ORIGINAL ARTICLE

NKD1 correlates with a poor prognosis and inhibits cellproliferation by inducing p53 expression in hepatocellularcarcinoma

Sheng Zhang1 & Jie Li2 & Xiaomin Wang1,2

Received: 23 February 2016 /Accepted: 12 July 2016# International Society of Oncology and BioMarkers (ISOBM) 2016

Abstract Naked cuticle 1 (NKD1), a negative regulator of theWnt signaling pathway, is abnormally expressed in manytypes of malignant tumors. Yet the role and mechanism ofNKD1 in hepatocellular carcinoma (HCC) cell proliferationand its relationship with HCC patients’ prognosis have beenpoorly characterized. In the present study, real-time polymer-ase chain reaction (PCR) was used to examine the mRNAexpression patterns of NKD1 in the tissues of 60 patients withHCC and corresponding adjacent non-tumor tissues andfound that NKD1 mRNA expression in HCC tissues was rel-atively lower than that in non-tumor tissues and negativelycorrelated with tumor size. Kaplan–Meier survival curves un-covered that patients with lower NKD1 expression had apoorer post-operative prognosis than those with higher ex-pression. In addition, over-expression of NKD1 inhibited theHCC cell proliferation ability, whereas knockdown of NKD1had the opposite effect. In vivo assays showed that miceinjected with SMMC-7721 + control cells had bigger tumornodules than those injected with SMMC-7721 + NKD1.

Mechanism studies demonstrated that NKD1 repressed HCCcell proliferation by inducing p53 expression. Taken together,our study revealed that NKD1 mRNA expression was down-regulated in HCC tissues and correlatedwith a poor prognosis.NKD1 inhibited HCC cell proliferation by inducing p53expression.

Keywords NKD1 . p53 . Proliferation . Prognosis .

Hepatocellular carcinoma

Introduction

Hepatocellular carcinoma (HCC) is the sixth most com-mon malignant tumor and the third leading cause ofcancer-related deaths worldwide [1, 2]. Although greatefforts have been made for improving early diagnosisand treatment, there are currently no efficacious therapiesfor HCC patients, even the overall survival rate is ex-tremely disappointing [3]. Thus, there is an urgent needto explore a better understanding of HCC developmentand progression, which may uncover new therapeuticstrategies for this disease.

Naked cuticle 1 (NKD1) functions as an antagonist of Wntsignaling via preventing the nuclear accumulation of β-catenin [4, 5]. Meanwhile, once the Wnt/β-catenin signalingpathway is activated by Wnt3a, some downstream genes areupregulated including NKD1 gene [6]. Since it was discov-ered in 2001, emerging evidence has implicated that NKD1 isdysregulated in multiple human cancers, including colorectaladenoma [7], hepatoblastoma [8], and HCC [9], suggestingthat it may play a critical role in tumorigenicity and

Electronic supplementary material The online version of this article(doi:10.1007/s13277-016-5173-0) contains supplementary material,which is available to authorized users.

* Xiaomin Wangwxm2203@xmu.edu.cn

1 Department of Hepatobiliary Surgery, The Affiliated Union Hospitalof Fujian Medical University, Fuzhou, Fujian, China

2 Fujian Provincial Key Laboratory of Chronic Liver Disease andHepatocellular Carcinoma, XiamenUniversity Affiliated ZhongShanHospital, Xiamen, Fujian, China

Tumor Biol.DOI 10.1007/s13277-016-5173-0

progression. Furthermore, study in breast cancer found outthat NKD1 is associated with histological grade and estrogenreceptor expression [10]. Downregulation of NKD1 via RNAinterference-mediated approach demonstrated that its proteinexpression not only correlated with lymph node metastasis inlung adenocarcinoma [11] but also with a poor prognosis innon-small cell lung cancer [12]. Data from our previous studyrevealed that NKD1 protein expression is downregulated inHCC tissues and correlates with series of clinicopathologicparameters such as histological differentiation, tumor size,and intra- or extrahepatic metastasis [13]. However, the pre-cise function and mechanism underlying the role of NKD1 inHCC cell proliferation and its relationship with patients’ prog-nosis remain unclear.

