotide) usingDNA recovered from an excised gel slice as the template. These PCR productswere cloned either directly or following agarose gel purification using the TAcloning system (Invitrogen, Carlsbad, Calif.).

Northern blotting was performed using radioactive probes made from a rep-resentative clone of each unique sequence in order to determine the mRNAlevels of each clone’s corresponding gene. Total RNA (�20 �g), isolated iden-tically to the samples used for the differential-display reactions, was probed asdescribed previously with the following modifications: one-half of a riboprobesynthesis reaction mixture (10 mM dithiothreitol, 500 �M [each] rATP, rGTP,rCTP, 100 �M UTP, 50 �Ci [�-32P]UTP [6,000 Ci/mmol], �1 �g of DNAtemplate, and either SP6 or T7 RNA polymerase [reaction buffer and conditionswere provided by the supplier]) was added to 5 ml of hybridization buffer (50%formamide, 5� SSPE [1� is 180 mM NaCl, 10 mM NaH2PO4 {pH 7.4}, 10 mMEDTA {pH 7.4}], 0.1% sodium dodecyl sulfate [SDS], 100 �g of denaturedsalmon sperm DNA/ml) and allowed to hybridize overnight at 55°C. Blots werewashed twice in 0.1� SSPE–0.1% SDS for 15 min at 55°C and exposed to aphosphorimager screen for analysis.

cDNA and genomic cloning. cDNA clones were obtained for many of thegenuine differential display amplicons via PCR. An oligonucleotide primer wasdesigned to direct polymerization toward the 5� end of the gene. This primer wasused in conjunction with a primer complementary to the cDNA library vector.Specific reaction conditions for the PCR were empirically determined by explor-ing a number of annealing temperatures, DNA polymerases, and cDNA libraries

as sources of templates (gt10 was a kind gift from Tohru Takemasa [Universityof Tsukuba, Tsukuba, Japan], and two plasmid-based full-length libraries aredescribed in reference 7). The PCR was performed using 50 to 100 ng of libraryDNA, polymerase-specific buffer, 250 �M dNTPs, and either Taq (Promega),Expand (Roche Molecular Biochemicals, Indianapolis, Ind.), or Pfu (Stratagene,La Jolla, Calif.) thermophilic DNA polymerases. Products from positive reac-tions were cloned with the TOPO-TA cloning system (Invitrogen) and com-pletely sequenced. Genomic clones encompassing particular genes were obtainedvia PCR using primers directed to the extreme 5� and 3� ends of the cDNA andT. thermophila (CU428.1) genomic DNA as the template.

Sequence analysis. Sequences of both partial and full-length cDNAs werecompared to entries in GenBank by using BLASTX. Conceptual translations offull-length cDNAs were analyzed for general protein features using Protean(DNA Star Software, Madison, Wis.) and further compared to known proteinsequences in GenBank by using the PSI-BLAST program. Alignments usingstructural information were performed by using the Conserved Domain Data-base (National Center for Biotechnology Information, Bethesda, Md.). Potentialamino-terminal signal sequences were analyzed by using the SignalP, version 2.0,World Wide Web server (www.cbs.dtu.dk/services/SignalP/).

Southern blot analysis. Genomic DNA was purified from T. thermophila asdescribed previously (15). Approximately 20 �g of DNA was digested withvarious restriction enzymes in accordance with the suppliers’ instructions. South-ern blotting was performed either under the riboprobe conditions above or bynonradioactive detection using the GENIUS system (Roche Molecular Bio-chemicals).

Gene disruption. A 2.8-kb genomic DNA fragment containing the IGR1 openreading frame (ORF) was obtained via PCR using oligonucleotide primers in-ternal to an XbaI site flanking this locus. The DNA sequence encoding theseprimers was obtained from a product of an inverse PCR designed to yield 650 bp5� and �1,500 bp 3� of IGR1. The NEO2 cassette (described in reference 14) wasinserted between the PacI site and HincII site in IGR1, a region which spans from�47 to �199 (numbers are relative to translational initiation), via ligation ofBstXI adapter oligonucleotides. Cells were transformed with the Biolistic device(Bio-Rad, Hercules, Calif.) as described previously (4). Macronuclear transfor-mants were initially selected at 120 �g of paromomycin sulfate/ml and subse-quently passaged for approximately 9 weeks during which the drug concentrationwas increased to 500 �g/ml.

Construction and expression of fusion and truncated proteins. All genesencoding fusion proteins in this study were expressed by using vectors derivedfrom pVGF.1 (28). Fusions to green fluorescent protein (GFP) were generatedby first adding appropriate restriction sites at the extreme 5� and 3� ends of theORF and ligating into the PmeI site of pVGF.1 (IGR1 P1, GGGGCAGCTGGCAAAATGAGAAAGATCA; P2, TTGTCAGCTGAAATTTCTTCTGTTGTT). DNA sequences encoding the hemagglutinin (HA) tag (YPYDVDPYA)were incorporated into the IGR1 sequence encoding the C terminus via a PCRapproach using forward primer P1 (CCTGATTATGCTTGAAAAAGACAATTCTATTAGTA) and reverse primer P2 (AACATCATAAGGATAATTTCTTCTGTTGTTTCTTCTG), which, upon intramolecular ligation of the linear am-plification product, create the proper coding sequence (17). This created igr1-1(HA). A similar strategy was used to generate the deletion constructs. Thesignal sequence-GFP fusion involved joining the first 20 amino acids encoded byIGR1 to the amino terminus of GFP; igr1-2(31-183) was derived from igr1-1(HA). Upon confirmation of the predicted DNA sequences, these genes wereinserted between the PmeI and XhoI sites of pVGF.1 (replacing the vector GFPcoding sequence). Positive transformants harboring each construct were ob-tained by electroporation of conjugating pairs (14).

Protein methods and subcellular fractionation. Preparation of whole-cell de-tergent lysates from T. thermophila was as described previously (52); the protocolfor purifying DCG contents following dibucaine stimulation is in reference 51and essentially consists of two to four washes to separate the insoluble DCGlattices from both soluble proteins and cells. For experiments with strains har-boring pVGF-derived vectors, cultures were used at a density of �1 � 105

cells/ml to maintain robust gene expression. Protein concentrations were deter-mined by using the bicinchoninic acid (BCA) protein assay (Pierce, Rockford,Ill.). Following standard SDS-polyacrylamide gel electrophoresis (PAGE) andgel transfer protocols, nitrocellulose membranes were stained with Ponceau-Sand subjected to standard Western blotting protocols (23). The Grl1p-specificpolyclonal antibody (anti-p40) (52) was used at 1:1,000; blocking and antibodyincubations were done in 5% dry milk. The HA-specific monoclonal antibody(HA.11/16B12; Covance, Richmond, Calif.) was used at 1:2,000, with blockingand antibody incubations done in 3% bovine serum albumin. Detection withchemiluminescence system SuperSignal (Pierce) was performed according to themanufacturer’s instructions. For radioactive detection, �1 to 5 �Ci of 125I-

584 HADDAD ET AL. EUKARYOT. CELL


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

protein A (ICN Biomedicals, Costa Mesa, Calif.) was incubated directly (Grl1p)or following an incubation with a rabbit anti-mouse secondary antibody (HA;Jackson Immunoresearch Laboratories, West Grove, Pa.) with membranes andsubsequently exposed to a phosphorimager screen for analysis.

