nk cell markers predict the efficacy of iv immunoglobulins

ARTICLE OPEN ACCESS CLASS OF EVIDENCE

NK cell markers predict the efficacy of IVimmunoglobulins in CIDPAnne K Mausberg PhD Maximilian K Heininger PhD Gerd Meyer Zu Horste MD Steffen Cordes PhD

Michael Fleischer MD Fabian Szepanowski PhD Christoph Kleinschnitz MD Hans-Peter Hartung MD

Bernd C Kieseier MD and Mark Stettner MD PhD

Neurol Neuroimmunol Neuroinflamm 20207e884 doi101212NXI0000000000000884

Correspondence

Dr Mausberg

anne-kathrinmausberg

uk-essende

AbstractObjectiveTo assess whether IV immunoglobulins (IVIgs) as a first-line treatment for chronic in-flammatory demyelinating polyneuropathy (CIDP) have a regulative effect on natural killer(NK) cells that is related to clinical responsiveness to IVIg

MethodsIn a prospective longitudinal study we collected blood samples of 29 patients with CIDP beforeand after initiation of IVIg treatment for up to 6 months We used semiquantitative PCR andflow cytometry in the peripheral blood to analyze the effects of IVIg on the NK cells The resultswere correlated with clinical aspects encompassing responsiveness

ResultsWe found a reduction in the expression of several typical NK cell genes 1 day after IVIgadministration Flow cytometry furthermore revealed a reduced cytotoxic CD56dim NK cellpopulation whereas regulatory CD56bright NK cells remained mostly unaffected or were evenincreased after IVIg treatment Surprisingly the observed effects on NK cells almost exclusivelyoccurred in IVIg-responsive patients with CIDP

ConclusionsThe correlation between the altered NK cell population and treatment efficiency suggests acrucial role for NK cells in the still speculative mode of action of IVIg treatment Analyzing NKcell subsets after 24 hours of treatment initiation appeared as a predictive marker for IVIgresponsiveness Further studies are warranted investigating the potential of NK cell status as aroutine parameter in patients with CIDP before IVIg therapy

Classification of evidenceThis study provides Class I evidence that NK cell markers predict clinical response to IVIg inpatients with CIDP

MORE ONLINE

Class of EvidenceCriteria for ratingtherapeutic and diagnosticstudies

NPuborgcoe

From the Department of Neurology (AKM MF FS CK MS) Research Group for Clinical and Experimental Neuroimmunology University Hospital Essen Department ofNeurology (MKH H-PH BCK) Medical Faculty Heinrich-Heine University Duesseldorf Department of Neurology with Institute of Translational Neurology (GMZH) UniversityHospital Munster and Oncology and Tumor Immunology (SC) Charite University Medicine Berlin Germany

The Article Processing Charge was funded by the authors

Go to NeurologyorgNN for full disclosures Funding information is provided at the end of the article

This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 40 (CC BY-NC-ND) which permits downloadingand sharing the work provided it is properly cited The work cannot be changed in any way or used commercially without permission from the journal

Copyright copy 2020 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the American Academy of Neurology 1

Chronic inflammatory demyelinating polyneuropathy (CIDP)is an acquired chronic autoimmune disorder of the peripheralnervous system12 A broad spectrum of subtypes has beendescribed and its heterogeneity poses challenges to diagnos-tics treatment and pathogenic concepts34 Although etiopa-thogenesis and autoimmune targets have not been fullyelucidated there is strong evidence for the involvement ofcellular and humoral immune responses5ndash7

Immunomodulatory therapies can improve clinical signs and upto 80 of patients respond to 1 of the 3 first-line treatmentscorticosteroids plasma exchange and IV immunoglobulins(IVIgs)8 Although IVIg is therapeutically efficacious in close to70 of patients it takes 2ndash6 months before nonresponders canbe identified9 Although key opinion leaders in the field tend toswitch to the next treatment option even within the first 3months of ineffective treatment there is an underestimated timewindow in IVIg nonresponding patients without effective ther-apy Given the heterogeneity of therapeutic response patientswould greatly benefit from the availability of prognostic markersand surrogate markers which predict treatment response1011

Reduced numbers of natural killer (NK) cells or a diminutionin cytotoxic NK cell activity has been reported in variousautoimmune conditions such as MS systemic lupus eryth-ematosus rheumatoid arthritis or type I diabetes1213 How-ever the pathophysiologic contribution of NK cells in thecontext of CIDP has not been addressed in detail

To further understand the mode of action of IVIg in patientswith CIDP and to decipher the alterations which are re-sponsible for its therapeutic effect we took a prospectivelongitudinal approach to collect blood samples of patientswith CIDP before and after treatment initiation with IVIg andinvestigated immune cell populations in detail

MethodsStandard protocol approvals registrationsand patient consentsThe study was performed in accordance with the principlesof the Declaration of Helsinki and the local ethics commit-tees approved the study plan (Ethics Committee Universityof Essen and Ethics Committee University of Dusseldorf)Participants who provided written informed consent were in-cluded All participants were older than 18 years A total of 29patients with CIDP were investigated

Diagnosis and classification of patientswith CIDPA total of 29 patients withCIDP (age range 34ndash78 years mean age55 years) consented to be enrolled and peripheral blood sampleswere obtained before treatment initiation and 1 2 3 and 6monthsafter the first infusion of IVIg CIDP was diagnosed according tothe European Federation of Neurological SocietiesPeripheralNerve Society criteria14 All patients had not received treatmentsother than methylprednisolone or plasma exchange before sam-pling and had been without immunomodulatory or immunosup-pressive treatment for at least 4 weeks before sampling Patientswere observed in monthly intervals for up to 2 years Samples ofpatients were excluded when they did not meet quality standards(cell viability messenger RNA [mRNA] quality and false-negativeor false-positive controls during measurements of the samples)

Summed Inflammatory Neuropathy Cause and Treatment(INCAT) disability scores were assessed as previously describedat each visit15 Briefly the INCAT disability score assessesfunctional disability on an ordinal scale ranging from 0 (nodisability) to 5 (no purposeful movement possible) for upperand lower extremities The summed INCAT score is addedfrom both values and can thus range from 0 to 10 Patients wereclassified as responders if the INCAT sum score declined at least1 point during 6 months of treatment Furthermore they wereclassified as responders if they stabilized under IVIg treatmentwith a progression of at least 2 points of the INCAT sum scoreover a period of 6 months before IVIg initiation

