new tricks from an old cow: infective endocarditis caused...
TRANSCRIPT
1
New tricks from an old cow: Infective endocarditis caused by Streptococcus 1
dysgalactiae subsp. dysgalactiae 2
3
Stina Jordal a, Marte Glambek b, Oddvar Oppegaard c, Bård Reiakvam Kittang b, d # 4
Department of Microbiology, Haukeland University Hospital, Bergen, Norway a, 5
Department of Medicine, Haraldsplass Deaconess Hospital, Bergen, Norway b, 6
Department of Medicine, Haukeland University Hospital, Bergen, Norway c, and 7
Department of Clinical Science, University of Bergen, Bergen, Norway d 8
9
Running title: Streptococcus dysgalactiae subsp. dysgalactiae endocarditis 10
11
# Address correspondence to Bård Reiakvam Kittang, [email protected] 12
13
14
15
16
17
18
19
20
JCM Accepts, published online ahead of print on 3 December 2014J. Clin. Microbiol. doi:10.1128/JCM.02437-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
2
CASE REPORTS 21
22
New tricks from an old cow: Infective endocarditis caused by Streptococcus 23
dysgalactiae subsp. dysgalactiae 24
We present a case of infective endocarditis caused by Streptococcus dysgalactiae subsp. 25
dysgalactiae; a major cause of bovine mastitis and previously thought to be an animal 26
restricted pathogen. The patient reported no direct contact with animals, and the clinical 27
course was severe and complicated. 28
29
30
A sixty-five year old male patient was admitted to Haukeland University Hospital in 31
western Norway with radiating pain in his left shoulder, fever and muscle ache. One 32
month earlier he had been admitted to a hospital in Spain with similar symptoms but 33
was rapidly discharged with a diagnosis of shoulder tendinitis. He had a family history of 34
sudden cardiac death, and his previous medical history included hypertrophic 35
obstructive cardiomyopathy and a normal coronary angiography seven years prior to 36
the actual admission. 37
Upon admission he had a pulse rate of 100/min., a temperature of 39 °C and a 38
respiratory frequency of 24/min, thus fulfilling the criteria of Systemic inflammatory 39
response syndrome (SIRS). He was pale, with a blood pressure of 118/59 mmHg, and a 40
holosystolic murmur was heard at the apex. No local signs of infection were observed 41
over his left shoulder. 42
The initial blood chemistry results were as follows, with normal range values in 43
parentheses: Hemoglobin 8.5 g/dl (13.4 – 17.0) , C-reactive protein 277 mg/l (<5), 44
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
3
leucocytes 20.8 x 10 9 /l (3.5 – 11.0) , neutrophils 18.5 x 10 9 /l (1.7 – 8.2), 45
sedimentation rate 102 mm/h (0-20), procalcitonin 12.1 µg/L (<0,10) and troponin T 46
896 ng/l (<25). Thrombocytes were within normal range. The electrocardiogram (ECG) 47
demonstrated ST-segment elevation in leads V1-V2 and T-inversion in leads V4-V6 48
indicative of ischemia. 49
Antibiotic therapy was started on day one, and included meropenem and vancomycin. 50
A broader initial regimen than recommended in the Norwegian National Antibiotic 51
Guidelines was chosen since the patient had recently been admitted to hospital in Spain. 52
The following day all four blood cultures grew non-hemolytic bacteria on blood agar. 53
Species identification was performed using MALDI-TOF MS, and showed that the isolate 54
was Streptococcus dysgalactiae. Subsequently, group C carbohydrate specificity was 55
documented using a slide agglutination test (Oxoid, Cambridge, UK). The antimicrobial 56
susceptibility testing showed that the GCS was fully susceptible to all tested antibiotics, 57