p53, a tumor suppressor, is activated in response togenotoxic stress through post-translational modifications suchas acetylation and phosphorylation which results in p53 pro-tein stabilization and nuclear localization, leading to its bind-ing to sequence-specific promoters of target genes as a finaloutcome of its function as a transcription factor [14]. In addi-tion, p53 activation induces the transcription of target genesinvolved in the cell growth arrest and apoptosis of cancerssuch as HCC, and thus, it is a crucial regulator of HCC cellproliferation [15].

In this study, we evaluated the role of NKD1 in HCC andinvestigated the putative relationship between NKD1 and p53.To this end, real-time polymerase chain reaction (PCR) wasused to examine NKD1 mRNA expression in the tissues ofpatients with HCC and determined the relationship with over-all survival. In addition, the overexpression and shRNA-mediated downregulation of NKD1 was performed to evalu-ate its role in HCC cell proliferation, clone formation, andapoptosis in vitro and in vivo. What is more, p53 inhibitorwas used to find out the potential mechanism for the influenceof NKD1 on HCC cells proliferation ability. To the best of ourknowledge, this is the first study to show that NKD1 inhibitsHCC cell proliferation via crosstalk with p53, providing evi-dence that NKD1 may have great clinical value as a therapeu-tic target in HCC.

Materials and methods

Cell lines and cell culture

Human HCC cell lines (MHCC-97H, HepG2, SMMC-7721,Huh7 and Hep1) were purchased from the cell bank ofShanghai Institute of Cell Biology (Shanghai, China) andwere cultured in complete growth media (HyClone, Logan,UT, USA) supplemented with 10 % fetal calf serum

(Biological Industries, Shanghai, China), 100 IU/ml penicil-lin, and 100 μg/ml streptomycin (Sigma, St. Louis, MO,USA). All cell cultures were maintained at 37 °C in a 5 %CO2 incubator.

Patients and specimens

All of the clinical tissue samples and follow-up informationwere obtained from the Chronic Liver Disease BiologicalSample Bank, Department of Hepatobiliary Surgery,ZhongShan Hospital Xiamen University, XiaMen, China.Written informed consent for tissue analysis was obtainedfrom each patient prior to specimen collection, and utilizationof the tumor materials for research purposes was carried out inaccordance with the approved guidelines and approved by theEthics Committee (No: 20,111,008) of ZhongShan HospitalXiamen University. The tissue samples of tumor and pairedparallel non-tumor portion from the same case were quicklyfrozen in liquid nitrogen and stored at −80 °C for furthermRNA analyses. All of the patient’s characteristics are sum-marized in Table S1.

RNA isolation and real-time PCR

Total RNA was obtained from human fresh tissues and cellsamples using the TRIzol reagent (Invitrogen, Shanghai,China) as described by the manufacturer. Real-time PCRwas performed to examine the mRNA levels of the indicatedgenes. β-actin was used as an internal control. Primers weredesigned and synthesized by BGI-Tech (Shenzhen, China).The sequences of the primers were as follows: NKD1, for-ward, 5′-CAGCGGAGATGAGAAGAAGATG-3′; reverse,5′-CAAAGTCATACAGGGTGAAGGT-3′. β-actin, forward,5′-ATAGCACAGCCTGGATAGCAACGTAC-3′; reverse,5′-CACCTTCTACAATGAGCTGCGTGTG-3′. A dissocia-tion procedure was performed to generate a melting curvefor confirmation of amplification specificity.