Peripheral bloodmononuclear cell preparationEthylenediaminetetraacetic acid (EDTA) tubes were used tocollect peripheral blood mononuclear cells (PBMCs) andPAXgene tubes to collect RNA Fresh blood samples inEDTA tubes were purified using Ficoll (Invitrogen Man-nheim Germany) gradient centrifugation according to themanufacturerrsquos protocol on the day of collection Cells weredivided into aliquots one was freshly used for flow cytometryanalyses and the others were stored in 10 dimethylsulfoxidefetal calf serum in liquid nitrogen until further use

Real-time PCRTotal RNA was isolated using the PAXgene preparation kitaccording to the manufacturerrsquos instructions and quantified(Nanodrop 2000 Thermo Scientific Waltham MA) Syn-thesis of complementary DNA (cDNA) was performed using1 μg of total RNA with Moloney murine leukemia virus re-verse transcriptase RNAse OUT deoxynucleoside triphos-phates and oligo dT primer (all Invitrogen)

GlossaryADCC = antibody-dependent cytotoxicity ANOVA = analysis of variance BNB = blood-nerve barrier cDNA =complementary DNA CIDP = chronic inflammatory demyelinating neuropathy DC = dendritic cell EAE = experimentalautoimmune encephalomyelitis EDTA = ethylenediaminetetraacetic acid IFNγ = interferon gamma INCAT = InflammatoryNeuropathy Cause and Treatment IVIg = IV immunoglobulin mRNA = messenger RNA NCAM1 = neural cell adhesionmolecule 1 NK = natural killer PBMC = peripheral blood mononuclear cell TNFα = tumor necrosis factor alpha

2 Neurology Neuroimmunology amp Neuroinflammation | Volume 7 Number 6 | November 2020 NeurologyorgNN

For real-time PCR the thermal cycler (AbiPrism7000 Ap-plied Biosystems Foster City CA) was set to run for 2 mi-nutes at 50degC and 10 minutes at 95degC 40 cycles for 15seconds at 95degC and 1 minute at 60degC using Power SYBRGreen PCR Master Mix (Applied Biosystems) cDNA wasamplified in the presence of a final concentration of 0625 μMfor each primer (sequences in the table) To affirm thespecificity of the product PCR was followed by a meltingcurve analysis The housekeeping gene GAPDH was used asthe control gene to relate mRNA content

Flow cytometryCells were surface stained using antibodies according tostandard procedures16 For extracellular staining 1 times 106 cellswere stained and fluorescence of cells was analyzed using theFACSCanto II flow cytometer with BD FACSDiva 80 soft-ware (BD Biosciences Heidelberg Germany) Distinct cellpopulations were analyzed using FlowJo 100 (LCC EugeneOR) For intracellular stainings of cytokines the BD CytofixCytoperm Plus kit (BD Biosciences) was used after extra-cellular staining according to the manufacturerrsquos protocolsIntracellular staining was performed using FoxP3 FixationPermeabilization (Thermo Fisher)

The following fluorescently labeled antibodies were usedCD4 (RPA-T4) CD8 (RPA-T8) CD16 (3G8) CD19(SJ25C1) and CD56 (NCAM162 all BD Biosciences) CD3(Okt 03) CD25 (M-A251) CD107a (H4-A3) CD161 (HP3G10) CD335(9E2) FOXP3 (150D) interferon gamma(IFNγ) (4SB3) and tumor necrosis factor alpha (TNFα)(MAb11 all BioLegend San Diego CA) and NKG2A(REA110) NKG2C (REA205) and NKG2D (BAT221 allMiltenyi Bergisch Gladbach Germany)

Cytotoxicity assay2 times 105 PBMCs were preincubated for 16 hours before theK562 cell line was cocultivated for an hour to stimulate NKcell activity in the presence of CD107a antibody (H4-A3BioLegend) Cultivation was prolonged for 4 hours in thepresence of GolgiStop and GolgiPlug (BD Biosciences) Aftercultivation cells were harvested and flow cytometry analyzedas described before Shortly cell populations were determinedas well as CD107 degranulation and expression of the in-tracellular cytokines IFNγ and TNFα

StatisticsThe primary research questions of this prospective study werewhether IVIg as a first-line treatment for CIDP have a regula-tory effect on NK cells and their markers and whether thesechanges are related to clinical responsiveness The classificationof evidence assigned to these questions is Class I The Shapiro-Wilk test was applied to assess normal distribution The Mann-Whitney U test was performed for unrelated (unpaired) sam-ples theWilcoxon rank test was performed for related (paired)samples the Kruskal-Wallis analysis of variance (ANOVA) wasperformed for multiple testing and the Dunn-Bonferroni posthoc test was used to test for statistically significant differences

Correlation analysis was performed by calculation of Spearmanρ Differences were considered significant at p values lt005 witha CI of 95 GraphPad Prism version 70 (GraphPad Software

Table Primer sequence

Genename(protein) Sequence

Productlength (nt)

