Evaluation of targetednext-generation sequencing–basedpreimplantation genetic diagnosisof monogenic disease

Nathan R. Treff, Ph.D.,a,b,c Anastasia Fedick, B.S.,a,b Xin Tao, M.S.,a Batsal Devkota, Ph.D.,a

Deanne Taylor, Ph.D.,a,c and Richard T. Scott Jr., M.D.a,c

a Reproductive Medicine Associates of New Jersey, Morristown, New Jersey; b Molecular Genetics, Microbiology andImmunology, and c Obstetrics, Gynecology, and Reproductive Sciences, University of Medicine and Dentistry of NewJersey–Robert Wood Johnson Medical School, New Brunswick, New Jersey

Objective: To investigate the applicability of next-generation sequencing (NGS) to preimplantation genetic diagnosis (PGD); toevaluate semiconductor-based NGS for genetic analysis of human embryos.Design: Blinded.Setting: Academic center for reproductive medicine.Patient(s): Six couples at risk of transmitting single-gene disorders to their offspring.Intervention(s): None.Main Outcome Measure(s): Embryonic genotype consistency of NGS with two independent conventional methods of PGD.Result(s): NGS provided 100% equivalent PGD diagnoses of compound point mutations and small deletions and insertions comparedwith both reference laboratory– and internally developed quantitative polymerase chain reaction (qPCR)–based analyses. Furthermore,NGS single-gene disorder screening could be performed in parallel with qPCR-based comprehensive chromosome screening.Conclusion(s): NGS can provide blastocyst PGD results with a high level of consistency with establishedmethodologies. This study and its

Use your smartphone

design could serve as a model for further development of this important and emerging technology.(Fertil Steril� 2013;99:1377–84. �2013 by American Society for Reproductive Medicine.)Key Words: Next-generation sequencing, preimplantation genetic diagnosis, monogenicdisorder, genotyping, aneuploidy screening

Discuss: You can discuss this article with its authors and with other ASRM members at http://fertstertforum.com/treffnr-next-generation-sequencing-based-preimplantation-genetic-diagnosis/

to scan this QR codeand connect to thediscussion forum forthis article now.*

* Download a free QR code scanner by searching for “QRscanner” in your smartphone’s app store or app marketplace.

reimplantation genetic diagnosis high-risk couples for more than two that provides unprecedented high-

P (PGD) of monogenic disordershas been successfully applied to

Received August 31, 2012; revised December 4, 2012January 9, 2013.

N.R.T. reports payment for lectures from American Snese Society for Reproduction (JSAR), Penn StatClinic, Applied Biosystems, Texas Assisted Reprociation of Bioanalysts (AAB); payment for deASRM; and patents pending (all outside of this wing to disclose. B.D. has nothing to disclose. D.Tfor lectures from ASRM, Midwest ReproductiveEngland Fertility Society, Drexel University Colleeration of Gynecology and Obstetrics, Emory Ucine, Brigham and Women's Hospital, CanadianCouncil of Physicians and Scientists, University oGeneral Hospital; payment for development of eof Medicine and Dentistry of New Jersey, and Frents pending (all outside of this work).

Reprint requests: Nathan R. Treff, Ph.D., RMA of Netown, New Jersey 07960 (E-mail: ntreff@rmanj.

Fertility and Sterility® Vol. 99, No. 5, April 2013 001Copyright ©2013 American Society for Reproductivehttp://dx.doi.org/10.1016/j.fertnstert.2012.12.018

VOL. 99 NO. 5 / APRIL 2013

decades (1). Next-generation sequenc-ing (NGS) is an emerging technology

; accepted December 7, 2012; published online

ociety for Reproductive Medicine (ASRM), Japa-e University, Washington State University, Mayoductive Technology Society, and American Asso-velopment of educational presentations fromork). A.F. has nothing to disclose. X.T. has noth-. has nothing to disclose. R.T.S. reports paymentSociety, Pacific Coast Reproductive Society, Newge of Medicine, Mayo Clinic, International Fed-niversity, Jones Institute for Reproductive Medi-Fertility and Andrology Society, IVF-ET Society,f Florida, Stamford Hospital, and Massachusettsducational presentations fromASRM,Universityontiers in Reproductive Endocrinology; and pat-

w Jersey, 111 Madison Ave., Suite 100, Morris-com).

5-0282/$36.00Medicine, Published by Elsevier Inc.

throughput, highly parallel, andbase-pair resolution data for geneticanalysis, but it has yet to be developedfor application to PGD. The parallelnature of NGS data provides a uniqueopportunity to evaluate multiple cus-tomizable genomic loci and multiplesamples on one chip. Furthermore,DNA from embryos from different pa-tients requiring sequence data in com-pletely different genomic loci could beevaluated on the same sequencingchip, all with the use of standard DNAbarcoding methodologies (2). Thesefeatures of NGS might also be usefulfor simultaneous evaluation of aneu-ploidy, single-gene disorders (SGDs),and translocations from the same

1377

ORIGINAL ARTICLE: GENETICS

biopsy without the need for multiple unique technologicalplatforms.