For equilibrium density gradient ultracentrifugation, cells were disrupted witha ball bearing homogenizer as described previously (51). Roughly 2 � 107 cellswere washed and mechanically lysed at a concentration of �107/ml in the pres-ence of protease inhibitors. Following lysis, the homogenates were loaded andsedimented through a continuous gradient in which the bottom solution con-tained 45% Nycodenz, 10 mM HEPES, pH 7.0, 1 mM EGTA, 1 mM MgCl2, and0.2% gelatin and the top solution was identical except that the Nycodenz wasreplaced with 0.28 M sucrose. Centrifugation was for 24 h at 30,000 rpm in anSW-41 rotor (Beckman, Fullerton, Calif.). One-milliliter fractions were collectedand subsequently assayed for Grl1p and HA-reactive species by using the West-ern blotting conditions described above.

Detergent lysates. Approximately 1 � 106 to 2 � 106 cells were washed twicein a solution containing 0.17 mM sodium citrate, 0.1 mM sodium phosphate, 0.1mM disodium phosphate, 0.65 mM CaCl2, and 100 �M MgCl2 and resuspendedin a volume of 0.25 ml. Cells were lysed with a buffered detergent solutioncontaining 1% Nonidet P-40, 0.4% sodium deoxycholate, EDTA (52), and pro-tease inhibitors (E-64, antipain, leupeptin, chymostatin A) (51). Lysates wereincubated on ice for 4 h and then centrifuged at top speed in a cold Microfuge(Brinkman Instruments, Westbury, N.Y.) for 10 min. Both supernatant andpellet fractions were subsequently analyzed by Western blotting.

RESULTS

Selection for genes induced by exocytosis. T. thermophilareplaces a full complement of DCGs, called mucocysts in thisspecies, within 4 h following induction of global synchronousexocytosis (22). During this period of regranulation, themRNAs for two granule content genes, GRL1 and GRL4,accumulate within 60 min to about 10 times the prestimulationlevels. In several exocytosis-deficient mutants, by contrast,there is no increase in these mRNAs in response to stimula-tion, indicating that transcription of granule-related genes re-sponds to exocytosis itself.

Since the expression of other granule component genes islikely to be similarly induced under these circumstances, weidentified transcripts that were more abundant following thestimulation of wild-type, but not exo� mutant, cell lines. We

isolated total RNA from two strains, wild-type CU428.1 andexo� MN173, prior to and 60 min after stimulation. In theMN173 mutant strain, DCGs cannot dock at the plasma mem-brane and therefore do not undergo exocytosis (36). The rel-ative abundances of individual mRNAs in these samples wereassayed by the semiquantitative, reverse transcription-basedPCR method termed differential display (33). Paired promis-cuous primers (the first, a 5� 10-mer, the second, one of fourpoly[A]-anchored 14-mers designed with mild degeneracy)were used to generate small amplification products (ampli-cons) from the starting mRNA templates. We identified andisolated amplicons that appeared more abundant after exocy-tosis in wild-type cells, ignoring that subset whose abundancealso appeared to increase in the exo� mutant under identicalconditions.

A total of 102 products, ranging in size from 75 to �500 bp,were cloned and sequenced. These corresponded to 86 uniqueclones. Three of these sequences were exact matches for genesencoding components of the DCG lattice (GRL3, GRL5, andGRL7) (53) (Table 1). Since these were known to be transcrip-tionally induced following exocytosis, their isolation indicatedthat the screen was likely to produce other genes relevant toDCG biosynthesis. Each of the remaining amplicons was usedas a probe to determine the abundance of the correspondingmRNA in cells treated identically to those in the initial differ-ential-display experiments. Thirteen of these representedgenes whose transcript abundances were modulated as antici-pated. A set is shown in Fig. 1A, with more detailed kinetics fora subset in Fig. 1B. We amplified cDNA clones from several T.thermophila cDNA libraries for eight of these expressed se-quence tags (ESTs) by using a combination of a vector-specificand an EST-specific primer. BLAST searches revealed clearhomologues for seven of the full-length clones but none for theESTs (Table 1).

Identification of a novel DCG marker. We pursued clonesencoding proteins whose likely amino-terminal signal se-

TABLE 1. Differential-display PCR isolates

Isolate (function or product) BLAST Identification Accession no.

Complete novel cDNA clonesIGR1 (Induced during granule regeneration) AY075145IGR2 AY075152IGR3 AY075146GIP1 (Granule regeneration-induced protease) Cysteine protease AY075147TKI1 (Tet.a Kazal-type protease inhibitor) Kazal-type protease inhibitor AY075151TER1 (Tet. ER retrieval receptor) ER retrieval receptor AY075150TAP1 (Tet. amino acid permease) unc47 family of amino acid transporters AY075149TCE1 (Tet. cation exchanger) K�-dependent Na�/Ca� exchanger AY075148

ESTsIGR4 AY075140IGR5 AY075144IGR6 AY075143IGR7 AY075142IGR8 AY075141

Previously cloned genesGRL3 Granule lattice protein 3 AF031319GRL5 Granule lattice protein 5 AF031321GRL7 Granule lattice protein 7 AF031322

a Tet., T. thermophila.

VOL. 1, 2002 TETRAHYMENA DENSE CORE GRANULE PROTEIN 585


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

quences indicated targeting to the secretory pathway (54):TKI1, GIP1, and IGR1. The proteins were expressed as GFPfusion proteins to determine in vivo localization. DCGs in T.thermophila are positioned along linearly aligned plasma mem-brane docking sites (25). The GFP-tagged product of IGR1[igr1-4p(GFP)] was confined to a bright and uniform constel-lation of puncta along the cell surface (Fig. 2A). That thesecorresponded to DCGs was confirmed by treating the cells witha secretagogue to induce massive synchronous exocytosis of theentire cohort of DCGs. Secretagogue treatment of cells ex-pressing the GFP fusion resulted in virtually complete disap-pearance of the intracellular fluorescence (not shown). Iden-tical patterns were observed with cells expressing a GFP fusionto known DCG core protein Grl1p (Fig. 2B).