ACTB FWD CTG GGA GTG GGT GGA GGC 57

ACTIN REV TCA ACT GGT CTC AAG TCA GTG

FCGRA FWD GTG TCA CTG TCC CAA GTT GC 205

CD16A REV GCT ACA CAG GAA TTA GAT ATTGAA GC

IL2RA FWD ACG GGA AGA CAA GGT GGA C 89

CD25 REV TGC CTG AGG CTT CTC TTC A

NCAM1 FWD TGT GTG ATG TGG TCA GCT CC 162

CD56 REV TGC CCT CAC AGC GAT AAG TG

KLRD1 FWD CTC TTA CAG TGA GGA GCA CAC C 92

CD94 REV TTG TAT TAA AAG TTT CAA ATGATG GAA

KLRB1 FWD AAA TGC AGT GTG GAC ATT CAA 91

CD161 REV CTC GGA GTT GCT GCC AATA

NCR1 FWD CCC ACA GAG GGA CAT ACC GAT 109

CD335 REV AGG CTG GTG TTC TCA ATG TCG

FOXP3 FWD CTT CCT TGA ACC CCA TGC 70

FOXP3 REV GAG GGT GCC ACC ATG ACT A

GAPDH FWD TGG ACC TGA CCT GCC GTC TA 150

GAPDH REV AGG AGT GGG TGT CGC TGT TG

IL10 FWD TGA AAA CAA GAG CAA GGC CG 83

IL-10 REV CACTCATGGCTT TGTAGATGCC

KLRC1 FWD ACC TAT CAC TGC AAA GAT TTACCA

144

NKG2A REV GGA AGA ATT GTT GTG CCT CTG

KLRC2 FWD CAA AAT CCT TCC CTG AAT CAT C 89

NKG2C REV ACC TCG GCA GTG AGC TTC T

KLRK1 FWD GCTTCGAAGAACTCTGATCTGC 101

NKG2D REV TTC GTT TAG TTC AAA TGG CAA C

KLRC3 FWD GCA GGC CTG TGC TTC AAA GA 131

NKG2E REV CCC ATG GAT GAT GAC TGC TG

KLRC4 FWD ACT GCA AAG GTT TAC TGC CAC 137

NKG2F REV AAA ATT GTT CTG CTC CAG TACTCC

Abbreviations FWD = forward REV = reverse

NeurologyorgNN Neurology Neuroimmunology amp Neuroinflammation | Volume 7 Number 6 | November 2020 3

San Diego CA) and SPSS version 25 (IBM Corp 2017Armonk NY) were used for statistical analysis

Data availabilityAll data generated or analyzed during this study are includedin this published article

ResultsTreatment of patients with CIDP with IVIgreduces NK cell frequency but not thefrequency of T cells and B cellsAdministration of IVIg is known to have strong effects onvarious subpopulations of leukocytes in human blood Toinvestigate distinct changes flow cytometry of peripheral

blood cells was performed before and 24 hours after IVIgadministration

Lymphocytes were identified based on size and granularity(figure 1A) Gated on this population staining with CD3 vsCD56 allowed the discrimination of NKT cells (CD3+CD56+) vs NK cells (CD3minusCD56+) NK cells were furthersubclassified using CD16 and CD56 NK cells with regulatoryfunctions express CD16minusCD56bright whereas predominantlycytotoxic NK cells are CD16+ but expression of CD56 is onlyintermediate (CD16+CD56dim) The frequency of total NKcells (CD3minusCD56+) was reduced after IVIg infusions in al-most all patients (figure 1B p lt 0001) Subdivision of NKcells into CD16minusCD56bright and CD16+CD56dim NK cellsdemonstrated that significant reduction is mainly due to

Figure 1 Treatment with IVIg reduces NK cell frequency but not the frequency of T cells and B cells

Flow cytometry analysis of PBMCs from patients with CIDP (n = 14) before treatment initiation and 24 hours after IVIg treatment (A) Representative gatingstrategy to define NK cells Lymphocytes were identified based on the size and granularity of cells To exclude NKT cells CD56 and CD3 costaining wasperformed Gated on CD56+CD3minus cells subpopulations of CD16+CD56dim and CD16minusCD56bright NK cells were determined (B) Changes in NK cells gated onlymphocytes in individual IVIg-naive patients and 24 hours after IVIg infusion (C) Proportion of CD56bright and CD56dim NK cell subpopulations withinlymphocytes Depicted ismean plusmn SEM of the analyzed patients (D) Changes in CD56bright subpopulation gated onNK cells in individual IVIg-naive patients and24 hours after IVIg infusion (E) Changes in frequencies of T cells and B cells gated on lymphocytes in individual IVIg-naive patients and 24 hours after IVIginfusion (F) Depicted are changes in the ratio of lymphocytes and monocytes within the leukocyte population in individual IVIg-naive patients and 24 hoursafter IVIg infusion (asterisks indicate significance p lt 0001 nonparametric distribution Wilcoxon rank test for paired samples) CIDP = chronic in-flammatory demyelinating neuropathy IVIg = IV immunoglobulin NK = natural killer PBMC = peripheral blood mononuclear cell


reduction within the CD16+CD56dim populations (figure1C) whereas the smaller CD16minusCD56bright population inmost patients increased 24 hours after IVIg treatment (figure1D p lt 0001)

In contrast IVIg treatment had no significant effect on theproportion of CD3+ T cells and CD19+ B cells (figure 1E)and lymphocytemonocyte ratios remained stable as well(figure 1F) indicating no specific expansionreduction of theinvestigated subpopulations of cells In single patients nosignificant changes were observed but a slight trend towardincrease or reduction was detectable

INCAT correlates with NK cells and theirmarkersWe next addressed the question as to whether disease severitycorrelates with the NK cell population size (figure 2) Patientswere subgrouped according to the INCAT score (0ndash3) andthe percentage of NK cells within the lymphocyte pop-ulation (figure 2A) and the relative expression of NKcellndashspecific genes in peripheral blood (figure 2B) wasgraphed Patients with low motor disabilities (INCAT = 0)had higher NK cell number in tendency compared withpatients with a higher disability (INCAT = 3) Significantdifferences were obtained for mRNA expression RelativemRNA expression of neural cell adhesion molecule 1(NCAM1) (CD56) and KLRD1 (CD94) were significantlylower in patients with higher INCAT score (figure 2BSpearman ρ minus0465 p = 0017 for KLRD1 and minus0467 p =0014 for NCAM1) In line with the reduced NK cellnumbers patients with a higher disease severity also hadlower NK cellndashspecific transcription levels detectable in theperipheral blood

Treatment with IVIg reduces NK cells and NK-specific markers but values recover betweenIVIg administrationsTo validate the flow cytometry data and additionally investigatefunctional markers of NK cells the relative mRNA expression ofdifferentNKcell geneswasmeasured in patientswithCIDPbeforeand 24 hours after IVIg infusion (figure 3A) NK cellndashspecificmarkers NCAM1 (CD56) KLRD1 (CD94) KLRB1 (CD161)and NCR1 (CD335) were analyzed as well as functional NKGfamily receptors either with activating (KLRC2 [NKG2C] andKLRK1 [NKG2D]) or inhibiting (KLRC1 [NKG2A]) function orwith unknown function (KLRC4 [NKG2F])