Plasmid construction and lentivirus preparation

As previously described [16], shRNA sequences (shown inTable 1) against NKD1 were cloned into the pSIREN-RetroQpuro RNA interference vector (Purchased fromTakara Bio, China) for the purpose of downregulatingNKD1 expression. An empty vector was used as a control.What is more, a 1413 base pair genomic sequence of theNKD1 coding region was cloned into the backbone of thePBOBI-CMV vector (purchased from Takara Bio, China)for the purpose of enhancing NKD1 expression. A stable cellline was generated by puromycin selection.

Tumor Biol.

CCK-8 assay

Approximately 4 × 103 cells per well were plated onto 96-wellplates in triplicate. Cell Counting Kit-8 (CCK-8) assays werep e r f o rmed u s i ng t h e K i t ( #YB-K001 , YiyuanBiotechnologies, Guangzhou, China) according to the manu-facturer’s instructions for the purpose of detecting cell prolif-eration ability. Optical density (OD) values were measured ata wavelength of 450 nm by a microplate reader. All experi-ments were performed three times, and the average resultswere calculated.

EdU assay

The EdU assay was performed using the EdU assay kit(RiboBio, Guangzhou, China) according to the manufac-turer’s instructions. In short, cells were cultured in triplicatein 24-well plates and incubated with 50 nM EdU for 2 h at37 °C. Then, cells were fixed in 4 % formaldehyde for 15 minand treated with 0.5 % Triton X-100 for 20 min at roomtemperature. After being washed three times with phosphate-buffered saline (PBS), the cells were visualized using a fluo-rescence microscope (Zeiss, Oberkochen, Germany).

Colony formation assay

A total of 5 × 104 cells per well were seeded into 24-wellplates and cultured for about 3 weeks in culture media.These cultures were stained with 0.4 % crystal violet. Clonesbeyond 2 mmwere counted and the number of clones per wellwas averaged from three wells. Experiment was repeated atleast three times.

Western blot analysis

Briefly, equal amounts of extracted protein were separated bysodium dodecyl sulfate polyacrylamide gel electrophoresisand blotted onto polyvinylidene difluoride membranes. Themembrane was blocked in 5 % skimmed milk and incubated

with primary antibodies against NKD1 (1:1000, #2262, CST),p53 (1:500, 21,891–1-AP, Proteintech), p21 (1:1000, #2947,CST), proliferating cell nuclear antigen (PCNA, 1:500,60,097–1-Ig, Proteintech), and β-actin (1:1000, AT0001,CMCTAG). After incubation with peroxidase-coupled sec-ondary antibodies, blots were developed using enhancedchemiluminescence reagents (K-12,045-D50, Advansta,USA).

Immunohistochemistry

As previously described [17], mice tumor specimens werefixed in 10 % neutral formalin and embedded in paraffin,and 4-μm-thick sections were prepared using a microtome(#HM315, Thermo Scientific, Waltham, USA). In order tocompare the expression level of PCNA in the mice tumortissues, the immunohistochemistry study was performed bythe streptavidin peroxidase method according to the instruc-tions of the Elivision™ super Kit (#9921, Maixin, Fuzhou,China). All sections were examined by two independent pa-thologists who were blinded to the experimental data.

Animal studies

Animal work was performed in compliance with the InstitutionalAnimal Care and Use Protocol of Xiamen University. A total of2 × 105 cells were injected subcutaneously into the armpit of 4–5-week-old nude mice (10 mice with the SMMC-7721 Ctrl andSMMC-7721 NKD1 overexpression groups, respectively).Tumor growth was monitored once a week using a caliper, andtumor volumewas calculated using the following formula: tumorvolume = (width2 × length)/2. All procedures involving experi-mental mice were performed in accordance with relevant proto-cols and regulation that were approved by the Committee forAnimal Research of Xiamen University and complied with theguideline for the Care and Use of Laboratory Animals (NIHpublication No. 86–23, revised 1985).