Clinical studies within other settings have already beenconducted using NGS technology (3, 4), as well as high-throughput studies used to target specific sequence variants(5). Many sequencing platforms exist that are capable ofNGS with varying degrees of sequence depth, coverage, andthroughput (6). Despite the potential power to increasethroughput and evaluate multiple genetic loci in parallel, itis also well known that NGS technology can introduce se-quencing artifacts (technical errors) which may complicateits application to PGD. For example, insufficient sequencingdepth may result in false positive or negative identificationof a mutation. Sequence depth refers to the number of re-peated sequence reads at a given position in the genome, orin other words, how many times a particular base was suc-cessfully measured. Depth at a given position is often de-scribed in terms such as 100� or 200�, referring to havingrepeatedly observed and assigned a base at a given position100 or 200 times, respectively. As depth of sequence in-creases, so does the accuracy in predicting the genotype ofthe sample at the given position. Likewise, lower sequencingdepth may lead to decreased accuracy. For example, if 10�depth is achieved and two reads indicate an A and eight readsa T then there is a lower likelihood of the A being true than ifthe depth achieved was 100�, and 20 reads indicated an Aand 80 reads a T. Therefore, sufficient sequence depth maybe a critical component to providing the necessary accuracywhen applying NGS to PGD. Furthermore, adaptation ofNGS to limited starting material, such as that obtainedfrom an embryo biopsy, will be critical to establish its utilityin PGD.

To investigate the applicability of NGS to PGD, the pres-ent study developed a specific protocol that could evaluateDNA from a trophectoderm biopsy with the use of semicon-ductor technology–based NGS (7). This protocol was also de-signed to provide what was hypothesized to be a more thansufficient sequencing depth to achieve accurate sequence pre-dictions. Furthermore, the NGS-based genotype predictionsdeveloped in this study were directly compared with resultsfrom the same embryos with the use of two independentand more conventional methods of PGD.

MATERIALS AND METHODSExperimental Design

Excess blinded DNA from embryos and/or lymphocytes de-rived from IVF-PGD cycles of couples at risk of transmittingcystic fibrosis (CF), Walker-Warburg syndrome (WWS), fa-milial dysautonomia (FD), X-linked hypophosphatemic rick-ets (XHR), or neurofibromatosis 1 (NF1) to their offspringwas evaluated by NGSwith the use of the Ion Torrent PersonalGenome Machine (PGM) (Life Tech). Taqman allelic discrimi-nation assays designed for each mutation (Table 1) were alsorun on blinded excess DNA from the same samples. Finally,results obtained from external PGD reference laboratories(Genesis Genetics Institute [Detroit] and Reproductive Genet-ics Institute [Chicago]) from the same embryos were un-blinded and all three independent methods evaluated for

1378

consistency. A flow chart of sample processing for lympho-cytes and embryos is shown in Supplemental Figure 1 (avail-able online at www.fertstert.org).

Lymphocyte DNA

Three cases where lymphocytes were available for analysiswere included. The first case involved two patients witha risk of transmitting FD because both the female and malepartners were known to be carriers of the IVS20þ6T>C mu-tation in the IKBKAP gene. In the second case, the couple wasat risk of transmitting XHR because the male partner washemizygous for the G649D mutation in the PHEX gene. Inthe third case, the couple was at risk of transmitting NF1 be-cause the female partner carried the c.1318C>T mutation inthe NF1 gene.

In each of the three cases, two 5-mL blood samples werereceived per patient. DNA was purified from the first bloodsample with the use of the QIAamp DNA Blood Maxi Kit (Qia-gen) and used to validate the Taqman allelic discriminationassays. The sample concentrations were obtained via Nano-drop (Thermo Fisher Scientific). Lymphocyte samples (fivelymphocytes per sample to model a trophectoderm biopsy)were then obtained as previously described (8) from the sec-ond blood sample. Four replicates of these five-lymphocytesamples were lysed and preamplified with a primer pool con-sisting of previously described assays to interrogate aneu-ploidy (8) and the assay targeting the mutation for eachpatient (Table 1). The preamplification samples were thengenotyped with the use of quantitative polymerase chainreaction (qPCR) and Taqman allelic discrimination. The ex-cess preamplification samples were then used to sequenceeach patient on the PGM.

Blastocyst Trophectoderm DNA

Three cases where excess embryo biopsy DNA was availablefor analysis were included. The first case involved a coupleat risk of transmitting CF because the female partner carriedthe DF508 CFTR mutation and the male partner carried theDI507 CFTR mutation. In the second case, the female partnercarried the W1282X CFTR mutation and the male partner car-ried the D1152H CFTR mutation. In the third case, the couplewas at risk of having children affected with WWS becauseboth partners carried the c.1167insA mutation in the FKTNgene.

In each of the three cases, two trophectoderm biopsieswere obtained from each blastocyst, one for SGD screeningat a PGD reference laboratory and one for comprehensivechromosome screening (CCS) at RMA Genetics (Morristown,NJ) as previously described (8). Additional primers/probesfor the mutations were included in the original CCS primerpool such that the excess preamplified DNA produced aspart of the CCS process could be directly used to conduct Taq-man allelic discrimination of the mutation loci. The assayswere first validated on purified DNA samples from knowncarriers for each mutation. Additional excess embryonicCCS-preamplified DNA was also used as template for PGM-based NGS as described subsequently. The biopsy samples ob-tained for the reference laboratory were sent for analysis only

VOL. 99 NO. 5 / APRIL 2013

TABLE 1

Taqman assay primer and probe sequences.