The observed localization of igr1-4p(GFP) is meaningfulonly if GFP does not itself concentrate in DCGs. We thereforecreated a construct in which GFP was fused at its amino ter-

minus to the signal sequence derived from Grl1p. The ex-pressed protein was targeted to the secretory pathway andappeared within bright, highly mobile small vesicles, as well asin a faint reticular pattern (Fig. 2C). Importantly, there was nolabeling of vesicles at the cell surface. GFP expressed by itself,unlinked to a signal sequence, gives uniform staining of the

FIG. 1. Isolation of genes induced during DCG biogenesis in T.thermophila. (A) Each unique amplicon identified by differential-dis-play PCR was used as a probe to assay the abundance of the corre-sponding mRNA in total RNA prepared from cells before (�) andafter (�) exocytosis. A subset of the positive clones is shown, with thehistone H4 transcripts serving as a loading control. Approximate tran-script sizes are as follows: IGR1, 1.0 kb; IGR2, 1.2 kb; IGR3, 0.8 kb;IGR4, 0.8 kb; IGR5, 1.6 kb; IGR6, 1.0 kb; IGR7, �6 to 8 kb; IGR8, 1.0kb; GIP1, 1.1 kb; TCE1, 2.0 kb; TER1, 0.9 kb; TKI1, 0.8 kb; TAP1, 1.9kb. WT, wild type. (B) Northern blots of T. thermophila total RNAprepared prior to and at various times during granule replacement.The mRNAs for both GRL3 and IGR1 show identical patterns ofaccumulation, rapidly accumulating within 60 min of secretagogueexposure. The GIP1 transcript accumulates rapidly following stimula-tion but decreases more rapidly than GRL3 or IGR1. The level ofhistone H4 transcripts remains unchanged throughout the time course.

FIG. 2. Expression of GFP fusion proteins reveals that the IGR1product localizes to DCGs in vivo. Confocal micrographs of T. ther-mophila strains harboring GFP-tagged constructs. Tangential opticalsections are shown. Bar, 10 �M. (A) Cells expressing igr1-4p(GFP)show punctate fluorescence along the cell surface. The periodic pat-tern is due to the fact that DCG docking sites are regularly spacedalong a well-ordered cortical cytoskeletal network (1 and 2° meridians)in these cells. (B) A similar pattern of fluorescence is seen in cellsexpressing a fusion to Grl1p, a DCG lattice protein. (C) Cells express-ing GFP linked to the signal sequence of Grl1p. GFP fluorescenceappears in the form of heterogeneous puncta and is not detectedwithin DCGs.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

cytoplasm (22). We conclude that igr1-4p(GFP) is localized toDCGs and that this depends on signals in Igr1p itself.

As expected for a gene encoding a DCG cargo protein, IGR1expression paralleled that of GRL genes for several hoursfollowing exocytosis. The mRNA rapidly accumulated duringDCG biogenesis and decreased at later times. This time coursewas identical to that of GRL3 mRNA, although the absolutelevels of induction were different. The correspondence is notseen for genes unrelated to DCGs (Fig. 1B).

Igr1p is structurally unrelated to known ciliate DCG pro-teins. Conceptual translation of the 930-bp ORF predicted a309-amino-acid protein (Fig. 3A). Comparison of IGR1 cDNAand genomic DNA sequences indicated that the gene containsno introns (not shown), and Southern blotting of restriction-digested genomic DNA using the IGR1 cDNA clone as theprobe revealed a single strongly reactive band in most lanes(Fig. 3B). A faint secondary band in the EcoRI-digestedgenomic DNA may reflect the existence of a related gene.Except for the amino-terminal signal sequence, the predictedprotein does not contain significant regions of hydrophobicityand is therefore unlikely to integrate stably into the membrane(Fig. 3C). The primary sequence indicated that the new proteinhas a significantly different character from those of all of theGrls. The Grls, as well as the orthologous tmps in P. tetraurelia,are highly acidic and are predicted to fold almost exclusively ascoiled coils (18, 53). In contrast, Igr1p is a slightly basic proteinwith no preponderance of coiled coils. Thus, the novel proteinis unrelated by sequence to the Grls and may therefore repre-sent the first member of a second class of proteins identified inT. thermophila DCGs.

We failed to detect any database matches to the amino-terminal sequence of Igr1p. However, the carboxy-terminal108 amino acids (representing about one-third of the protein)bears significant homology to the carboxy-terminal regions of afamily of proteins in P. tetraurelia called Pcmps (Parameciumcalmodulin-binding membrane proteins) (BLASTp; E value,�1e-4) (5). The remaining portions of Igr1p and the Pcmpshave no detectable similarity. The initial description of thePcmps as cytosolic proteins is considered below.

The similarity to the Pcmps carboxy-terminal domain mayprovide a hint about the structure of Igr1p, since the Pcmpdomain appears distantly related to the /�-crystallin family ofproteins (5). The /�-crystallin domain consists of a compactarray formed by two four-stranded antiparallel beta sheets(47). To consider whether the carboxy-terminal domain inIgr1p might have a similar fold, we aligned the Igr1p carboxy-terminal domain with a Pcmp as well as an authentic /�-crystallin domain. This tentative alignment was based on thepositions of a small number of residues conserved among crys-tallins that are also present in the ciliate proteins (Fig. 4A). Wethen attempted to trace the Igr1b primary sequence in the /�-crystallin tertiary structure (Fig. 4B). Those residues thatare absolutely conserved, two glycines and a serine, all fellwithin relatively tight turns either preceding or in the firstposition of a beta strand. These are positions where side chainpacking would be tightly constrained. The insertions or dele-tions in Igr1p, relative to the /�-crystallin, are found withinloops rather than within the core structure, an indication thatthe superimposition of the ciliate sequences on the structure isnot unreasonable (Fig. 4A). A conspicuous feature conserved

FIG. 3. Sequence and predicted features of Igr1p. (A) The 930-bp IGR1 ORF encodes a 309-amino-acid protein, whose sequence is shown. Thepredicted amino-terminal signal sequence is in italics. (B) Southern blot of T. thermophila genomic DNA digested with EcoRI (E), HindIII (H),PacI (P), and XbaI (X). A single strong band is present in all digestions, with an additional weaker reactive band present in lane E. (C) Predictedfeatures of Igr1p. The sole extended stretch of hydrophobic residues corresponds to the amino-terminal signal sequence. In contrast to the acidicGrlps, Igr1p is a slightly basic protein and is not predicted to fold as �-helical coiled coils.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

among the ciliate proteins but absent in crystallin counterpartsis four cysteines. When these residues are placed in the struc-ture, they fall into two pairs. This suggests the possibility ofdisulfide bond formation, which would further stabilize thisdomain. This structural modeling does not imply any evolu-tionary relatedness between the ciliate proteins and authentic /�-crystallins, since similar structures can arise convergently.Apparent convergence on a crystallin-like fold has alreadybeen noted in several cases (9).