Table 1 Primers sequences

Primername

F:5′-3′ R:5′-3′

shRNA NKD1–1 ccggtAGGAGAAACCACTACTTAGTTCAAGAGACTAAGTAGTGGTTTCTCCTTTTTTTACGCGTg

aattcACGCGTAAAAAAAGGAGAAACCACTACTTAGTCTCTTGAACTAAGTAGTGGTTTCTCCTa

NKD1–2 ccggtGCCATGAACATCACCACCATTTCAAGAGAATGGTGGTGATGTTCATGGTTTTTTACGCGTg

aattcACGCGTAAAAAACCATGAACATCACCACCATTCTCTTGAAATGGTGGTGATGTTCATGGCa

Pbobi-cmv NKD1 CCGCTCGAGATGGATTACAAGGATGACGACGATAAGGGGAAACTTCACTCCAAGCC

CGGAATTCCTATGTCTGGTAGAAGTGGT

Tumor Biol.

Data analysis

All of the experiments were independently repeated at least intriplicate. Results are expressed as mean ± standard deviationand were analyzed using SPSS 21.0 software (IBM, NewYork, USA). The Wilcoxon non-parametric test was per-formed for comparing two related different groups. Survivalcurves were calculated by the Kaplan–Meier test. P values lessthan 0.05 were considered statistically significant.

Results

NKD1 mRNAwas downregulated in HCC tissuesand correlates with a poor prognosis in patients

We previously showed that NKD1 protein expression isdownregulated in HCC tissues [13]. In this study, we

examined NKD1 mRNA expression levels in 60 pairedHCC tissues and adjacent normal tissues, and results showedthat it was downregulated in HCC tissues compared to thecorresponding non-tumor tissues (46/60 = 76.7 %,P < 0.0001, Fig. 1a). In addition, statistical analysis (non-parametric test) showed that NKD1 mRNA expression inHCC tissues was negatively correlated with tumor size(P = 0.002, Fig. 1b). Next, the association of NKD1 mRNAexpression with clinical outcomes in HCC patients (n = 28)was analyzed by Kaplan–Meier survival analysis. As shownin Fig. 1c, patients with lower NKD1 expression (which wasdefined as the mRNA levels were less than the median value)had a shorter overall post-operative survival time than thosewith higher NKD1 expression (P = 0.029). In addition, theexpression level of NKD1 was positively correlated with the1-year survival rate specifically; the rate was 53.8 % in pa-tients with lower NKD1 expression and 92.9 % in those withhigher expression (P = 0.033, Table 2). The dysregulation of

Fig. 1 Reduction of NKD1mRNA expression in HCC wasassociated with a poor prognosis.a The mRNA level of NKD1 wasquantified using real-time PCR in60 paired HCC and non-tumortissues (normal). Statistical anal-ysis showed that NKD1 mRNAexpression in HCC was signifi-cantly lower than that in the adja-cent normal liver tissues (46 of60 = 76.7 %, P < 0.0001). b Non-parametric test showed thatNKD1 mRNA expression inHCC tissues was negatively cor-related with tumor size(P = 0.002). c Patients with lowerNKD1 expression had a shorteroverall post-operative survivaltime than those with higherNKD1 expression (P = 0.029)

Tumor Biol.

NKD1 in HCC patients suggests that it may function as atumor suppressor in HCC tumorigenesis and progression.

Downregulation of NKD1 promotes HCC cellproliferation, whereas enhanced NKD1 expressioninhibits proliferation

