notch sigalling pathway regulates the terminal … · 2018. 7. 25. · shao jin, zhou yinghong,...

NOTCH SIGALLING PATHWAY

REGULATES THE TERMINAL

DIFFERENTIATION OF

OSTEOBLASTS

Jin Shao

BDS, MDS

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Institute of Health and Biomedical Innovation

Science & Engineering Faculty

Queensland University of Technology

2018

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS i

Keywords

Notch, Wnt, bone modelling and remodelling, osteogenesis, osteogenic

differentiation, IDG-SW3 cell line, Hes1, E11, DMP1, Akt, PTEN

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS iii

Abstract

The osteogenic process contains a series of successive differentiated steps from

BMSCs to osteocytes as the terminal stage of differentiation. Some factors and

signalling pathways play a role in the initiation and early stage differentiation of

osteogenesis, for example, Runx2 has been confirmed as a key transcriptional factor

to initiate osteoblastic differentiation. As the following step, the terminal

differentiation from osteoblasts to osteocytes is also an important physical process in

mediating mineralisation and maintaining the bone strength. However, the

mechanisms that regulate the terminal differentiation are largely unknown. This

thesis aims to fill this knowledge gap by exploring the molecular mechanisms

underlying the terminal differentiation for future application to improve the quality

of bone mineralisation.

First, a candidate signalling pathway, Notch, has been determined as a potential

target because Notch is a highly conserved mechanism in cell fate determination

throughout the animal kingdom and plays a role in terminal differentiation in various

tissues such as skin. In the first part of this thesis, several markers of the Notch

signalling pathway have been chosen to represent signalling intensity.

Immunostaining of Hes1 was conducted in normal rat femur samples as well as in

BMSC osteogenic culture, and the results revealed that osteocytes expressed Hes1

while osteoblasts did not. Also, Hes1, Notch1, and Rbp-jκ were all increased at

transcriptional level. Moreover, a Rbp-jκ luciferase reporter vector was transfected

into the IDG-SW3 cell line, and the luciferase intensity also increased during the late

stage of differentiation. Together, these results suggest that Notch signalling

increases during the transition from osteoblasts to osteocytes, which forces

researchers to reconsider the functions of Notch in osteocytes.

Next, the Notch signalling was inhibited by DAPT to testits role in regulating

osteocytes regarding proliferation, morphology, and mineralisation. FACS based on

the EdU labelled proliferation cells was conducted, and results indicate that Notch

inhibits cell proliferation at a very late stage of differentiation. The data from

ivNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

morphological studies by SEM and immunostaining also suggest Notch plays a role

in the transition from a cubic osteoblast to a dendritic osteocyte. In the mineralisation

aspect, we found that DMP1 expression was decreased after Notch blockage.

Moreover, the mineral structures and mechanical properties were also impacted with

a deficient Notch signalling pathway. Even the intracellular mineral transport

presented abnormal particles that were too small for efficient extracellular mineral

deposit. The results presented in this part reveal the roles of Notch in osteocytes’

phenotype.

Finally, the mechanisms underlying how the Notch signalling pathway regulates the

osteocytes’ functions are discussed. The E11 and DMP1 promotor regions were

cloned into a luciferase reporter vector and two approaches to activate Notch were

utilised in this research: Notch extracellular antibody coating and Hes1 over-

expression vector transfection. The results indicated that Notch directly regulates

E11 expression through Hes1 activity, while it regulates DMP1 through some other

unknown mechanisms. It is of interest that the regulatory function of E11 by Hes1

was not found in the 293T cell line, indicating a cell context-dependent modeof

Notch signalling pathway. Finally, we also found that Notch signalling inhibits Wnt

through directly repressing phosphorylated level of Akt.

In conclusion, this thesis reveals complex functions of Notch in the terminal

differentiation of osteogenesis. The results suggest a potential application of Notch in

the treatment of abnormal bone mineralisation. However, further investigation on

Notch, especially quantitative research on signalling intensity, is favoured before

manipulating Notch in the research and development of the therapeutic applications.

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS v

Table of Contents

Keywords .................................................................................................................................. i

Abstract ................................................................................................................................... iii

Table of Contents ...................................................................................................................... v

List of Publications ............................................................................................................... viii

List of Conference Presentations ............................................................................................ ix

List of Figures ........................................................................................................................... x

List of Tables .......................................................................................................................... xv

List of Abbreviations ............................................................................................................ xvi

Statement of Original Authorship ........................................................................................... xx

Acknowledgements .............................................................................................................. xxii

Chapter 1: Introduction ...................................................................................... 1

1.1 Background ..................................................................................................................... 1

1.2 Hypothesis and aims ....................................................................................................... 2

1.3 Significance .................................................................................................................... 2

1.4 Thesis outline .................................................................................................................. 3

Chapter 2: Literature Review ............................................................................. 5

2.1 Introduction .................................................................................................................... 5