Characterization of epitope-tagged variants. For furtherbiochemical analysis of Igr1p and preliminary dissection ofputative sorting signals, we expressed full-length Igr1p with acarboxy-terminal HA epitope tag [igr1-1p(HA)] as well as asimilarly tagged construct consisting of Igr1p from which we

deleted amino acids 31 to 183 [igr1-2p(31-183,HA)] (Fig.5A). The latter protein contained the signal sequence (aminoacids 1 to 30) followed by carboxy-terminal amino acids 184 to309. This carboxy terminus includes the region which, based onthe structural arguments presented above, seemed likely toform an independently folded domain. We likewise created atruncated protein consisting solely of the amino-terminal re-gion (amino acids 1 to 200). This, however, could not be stablyexpressed in cells.

Western blot analysis of cell lysates prepared from strainsexpressing either full-length igr1-1p(HA) or igr1-2p(31-183,HA) revealed strong HA-reactive species. These some-times appeared as doublets (Fig. 5B), which may reflect limitedamino-terminal proteolytic degradation; importantly, the dif-

FIG. 4. Tentative alignment of ciliate proteins Igr1p and Pcm3p with bovine B2-crystallin, domain 2. (A) Residues indicated by double-heightletters are absolutely conserved among /�-crystallins (G36, S60, and G80) and were used as guides for the alignment. A linear representation ofthe /�-crystallin 2° structure, immediately below the sequence, shows the relative positions of -strands (S) and loops (L). Four cysteine residuespresent in Igr1p and Pcm3p but not in /�-crystallins are in boldface and were assigned arbitrary numbers. A four-residue deletion in the Igr1psequence, relative to the other two sequences shown, falls within an extended loop (L3). (B) Modeling the carboxy termini of the ciliate proteinson the tertiary structure of a /�-crystallin domain (bovine B2-crystallin). Small balls: the three residues conserved between Igr1p, the Pcmps,and the vertebrate /�-crystallins, which are positioned at tight turns where the range of acceptable side chains is constrained; large balls: fourcysteines found in the ciliate, but not the vertebrate, proteins. When the ciliate sequences are mapped on the /�-crystallin domain structure, thecysteines appear well situated to form two disulfide bonds.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

ferent species behaved identically in all experiments we havedone. We have never detected a larger form in cell lysates,suggesting that Igr1p, unlike the Grls, is not processed from aproform. Further evidence against processing came from ex-pressing igr1-1p(HA) in cell line SB281, a mutant that is de-fective in DCG biosynthesis and in Grl1p processing, so thatGrl1p accumulates as the proprotein (13, 52). Igr1p expressedin SB281 was identical in mobility to that expressed in wild-type cells (not shown). No proteins reactive to HA antibodieswere seen in untransformed cells, either wild type or SB281.

GFP-tagged Igr1p appeared to be localized exclusively toDCGs in vivo. For technical reasons, we could not visualizeHA-tagged Igr1p in living or fixed cells, so we examined itsdistribution using subcellular fractionation. Postnuclear super-natants of cell lysates were resolved by equilibrium densitygradient centrifugation, and the fractions containing igr1-1p(HA) were identified by Western blotting. DCGs, as markedby Grl1p, were found near the bottom of such gradients. Theigr1-1p(HA) was found in the same fractions as Grl1p (Fig. 5C,top). There was a slight difference in the distributions of thesetwo markers: while Grl1p was more abundant in fraction 10than 9, the opposite was true for igr1-1p(HA). Several possibleexplanations are discussed below.

The Igr1p carboxy-terminal domain localizes to DCGs. Sig-nals that target proteins to DCGs are poorly defined, but smallstable loops appear to be important determinants in severalsystems (6, 10, 11, 19, 45, 56). To ask whether the carboxy-terminal domain of Igr1p is sufficient for DCG targeting, weassayed the localization of igr1-2p(31-183,HA). The trun-cated protein behaved identically to full-length igr1-1p(HA) onequilibrium density gradients, with its peak fraction slightlyoffset from that of Grl1p (Fig. 5C, bottom). One possibleexplanation for this difference in distribution is that the full-length and truncated proteins are present in a compartmentthat is distinct from, though of similar density to, DCGs. Wemade use of a functional assay to test the extent to whichigr1-2p(31-183,HA) was depleted from cells exposed to asecretagogue. Under conditions of rapid synchronous exocyto-sis, a large fraction of DCG contents is released within secondsof stimulation. In previous experiments, the cellular levels ofGrl1p and of a second abundant DCG cargo protein, p80,decreased by 60 and 70%, respectively (52). When cells ex-pressing igr1-2p(31-183,HA) were stimulated, roughly 60%of the truncated protein was released within 15 s (Fig. 5D).Grl1p itself showed �90% depletion in this experiment. Thisresult is representative of several in which depletion of Grl1p

FIG. 5. Expression and characterization of HA-tagged full-length and truncated Igr1p. (A) The HA nonapeptide was fused to the extremecarboxy termini of Igr1p and a truncated derivative. The former is igr1-1p(HA). In the latter, igr1-2p(31-183,HA), the N-terminal 153 amino acidresidues (not including the signal sequence, residues 1 to 30) are deleted, leaving the carboxy-terminal region linked to the signal sequence.(B) Western blots of whole-cell lysates expressing these constructs reveal anti-HA-reactive bands near the predicted molecular weights. (C) Frac-tionation of cell homogenates by equilibrium density ultracentifugation on continuous Nycodenz gradients. Harvested fractions were subjected toSDS-PAGE and analyzed by antibody blotting using antibodies against HA or Grl1p. (Top) Both igr1-1p(HA) and Grl1p are found in the samehigh-density fractions. However, Grl1p is most concentrated in fraction 10, while igr1-1p(HA) is most concentrated in fraction 9. (Bottom)Equivalent fractionation of cells expressing igr1-2p(31-183,HA). On this particular gradient, the Grl1p-containing DCG peak is shifted onefraction relative to that above. As for the holoprotein, the distribution of igr1-2p(31-183,HA) is subtly different from that of Grl1p. (D) Depletionof igr1-2p(31-183,HA) and Grl1p from cells following exocytic release. Cells expressing igr1-2p(31-183,HA) were stimulated with dibucaine for15 s and separated from the released granule contents. Cells were depleted of �60% of igr1-2p(31-183,HA) and �90% of Grl1p. ProGrl1p servesas an internal control, since the proprotein is not released upon stimulation (52).