Our previous research in HCC tissues demonstrated that thedownregulation of NKD1 in HCC correlated with tumor size[13], suggesting its potential role in regulating HCC cell prolif-eration and growth. Because the proliferative abilities of tumorcells are crucial for tumor size, we performed a series of assays toevaluate the role of NKD1 in HCC cell proliferation. First, weexamined the NKD1 protein expression pattern in some HCCcell lines. Western blot analysis showed relatively high NKD1expression in HepG2 cells, whereas SMMC-7721 cells lackedNKD1 expression (Fig. 2a). Therefore, these two cell lines wereselected for subsequent loss-of-function and gain-of-functionanalyses, respectively. The efficiencies of knockdown and over-expression in these cells was confirmed and shown in Fig. 2b. Toinvestigate the role of NKD1 in the proliferative ability of HCCcells, several systematic assays were performed in stable NKD1-knockdown HepG2 cells and NKD1-overexpression SMMC-7721 cells. A CCK-8 assay showed that the enhanced expressionof NKD1 significantly decreased cells proliferation in contrast tocontrol, while silence of NKD1 promoted the proliferation ofHCC cells (Fig. 2c, P < 0.01). As shown in Fig. 2d, NKD1-overexpression SMMC-7721 cells had a significantly lower rateof EdU incorporation than Ctrl SMMC-7721 cells (36 vs. 18 %,P < 0.05). In contrast, NKD1-knockdown HepG2 cells had sig-nificantly increased cell proliferation (from 25 to 63 % EdU-positive cells, P < 0.05). Similarly, colony formation assaysshowed that NKD1 expression was negatively correlated withthe number and size of clonogenicity (P < 0.01, Fig. 2e).Together, these data demonstrate that NKD1 negatively regulatesHCC cell proliferation in vitro.

NKD1 inhibits HCC cell proliferation partlythrough inducing p53 expression

The aforementioned data shows that NKD1 negatively regulatesHCC cell proliferation; however, the underlying molecularmechanism remains poorly understood. Considering the fact thatp53 is a critical regulator of cell survival and proliferation, we

presumed that p53 may be responsible for the proliferation in-duced byNKD1. Therefore, we usedwestern blotting to examinethe expression of p53 in NKD1 overexpression cell lines andfound that the protein expression of p53 and p21 was significant-ly increased in these cells compared to control cells (Fig. 3).Since NKD1 can inhibit HCC cell proliferation and regulatep53 protein levels in HCC cells, we sought to determine if p53upregulation is required for NKD1-induced HCC cell prolifera-tion. This hypothesis was supported by our rescue experiment,which demonstrated that treatment with the specific p53 inhibi-tor, pifithrin-a, drastically attenuated NKD1-mediated inhibitionof PCNA expression, a cell proliferation marker. Transfection ofNKD1 impaired the expression of PCNA, whereas the expres-sion of PCNA protein was partially restored by the treatment ofNKD1-overexpression SMMC-7721 cells with pifithrin-a(Fig. 3). These results confirm that p53 is critical factor for theregulation of HCC cell proliferation by NKD1.

NKD1 suppressed xenograft tumor growth in vivo

To determine if NKD1 had similar effects in vivo, xenograftmodel was constructed via the subcutaneous injection of nudemice injection with equal amounts of NKD1-overexpressionand Ctrl SMMC-7721 cells. Thereafter, we monitored tumorgrowth over a 35-day period. At the end of the observationperiod, the animals were sacrificed and tumors were removedand weighed. As shown in Fig. 4a, tumor growth in the NKD1overexpression group was significantly smaller than that in thecontrol group (P < 0.01). What is more, the mice with theNKD1 overexpression groups had a slower growth speedand lighter tumor weight compared with the control group(Fig. 4b, c). To further confirm the role of NKD1 in HCCcells, PCNA protein levels in tumor nodules were assessedby immunohistochemistry. As shown in Fig. 4d, the enhancedexpression of NKD1 caused a significant decrease in PCNAprotein levels in transplanted tumor tissue. These findings areconsistent with our in vitro data and indicate that NKD1 sup-presses xenograft tumor growth in vivo.

Discussion

The Wnt/β-catenin signaling pathway, which plays an impor-tant role in tumor cell proliferation [18], is aberrantly activated

Table 2 The 1-year survival rateamong differential expressions ofNKD1

NKD1 expression Survival (month) N 1-year survival ratio (%) P value

≥12 <12

Lower expression 7 6 13 53.8 % 0.033*Higher expression 13 1 14 92.9 %

*p < 0.05

Tumor Biol.