Mutation Sequence information

CFTR, DI507 Forward primer GGATTATGCCTGGCACCATTAAAGAReverse primer CATGCTTTGATGACGCTTCTGTATCProbe 1: wild type (VIC) ACACCAAAGATGATATTTProbe 2: mutant (FAM) AAACACCAAAGATATTT

CFTR, DF508 Forward primer GGATTATGCCTGGCACCATTAAAGAReverse primer CATGCTTTGATGACGCTTCTGTATCProbe 1: wild type (VIC) AGGAAACACCAAAGATGATAProbe 2: mutant (FAM) CATAGGAAACACCAATGATA

CFTR, D1152H Forward primer CATTGCAGTGGGCTGTAAACTCReverse primer TGAATTTTTTTCATAAAAGTTAAAAAGATGATAAGACTTACCAProbe 1: wild type (VIC) AGCTATCCACATCTATGCTGProbe 2: mutant (FAM) CTATCCACATGTATGCTG

CFTR, W1282X Forward primer ATGGTGTGTCTTGGGATTCAATAACTReverse primer TCTGGCTAAGTCCTTTTGCTCACProbe 1: wild type (VIC) CAACAGTGGAGGAAAGProbe 2: mutant (FAM) CAACAGTGAAGGAAAG

FKTN, c.1167insA Forward primer GAATGGAGGCACTCAGGCCReverse primer TCTACCTCCTGAAATTATTTCTGTAGTACCTTProbe 1: wild type (VIC) ATACTTGAATTTTTTTCCTGTTTProbe 2: mutant (FAM) ATACTTGAATTTTTTTTCCTGTTT

IKBKAP, IVS20þ6T>C Forward primer TGGTTTTAGCTCAGATTCGGAAGTGReverse primer ACATAAATCACAAGCTAACTAGTCGCAAAProbe 1: wild type (VIC) TTGGACAAGTAAGTGCCATTProbe 2: mutant (FAM) TGGACAAGTAAGCGCCATT

PHEX, G649D Forward primer GCTGAATGATAGTTGACCGTGAAACReverse primer GCAGCGCATACCCTAAAAGCProbe 1: wild type (VIC) CCGCAGGCCTCCATProbe 2: mutant (FAM) CCCGCAGGTCTCCAT

NF1, c.1318C>T Forward primer TGGCCTAAGATTGATGCTGTGTATTReverse primer CAACCTTGCACTGCTTTATGAAGTProbe 1: wild type (VIC) CAAACATATTTCGAAGTTCProbe 2: mutant (FAM) CAAACATATTTCAAAGTTC

Treff. NGS-based PGD. Fertil Steril 2013.

Fertility and Sterility®

from the embryos identified as euploid by CCS for the DI507-DF508 CFTR case to reduce costs to the patient. All of the bi-opsy samples obtained for the reference laboratory were sentfor the second and third cases.

NGS Data Acquisition

Whole-blood purified DNA samples were normalized to 5ng/mL and amplified for 14 cycles of PCR with the use ofthe Taqman allelic discrimination primers targeting the mu-tations (Table 1) and Preamp Master Mix as recommendedby the supplier (Life Technologies). The Ion Xpress PlusgDNA and Amplicon Library Preparation protocol wasused for the nonbarcoded short amplicons procedure as rec-ommended by the supplier (Life Technologies). The concen-trations of the amplicon DNA samples were obtained withthe use of a Nanodrop-8000 spectrophotometer and normal-ized to 100 ng in 79 mL for input into the library construc-tion. The molar concentration of each amplicon wasobtained with the use of a Bioanalyzer on the AgilentHigh-Sensitivity DNA microfluidic chip (Agilent Technolo-gies), and the samples were then normalized to 26 pmol/Lfor template preparation for the Ion Onetouch protocol(Life Technologies). The Ion Onetouch Template Kit wasused for template preparation and the Ion Sequencing Kitv2.0 for the Ion 314 Chip–based sequencing, as recommen-ded (Life Technologies).

VOL. 99 NO. 5 / APRIL 2013

The same methods as above for whole-blood purifiedDNA samples were followed for the sequencing of the tro-phectoderm and five-lymphocyte sample preamplificationproducts with several exceptions. The excess CCS preamplifi-cation product (25 mL) was used in a second preamplificationreaction (100 mL) with only the SGD assay as the primer. Thebarcoding protocol was followed at the ‘‘ligate adapters andnick repair’’ step, and the samples were run on the Ion 316Chip. For barcoding purposes, Ion Xpress Barcodes 1–16were used, as well as the Ion P1 Adpater, as recommended(Life Technologies). Eight samples were barcoded per 316Chip.

NGS Data Analysis

Fastq files (9) for all of the barcoded samples were obtainedfrom the Ion Torrent Server. Each Fastq file was alignedagainst the reference sequence composed of the nucleotidesin the amplicon generated by the Taqman genotyping assays(Table 2), with the use of Bowtie 2 (10). Reference sequencescorresponding to the CFTR, FKTN, IKBKAP, PHEX, and NF1genes were generated from NCBI accession numbersNG_016465.1, NG_008754.1, NG_008788.1, NG_007563.1,and NG_009018.1, respectively. Local alignment was donewith default parameters to output the alignment file in Se-quence Alignment/Map (SAM) format. These files were thensubsequently converted to BAM (binary version of SAM)

1379

TABLE 2

Summary of genetic data from blastocysts.