The relative expression of NCAM1 was significantly reduced 24hours after the first IVIg infusion (p = 00038 reduction observedin 12 of 16 patients) The same reduction of relative expression ofNK cellndashspecific markers was detected regarding KLRD1 (p =00012) andKLRB1 (p = 00087) transcripts Diminished relativeexpression ofNCR1wasmost prominent amongNK cellndashspecificmarkers and was observed in 15 of 16 patients (p lt 0001) Therelative reduction was also significant for most of the NKG familymembers (KLRC2 p = 00239 and KLRC4 p = 00348) TheKLRC1marker was decreased in tendency after 24 hours of IVIginfusion In summary transcripts ofNKcellmarkers and receptorswere diminished 24 hours after IVIg infusion

In contrast to that we did not find relevant changes in longitudinalanalysis of samples prior treatment initiation compared with 1 2 3and 6 months of treatment (data not shown) neither with flowcytometry nor transcriptional analysis To further understand theobservations of the 24-hour samples we confirmed that changes arereversible within the monthly treatment intervals Thereforechanges of different NK cell genes were analyzed over 3 months in3 responding patients and representative data of 1 patient aredepicted in figure 3B As expected the relative expression of theanalyzed genes was markedly reduced 24 hours after infusionHowever the levels returned to the initial value between the

Figure 2 Correlation of INCAT with NK cells and theirmarkers

Correlation of the INCAT score with the percentage of NK cells within lym-phocytes (A n = 16) and the expression level of NK-specific genes CD56 andCD94 (B n = 27) Patients were classified in terms of the INCAT disabilityscore Depicted is mean plusmn SD and correlation with Spearman correlationcoefficient r significance level p is as stated INCAT = Inflammatory Neu-ropathy Cause and Treatment NK = natural killer


treatments andwere again lowered after subsequent infusionsOvera period of 3 months patients revealed a stable recurring pattern

In treatment-naive patients no difference inNK cell marker expression is detectablebetween responders and nonrespondersPatients with CIDP differ in their responsiveness to IVIg Ret-rospectively enrolled patients were subdivided into respondersand nonresponders after 3ndash6 months of IVIg treatment NK celllineage and functional markers were compared between the 2groups before IVIg treatment initiation (responders dark graybars nonresponders light gray bars figure 4) Flow cytometryanalysis of NK cells and relevant NK cell markers (figure 4A)revealed no significant differences between the 2 groups Fre-quencies of NK cell lineagendashspecific markers were in a compa-rable range and also functional receptors did not differ in IVIgresponders vs nonresponders These results were confirmed onthe mRNA level (figure 4B) and revealed no significant differ-ence in NK cell markers In summary treatment-naive re-sponders vs nonresponders had no distinct NK cell profile NKcell function was tested in an ex vivo assay and in line with the

above described results Neither the cytotoxicity measured by aCD107 flow cytometry assay nor the cytokine production ofTNFα and IFNγ after stimulation with K562 target cells wasdifferent between responders and nonresponders (figure e-1)

Reduction of NK cell marker expression 24hours after IVIg treatment initiation is morepronounced in responding patientsWe further analyzed whether the changes within the NK cellpopulation differed in responders and nonresponders Thereforefrequency changes of NK cell were compared in responders andnonresponders 24 hours after IVIg infusion (figure 5A) Com-pared with naive samples we found a significant increase of theregulatory CD56bright population within the NK cells after IVIginfusion whereas the frequency did not increase in nonre-sponders Most interestingly this difference is significant betweenresponders and nonresponders (p = 00047) Withinthe lymphocytes the regulatory CD56bright population even de-creased in nonresponders In general the frequencies of NK cellswere reduced in responders and nonresponders with higher re-duction in responders This decrease of NK cells within

Figure 3 Treatment with IVIg reduces NK cells and NK-specific markers in a reversible manner

Analysis of changes in relative expression levelsof the indicated typical NK cellndashspecific genes inPBMCs from patients with CIDP before treat-ment initiation and 24 hours after IVIg treatment(A) Depicted are changes of relative expressionof indicated genes in individual patients (n = 17)related to the house keeping gene GAPDH (2minusDCtasterisks indicate significance p lt 005 p lt001 p lt 0001 nonparametric distributionWilcoxon rank test for paired samples) Changesof the indicated genes (B) Representative ex-pression levels of the indicated genes of a rep-resentative patient over time before IVIgtreatment initiation and 24 hours after monthlyinfusion of IVIg CIDP = chronic inflammatorydemyelinating neuropathy IVIg = IV immuno-globulin NK = natural killer PBMC = peripheralblood mononuclear cell


the lymphocyte population was also confirmed on the mRNAexpression level (figure 5B) The majority of NK cell genes weresignificantly downregulated in responders whereas in nonre-sponders only a moderate downregulation could be detected oreven an upregulation of some mRNA transcripts (KLRB1KLRK1 and KLRC4) 24 hours after IVIg infusion This resultedin a significant difference in responders and nonresponders(KLRB1 p = 0027 KLRK1 p = 0031 KLRC4 p = 0024)

To better discriminate responders from nonresponders 2candidate markers were depicted for representative singleresponding and nonresponding patients (figure 5C) Althoughmost of the responding patients showed decreased KLRC2mRNA expression after IVIg treatment in nonresponders theshift was not as pronounced or the expression was even slightly

increased In most of the responding patients CD56bright NKcells were strongly increased whereas this phenomenon couldnot be observed in the nonresponder cohort

To predict the responsiveness of IVIg a combinational approachof more than 1 candidate marker could increase the significanceTo test this hypothesis CD56bright flow cytometry data wherecombined with KLRB1 and KLRK1 transcriptional data For theadjustment of multiple testing we performed 1-way Kruskal-Wallis ANOVA In this model responders were significantlydiscriminated from nonresponders (F = 6974 p = 0013) Inpairwise comparisons with the Dunn-Bonferroni post hoc testCD56bright showed the highest significance level (p = 0007)followed by KLRK1 (p = 0010) and KLRB1 (p = 0027) Thusthe combination of these 3 candidate markers increases the level