Fig. 2 Downregulation of NKD1 promotes HCC cell proliferation,whereas ectopic expression inhibits HCC cell proliferation. aEndogenous expression of NKD1 was examined in some HCC celllines by western blotting. b Western blot analysis showed that cellstransfected with the pBOBI-NKD1 plasmid significantly enhancedNKD1 expression in SMMC-7721 cells, whereas shRNA-mediatedknockdown of NKD1 markedly decreased its protein levels in HepG2cells, especially sh2-RNA. c CCK-8 assay showed that NKD1 overex-pression in SMMC-7721 cells caused a decrease in cell proliferation,

whereas a time-dependent increase was seen in HepG2 cell proliferationin cells transfected with NDK1 sh2-RNA. d NKD1-overexpressionSMMC-7721 cells had a significantly lower positive EdU incorporationrate than Ctrl cells. In contrast, NKD1-knockdown in HepG2 cells sig-nificantly promoted cell proliferation. e Colony formation assay was per-formed in NKD1 knockdown and overexpression cells. A marked in-crease and decrease in colony number and size is seen in groups withNKD1 knockdown and ectopic expression, respectively. *P < 0.05 and**P < 0.01

Tumor Biol.

in HCC [19]. NKD1 negatively regulates this signaling path-way via sequestering disheveled protein (Dvl) and preventingthe nuclear accumulation of β-catenin as well [4, 5].Dysregulation of NKD1 has been reported in many types ofneoplasms and has some critical clinical pathological signifi-cance. Although the various biological functions of NKD1have been extensively studied, the relationship betweenNKD1 and the prognosis of patients with HCC and its rolein HCC cell proliferation remains poorly understood. Here,we showed that NKD1 mRNA was downregulated in HCCtissues and correlated with a poor prognosis. In vitro experi-ments showed that NKD1 significantly inhibited HCC cellproliferation ability in part, through induction of p53 expres-sion. Furthermore, the ectopic expression of NKD1 resulted inthe inhibition of tumor growth in vivo, which is consistentwith data from our in vitro experiments.

Cancer development and progression is a multistepprogram, both tumor growth and adhesion-dependent mi-gration in tissue are important prerequisite for cancer celldissemination and metastasis [20]. In addition, metastasisis the main cause of mortality in patients with HCC [21].Since our previous research in HCC tissues showed thatthe abnormal expression of NKD1 in HCC tissues corre-late with many tumor malignant phenotypes such as tu-mor size, poor differentiation, and metastasis [13], wespeculated that NKD1 may act as a predictor marker forpatient prognosis. Kaplan–Meier survival curves showedthat the survival time and 1-year survival rate were shorterand lower in HCC patients with low NKD1 expressionthan those with high expression. However, we realize thatthis analysis could potentially be improved and solid witha larger sample size cases and longer follow-up time.

p53 is one of the crucial regulators of HCC cell prolifera-tion [22, 23], and NKD1 negatively regulates tumor growth.Based on the above, we evaluated a putative relationship be-tween NKD1 and p53 and found that NKD1 can positivelyregulate p53 protein expression. However, the underlyingmechanism, albeit direct or indirect, remains unclear, whichneed further studied. As a specific inhibitor of p53, pifithrin-acan suppress the transcription of some genes which are acti-vated by p53, such as p21 and MDM2. When pifithrin-a wasadded to the NKD1-overexpression HCC cells, cell prolifera-tion was partly restored. Guo et al. demonstrated that mutantNKD1 proteins are defective at inhibiting Wnt signaling; inother words, mutant NKD1 do not have the ability to bind anddestabilize Dvl proteins, with a consequence of upregulatingβ-catenin protein levels and further promoting the prolifera-tion of the colonic epithelial cell line CCD841 [24]. Hence, weconclude that HCC cell proliferation is regulated not only bythe NKD1/p53/p21 pathway but also by other possible un-known molecular mechanisms, such as activation of theNKD1/Wnt-β-catenin pathway at least. Additional studiesare needed to confirm this hypothesis.