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

was always somewhat greater than that of Igr1p. An internalcontrol was the unprocessed form of Grl1p, proGrl1p.proGrl1p is not present in mature docked DCGs and is notreleased from stimulated cells. We conclude that, at a mini-mum, the majority of the HA-tagged truncated protein is lo-calized to DCGs.

Igr1p is not retained by the Grl-based insoluble lattice.Mature Grls are assembled into insoluble lattices that form theDCG cores. While the lattices expand during exocytosis, theyremain insoluble. The tendency of expanded lattices to clumpmakes it straightforward to enrich for Grls and associatedlattice proteins from stimulated cell supernatants by severalwashes using low-speed centrifugation. During this period, lat-tices are separated both from soluble proteins and from thebulk of the cells.

We determined the relative amounts of igr1-1p(HA) inwhole-cell lysates versus enriched lattices (Fig. 6A). Grl1p was

enriched �20-fold in the insoluble lattice fraction, whereasigr1-1p(HA) was depleted �2-fold in the same fraction. Igr1pin the lattice fraction is therefore �40-fold depleted relative toGrl1p, in contrast to their relative abundances in the whole-celllysates. As shown above, the majority of Igr1ps are rapidlyreleased from cells during the stimulation period. In combina-tion, these results indicate that Igr1p, unlike any previouslyidentified DCG cargo proteins in ciliates, does not remainassociated with the expanded cores following exocytosis.

A different approach to assessing the relative solubility ofDCG cargo proteins is by fractionating detergent lysates ofunstimulated cells. Preparation of such lysates in calcium-freebuffers prevents lattice expansion. It was thus possible to askwhether Igr1p can be removed from DCG cores in the preex-panded state. More than 95% of Grl1p was found in the pelletfraction of such lysates, whereas �30% of Igr1p was found inthe supernatant (Fig. 6B). The pelletable fraction seemedlikely to be associated with the insoluble Grl-based lattice. Totest this hypothesis, detergent lysates were prepared fromSB281 cells expressing igr1-1p(HA). As mentioned above, Grlproteins are not processed in SB281 and do not assemble intoinsoluble lattices. The igr1-1p(HA) was present exclusively inthe supernatants of such lysates (Fig. 6C). We conclude thatIgr1p can associate with the condensed lattice but that a sig-nificant fraction is readily dissociable. This may indicate theexistence of two pools of Igr1p or may simply reflect slowdissociation kinetics.

Comparison of Igr1p to the Grl family of granule core pro-teins. The partial association of Igr1p with the condensed orexpanded lattices suggested that it is not a structural compo-nent of these macromolecular assemblies and prompted theprediction that the absence of Igr1p would have no majoreffect on lattice structure or expansion. We disrupted all ma-cronuclear copies of IGR1 by homologous recombination usingestablished techniques (Fig. 7A). Southern blotting confirmedthe correct targeting and replacement of the all copies of IGR1in the polyploid macronucleus. Under these blotting condi-tions, the strongly hybridizing band containing the IGR1 geneis detected at �3.0 kbp. The correct targeting of the IGR1deletion construct was confirmed by observing a diagnosticshift in the electrophoretic migration of the strongly hybridiz-ing band. Elimination of all endogenous copies of IGR1 wasindicated by the absence of the restriction fragment seen in thewild type. An additional weakly hybridizing band is seen at 2.6kbp (Fig. 3C). This band was unchanged in IGR1 strains andis consistent with the existence of an IGR1-related gene.

IGR1 cells showed no deficiency in exocytosis. Their arrayof DCGs was indistinguishable from that of the wild type, andthe DCGs themselves had no discernible alterations in posi-tion, dimensions, or lattice structure (Fig. 7B). When IGR1strains were challenged with an array of secretagogues, theyresponded with robust exocytic responses that were qualita-tively and quantitatively indistinguishable from those in wild-type cells (not shown). Since rapid exocytosis depends on lat-tice expansion, we conclude that Igr1p is not essential for theassembly of functional lattices. We cannot, however, rule outthe possibility that the normal role of Igr1p is redundant withthat of the putative Igr1p-related protein implied by ourSouthern blots. Such redundancy could account for the ab-sence of a detectable phenotype in the IGR1 strain. This

FIG. 6. Igr1p is not stably associated with the Grl-based DCGlattice. (A) The insoluble contents of DCGs were enriched from stim-ulated cell supernatants as described in Materials and Methods. Grl1pand igr1-1p(HA) were detected by Western blotting of whole-celllysates prepared from prestimulated cells (WCL) or a fraction corre-sponding to the insoluble fraction of enriched granule lattices, isolatedfrom stimulated-cell supernatants (lattice). The igr1-1p(HA) was de-tected in both whole-cell lysates and in the granule contents but wasdepleted approximately twofold in the latter. In contrast, Grl1p isenriched �20-fold in the granule content fraction. Similar results wereobtained for cells expressing igr1-2p(31-183,HA). SDS-PAGE sam-ples were prepared for equal protein loading. Antibodies were de-tected with 125I-protein A. (B) Wild-type cells expressing igr1-1p(HA)were solubilized with detergent, and the insoluble fraction was pelletedas described in Materials and Methods. The relative levels of HA-tagged proteins and Grl1p in pellets (P) and supernatants (S) weredetermined by Western blotting. While more than 95% of Grl1p isfound in the pellet fraction, igr1-1p(HA) is present in both the pellet(�70%) and supernatant (�30%). (C) igr1-1p(HA) was expressed inT. thermophila exo� strain SB281, which is defective in processingDCG proproteins and in assembling insoluble granule cores. Deter-gent lysates were prepared and fractionated as described for panel A.The igr1-1p(HA) was present almost exclusively in the soluble fraction.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

would be in contrast to what is found for proteins encoded bythe GRL family, in which disruption of any individual gene issufficient to interfere with normal granule formation.

We compared the proteins secreted from wild-type andIGR1 strains. Coomassie blue-stained SDS-PAGE gels re-vealed an identical pattern of polypeptides, with the exceptionof a very lightly stained band that was reproducibly seen inwild-type but not IGR1 cells (Fig. 7C). The polypeptide hadan apparent molecular mass of �34 kDa, agreeing well withthe predicted molecular mass of 33.2 kDa. The low concentra-tion of this protein in isolated lattices provides no informationabout its abundance in intact granules. However, the proteinprofile of purified intact DCGs, representing both insolubleand soluble cargo, similarly shows no substantial protein withthe mobility of Igr1p (8). The relatively low abundance of theprotein in DCGs, relative to that of the Grls, is inconsistentwith a stoichiometric role in lattice formation. It does not,however, exclude the possibility that Igr1p could act as a latticeassembly factor.