with the following minimal inhibitory concentrations (mg/l): penicillin-G 0.008, 58
ceftriaxone< 0.016, clindamycin 0.25, vancomycin 0.25, teicoplanin 0.25 and linezolid 1. 59
A more thorough anamnestic interview revealed a history of weight loss of 6 kg, 60
bloody stools, increasing pain in the left shoulder and inaccuracy of vision. On 61
examination he had no peripheral vascular phenomena indicative of septic embolization. 62
He was delirious and hallucinated. 63
Infective endocarditis (IE) with possible septic embolization to the brain and left 64
shoulder was suspected. Since ceftriaxone penetrates the blood brain barrier better than 65
penicillin, the antimicrobial treatment was subsequently changed to ceftriaxone in 66
combination with gentamicin. Transthoracic echocardiography (TTE) confirmed the 67
clinical suspicion of IE and revealed a vegetation on the anterior mitral cusp. MRI of the 68
brain and left shoulder showed septic embolization to both cerebral and cerebellar 69
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
4
hemispheres as well as fluid in left subdeltoideal bursa. Abdominal CT scan performed 70
after ten days confirmed embolization to the spleen after which clindamycin was 71
temporarily added to the antimicrobial regimen for two weeks to optimize abscess 72
penetration. 73
During the treatment course, a colonoscopy was performed due to persistent bloody 74
stools, and revealed a malignant tumor in the rectum. 75
Subsequent examinations with TTE and transesophageal echocardiography revealed 76
an increasing mitral insufficiency, a vegetation on the aortic valve and a severe aortic 77
insufficiency grade III-IV. Cardiac CT showed normal coronary arteries and a significant 78
difference in heart-minute volume (5 l/min in left ventricle, 7.8 l/min right ventricle), 79
confirming severe valve insufficiencies on the left side of the heart. It thus became clear 80
that surgical replacement of the valves was needed. However, the persisting bleeding 81
from his rectal tumor maintained anemia and inoperable conditions. Radiation therapy 82
was successfully reducing the bleeding from his rectal tumor and treatment with 83
recombinant human erythropoietin helped correcting his anemia. 84
Two months after admission, he suffered from a fulminant pulmonary edema and 85
underwent acute, life-saving thoracic surgery with both biological aortic and mitral 86
valve replacement. Aortic perivalvular abscess formation was also documented and 87
debrided. Cultures were performed on the excised aortic and mitral valves, without 88
bacterial growth. Unfortunately, direct 16rRNA sequencing on the valve specimens was 89
not performed. The patient rapidly recovered after surgery and received intravenous 90
antibiotic therapy during the first six post-operative weeks. 91
Four months after admission his rectal tumor, a differentiated adenocarcinoma, was 92
radically resected, with acute complications causing re-operation after which his 93
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
5
hemoglobin level was 3, 3 g/dl at the lowest. His temporary ileostomy was removed six 94
months later without further complications. 95
He was followed on an outpatient basis for 18 months, with no clinical or 96
echocardiographic signs of recurring endocarditis. 97
98
The GCS isolate (T534) was stored on Greaves medium at – 80 ° C until further testing. 99
Lack of hemolysis on blood agar, along with the MALDI-TOF MS species identification, 100
could indicate that this strain did not belong to Streptococcus dysgalactiae subsp. 101
equisimilis (SDSE), which, together with Streptococcus belonging to the Anginosus group 102