Figure 4 In treatment-naive patients no difference in NK cell marker expression is detectable between responders andnonresponders

Comparison of NK cell markers ofPBMCs from patients with CIDP be-fore IVIg treatment that were sub-sequently classified as responders (n= 11) or nonresponders (n = 6)depending on the treatment efficacyof IVIg Depicted is mean plusmn SEM (A)Changes of frequencies of NK cellsCD56bright and CD56dim NK cell sub-populations and CD161+ andNKG2A+ populations in patients withCIDP In addition mean fluorescenceintensity was analyzed of surfaceprotein expression levels of CD161and CD335 (B) Longitudinal changesin transcriptions levels of the in-dicated genes after real-time qPCRanalysis was performed on mRNApreparations of PBMCs CIDP =chronic inflammatory demyelinatingneuropathy IVIg = IV immunoglobu-lin NK = natural killer mRNA = mes-senger RNA PBMC = peripheralblood mononuclear cell


of significance for CD56bright and KLRK1 improving predictionfor the responsiveness of IVIg

DiscussionDespite generally high efficacy of IVIg a significant proportion ofpatients with CIDP fail to respond to this treatment In theseinstances treatment failure is confirmed after 3ndash6 months ofunaltered disease progression Patients refractory to IVIg treat-ment would highly benefit from surrogates capable of predictingtreatment efficacy earlier Although amajority of patients respondwell to treatment with IVIg (responders) around 30 of patientsdo not benefit at all (nonresponders)9 Here we demonstratechanges within the lymphocyte populations in patients withCIDP induced by IVIg treatment andmdashfurthermoremdasha distinctchange in the NK cell profile 24 hours after treatment dependingon clinical responsiveness to IVIg treatment The effect waspredominantly observed within NK populations and for NK cellreceptors IVIg responders had a relative reduction of CD16+

CD56dim cells in the peripheral blood and a relative increase inCD16minusCD56bright cells In nonresponders these effects wereless pronounced or absent We did not check for IgG4 subclassesor antibodies to paranodal antigens Because up to 10 of thenonresponders have antibodies against paranodal antigens17

some of our patients may not relate to NK transcripts but ratherto a different autoantibody status To increase the prediction ofIVIg responsiveness we tested a combinatorial approach of 3strong candidate markers The combination of CD56bright flowcytometry data with the transcriptional data of KLRB1 andKLRK1 increased the level of significance improving predictionfor the responsiveness of IVIg Nevertheless establishing a test inthe clinical routine could be an ambitious goal

The role of NK cells was not investigated so far in context ofautoimmune neuropathies NK cells are innate immune cells andrecognize virus-infected or pathologically altered cells Targetcells are either eliminated by release of cytolytic granules or se-crete cytokines to regulate the immune response NK cells arealso involved in limiting immune response after inflammatory

Figure 5 Reduction of NK cell marker expression after 24-hour IVIg treatment is more pronounced in responding patients

(A) Changes of frequencies of relevant NK cell markers inPBMCs of patients with CIDP 24 hours after IVIg infusionrelated to baseline in responders (n = 11) and nonre-sponders (n = 6) Frequency of CD56bright NK cells was de-termined within the total NK cell population and withinlymphocytes Asterisks above bars indicate significantchanges after IVIg treatment compared with control (p lt005 p lt 001 p lt 0001 nonparametric distributionWilcoxon rank test for paired samples) Asterisks betweenbars indicate significant changes between the responderand nonresponder cohort Depicted is mean plusmn SEM (p lt005 p lt 001 nonparametric distribution unpairedMann-Whitney U test) (B) Changes of the transcription level of rel-evant NK cell genes in PBMCs of patients with CIDP 24 hoursafter IVIg infusion related to baseline in responders (n = 11)and nonresponders (n = 6) Asterisks above bars indicatesignificant changes after IVIg treatment compared with con-trol (p lt 005 p lt 001 nonparametric distribution Wil-coxon rank test for paired samples) Asterisks between barsindicate significant changes between the responder andnonresponder cohort Depicted ismean plusmn SEM (p lt 005 plt 001 nonparametric distribution unpaired Mann-WhitneyU test) (C) Changes in PBMCs of patients with CIDP after 24hours of IVIg infusion in representativemarkers of NK cells ongene expression and surface expression in the individual pa-tients related to baseline (responders n = 8 nonresponders n= 6) CIDP = chronic inflammatory demyelinating neuropathyIVIg = IV immunoglobulin NK = natural killer PBMC = pe-ripheral blood mononuclear cell


reactions18 Several NK cell receptors activate or inhibit theiractivity (such as the NKG2 receptor family) and subpopulationscan be identified via the expression level of the surface moleculeCD56 (encoded by NCAM1) The CD56dim cell subpopulationhas cytotoxic activity whereas CD56bright cells fulfill regulatoryfunctions partly via cytokine secretion19

IVIgs achieve their anti-inflammatory effect through a broad rangeof target mechanisms20 The therapeutic effect of IVIgs is in partmediated via the Fc gamma receptor which is also expressed onNK cells Another mode of action that has been proposed is theupregulation of target cell killing by antibody-dependent cytotox-icity (ADCC)20 There is also evidence for a reduction of cytotoxicNK cells immediately after IVIg treatment in patients with CIDPmost likely due to lowering of the number of circulatingNK cells21

The possible link between IVIg efficacy and NK cells appearsobvious but has not been further investigated in CIDP

One possible mechanism of the IVIg effect on NK cells is theactivationinduction of their cytotoxic phenotype In our studyparticularly CD56dim NK cells were reduced in peripheral bloodpredominantly in responders It is known that recruitment ofCD56dim cells into inflamed tissue is mandatory for limitingimmune reaction in experimental autoimmune encephalomyelitis(EAE)1222 An increased fraction of CD56dim cytotoxic cellsmigrating into inflamed tissue could therefore lead to a localreduction of autoreactive T cells eliminated via cytotoxic lysis bythe NK cells23 This mechanism is well known thus recruitmentof CD56dim NK cells is a potent defense mechanism againstinflammation in various tissues It influences dendritic cell (DC)activation regulates the adaptive immune system and reduceslocal tissue destruction2425 Although mature DCs are protectedby an upregulation of major histocompatibility complex class Imolecules26 NK cells are known to lyse immature DCs27 IVIgenhances lysis of mature DCs via CD16+CD56dim NK cells andADCC28 This may terminate autoimmune reactions due tolimited T-cell activation via restricted DC antigen presentation