DISCUSSION

The most significant result reported in this paper is theidentification of a ciliate protein, Igr1p, that is localized to andsecreted from DCGs but that is not an element of the corelattice. Igr1p does not serve an essential structural function,and its absence had no effect on core assembly or expansion.

Furthermore, Igr1p was not stably associated with the coresand could be dissociated from the expanded Grl1p-containinglattices following exocytosis. These results fulfill the expecta-tion that ciliate DCGs, like those in metazoans, release mac-romolecules that can diffuse in the cellular environs. Consid-ering the architectural and molecular complexity of thesesecretory vesicles in ciliates, it seems likely that a variety ofcargo proteins play roles including but not limited to the shap-ing of interactions with other microorganisms during preda-tory, defensive, and amatory encounters. The identification ofIgr1p and other proteins, which must be copackaged with thearchitectural Grls, may offer new insights into ciliate biology. Itshould also contribute to the study of mechanisms involved insorting to DCGs in eukaryotes, given the experimental advan-tages of ciliates relative to metazoan model systems.

We do not know the molecular basis for the sorting of Igr1pto DCGs, but it may involve association with proteins thatconstitute the structural core. In this regard, it would be inter-esting to know whether Igr1p is free to diffuse within thecondensed DCG lattice. Our analysis of Igr1p dissociationfrom condensed lattices in detergent-solubilized cell extractsoffers some hints. In these experiments, roughly 30% of theprotein was soluble. The insolubility of the remaining 70% waslikely due to association with the condensed lattice, since theinsoluble fraction was negligible in mutants that fail to assem-ble such lattices. Two different scenarios may account for the

FIG. 7. Disruption of the macronuclear IGR1 gene. (A) The construct used for interruption of macronuclear IGR1. A 256-bp fragmentincluding the translational start site of IGR1 was replaced with the NEO2 cassette and used to transform cells. Correct targeting and replacementof the endogenous macronuclear copies of IGR1 were confirmed by Southern blotting of untransformed strains (lanes C and c) and two differentIGR1 strains (lanes 1 and 2) using an IGR1 probe. The 3.0-kb XbaI fragment in untransformed cells is replaced by a 2.3-kb fragment, as expectedfor complete replacement of the endogenous allele. Lane c contains a reduced amount of DNA; the signal at this dilution is due to the twotranscriptionally silent micronuclear copies of IGR1, which are not replaced in such transformants. A weaker secondary band is common to allthree strains. (B) DCGs in IGR1 strains are indistinguishable from those in wild-type cells. Electron microscope thin section of an IGR1 cellshowing a DCG docked at the plasma membrane. (C) Comparison of the secreted proteins in wild-type versus IGR1 cells by SDS-PAGE andCoomassie blue staining demonstrated the absence of a minor polypeptide (molecular mass, �34 kDa) in the IGR1 sample. �, position of thepolypeptide. The right panel is a magnified view of the boxed region of the gel shown on the left.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

30% found in the supernatant, each of which is consistent withthe subtle difference between the distributions of Grl1p andHA-tagged Igr1p on equilibrium density gradients. One possi-bility is that some Igr1p protein is localized in a compartmentof the secretory pathway distinct from DCGs, though also ofhigh density. If so it represents a minority of the protein, sincethe majority can be rapidly released during synchronous exo-cytosis of DCGs. If the former is detergent soluble while themajority associated with DCGs is insoluble, these two popula-tions could account for the partial solubility of Igr1p in celllysates. However, the fact that all of the GFP-tagged Igr1pprotein appears localized to DCGs suggests a second scenario,namely, that the difference in density gradient distributionsreflects a previously undetected heterogeneity within DCGs.At the same time, however, the localization of the GFP-taggedIgr1p cannot be considered definitive, since a non-DCG-local-ized pool might not be visible if it were relatively diffuse.

Igr1p within these DCGs may be heterogeneous in solubilityif some of the Igr1p is bound to the DCG membrane. Aprecedent for such association of DCG cargo proteins with thelimiting membrane is chromogranin B in neuroendocrine gran-ules. Like Igr1p, chromogranin B has no obvious membraneinteraction domain but a fraction appears membrane bound(19). Chromogranin B also participates in homo- and hetero-typic protein interactions (40, 49). One can therefore imaginetwo overlapping fractions. The first is associated with the mem-brane and has limited interactions with other core proteins.The second is not membrane associated and has more-exten-sive interactions with other core proteins. If we model Igr1p onchromogranin B, the partial solubilization of Igr1p in detergentlysates may reflect the rapid release of the first, but not thesecond, fraction of the protein. This scenario is also consistentwith the observation that a substantial minority of Igr1p re-mains cell associated after exocytosis. Igr1p that is bound tothe DCG membrane may remain associated with the plasmamembrane or with the DCG membrane that is rapidly recov-ered by exocytosis-coupled endocytosis.

Igr1p was identified because the regeneration of DCGs in-volves de novo synthesis of its cargo and therefore coordinatedexpression of the corresponding genes. This is true in many celltypes including adrenal cortex cells (31, 32), pancreatic -cells(20, 21), Xenopus laevis pituitary cells (27), and Parameciumcells (16). In T. thermophila, 86 differential-display PCR prod-ucts appeared to increase in abundance during recovery fromexocytosis. Nineteen of these failed to detect transcripts byhybridization and may not correspond to expressed genes. Pre-liminary characterization of 11 of the 86 revealed that 3 werealready known in T. thermophila, 6 have likely homologues inother organisms, and 2 are novel. Expression of these genesappears linked to exocytosis, since they were not induced fol-lowing stimulation of exo� mutants. This linkage, however,may be indirect. For example, the increased transcription ofTER1, the endoplasmic reticulum (ER) retrieval receptorgene, may reflect demands on the secretory pathway imposedby DCG protein traffic in exo� strains (43). exo� cells under-going synchronous fusion of thousands of DCGs may also besubject to other homeostatic demands. Direct linkage, on theother hand, certainly accounts for transcriptional activation ofDCG cargo-encoding genes. It may also account for the in-creased expression of a putative Na-Ca exchanger, since such a

membrane-localized activity may be required for calcium de-pletion from immature DCGs, a step in the assembly of afunctional lattice (53).