are responsible for the vast majority of human GCS infections (3,6,19). In order to assign 103
correct streptococcal subgroup, the isolate was therefore subjected to selected 104
molecular analyses: 105
First, 16S rRNA sequencing was performed with the following primers: 5’-CGG-CCC-106
AGA-CTC-CTA-CGG-GAG-GCW-GCA - 3’ (F-primer) and 5’-GCG-TGG-ACT-ACC-AGG-GTA-107
TCT-AAK-CC - 3’ (R-primer), under previously reported PCR conditions (9). This 108
analysis confirmed that T534 was of the species Streptococcus dysgalactiae, with 99.7 % 109
and 99.6% homology to SDSE and Streptococcus dysgalactiae subsp. dysgalactiae 110
(SDSD), respectively. However, neither MALDI-TOF MS nor 16S rRNA sequencing could 111
separate SDSD from SDSE. 112
Next, we performed targeted PCR on genes or gene segments previously reported to be 113
frequently present in SDSE-isolates associated with human infections, and not in isolates 114
belonging to SDSD; namely genes encoding streptokinase (ska), streptolysin O (slo), C5 a 115
peptidase (scpA) (5), along with surface lipoprotein DppA (dppA), immunogenic 116
secreted protein (isp) and laminin-binding protein (lmb) (15). As shown in table 1, none 117
of those genes were detected in T534. Six SDSE-isolates associated endocarditis in 118
western Norway were also tested, and all were PCR- positive for those six genes. 119
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
6
Based on the whole-genome sequence of a SDSD strain ATCC 27957 associated with 120
bovine udder infection (17), primers targeting the rihC- gene were constructed, since a 121
BLAST search of the rihC- sequence from this particular SDSD showed that it lacks 122
significant homology with genes from streptococcal isolates associated with human 123
infections. 124
T534 possessed a rihC-gene, and the DNA sequence showed 100 % homology to that of 125
the rihC-gene in SDSD from fish. 126
Finally, a multilocus sequence analysis (MLSA) scheme consisting of the seven 127
housekeeping genes map, pfl, ppaC, pyk, rpoB, sodA and tuf was used, with primers and 128
thermal profiles as previously described (1,6). A BLAST search of the trimmed 129
consensus sequences of all these seven genes showed that T354 had identical MLSA 130
profile with Streptococcus dysgalactiae subsp. dysgalactiae strain CCUG 27439, isolated 131
from cow (6). 132
133
SDSD has until lately been regarded as an animal restricted pathogen, and is a principal 134
cause of bovine mastitis (14). SDSD has also shown the ability to cause severe cellulitis 135
and toxic shock syndrome in cattle (4), septicemia in fish and dogs (12,20) and infective 136
arthritis in sheep (16). To our knowledge, SDSD possesses either Lancefield group 137
antigen C or L, and most often grow large colonies with surrounding alpha-hemolysis, or 138
lack of hemolysis, on blood agar (6,19). Human GCS infections, however, are most often 139
caused by beta-hemolytic SDSE, or more rarely Streptococcus belonging to the 140
Anginosus group, with a wide range of clinical manifestations, including severe soft 141
tissue infections, primary bacteremia, osteomyelitis, arthritis, pneumonia, meningitis, 142
peritonitis, toxic shock syndrome and endocarditis (3). 143
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
7
The incidence of infective endocarditis (IE) appears to be rising. In the United States, a 144
2.4 % annual increase in admission rate of IE from 1998-2009 was documented, leading 145
to an incidence rate of 12.7 per 100.000 inhabitants in 2009 (2). Approximately 70 % of 146