In this study, we demonstrated that NKD1 inhibits HCCcell proliferation and is positively associated with HCC cellapoptosis (Fig. S1). In addition, NKD1 mRNA expressionwas downregulated in HCC tissues and correlated with a poorprognosis. Functional experiments revealed that NKD1 caninhibit HCC cell proliferation partly through p53. These datademonstrate that NKD1 may function as a tumor suppressor,at least in HCC. Hence, a better understanding its role in thisdisease will provide clues that maybe increase the survivaltime of patients with HCC and lead to the development ofnew therapeutic strategies for this malignancy.

Fig. 3 NKD1 inhibits HCC cell proliferation partly through p53. aWestern blot analysis shows that NKD1 transfection increased p53 andp21 protein expression, but decreased PCNA expression. The p53specific inhibitor pifithrin-a attenuated the inhibitory function of NKD1

on PCNA protein expression partly. b Statistical description of the rela-tive density of PCNA protein (PCNA/GAPDH). **P < 0.01 and***P < 0.001

Tumor Biol.

Fig. 4 NKD1 suppresses HCC growth in mouse models. aMacrographof mice and tumors in the NKD1 overexpression group (bottom) andcontrol group (top) at the end of the experiment. b Growth curves ofCtrl and NKD1-overexpression models. c Tumor weight in the NKD1

overexpression group was smaller than that in the control group. dImmunohistochemistry analysis of PCNA protein expression in miceinjected with NKD1-overexpression and control cells. **P < 0.01 and***P < 0.001

Tumor Biol.

Acknowledgments We sincerely thank Alfred Sze Lok Cheng andYingying Lee (Chinese University of Hong Kong) for kindly providingthe plasmid for NKD1. And we also appreciate all of the patients partic-ipated in this study. This study was supported by grants from the NationalNatural Science Foundation of China (No. 81401945 and No. 81472231),the Youth Project of Fujian provincial Health and Family Planning com-mission (NO. 2013-2-89), the Science and Technology Project ofXiamen, China (NO. 3502Z20164023) and the Medical InnovativeProject of Fujian provincial Health and Family Planning commission(No. 2015-CXB-40).

Compliance with ethical standards

Conflicts of interest There is no conflict of interest between theauthors.

References

1. Park YY, Kim SB, Han HD, Sohn BH, Kim JH, Liang J, et al. Tat-activating regulatory DNA-binding protein regulates glycolysis inhepatocellular carcinoma by regulating the platelet isoform of phos-phofructokinase through microRNA 520. Hepatology. 2013;58:182–91.

2. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics 2002.CA Cancer J Clin. 2005;55:74–108.

3. Befeler AS, Di Bisceglie AM. Hepatocellular carcinoma: diagnosisand treatment. Gastroenterology. 2002;122:1609–19.

4. Van Raay TJ, Fortino NJ, Miller BW, Ma H, Lau G, Li C, et al.Naked1 antagonizes Wnt signaling by preventing nuclear accumu-lation of beta-catenin. PLoS One. 2011;6:e18650.

5. Larraguibel J, Weiss AR, Pasula DJ, Dhaliwal RS, Kondra R, VanRaay TJ. Wnt ligand-dependent activation of the negative feedbackregulator Nkd1. Mol Biol Cell. 2015;26:2375–84.

6. Yan D, Wiesmann M, Rohan M, Chan V, Jefferson AB, Guo L,et al. Elevated expression of axin2 and hnkd mRNA provides evi-dence that Wnt/beta -catenin signaling is activated in human colontumors. Proc Natl Acad Sci U S A. 2001;98:14973–8.

7. Caldwell GM, Jones CE, Soon Y, Warrack R, Morton DG,Matthews GM. Reorganisation of Wnt-response pathways in colo-rectal tumorigenesis. Br J Cancer. 2008;98:1437–42.