In summary, DCGs in T. thermophila contain at least twoclasses of luminal cargo proteins. One is structural, insoluble,and essential for lattice expansion. The second, reported in thispaper, can be released in a soluble form upon exocytosis. Thecarboxy terminus of Igr1p shows homology to the P. tetraureliaPcmps, previously identified as cytoplasmic constituents (5).The Pcmps, like Igr1p, appear to have conserved two pairs ofcysteines within the carboxy-terminal domain, but conservationof paired cysteines is unlikely to occur in proteins resident inthe reducing environment of the cytoplasm. In contrast, thesecretory pathway in general and DCGs in particular have anoxidizing environment consistent with disulfide bond forma-tion. Additionally, the deduced Pcmp polypeptide sequencesalso hint that they may be present within vesicles. For the twoPcmps in which the amino terminus has been reported, at leastone appears to us to begin with an ER translocation signal(Pcm4p). Igr1p may therefore represent a family of proteinspresent as DCG cargo in ciliates. Last, the copackaging ofproteins with heterogeneous physicochemical properties, a fea-ture of DCGs in multicellular eukaryotes, appears to occur inciliates as well.

ACKNOWLEDGMENTS

This work was supported by NIH GM50946 to A.T. In addition,A.H. was supported by predoctoral training grant GM071836.

We thank D. Chilcoat, S. Melia, and M. Lacagna, as well as othermembers of the Turkewitz lab, for help and discussion, and Ted Steckfor careful review of the manuscript.

REFERENCES

1. Allen, S. L., M. I. Altschuler, P. J. Bruns, J. Cohen, F. P. Doerder, J. Gaertig,M. Gorovsky, E. Orias, and A. Turkewitz. 1998. Proposed genetic nomen-clature rules for Tetrahymena thermophila, Paramecium primaurelia and Par-amecium tetraurelia. Genetics 149:459–462.

2. Arvan, P., and D. Castle. 1998. Sorting and storage during secretory granulebiogenesis: looking backward and looking forward. Biochem. J. 332:593–610.

3. Blazquez, M., C. Thiele, W. B. Huttner, K. Docherty, and K. I. Shennan.2000. Involvement of the membrane lipid bilayer in sorting prohormoneconvertase 2 into the regulated secretory pathway. Biochem. J. 349:843–852.

4. Cassidy-Hanley, D., J. Bowen, J. H. Lee, E. Cole, L. A. VerPlank, J. Gaertig,M. A. Gorovsky, and P. J. Bruns. 1997. Germline and somatic transforma-tion of mating Tetrahymena thermophila by particle bombardment. Genetics146:135–147.

5. Chan, C. W., Y. Saimi, and C. Kung. 1999. A new multigene family encodingcalcium-dependent calmodulin-binding membrane proteins of Parameciumtetraurelia. Gene 231:21–32.

6. Chanat, E., U. Weiss, W. B. Huttner, and S. A. Tooze. 1993. Reduction of thedisulfide bond of chromogranin B (secretogranin I) in the trans-Golgi net-work causes its missorting to the constitutive secretory pathways. EMBO J.12:2159–2168.

7. Chilcoat, N. D., N. C. Elde, and A. P. Turkewitz. 2001. An antisense ap-proach to phenotype-based gene cloning in Tetrahymena. Proc. Natl. Acad.Sci. USA 98:8709–8713.

8. Chilcoat, N. D., S. M. Melia, A. Haddad, and A. P. Turkewitz. 1996. Granulelattice protein 1 (Grl1p), an acidic, calcium-binding protein in Tetrahymenathermophila dense-core secretory granules, influences granule size, shape,content organization, and release but not protein sorting or condensation.J. Cell Biol. 135:1775–1787.

9. Clout, N. J., C. Slingsby, and G. J. Wistow. 1997. Picture story. An eye oncrystallins. Nat. Struct. Biol. 4:685.

10. Cool, D. R., M. Fenger, C. R. Snell, and Y. P. Loh. 1995. Identification of thesorting signal motif within pro-opiomelanocortin for the regulated secretorypathway. J. Biol. Chem. 270:8723–8729.

11. Cool, D. R., E. Normant, F.-S. Shen, H.-C. Chen, L. Pannell, Y. Zhang, andY. P. Loh. 1997. Carboxypeptidase E is a regulated secretory pathway sortingreceptor: genetic obliteration leads to endocrine disorders in Cpefat mice.Cell 88:73–83.

12. Dannies, P. S. 1999. Protein hormone storage in secretory granules: mech-anisms for concentration and sorting. Endocr. Rev. 20:3–21.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

13. Ding, Y., A. Ron, and B. H. Satir. 1991. A potential mucus precursor inTetrahymena wild type and mutant cells. J. Protozool. 38:613–623.

14. Gaertig, J., and M. A. Gorovsky. 1992. Efficient mass transformation ofTetrahymena thermophila by electroporation of conjugants. Proc. Natl. Acad.Sci. USA 89:9196–9200.

15. Gaertig, J., T. H. Thatcher, K. E. McGrath, R. C. Callahan, and M. A.Gorovsky. 1993. Perspectives on tubulin isotype function and evolutionbased on the observation that Tetrahymena thermophila microtubules containa single alpha- and beta-tubulin. Cell Motil. Cytoskelet. 25:243–253.

16. Galvani, A., and L. Sperling. 2000. Regulation of secretory protein geneexpression in paramecium: role of the cortical exocytotic sites. Eur. J. Bio-chem. 267:3226–3234.

17. Gama, L., and G. E. Breitwieser. 1999. Generation of epitope-tagged pro-teins by inverse PCR mutagenesis. BioTechniques 26:814–816.

18. Gautier, M.-C., L. Sperling, and L. Madeddu. 1996. Cloning and sequenceanalysis of genes coding for Paramecium secretory granule (trichocyst) pro-teins. J. Biol. Chem. 271:10247–10255.

19. Glombik, M. M., A. Kromer, T. Salm, W. B. Huttner, and H. H. Gerdes.1999. The disulfide-bonded loop of chromogranin B mediates membranebinding and directs sorting from the trans-Golgi network to secretory gran-ules. EMBO J. 18:1059–1070.

20. Guest, P. C., E. M. Bailyes, N. G. Rutherford, and J. C. Hutton. 1991. Insulinsecretory granule biogenesis. Biochem. J. 274:73–78.

21. Guest, P. C., C. J. Rhodes, and J. C. Hutton. 1989. Regulation of thebiosynthesis of insulin-secretory-granule proteins. Co-ordinate translationalcontrol is exerted on some, but not all, granule matrix constituents. Biochem.J. 257:431–437.

22. Haddad, A., and A. P. Turkewitz. 1997. Analysis of exocytosis mutantsindicates close coupling between regulated secretion and transcription acti-vation in Tetrahymena. Proc. Natl. Acad. Sci. USA 94:10675–10680.