the cases of IE occur on native valves, the mitral and aortic valves are most often 147
affected. IE is caused by either Staphylococcus aureus or viridans group streptococci in 148
around 50 % of the cases (11), whereas IE caused by GCS belonging to SDSE is indeed a 149
rarity (3,7,18). To our knowledge, SDSD has never been associated with human carriage, 150
and infection possibly caused by this bacterium has previously only been reported 151
twice: 152
SDSD was associated with a prosthetic joint infection after total knee arthroplasty in a 153
case report from Korea. However, the mode of species identification of this bacterial 154
isolate was not described (13). Furthermore, SDSD was associated with cellulitis in a 155
patient with a poking injury of a finger after handling raw fish (8). The species 156
identification in this study was based on the results from API STREP 20, along with 157
partial sequencing of the 16s rRNA and sodA genes; none of which unequivocally 158
discriminates SDSD from SDSE (6). 159
Our patient fulfilled the modified Duke Criteria for definitive endocarditis (10), with 160
one major criteria (evidence of endocardial involvement) and four minor criteria 161
(microorganism consistent with IE, predisposing heart disease, fever and septic 162
embolization). The identification of this particular GCS endocarditis isolate as SDSD 163
relied on a combination of phenotypic characteristics, MALDI-TOF MS and 16s rRNA 164
analysis, virtually excluding other pathogens than SDSD and SDSE, along with the lack of 165
virulence genes typically present in SDSE, namely ska, slo, scpA, dppA, isp and lmb (5,15), 166
the presence of rihC, previously only identified in SDSD, and finally an MLSA profile 167
exactly matching that of an SDSD strain derived from cow. 168
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
8
This case illustrates the zoonotic potential of SDSD. Despite a thorough, retrospective 169
interview on animal exposure, the clinical history of the patient did not reveal the source 170
and mode of transmission of the bacterium. The clinical course was complicated, and it 171
cannot be excluded that his concurrent malignancy contributed to the severity of the 172
infection. 173
We have not yet any molecular data that can explain the virulence of our SDSD-strain. 174
A recent study, comparing the genome content of one SDSD and two SDSE showed a high 175
degree of genetic similarity between them, and the presence of two putative phages in 176
SDSD with homology to M3 GAS prophages, carrying possible virulence genes like 177
hyaluronidase and streptodornase (17). That particular SDSD isolate also possessed 178
putative integrative and conjugative (ICE) elements, which are known to be particularly 179
abundant in S. agalactiae, another major agent of bovine mastitis. Hence, it appears that 180
SDSD can accommodate both phages and ICEs from related streptococcal species, which 181
might be crucial in the development of virulence attributes. 182
In conclusion, this first documented case of human bacteremia and endocarditis 183
caused by SDSD calls for a broader molecular analysis of the bacterial isolate in order to 184
explore the zoonotic potential and virulence of this pathogen. 185
186
187
188
189
190
191
192
193
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
9
Reference List 194
195
1. Bishop, C. J., D. M. Aanensen, G. E. Jordan, M. Kilian, W. P. Hanage, and B. G. 196
Spratt. 2009. Assigning strains to bacterial species via the internet. BMC.Biol. 7:3. 197
doi:1741-7007-7-3 [pii];10.1186/1741-7007-7-3 [doi]. 198