We and others have shown629 that patients with CIDP displaychanges in their T-cell receptor repertoire but these alterations dohardly explain the treatment effect of IVIg and do not answer thequestion why a distinct group of patients with CIDP do not re-spond to therapy It is known froman animalmodel ofMS thatNKcells are crucial for the therapeutic effect of IVIg NK cell depletionin EAE leads to a loss of IVIg efficacy30 Furthermore a recentstudy on the CSF of patients with inflammatory neuropathiesrevealed a distinctive increase in NK cell numbersmdashindicating anunderestimated role of NK cells in inflammatory neuropathies31

One limitation of the study is the comparable low INCAT score of142 This can be explained by the fact that the study mainlyincluded patientswith a newly diagnosedCIDP Still an INCATof2 is a relevant functional limitation for patients and INCATmainlyreflects motor symptoms Because the INCAT score is a well-established scale we choose this motor functional score to classifyresponse and clinical course

Our observations add evidence of an IVIg-induced migration ofcytotoxic CD16+CD56dim NK cells into the inflamed peripheralnerve where they might induce suppression of autoreactive im-mune cells and therefore limit autoimmunity However in non-responders concurrent homing of CD56bright NK cells mayaugment autoimmune reactions counteracting this mechanismIn additionNKcellndashmediated lysis of activatedmacrophages32 orautoreactive T cells33 may further curtail autoimmune reactionsfollowing IVIg treatment The observation of the monthly re-covery of NK cell markers is of high interest and further studieswill correlate the NK cell course with the clinical end-of-doseeffect in IVIg-treated patients34 In addition monitoring the NKtranscripts during the treatment interval of 3ndash4 weeks will addknowledge to the role of NK cells in pathophysiology of CIDP

Taken together this comprehensive study provides evidence fora so far unknown relevant contribution of NK cells to thepathogenesis of CIDP Furthermore the differential response ofsubpopulations of NK cells in responders and nonresponders toIVIg treatmentmay serve as a surrogatemarker in predicting theoutcome of IVIg treatment in patients with CIDP after re-production of the results in an independent cohort

AcknowledgmentThe authors thank Zippora Kohne for excellent technicalassistance

Study fundingGMeyer Zu Horste received grant support from the DeutscheForschungsgemeinschaft (DFG ME40504-1 ME40508-1)from the Grant for Multiple Sclerosis Innovation (GMSIMerck) from the InnovativeMedical Research (IMF) programof the University Munster and from the Ministerium fur In-novation Wissenschaft und Forschung (MIWF) of the stateNordrhein-Westfalen

DisclosureAK Mausberg and MK Heininger report no disclosures rele-vant to themanuscript GMeyer ZuHorste has received speakerhonoraria and served in advisory boards for LFB PharmaS Cordes M Fleischer F Szepanowski and C Kleinschnitzreport no disclosures relevant to the manuscript H-P Hartungreceived honoraria for serving on steering committees fromCSLBehring LFB and Octapharma outside this work from BayerHealthCare Biogen Celgene Receptos GeNeuro MerckNovartis Roche and TG Therapeutics with approval by theRector of Heinrich-Heine-University BC Kieseier reports nodisclosures relevant to the manuscript M Stettner served on thescientific advisory andor received speaker honoraria or travelfunding from UCB Biogen Idec Grifols Genzyme RocheMerck Novartis Octapharma Sanofi-Aventis Teva and BayerHealthCare Go to NeurologyorgNN for full disclosures

Publication historyReceived by Neurology Neuroimmunology amp NeuroinflammationDecember 8 2019 Accepted in final form August 7 2020


References1 Koller H Kieseier BC Jander S Hartung HP Chronic inflammatory demyelinating

polyneuropathy N Engl J Med 20053521343ndash13562 Vallat J-M Sommer C Magy L Chronic inflammatory demyelinating poly-

radiculoneuropathy diagnostic and therapeutic challenges for a treatable conditionLancet Neurol 20109402ndash412

3 Dalakas MC Advances in the diagnosis pathogenesis and treatment of CIDP NatRevNeurol 20117507ndash517

4 Bunschoten C Jacobs BC Van den Bergh PYK Cornblath DR van Doorn PAProgress in diagnosis and treatment of chronic inflammatory demyelinating poly-radiculoneuropathy Lancet Neurol 201918784ndash794

5 Querol L Siles AM Alba-Rovira R et al Antibodies against peripheral nerve antigens inchronic inflammatory demyelinating polyradiculoneuropathy Sci Rep 2017714411

6 Mausberg AK Dorok M Stettner M et al Recovery of the T-cell repertoire in CIDPby IV immunoglobulins Neurology 201380296ndash303

7 Mathey EK Park SB Hughes RAC et al Chronic inflammatory demyelinating pol-yradiculoneuropathy from pathology to phenotype J Neurol Neurosurg Psychiatr201586973ndash985

8 Leger J-M Guimaratildees-Costa R Muntean C Immunotherapy in peripheral neurop-athies Neurotherapeutics 20151396ndash107

9 Hughes RAC Donofrio P Bril V et al Intravenous immune globulin (10 caprylate-chromatography purified) for the treatment of chronic inflammatory demyelinatingpolyradiculoneuropathy (ICE study) a randomised placebo-controlled trial LancetNeurol 20087136ndash144

10 Brannagan TH Current diagnosis of CIDP the need for biomarkers J Peripher NervSyst 2011163ndash13

11 Kieseier BC Mathey EK Sommer C Hartung HP Immune-mediated neuropathiesNat Rev Dis Primers 2018431

12 Yoshii F Shinohara Y Natural killer cells in patients with Guillain-Barre syndromeJ Neurol Sci 1998157175ndash178

13 Fogel LA Yokoyama WM French AR Natural killer cells in human autoimmunedisorders Arthritis Res Ther 201315216

14 Van den Bergh PYK Hadden RDM Bouche P et al European Federation of Neu-rological SocietiesPeripheral Nerve Society guideline on management of chronicinflammatory demyelinating polyradiculoneuropathy report of a joint task force ofthe European Federation of Neurological Societies and the Peripheral NerveSocietymdashfirst revision Eur J Neurol 201017356ndash363