Case Embryo CCS Reference lab SGD Taqman SGD NGS SGD

DI507-DF508 1 46,XX No Result Normal Normal2 46,XX Normal Normal Normal3 47,XY,þ16 Not Tested DF508 Carrier DF508 Carrier4 46,XX Normal Normal Normal5 46,XX Affected Affected Affected6 47,XX,þ8 Not Tested DI507 Carrier DI507 Carrier7 47,XX,þ2 Not Tested Normal Normal8 46,XY Normal Normal Normal

D1152H-W1282X 1 46,XY D1152H Carrier D1152H Carrier D1152H Carrier2 46,XX Affected Affected Affected3 46,XY D1152H Carrier D1152H Carrier D1152H Carrier4 46,XY Normal Normal Normal

c.1167insA 1 46,XX No Result Carrier Carrier2 46,XY Carrier Carrier Carrier3 46,XX Carrier Carrier Carrier4 46,XY Carrier Carrier Carrier5 47,XY,þ9 Normal Normal Normal6 46,XX Affected Affected Affected7 46,XX Affected Affected Affected8 46,XY Affected Affected Affected9 46,XY Normal Normal Normal

Note: CCS ¼ comprehensive chromosome screening; NGS ¼ next-generation sequencing; SGD ¼ single-gene disorder.

Treff. NGS-based PGD. Fertil Steril 2013.

ORIGINAL ARTICLE: GENETICS

format using SAMtools (11). The BAM files were loaded intothe Integrative Genomic Viewer (IGV) from Broad Institute(12, 13) so that the sequence alignment could be observed.Aligned reads with the reference sequence were displayed inthe IGV interface. Relative amounts of each allele wereobtained through evaluation of read counts for eachgenotype. For single-nucleotide mutations, the count of thenucleotide that corresponded to the reference sequence foreach position, based on the total number of reads at that par-ticular position, was obtained from IGV. For insertions anddeletions the number of reads were obtained for the positionsof interest and averaged to set this number as a referencecount. A percentage was then obtained by dividing thealigned read depth count of the nucleotides at the positionsof interest by the average read depth count of the referencenucleotides at the corresponding positions and multiplyingby 100.

Ethics

Thematerial used in this study was obtained with patient con-sent and Institutional Review Board approval.

RESULTSLymphocytes

FD cases. Taqman allelic discrimination demonstrated theexpected carrier genotypes from both the patient and herpartner (Supplemental Fig. 2, available online at www.fertstert.org). The four biologic replicates from the five-lymphocyte samples were then blinded, amplified, andprocessed to perform NGS-based genotyping of theIVS20þ6T>C loci. Results were obtained from all four repli-cates for both patients (example shown in SupplementalFig. 3, available online at www.fertstert.org). The sequence

1380

depth of coverage (aligned reads) within the region of interestranged from 1,177 in replicate 4 to 3,810 in replicate 1 for thefemale patient and from 882 in replicate 1 to 1,877 in replicate3 for the male patient. The counts were<48% of the referencecount for the T base at position 39,513 in the IKBKAP gene(Refseq ID NG_008788.1) for the female patient and <50%for her male partner (Supplemental Table 1, available onlineat www.fertstert.org). Thus, from the counts of particular ba-ses compared with the reference counts, NGS genotypes of thesamples demonstrated 100% consistency with Taqman allelicdiscrimination and prior genetic testing results.

XHR case. Taqman genotyping demonstrated the expectedaffected genotypes from the patient (Supplemental Fig. 2).The four biologic replicates from the five-lymphocyte sampleswere then blinded, amplified, and processed to perform NGSbased genotyping of the G649D loci. Results were obtainedfrom all four replicates (example shown in SupplementalFig. 3). The sequence depth of coverage within the region ofinterest ranged from 6,552 in replicate 2 to 26,148 in replicate4. The counts were <1% to the reference count for the G baseat position 193,686 (Refseq ID NG_007563.1) in the PHEXgene (Supplemental Table 1). Thus, from the counts of partic-ular bases compared with the reference counts, NGS geno-types of the replicates demonstrated 100% consistency withTaqman allelic discrimination and prior genetic testingresults.

NF1 case. Taqman genotyping demonstrated the expectedcarrier genotypes from the patient (Supplemental Fig. 2).The four biologic replicates from the five-lymphocyte sampleswere then blinded, amplified, and processed to perform NGSbased genotyping of the c.1318C>T loci. Results were ob-tained from all four replicates (example shown inSupplemental Fig. 3). The sequence depth of coverage within

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

the region of interest ranged from 4,182 in replicate 3 to 6,860in replicate 1. The counts were <55% to the reference countfor the C base at position 111,371 (Refseq ID NG_009018.1)in the NF1 gene (Supplemental Table 1). Thus, from the countsof particular bases compared with the reference counts, NGSgenotypes of the replicates demonstrated 100% consistencywith Taqman allelic discrimination and prior genetic testingresults.

Embryos

CF case 1. CCS results were obtained for all eight embryosand demonstrated that three were aneuploid (SupplementalFig. 4, available online at www.fertstert.org). Taqmangenotyping of CFTR DI507 and DF508 demonstrated theexpected carrier genotypes from the patient and her partner(Supplemental Fig. 2). In addition, all eight embryos were di-agnosed with Taqman genotyping, with five identified as nor-mal, one as aDI507 carrier, one as aDF508 carrier, and one asaffected (Supplemental Fig. 2). The second of the two biopsies(from only the five euploid embryos) was sent to a referencelaboratory for CFTR DI507 and DF508 PGD. Results were ob-tained from four of the five embryos tested, because one failedto amplify. The four embryos that were given a diagnosis weregenotyped consistently with the Taqman allelic discrimina-tion–based predictions (Table 2).