2. Bor, D. H., S. Woolhandler, R. Nardin, J. Brusch, and D. U. Himmelstein. 2013. 199
Infective endocarditis in the U.S., 1998-2009: a nationwide study. PLoS.One. 200
8:e60033. doi:10.1371/journal.pone.0060033 [doi];PONE-D-12-37257 [pii]. 201
3. Broyles, L. N., B. C. van, B. Beall, R. Facklam, P. L. Shewmaker, P. Malpiedi, P. 202
Daily, A. Reingold, and M. M. Farley. 2009. Population-Based Study of Invasive 203
Disease Due to beta-Hemolytic Streptococci of Groups Other than A and B. 204
Clin.Infect.Dis. 48:706-712. 205
4. Chenier, S., M. Leclere, S. Messier, and G. Fecteau. 2008. Streptococcus 206
dysgalactiae cellulitis and toxic shock like syndrome in a Brown Swiss cow. 207
J.Vet.Diagn.Invest 20:99-103. doi:20/1/99 [pii]. 208
5. Ikebe, T., S. Murayama, K. Saitoh, S. Yamai, R. Suzuki, J. Isobe, D. Tanaka, C. 209
Katsukawa, A. Tamaru, A. Katayama, Y. Fujinaga, K. Hoashi, and H. 210
Watanabe. 2004. Surveillance of severe invasive group-G streptococcal 211
infections and molecular typing of the isolates in Japan. Epidemiol.Infect. 212
132:145-149. 213
6. Jensen, A. and M. Kilian. 2012. Delineation of Streptococcus dysgalactiae, its 214
subspecies, and its clinical and phylogenetic relationship to Streptococcus 215
pyogenes. J.Clin.Microbiol. 50:113-126. doi:JCM.05900-11 216
[pii];10.1128/JCM.05900-11 [doi]. 217
7. Kittang, B. R., T. Bruun, N. Langeland, H. Mylvaganam, M. Glambek, and S. 218
Skrede. 2011. Invasive group A, C and G streptococcal disease in western 219
Norway: virulence gene profiles, clinical features and outcomes. 220
Clin.Microbiol.Infect. 17:358-364. doi:CLM3253 [pii];10.1111/j.1469-221
0691.2010.03253.x [doi]. 222
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
10
8. Koh, T. H., L. H. Sng, S. M. Yuen, C. K. Thomas, P. L. Tan, S. H. Tan, and N. S. 223
Wong. 2009. Streptococcal cellulitis following preparation of fresh raw seafood. 224
Zoonoses.Public Health 56:206-208. doi:JVB1213 [pii];10.1111/j.1863-225
2378.2008.01213.x [doi]. 226
9. Kommedal, O., K. Kvello, R. Skjastad, N. Langeland, and H. G. Wiker. 2009. 227
Direct 16S rDNA sequencing from clinical specimens with special focus on poly-228
bacterial samples and interpretation of mixed DNA chromatograms. 229
J.Clin.Microbiol. 230
10. Li, J. S., D. J. Sexton, N. Mick, R. Nettles, V. G. Fowler, Jr., T. Ryan, T. Bashore, 231
and G. R. Corey. 2000. Proposed modifications to the Duke criteria for the 232
diagnosis of infective endocarditis. Clin.Infect.Dis. 30:633-638. doi:CID990870 233
[pii];10.1086/313753 [doi]. 234
11. Murdoch, D. R., G. R. Corey, B. Hoen, J. M. Miro, V. G. Fowler, Jr., A. S. Bayer, A. 235
W. Karchmer, L. Olaison, P. A. Pappas, P. Moreillon, S. T. Chambers, V. H. 236
Chu, V. Falco, D. J. Holland, P. Jones, J. L. Klein, N. J. Raymond, K. M. Read, M. 237
F. Tripodi, R. Utili, A. Wang, C. W. Woods, and C. H. Cabell. 2009. Clinical 238
presentation, etiology, and outcome of infective endocarditis in the 21st century: 239
the International Collaboration on Endocarditis-Prospective Cohort Study. 240
Arch.Intern.Med. 169:463-473. doi:169/5/463 241
[pii];10.1001/archinternmed.2008.603 [doi]. 242
12. Netto, L. N., C. A. Leal, and H. C. Figueiredo. 2011. Streptococcus dysgalactiae as 243
an agent of septicaemia in Nile tilapia, Oreochromis niloticus (L.). J.Fish.Dis. 244
34:251-254. doi:10.1111/j.1365-2761.2010.01220.x [doi]. 245
13. Park, M. J., I. S. Eun, C. Y. Jung, Y. C. Ko, Y. J. Kim, C. K. Kim, and E. J. Kang. 246
2012. Streptococcus dysgalactiae subspecies dysgalactiae infection after total 247
knee arthroplasty: a case report. Knee.Surg.Relat Res. 24:120-123. 248
doi:10.5792/ksrr.2012.24.2.120 [doi]. 249