8. Koch A, Waha A, Hartmann W, Hrychyk A, Schüller U, Waha A.Elevated expression of Wnt antagonists is a common event inhepatoblastomas. Clin Cancer Res. 2005;11:4295–304.

9. Cheng AS, Lau SS, Chen Y, Kondo Y, Li MS, Feng H, et al. EZH2-mediated concordant repression of Wnt antagonists promotes beta-

catenin-dependent hepatocarcinogenesis. Cancer Res. 2011;71:4028–39.

10. Lv ZD, Zhang L, Liu XP, Jin LY, Dong Q, Li FN, et al. NKD1down-regulation is associated with poor prognosis in breast inva-sive ductal carcinoma. Int J Clin Exp Pathol. 2015;8:4015–21.

11. Ahn S, Hwangbo W, Kim H, Kim CH. Naked cuticle drosophila 1expression in histologic subtypes of small adenocarcinoma of thelung. Korean J Pathol. 2013;47:211–8.

12. Zhang S, Wang Y, Dai SD, Wang EH. Down-regulation of NKD1increases the invasive potential of non-small-cell lung cancer andcorrelates with a poor prognosis. BMC Cancer. 2011;11:–186.

13. Zhang S, Li J, Yin ZY, Liu PG, ZhaoWX,Xie CR, et al. Expressionpattern and clinicopathologic significance of NKD1 in human pri-mary hepatocellular carcinoma. APMIS. 2015;123:315–20.

14. Brooks CL, Gu W. Ubiquitination, phosphorylation and acetyla-tion: the molecular basis for p53 regulation. Curr Opin Cell Biol.2003;15:164–71.

15. Vousden KH, Lane DP. p53 in health and disease. Nat RevMol CellBiol. 2007;8:275–83.

16. Zhang S, Li J, Liu P, Xu J, Zhao W, Xie C, et al. Pygopus-2 pro-motes invasion andmetastasis of hepatic carcinoma cell by decreas-ing E-cadherin expression. Oncotarget. 2015;6:11074–86.

17. Zhang S, Li J, He F, Wang XM. Abnormal nuclear expression ofPygopus-2 in human primary hepatocellular carcinoma correlateswith a poor prognosis. Histopathology. 2015;67:176–84.

18. Ma Y, Zhu B, Liu X, Yu H, Yong L, Liu X, et al. Inhibition ofoleandrin on the proliferation show and invasion of osteosarcomacells in vitro by suppressing Wnt/beta-catenin signaling pathway. JExp Clin Cancer Res. 2015;34:115.

19. Wands JR, Kim M. WNT/β-catenin signaling and hepatocellularcarcinoma. Hepatology. 2014;60:452–4.

20. Koontongkaew S. The tumor microenvironment contribution todevelopment, growth, invasion and metastasis of head and necksquamous cell carcinomas. J Cancer. 2013;4:66–83.

21. Chung AS, Lee J, Ferrara N. Targeting the tumour vasculature:insights from physiological angiogenesis. Nat Rev Cancer.2010;10:505–14.

22. Wei JC, Meng FD, Qu K, Wang ZX, QF W, Zhang LQ, et al.Sorafenib inhibits proliferation and invasion of human hepatocellu-lar carcinoma cells via up-regulation of p53 and suppressingFoxM1. Acta Pharmacol Sin. 2015;36:241–51.

23. Zhao B, Zhao W, Wang Y, Xu Y, Xu J, Tang K, et al. Connexin32regulates hepatoma cell metastasis and proliferation via the p53 andAkt pathways. Oncotarget. 2015;6:10116–33.

24. Guo J, Cagatay T, Zhou G, Chan CC, Blythe S, Suyama K, et al.Mutations in the human naked cuticle homolog NKD1 found incolorectal cancer alter Wnt/Dvl/beta-catenin signaling. PLoS One.2009;4:e7982.

Tumor Biol.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具