Excess DNA from the CCS protocol was then blinded, am-plified, and processed to perform NGS-based genotyping ofthe CFTR DI507 and DF508 loci. Results were obtained fromall eight embryos (example shown in Fig. 1A). The sequencedepth of coverage (aligned reads) within the region of interestranged from 799 in sample 5 to 20,664 in sample 8. For sam-ples predicted as wild type (samples 1, 2, 4, 7, and 8), the readcounts for all positions of interest (Supplemental Table 2,available online at www.fertstert.org) were within �2% ofthe reference read count. For the sample predicted asa DF508 carrier (sample 3), the counts were <64% of the ref-erence count for the CTT bases at positions 79,498–79,500(Refseq ID NG_016465.1) in the CFTR gene. Similarly, forthe sample predicted as a DI507 carrier (sample 6), the countsfor the CAT bases at positions 79,495–79,497 were <57% ofthe reference. The percentage of mutation alleles detectedfor both carrier samples was slightly lower than the rangeof 45%–61% seen in the heterozygous lymphocyte samples,but this may reflect the difference in detecting a three-nucleotide base-pair deletion and a single-point mutation.In the sample predicted as a compound heterozygote (sample5), nucleotides at position 79,495–79,500 showed on average50% of read counts compared with the reference, with a dele-tion detected between the six bases 100% of the time. Thus,from the counts of particular bases compared with the refer-ence counts, NGS genotypes of the samples demonstrated100% consistency with both Taqman allelic discriminationand the reference laboratory genotypes (Table 2).

CF case 2. CCS results were obtained for all four embryos anddemonstrated that they were all euploid (Supplemental Fig. 4).All four embryos were diagnosed with Taqman allelic dis-crimination, with one identified as normal, two as D1152Hcarriers, and one as being a compound carrier for both the

VOL. 99 NO. 5 / APRIL 2013

D1152H and the W1282X mutations (Supplemental Fig. 2).The second of the two biopsies from each embryo was sentto a reference laboratory for CFTR D1152H and W1282XPGD. Results were obtained from all four of the embryostested, and the diagnoses were consistent with the Taqman al-lelic discrimination based predictions (Table 2).

Excess DNA from the CCS protocol was then blinded, am-plified, and processed to perform NGS-based genotyping ofthe CFTR D1152H and W1282X loci. Results were obtainedfrom all four embryos (example shown in Fig. 1B). The se-quence depth of coverage at the point of interest rangedfrom 100 in sample 3 to 235 in sample 1 for the D1152H mu-tation and from 109 in sample 4 to 193 in sample 1 for theW1282X mutation. For the samples predicted as wild typefor one or both of the mutations, the read counts at the pointsof interest (Supplemental Table 2) were 100% concordant tothe reference read count. For the samples predicted asD1152H carriers (samples 1, 2, and 3), the counts were<62% of the reference count for G at position 134,737. Sim-ilarly, for the sample predicted as a W1282X carrier (sample2), the count for the G nucleotide at position 162,604 (RefseqID NG_016465.1) was <53% of the reference. The percentageof mutation alleles detected for the carrier samples fell bothwithin and below the 45%–61% range seen in the heterozy-gous lymphocyte samples. Thus, from the counts of particularbases compared with the reference counts, NGS genotypes ofthe samples demonstrated 100% consistency with both Taq-man allelic discrimination and the reference laboratory diag-noses (Table 2).

WWS case. CCS results were obtained for all nine embryosand demonstrated that one was aneuploid (trisomy 9) andeight were euploid (Supplemental Fig. 4). All nine embryoswere diagnosed with Taqman allelic discrimination, withtwo identified as normal, four as carriers for the c.1167insAmutation in the FKTN gene, and three as affected(Supplemental Fig. 2). The second of the two biopsies wassent to a reference laboratory for c.1167insA PGD. Resultswere obtained from eight of the nine embryos tested, becauseone failed to amplify. The eight embryos that were given a di-agnosis were consistent with the Taqman-based predictions(Table 2).

Excess DNA from the CCS protocol was then blinded, am-plified, and processed to perform NGS-based genotyping ofthe c.1167insA loci. Results were obtained from all nine em-bryos (examples shown in Fig. 1C). The sequence depth ofcoverage within the region of interest ranged from 255 insample 2 to 180,361 in sample 8. Samples 1 and 2 were runon a separate chip from samples 3–9. For the samples pre-dicted as wild type (samples 5 and 9), the read counts for allpositions of interest (Supplemental Table 2) were within�0.42% of the reference read count. The error rate for the in-sertion of an A in these two samples was 5.25%. For the sam-ples predicted as carriers (samples 1, 2, 3, and 4), the averagedcounts were 23%–36% of the reference count for the A inser-tion. The count consisted of any A insertions throughout theseven-nucleotide stretch of As at positions 61,920–61,927(Refseq ID NG_008754.1) in the FKTN gene divided by the av-erage depth of coverage for those seven nucleotides. The

1381

FIGURE 1

Next-generation sequencing Integrative Genomics Viewer plots of data obtained from three preimplantation genetic diagnosis cases, representinga variety of genotypes found among the tested embryos. Each plot includes a vertical bar graph (columns on top) indicating the depth at each base.Letter codes for each position are indicated at the bottom and represent a normal human genome reference sequence. Each plot also containsmultiple horizontal bars each representing an individual sequence read, with a purple symbol indicating an insertion, a black dashed lineindicating a deletion, and a letter indicating a variant relative to the reference sequence. (A) CFTR DI507-DF508 case; (B) CFTR D1152H-W1282X case; and (C) FKTN c.1167insA case. CF ¼ cystic fibrosis; WWS ¼ Walker-Warburg syndrome.Treff. NGS-based PGD. Fertil Steril 2013.