23. Harlow, E., and L. D. Lane. 1988. Immunoassays. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

24. Harumoto, T., and A. Miyake. 1991. Defensive function of trichocysts inParamecium. J. Exp. Zool. 260:84–92.

25. Hausmann, K. 1978. Extrusive organelles in protists Int. Rev. Cytol. 52:197–276.

26. Hausmann, K., and P. C. Bradbury (ed.). 1996. Ciliates, cells as organisms.Gustav Fischer, Stuttgart, Germany.

27. Holthuis, J. C., E. J. Jansen, M. C. van Riel, and G. J. Martens. 1995.Molecular probing of the secretory pathway in peptide hormone-producingcells. J. Cell Sci. 108:3295–3305.

28. Karrer, K. M. 2000. Tetrahymena genetics: two nuclei are better than one.Methods Cell Biol. 62:127–186.

29. Kelly, R. B. 1985. Pathways of protein secretion in eukaryotes. Science230:25–32.

30. Knoll, G., B. Haacke-Bell, and H. Plattner. 1991. Local trichocyst exocytosisprovides an efficient escape mechanism for Paramecium cells. Eur. J. Pro-tistol. 27:381–385.

31. Laslop, A., S. K. Mahata, M. Wolkersdorfer, M. Mahata, M. Srivastava,N. G. Seidah, R. Fischer-Colbrie, and H. Winkler. 1994. Large dense-corevesicles in rat adrenal after reserpine: levels of mRNAs of soluble andmembrane-bound constituents in chromaffin and ganglion cells indicate abiosynthesis of vesicles with higher secretory quanta. J. Neurochem. 62:2448–2456.

32. Laslop, A., C. Tschernitz, and C. Eiter. 1994. Biosynthesis of proteins oflarge dense-core vesicles in rat PC12 cells: regulation by forskolin and phor-bol ester. Neuroscience 59:477–485.

33. Liang, P., and A. B. Pardee. 1998. Differential display. A general protocol.Mol. Biotechnol. 10:261–267.

34. Madeddu, L., M.-C. Gautier, L. Vayssie, A. Houari, and L. Sperling. 1995. A

large multigenic family codes for the polypeptides of the crystalline tricho-cyst matrix in Paramecium. Mol. Biol. Cell 6:649–659.

35. Madeddu, L., M. C. Gautier, J. P. Le Caer, N. Garreau de Loubresse, and L.Sperling. 1994. Protein processing and morphogenesis of secretory granulesin Paramecium. Biochimie 76:329–335.

36. Melia, S. M., E. S. Cole, and A. P. Turkewitz. 1998. Mutational analysis ofregulated exocytosis in Tetrahymena. J. Cell Sci. 111:131–140.

37. Michael, J., R. Carroll, H. H. Swift, and D. F. Steiner. 1987. Studies on themolecular organization of rat insulin secretory granules. J. Biol. Chem.262:16531–16535.

38. Molinete, M., J. C. Irminger, S. A. Tooze, and P. A. Halban. 2000. Traffick-ing/sorting and granule biogenesis in the beta-cell. Semin. Cell Dev. Biol.11:243–251.

39. Nanavati, C., and J. M. Fernandez. 1993. The secretory granule matrix: afast-acting smart polymer. Science 259:963–965.

40. Natori, S., and W. B. Huttner. 1996. Chromogranin B (secretogranin I)promotes sorting to the regulated secretory pathway of processing interme-diates derived from a peptide hormone precursor. Proc. Natl. Acad. Sci.USA 93:4431–4436.

41. Orias, E., and P. J. Bruns. 1976. Induction and isolation of mutants inTetrahymena. Methods Cell Biol. 13:247–282.

42. Orias, E., M. Flacks, and B. H. Satir. 1983. Isolation and ultrastructuralcharacterization of secretory mutants of Tetrahymena thermophila. J. Cell Sci.64:49–67.

43. Pelham, H. R. 1996. The dynamic organisation of the secretory pathway.Cell. Struct. Funct. 21:413–419.

44. Rahaminoff, R., and J. M. Fernandez. 1997. Pre- and postfusion regulationof transmitter release. Neuron 18:17–27.

45. Roy, P., D. Chevrier, H. Fournier, C. Racine, M. Zollinger, P. Crine, and G.Boileau. 1991. Investigation of a possible role of the amino-terminal pro-region of proopiomelanocortin in its processing and targeting to secretorygranules. Mol. Cell. Endocrinol. 82:237–250.

46. Ruiz, F., L. Vayssie, C. Klotz, L. Sperling, and L. Madeddu. 1998. Homol-ogy-dependent gene silencing in Paramecium. Mol. Biol. Cell 9:931–943.

47. Slingsby, C., and N. J. Clout. 1999. Structure of the crystallins. Eye 13:395–402.

48. Steers, E., Jr., J. Beisson, and V. T. Marchesi. 1969. A structural proteinextracted from the trichocysts of Paramecium aurelia. Exp. Cell Res. 57:392–396.

49. Thiele, C., and W. B. Huttner. 1998. The disulfide-bonded loop of chromo-granins, which is essential for sorting to secretory granules, mediates ho-modimerization. J. Biol. Chem. 273:1223–1231.

50. Tooze, S. A. 1998. Biogenesis of secretory granules in the trans-Golgi net-work of neuroendocrine and endocrine cells. Biochim. Biophys. Acta 1404:231–244.

51. Turkewitz, A. P., N. D. Chilcoat, A. Haddad, and J. W. Verbsky. 2000.Regulated protein secretion in Tetrahymena thermophila. Methods CellBiol. 62:347–362.

52. Turkewitz, A. P., L. Madeddu, and R. B. Kelly. 1991. Maturation of densecore granules in wild type and mutant Tetrahymena thermophila. EMBO J.10:1979–1987.

53. Verbsky, J. W., and A. P. Turkewitz. 1998. Proteolytic processing and Ca2�-binding activity of dense-core vesicle polypeptides in Tetrahymena. Mol. Biol.Cell 9:497–511.

54. Von Heijne, G. 1985. Signal sequences: the limits of variation. J. Mol. Biol.184:99–105.

55. Winkler, H. 1993. The adrenal chromaffin granule: a model for large densecore vesicles of endocrine and nervous tissue. J. Anat. 183:237–252.

56. Zhang, C. F., C. R. Snell, and Y. P. Loh. 1999. Identification of a novelprohormone sorting signal-binding site on carboxypeptidase E, a regulatedsecretory pathway-sorting receptor. Mol. Endocrinol. 13:527–536.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

new class of cargo protein in tetrahymena thermophila ... · to detect new granule proteins, we...

Documents