14. Rato, M. G., R. Bexiga, C. Florindo, L. M. Cavaco, C. L. Vilela, and I. Santos-250
Sanches. 2013. Antimicrobial resistance and molecular epidemiology of 251
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
11
streptococci from bovine mastitis. Vet.Microbiol. 161:286-294. doi:S0378-252
1135(12)00445-2 [pii];10.1016/j.vetmic.2012.07.043 [doi]. 253
15. Rato, M. G., A. Nerlich, R. Bergmann, R. Bexiga, S. F. Nunes, C. L. Vilela, I. 254
Santos-Sanches, and G. S. Chhatwal. 2011. Virulence gene pool detected in 255
bovine group C Streptococcus dysgalactiae subsp. dysgalactiae isolates by use of 256
a group A S. pyogenes virulence microarray. J.Clin.Microbiol. 49:2470-2479. 257
doi:JCM.00008-11 [pii];10.1128/JCM.00008-11 [doi]. 258
16. Rutherford, S. J., A. N. Rycroft, and A. L. Ridler. 2014. Sources of Streptococcus 259
dysgalactiae in English and Welsh sheep flocks affected by infectious arthritis 260
(joint ill). Vet.Rec. 174:579. doi:vr.101753 [pii];10.1136/vr.101753 [doi]. 261
17. Suzuki, H., T. Lefebure, M. J. Hubisz, P. P. Bitar, P. Lang, A. Siepel, and M. J. 262
Stanhope. 2011. Comparative genomic analysis of the Streptococcus dysgalactiae 263
species group: gene content, molecular adaptation, and promoter evolution. 264
Genome Biol.Evol. doi:evr006 [pii];10.1093/gbe/evr006 [doi]. 265
18. Takahashi, T., K. Sunaoshi, K. Sunakawa, S. Fujishima, H. Watanabe, and K. 266
Ubukata. 2010. Clinical aspects of invasive infections with Streptococcus 267
dysgalactiae ssp. equisimilis in Japan: differences with respect to Streptococcus 268
pyogenes and Streptococcus agalactiae infections. Clin.Microbiol.Infect. 16:1097-269
1103. doi:CLM3047 [pii];10.1111/j.1469-0691.2009.03047.x [doi]. 270
19. Vandamme, P., B. Pot, E. Falsen, K. Kersters, and L. A. Devriese. 1996. 271
Taxonomic study of lancefield streptococcal groups C, G, and L (Streptococcus 272
dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov. 273
Int.J.Syst.Bacteriol. 46:774-781. 274
20. Vela, A. I., E. Falsen, I. Simarro, E. Rollan, M. D. Collins, L. Dominguez, and J. F. 275
Fernandez-Garayzabal. 2006. Neonatal mortality in puppies due to bacteremia 276
by Streptococcus dysgalactiae subsp. dysgalactiae. J.Clin.Microbiol. 44:666-668. 277
doi:44/2/666 [pii];10.1128/JCM.44.2.666-668.2006 [doi]. 278
279
280
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Primer target Annealing Primer sequence (5`-3`) Gene Reference
temperature (°C) SDSD*
T534 T111 T277 T315 T422 T481 T527
ska (forward) AGTCCAAAATCAAAACCATT
ska (reverse) AAATTCTTGGACAGGTTGGG
slo (forward) CTTATCCTATTTCATACAC
slo (reverse) TACTTATAAGTAATCGAACC
scpA (forward) CCATTTGATAAACTTGC
scpA (reverse) TTAATCACCTTAGCTCCC
dppA (forward) CCGTTATGGAGTCCACAATGAA
dppA (reverse) ACTAGCTTTGAGTTTAATAGTAATC
isp (forward) CAACTGAAAAAACCCCAGAGCC
isp (reverse) GGTTGAAGTCAAAGGCACCATAA
lmb (forward) AACCCCAAACAGCCTACGCAAG
lmb (reverse) TAAAACGGGATCCGTCCAGGTAT
rihC (forward) AGGTATTGATGACGCTACTGCT
rihC (reverse) TGAAACAGGTTCGTAGGCTGA
** Six beta-hemolytic group G streptocci associated with infective endocarditis in western Norway. All possessed emm genes belonging to emm types typical of SDSE.
SDSE**
Streptococcals subspecies
TABLE 1. Primer sequences used in PCR and presence of selected genes in SDSD and SDSE endocarditis isolates
52
52
-ska
slo
+
+
+
+
+
+
+
+
58
58
58
58
52
-
+ -
+
scpA
dppA
isp
lmb
rihC
+
+
+
-
-
-
-
+
+
+
+
-
+
+
+
+
-
+
+
+
+
- -
+
+
+
+
+
* One non-hemolytic group C streptococcus belonging to SDSD, emm - nontypeable
15
This study
5
5
5
15
15
+
-
+
+
+
+
+
+
on June 13, 2018 by guesthttp://jcm
.asm.org/
Dow
nloaded from