ORIGINAL ARTICLE: GENETICS

percentage of mutation alleles detected for the carrier samplesfell below the range of 45%–61% seen in the heterozygouslymphocyte samples, but this may reflect the difference indetecting an insertion in a homopolymer stretch. For the sam-ples predicted as affected (samples 6, 7, and 8), the averagedcounts for the A insertion were >64% of the reference.Thus, from the counts of particular bases compared with thereference counts, NGS genotypes of the samples demon-strated 100% consistency with both Taqman allelic discrimi-nation and the reference laboratory diagnoses (Table 2).

DISCUSSIONThis study developed an NGS-based PGD methodology thatwas perfectly consistent with two independent conventionalmethodologies of PGD and with 100% reliability. The com-parison with two independentmethodsmay represent a usefulstrategy in further establishing the general applicability ofNGS to a variety of other SGDs and is an area of active inves-tigation. In the present study, it was also possible to obtain

1382

24-chromosome aneuploidy screening results from qPCR (8)from the same biopsy in which NGS-based PGD of the SGDwas obtained. Given the high-throughput nature of NGS tech-nology, it is possible to investigate the ability of NGS to pre-dict chromosome copy number for the direct diagnosis ofaneuploidy and assess its consistency with an establishedmethodology.

Interestingly, the ability to evaluate eight embryo biop-sies on the same chip through DNA barcoding (2) providedan opportunity to model the possible NGS throughput capac-ity of a single instrument and chip. Because the lowest depthof coverage of eight evaluated samples was 100� on a 316Chip with seven other samples, and because many genotypingapplications of NGS require far less depth (14), it is theoreti-cally possible to evaluate >100 embryo samples on a single318 Chip. In addition, higher-capacity NGS platforms couldfurther increase throughput. Together, these capabilitiesmay provide a unique opportunity to significantly reducethe costs associated with PGD for nearly every indication.Furthermore, this procedure can be completed in less than

VOL. 99 NO. 5 / APRIL 2013

Fertility and Sterility®

24 hours, with a preamplification step of �2 hours, a librarypreparation of �8 hours, a template preparation of �6 hours,and sequencing for �3 hours. However, the protocol estab-lished here has not been applied to single cells and thereforemay only be applicable to blastocyst biopsy, where a muchmore rapid method may be necessary to avoid cryopreserva-tion and frozen embryo transfer. Still, the observed success ofcombining blastocyst biopsy, PGD, and vitrification (15) mayprovide a realistic opportunity for NGS to soon find a place inroutine clinical application. Moreover, a recent cost analysisof a variety of benchtop sequencing instruments estimatedthat a 318 Chip would cost US$625 to run (16). Given thateight samples could be run on one 316 Chip in the presentstudy and that the 318 Chip gives �10 times the sequence,as many as 80 embryos could be run for $625, making the ex-isting costs of NGS comparable with current methodologies.

The importance of screening for both aneuploidy andSGDs was also demonstrated in this study. Patients do notalways choose to test for both when doing PGD, but it isrecommended because a normal genotyping result does notnecessarily guarantee that the embryo is also euploid. Forinstance, embryo 5 in theWWS case was trisomic for chromo-some 9 but genotyped as normal for the c.1167insA mutationin the FKTN gene, which is located on chromosome 9q31-q33.There are numerous ways in which an embryo could be gen-otyped as normal for a mutation that occurs on the samechromosome responsible for causing aneuploidy. Examplesinclude an error in meiosis II where nondisjunction occurredfor the sister chromatids, and an error in meiosis I where therewas nondisjunction after a crossover event between the ho-mologs. Regardless of the cause, if the embryo had been testedonly for the SGD, the normal genotyping result would haveindicated that it was a suitable for transfer when in fact itwas not, thus illustrating the importance of screening forboth aneuploidy and SGDs in parallel.

The fact that the Ion Torrent PGM could accurately detectthe three different genotypes in the samples tested for WWSalso shows that it is capable of detecting mutations in homo-polymer stretches. Although it has been reported thatstretches of the same nucleotide (i.e., homopolymers) cancause sequencing problems for the PGM (16, 17), we wereable to avoid this by examining the entire homopolymerstretch for the insertion mutation. The genotypes of thesamples were visually very evident because the affectedsamples had an adenine insertion between one of the sevenadenines in the reference sequence at almost every read,whereas the insertions in the heterozygous samples were farless frequent but still distinguishable from normal samples.Although insertion of one adenine was most common,3.34% of the time there was an insertion of two or moreadenines in the heterozygous or homozygous affectedsamples. Additionally, 2.23% of the time an insertion otherthan an A was observed at the mutation site, indicating thatsome sequencing errors were made. These errors wereminor, however, and did not affect the overall diagnosticaccuracy. This point is also applicable to the additional PGDcases evaluated, because sequencing errors could beobserved in each case (Fig. 1). Because of the sequencingdepth across the region of interest with the use of NGS, and

VOL. 99 NO. 5 / APRIL 2013

because the consensus of all reads is used to determine thefinal genotype, these sequencing errors did not affect thediagnostic accuracy of NGS-based PGD in any of the cases.Furthermore, the valid concern over incidental findingsfrom comprehensive genetic analysis of human embryos(18) may be reduced by the targeted approach used here, be-cause additional information from nontargeted regions ofthe genome is avoided.