15 Hughes R Bensa S Willison H et al Randomized controlled trial of intravenousimmunoglobulin versus oral prednisolone in chronic inflammatory demyelinatingpolyradiculoneuropathy Ann Neurol 200150195ndash201

16 Warnke C Stettner M Lehmensiek V et al Natalizumab exerts a suppressive effect onsurrogates of B cell function in blood and CSF Mult Scler 2015211036ndash1044

17 Querol L Nogales-Gadea G Rojas-Garcia R et al Neurofascin IgG4 antibodies inCIDP associate with disabling tremor and poor response to IVIg Neurology 201482879ndash886

18 OrsquoBrien KL Finlay DK Immunometabolism and natural killer cell responses Nat RevImmunol 201919282ndash290

19 Poli A Michel T Theresine M Andres E Hentges F Zimmer J CD56bright naturalkiller (NK) cells an important NK cell subset Immunology 2009126458ndash465

20 Schwab I Nimmerjahn F Intravenous immunoglobulin therapy how does IgGmodulate the immune system Nat Rev Immunol 201313176ndash189

21 Bohn AB Nederby L Harbo T et al The effect of IgG levels on the number of naturalkiller cells and their Fc receptors in chronic inflammatory demyelinating poly-radiculoneuropathy Eur J Neurol 201118919ndash924

22 Hertwig L Hamann I Suarez SR et al CX3CR1‐dependent recruitment of matureNK cells into the central nervous system contributes to control autoimmune neu-roinflammation Eur J Immunol 2016461984ndash1996

23 Leavenworth JW Wang X Wenander CS Spee P Cantor H Mobilization of naturalkiller cells inhibits development of collagen-induced arthritis Proc Natl Acad Sci USA201110814584ndash14589

24 Campbell JJ Qin S Unutmaz D et al Unique subpopulations of CD56+ NK and NK-T peripheral blood lymphocytes identified by chemokine receptor expression rep-ertoire J Immunol 20011666477ndash6482

25 Moretta A Natural killer cells and dendritic cells rendezvous in abused tissues NatRev Immunol 20022957ndash965

26 Ferlazzo G Semino C Melioli G HLA Class I molecule expression is up-regulatedduring maturation of dendritic cells protecting them from natural killer cell-mediatedlysis Immunol Lett 20017637ndash41

27 Piccioli D Sbrana S Melandri E Valiante NM Contact-dependent stimulation andinhibition of dendritic cells by natural killer cells J Exp Med 2002195335ndash341

28 Tha-In T Metselaar HJ Tilanus HW et al Intravenous immunoglobulins suppressT-cell priming by modulating the bidirectional interaction between dendritic cells andnatural killer cells Blood 20071103253ndash3262

29 Schneider-Hohendorf T Schwab N Uceyler N Gobel K Sommer C Wiendl HCD8+ T-cell immunity in chronic inflammatory demyelinating poly-radiculoneuropathy Neurology 201278402ndash408

30 Chong WP Ling MT Liu Y et al Essential role of NK cells in IgG therapy forexperimental autoimmune encephalomyelitis PLoS One 20138e60862

31 Heming M Schulte-Mecklenbeck A Brix T et al Immune cell profiling of the ce-rebrospinal fluid provides pathogenetic insights into inflammatory neuropathiesFront Immunol 201910515

32 Nedvetzki S Sowinski S Eagle RA et al Reciprocal regulation of human natural killercells and macrophages associated with distinct immune synapses Blood 20071093776ndash3785

33 Crouse J Xu HC Lang PA Oxenius A NK cells regulating T cell responsesmechanisms and outcome Trends Immunol 20153649ndash58

34 Berger M Allen JA Optimizing IgG therapy in chronic autoimmune neuropathies ahypothesis driven approach Muscle Nerve 201551315ndash326

Appendix Authors

Name Location Contribution

Anne KMausbergPhD

Department ofNeurology UniversityHospital Essen Germany

Designed and performedthe experiments analyzedthe data and drafted themanuscript for intellectualcontent

Maximilian KHeiningerPhD

Department ofNeurology MedicalFaculty Heinrich-HeineUniversity DuesseldorfGermany

Major role in theacquisition of dataanalyzed the data andrevised the manuscript forintellectual content

Gerd MeyerZuHorsteMD

Department of Neurologywith Institute ofTranslational NeurologyUniversity HospitalMunster Germany

Major role in theacquisition of data andrevised the manuscript forintellectual content

SteffenCordes PhD

Oncology and TumorImmunology ChariteUniversity MedicineBerlin Germany

Major role in data analysis

MichaelFleischer MD


Major role in data analysisand statistical analysis

FabianSzepanowskiPhD


Major role in theacquisition of data

ChristophKleinschnitzMD


Revised themanuscript forintellectual content

Hans-PeterHartung MD



Bernd CKieseier MD


Analyzed the data andcoordinated the study

MarkStettner MDPhD


Coordinated and designedthe study and revised themanuscript for intellectualcontent


DOI 101212NXI000000000000088420207 Neurol Neuroimmunol Neuroinflamm

Anne K Mausberg Maximilian K Heininger Gerd Meyer Zu Horste et al NK cell markers predict the efficacy of IV immunoglobulins in CIDP

This information is current as of October 2 2020

ServicesUpdated Information amp

httpnnneurologyorgcontent76e884fullhtmlincluding high resolution figures can be found at

References httpnnneurologyorgcontent76e884fullhtmlref-list-1

This article cites 34 articles 6 of which you can access for free at

Subspecialty Collections

nating_polyneuropathyhttpnnneurologyorgcgicollectionchronic_inflammatory_demyeliChronic inflammatory demyelinating polyneuropathy

httpnnneurologyorgcgicollectionautoimmune_diseasesAutoimmune diseasesfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpnnneurologyorgmiscaboutxhtmlpermissionsits entirety can be found online atInformation about reproducing this article in parts (figurestables) or in