Although this study has shown that NGS of blastocystbiopsies is a reliable method for genotyping PGD caseswhen obtaining a very large depth of coverage, further studiesdefining thresholds for homozygous and heterozygous geno-typing calls, the limits of sequence depth necessary to main-tain accuracy, and the causes of variation in sequencing depthacross different genomic loci remain critical to further evalu-ate this methodology before its clinical application. Further-more, each methodology involving other NGS technologies(i.e., different platforms, or different sequencing depths)should also involve similar experimental evaluation beforeroutine clinical use.

Acknowledgments: The authors thank Chaim Jalas fromBonei Olam for providing materials used in this study.

REFERENCES1. Handyside AH, Kontogianni EH, Hardy K, Winston RM. Pregnancies from

biopsied human preimplantation embryos sexed by Y-specific DNA amplifi-cation. Nature 1990;344:768–70.

2. Knapp M, Stiller M, Meyer M. Generating barcoded libraries for multiplexhigh-throughput sequencing. Methods Mol Biol 2012;840:155–70.

3. Mestan KK, Ilkhanoff L, Mouli S, Lin S. Genomic sequencing in clinical trials. JTransl Med 2011;9:222.

4. Corrales I, Catarino S, Ayats J, Arteta D, Altisent C, Parra R, et al.High-throughput molecular diagnosis of von Willebrand disease by nextgeneration sequencing methods. Haematologica 2012;97:1003–7.

5. Wei X, Ju X, Yi X, Zhu Q, Qu N, Liu T, et al. Identification of sequence variantsin genetic disease-causing genes using targeted next-generation sequenc-ing. PloS One 2011;6:e29500.

6. Glenn TC. Field guide to next-generation DNA sequencers. Mol Ecol Resour2011;11:759–69.

7. Rothberg JM, Hinz W, Rearick TM, Schultz J, Mileski W, Davey M, et al. Anintegrated semiconductor device enabling nonoptical genome sequencing.Nature 2011;475:348–52.

8. Treff NR, Tao X, Ferry KM, Su J, Taylor D, Scott RT Jr. Development and val-idation of an accurate quantitative real-time polymerase chain reaction-based assay for human blastocyst comprehensive chromosomal aneuploidyscreening. Fertil Steril 2012;97:819–24.e2.

9. Cock PJ, Fields CJ, Goto N, Heuer ML, Rice PM. The Sanger Fastq file formatfor sequences with quality scores, and the Solexa/Illumina Fastq variants.Nucleic Acids Res 2010;38:1767–71.

10. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. NatMethods 2012;9:357–9.

11. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. TheSequence Alignment/Map format and SAMtools. Bioinformatics 2009;25:2078–9.

12. Robinson JT, Thorvaldsdottir H, Winckler W, GuttmanM, Lander ES, Getz G,et al. Integrative genomics viewer. Nat Biotechnol 2011;29:24–6.

13. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer(IGV): high-performance genomics data visualization and exploration. BriefBioinform 2012 Apr 19. [Epub ahead of print.]

14. Davey JW, Hohenlohe PA, Etter PD, Boone JQ, Catchen JM, Blaxter ML.Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat Rev 2011;12:499–510.

1383

ORIGINAL ARTICLE: GENETICS

15. Schoolcraft WB, Treff NR, Stevens JM, Ferry K, Katz-Jaffe M, Scott RT Jr. Livebirth outcome with trophectoderm biopsy, blastocyst vitrification, andsingle-nucleotide polymorphism microarray-based comprehensive chromo-some screening in infertile patients. Fertil Steril 2011;96:638–40.

16. Loman NJ, Misra RV, Dallman TJ, Constantinidou C, Gharbia SE, Wain J,et al. Performance comparison of benchtop high-throughput sequencingplatforms. Nat Biotechnol 2012;30:434–9.

1384

17. Elliott AM, Radecki J, Moghis B, Li X, Kammesheidt A. Rapid detection ofthe ACMG/ACOG-recommended 23 CFTR disease-causing mutationsusing ion torrent semiconductor sequencing. J Biomol Tech 2012;23:24–30.

18. Hens K, Dondorp W, Geraedts J, de Wert G. Comprehensive pre-implantation genetic screening: ethical reflection urgently needed. NatRev 2012;13:676–7.

VOL. 99 NO. 5 / APRIL 2013

SUPPLEMENTAL FIGURE 1

Flow chart of sample DNA processing for (A) lymphocytes and (B) embryo trophectoderm biopsies. CCS¼ comprehensive chromosome screening;NGS ¼ next-generation sequencing; PCR ¼ polymerase chain reaction; qPCR ¼ quantitative polymerase chain reaction; SGD ¼ single-genedisorder.Treff. NGS-based PGD. Fertil Steril 2013.

Fertility and Sterility®

VOL. 99 NO. 5 / APRIL 2013 1384.e1

SUPPLEMENTAL FIGURE 2

Taqman allelic discrimination results from (A) purified DNA and five-lymphocyte samples from carriers of the IVS20þ6T>Cmutation in the IKBKAPgene, a G649D mutation in the PHEX gene, and a carrier of the c.1318C>T in the NF1 gene; and from parental DNA and trophectoderm biopsiesfrom (B) CFTR DI507 and DF508 mutations (cystic fibrosis [CF] case 1), (C) CFTR D1152HW1282X mutations (CF case 2), and (D) FKTN c.1167insAmutation (Walker-Warburg syndrome [WWS] case).Treff. NGS-based PGD. Fertil Steril 2013.

1384.e2 VOL. 99 NO. 5 / APRIL 2013

ORIGINAL ARTICLE: GENETICS

SUPPLEMENTAL FIGURE 3

Examples of next-generation sequencing Integrative Genomics Viewer plots of data obtained on five-lymphocyte samples from two carriers of theIVS20þ6T>C mutation in the IKBKAP gene, a G649D mutation in the PHEX gene, and a carrier of the c.1318C>T in the NF1 gene. Each plotincludes a vertical bar graph (columns on top) indicating the depth at each base. Letter codes for each position are indicated at the bottom andrepresent a normal human genome reference sequence. Each plot also contains multiple horizontal bars each representing an individualsequence read, with a purple symbol indicating an insertion, a black dashed line indicating a deletion, and a letter indicating a variant relativeto the reference sequence.Treff. NGS-based PGD. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013 1384.e3

Fertility and Sterility®

SUPPLEMENTAL FIGURE 4

qPCR-based trophectoderm biopsy CCS (24-chromosome copy number) plots from carriers of the (A) CFTRDI507 andDF508mutations (CF case 1),(B) CFTRD1152HW1282Xmutations (CF case 2), and (C) FKTN c.1167insAmutation (WWS case). Abbreviations as in Supplemental Figures 1 and 2.Treff. NGS-based PGD. Fertil Steril 2013.

1384.e4 VOL. 99 NO. 5 / APRIL 2013

ORIGINAL ARTICLE: GENETICS

SUPPLEMENTAL TABLE 1

Next-generation sequencing data for lymphocytes.

Mutation Parameter Sample 1 Sample 2 Sample 3 Sample 4

IVS20þ6T>C patient 1 Depth of coverage 3,810 2,678 3,235 1,177Percent reference allele 39% 48% 44% 41%Percent mutant allele 60% 52% 56% 59%Interpretation Carrier Carrier Carrier Carrier

IVS20þ6T>C patient 2 Depth of coverage 882 1,519 1,877 1,680Percent reference allele 44% 49% 50% 38%Percent mutant allele 56% 51% 49% 61%Interpretation Carrier Carrier Carrier Carrier

G649D Depth of coverage 11,865 6,552 9,491 26,148Percent reference allele 1% 1% 1% 1%Percent mutant allele 99% 99% 99% 99%Interpretation Affected Affected Affected Affected

c.1318C>T Depth of coverage 6,860 6,111 4,182 6,284Percent reference allele 55% 48% 53% 44%Percent mutant allele 45% 52% 47% 56%Interpretation Carrier Carrier Carrier Carrier

Treff. NGS-based PGD. Fertil Steril 2013.

VOL. 99 NO. 5 / APRIL 2013 1384.e5

Fertility and Sterility®

SUPPLEMENTAL TABLE 2

Next-generation sequencing data for embryos.

CF case 1 Parameter Embryo 1 Embryo 2 Embryo 3 Embryo 4 Embryo 5 Embryo 6 Embryo 7 Embryo 8

DI507 Average depth of coverage 5,120 9,324 1,569 1,604 884 5,805 1,749 20,643Percent reference allele 99% 99% 99% 99% 0% 57% 99% 99%Percent deletion CAT 0% 0% 0% 0% 100% 44% 0% 0%

DF508 Average depth of coverage 5,124 9,322 1,141 1,605 799 7,945 1,748 20,664Percent reference allele 99% 99% 64% 99% 0% 99% 99% 99%Percent deletion CTT 0% 0% 37% 0% 100% 0% 0% 0%Interpretation Normal Normal Carrier DF508 Normal Affected Carrier DI507 Normal Normal

CF case 2 Embryo 1 Embryo 2 Embryo 3 Embryo 4

D1152H Depth of coverage 235 226 100 179Percent reference allele 61% 57% 53% 100%Percent mutant allele 38% 43% 47% 0%

W1282X Depth of coverage 193 180 128 109Percent reference allele 100% 53% 100% 100%Percent mutant allele 0% 47% 0% 0%Interpretation Carrier D1152H Affected Carrier D1152H Normal

WWS case Embryo 1 Embryo 2 Embryo 3 Embryo 4 Embryo 5 Embryo 6 Embryo 7 Embryo 8 Embryo 9

c.1167insA Average depth of coverage 351 264 99,293 108,499 89,204 141,277 100,602 180,361 92,741Percent reference allele 64% 77% 69% 68% 100% 36% 27% 30% 100%Percent mutant allele 36% 23% 32% 32% 0% 64% 73% 71% 0%Interpretation Carrier Carrier Carrier Carrier Normal Affected Affected Affected Normal

Note: CF ¼ cystic fibrosis; WWS ¼ Walker-Warburg syndrome.

Treff. NGS-based PGD. Fertil Steril 2013.

1384.e6 VOL. 99 NO. 5 / APRIL 2013

ORIGINAL ARTICLE: GENETICS