Reprints

httpnnneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

Academy of Neurology All rights reserved Online ISSN 2332-7812Copyright copy 2020 The Author(s) Published by Wolters Kluwer Health Inc on behalf of the AmericanPublished since April 2014 it is an open-access online-only continuous publication journal Copyright

is an official journal of the American Academy of NeurologyNeurol Neuroimmunol Neuroinflamm

Chronic inflammatory demyelinating polyneuropathy (CIDP)is an acquired chronic autoimmune disorder of the peripheralnervous system12 A broad spectrum of subtypes has beendescribed and its heterogeneity poses challenges to diagnos-tics treatment and pathogenic concepts34 Although etiopa-thogenesis and autoimmune targets have not been fullyelucidated there is strong evidence for the involvement ofcellular and humoral immune responses5ndash7

Immunomodulatory therapies can improve clinical signs and upto 80 of patients respond to 1 of the 3 first-line treatmentscorticosteroids plasma exchange and IV immunoglobulins(IVIgs)8 Although IVIg is therapeutically efficacious in close to70 of patients it takes 2ndash6 months before nonresponders canbe identified9 Although key opinion leaders in the field tend toswitch to the next treatment option even within the first 3months of ineffective treatment there is an underestimated timewindow in IVIg nonresponding patients without effective ther-apy Given the heterogeneity of therapeutic response patientswould greatly benefit from the availability of prognostic markersand surrogate markers which predict treatment response1011

Reduced numbers of natural killer (NK) cells or a diminutionin cytotoxic NK cell activity has been reported in variousautoimmune conditions such as MS systemic lupus eryth-ematosus rheumatoid arthritis or type I diabetes1213 How-ever the pathophysiologic contribution of NK cells in thecontext of CIDP has not been addressed in detail

To further understand the mode of action of IVIg in patientswith CIDP and to decipher the alterations which are re-sponsible for its therapeutic effect we took a prospectivelongitudinal approach to collect blood samples of patientswith CIDP before and after treatment initiation with IVIg andinvestigated immune cell populations in detail

MethodsStandard protocol approvals registrationsand patient consentsThe study was performed in accordance with the principlesof the Declaration of Helsinki and the local ethics commit-tees approved the study plan (Ethics Committee Universityof Essen and Ethics Committee University of Dusseldorf)Participants who provided written informed consent were in-cluded All participants were older than 18 years A total of 29patients with CIDP were investigated

Diagnosis and classification of patientswith CIDPA total of 29 patients withCIDP (age range 34ndash78 years mean age55 years) consented to be enrolled and peripheral blood sampleswere obtained before treatment initiation and 1 2 3 and 6monthsafter the first infusion of IVIg CIDP was diagnosed according tothe European Federation of Neurological SocietiesPeripheralNerve Society criteria14 All patients had not received treatmentsother than methylprednisolone or plasma exchange before sam-pling and had been without immunomodulatory or immunosup-pressive treatment for at least 4 weeks before sampling Patientswere observed in monthly intervals for up to 2 years Samples ofpatients were excluded when they did not meet quality standards(cell viability messenger RNA [mRNA] quality and false-negativeor false-positive controls during measurements of the samples)

Summed Inflammatory Neuropathy Cause and Treatment(INCAT) disability scores were assessed as previously describedat each visit15 Briefly the INCAT disability score assessesfunctional disability on an ordinal scale ranging from 0 (nodisability) to 5 (no purposeful movement possible) for upperand lower extremities The summed INCAT score is addedfrom both values and can thus range from 0 to 10 Patients wereclassified as responders if the INCAT sum score declined at least1 point during 6 months of treatment Furthermore they wereclassified as responders if they stabilized under IVIg treatmentwith a progression of at least 2 points of the INCAT sum scoreover a period of 6 months before IVIg initiation

Peripheral bloodmononuclear cell preparationEthylenediaminetetraacetic acid (EDTA) tubes were used tocollect peripheral blood mononuclear cells (PBMCs) andPAXgene tubes to collect RNA Fresh blood samples inEDTA tubes were purified using Ficoll (Invitrogen Man-nheim Germany) gradient centrifugation according to themanufacturerrsquos protocol on the day of collection Cells weredivided into aliquots one was freshly used for flow cytometryanalyses and the others were stored in 10 dimethylsulfoxidefetal calf serum in liquid nitrogen until further use

Real-time PCRTotal RNA was isolated using the PAXgene preparation kitaccording to the manufacturerrsquos instructions and quantified(Nanodrop 2000 Thermo Scientific Waltham MA) Syn-thesis of complementary DNA (cDNA) was performed using1 μg of total RNA with Moloney murine leukemia virus re-verse transcriptase RNAse OUT deoxynucleoside triphos-phates and oligo dT primer (all Invitrogen)

GlossaryADCC = antibody-dependent cytotoxicity ANOVA = analysis of variance BNB = blood-nerve barrier cDNA =complementary DNA CIDP = chronic inflammatory demyelinating neuropathy DC = dendritic cell EAE = experimentalautoimmune encephalomyelitis EDTA = ethylenediaminetetraacetic acid IFNγ = interferon gamma INCAT = InflammatoryNeuropathy Cause and Treatment IVIg = IV immunoglobulin mRNA = messenger RNA NCAM1 = neural cell adhesionmolecule 1 NK = natural killer PBMC = peripheral blood mononuclear cell TNFα = tumor necrosis factor alpha










Productlength (nt)






















144



































































































Appendix Authors


Anne KMausbergPhD









SteffenCordes PhD



MichaelFleischer MD












Bernd CKieseier MD



MarkStettner MDPhD
















Reprints












Productlength (nt)






















144



































































































Appendix Authors


Anne KMausbergPhD









SteffenCordes PhD



MichaelFleischer MD












Bernd CKieseier MD



MarkStettner MDPhD
















Reprints



























































































Appendix Authors


Anne KMausbergPhD









SteffenCordes PhD



MichaelFleischer MD












Bernd CKieseier MD



MarkStettner MDPhD
















Reprints
















Reprints




nk cell markers predict the efficacy of iv immunoglobulins

Documents