2.2 Transition from osteoblasts to osteocytes ....................................................................... 5

2.3 The environment of osteocyte residence and network behaviour ................................... 9

2.4 Mineralisation process inducted by osteocyte .............................................................. 10

2.5 The core Notch pathway: components and regulatory mechanisms ............................. 13

2.6 Notch regulates cell proliferation ................................................................................. 20

2.7 Notch in osteogenesis ................................................................................................... 23

2.8 Signalling crosstalk with Notch .................................................................................... 26 2.8.1 Notch and Wnt ..................................................................................................... 26 2.8.2 Notch and BMP ................................................................................................... 27 2.8.3 Notch and TGF-β ................................................................................................. 28 2.8.4 Notch and Hypoxia-Inducible Factor (HIF)-1 ..................................................... 29

2.9 In vitro and in vivo models for studying osteocytes ..................................................... 30

2.10 Summary and Implications ........................................................................................... 32

Chapter 3: Research Part One .......................................................................... 33

3.1 Abstract ......................................................................................................................... 37

3.2 Introduction .................................................................................................................. 37

3.3 Materials and methods .................................................................................................. 39 3.3.1 Immunohistochemistry ....................................................................................... 39 3.3.2 Immunofluorescence .......................................................................................... 39

viNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

3.3.3 Cell culture ......................................................................................................... 40 3.3.4 Western blot ....................................................................................................... 41 3.3.5 Quantitative reverse transcription polymerase chain reaction (RT-qPCR) ....... 41 3.3.6 Rbpj luciferase reporter assay ............................................................................ 42 3.3.7 Statistical analysis .............................................................................................. 42

3.4 Results .......................................................................................................................... 42 3.4.1 Osteocytes express high levels of Notch signalling related markers ................. 42 3.4.2 Wnt signalling is downregulated during osteocyte formation ........................... 46

3.5 Discussion .................................................................................................................... 47

3.6 Conclusions .................................................................................................................. 49

Chapter 4: Research Part Two ......................................................................... 51

Principal Supervisor Confirmation ........................................................................ 53

4.1 Abstract ........................................................................................................................ 55

4.2 Introduction .................................................................................................................. 55

4.3 Materials and methods ................................................................................................. 57 4.3.1 Immunohistochemistry ...................................................................................... 57 4.3.2 Immunofluorescence .......................................................................................... 57 4.3.3 Cell culture ......................................................................................................... 58 4.3.4 siRNA knockdown ............................................................................................. 59 4.3.5 EdU labelling and FACS ................................................................................... 59 4.3.6 Western blot ....................................................................................................... 59 4.3.7 Quantitative reverse transcription polymerase chain reaction (RT-qPCR) ....... 60 4.3.8 SEM ................................................................................................................... 60 4.3.9 TEM ................................................................................................................... 61 4.3.10 AFM ................................................................................................................... 61 4.3.11 Calcium concentration ....................................................................................... 61 4.3.12 Statistical analysis .............................................................................................. 61

4.4 Results .......................................................................................................................... 62 4.4.1 Notch inhibits proliferation of late osteoblasts .................................................. 62 4.4.2 Notch is required for cell mediated mineralisation ............................................ 66 4.4.3 Notch plays a role in the morphological change from osteoblasts to

osteocytes ........................................................................................................... 73

4.5 Discussion .................................................................................................................... 77

4.6 Conclusions .................................................................................................................. 80

Chapter 5: Research Part Three ....................................................................... 81

5.1 Abstract ........................................................................................................................ 85

5.2 Introduction .................................................................................................................. 85

5.3 Materials and methods ................................................................................................. 88 5.3.1 Cell culture ......................................................................................................... 88 5.3.2 Vector construction and plasmid transfection .................................................... 88 5.3.3 Notch activation ................................................................................................. 89 5.3.4 Luciferase assay ................................................................................................. 89 5.3.5 Western blot ....................................................................................................... 90 5.3.6 Immunofluorescence .......................................................................................... 90

5.4 Results .......................................................................................................................... 91 5.4.1 Notch signalling pathway directly regulates E11 expression through Hes1

activity. .............................................................................................................. 91

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS vii

5.4.2 Notch signalling pathway regulates DMP1 expression in a Hes1 independent manner ........................................................................................... 93

5.4.3 The switch of Wnt to Notch in osteocytes formation is mediated by Akt and PTEN ........................................................................................................... 95

5.5 Discussion ................................................................................................................... 100

5.6 Conclusions ................................................................................................................ 103

5.7 Supplements ................................................................................................................ 104

Chapter 6: Conclusions and Discussion ......................................................... 107

6.1 Research summary ...................................................................................................... 109

6.2 Discussion ................................................................................................................... 110

6.3 Limitations .................................................................................................................. 114

6.4 Future implications ..................................................................................................... 115

References ............................................................................................................... 123

viiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

List of Publications

The following is a list of submitted manuscripts that are derived from the work

performed in this thesis:

1. Shao Jin, Zhou Yinghong, Lin Jinying, Friis Thor, Crawford Ross, Xiao

Yin. (2017) Notch expressed by osteocytes plays a critical role in

mineralisation. Journal of International Molecular Medicine. Submitted.

2. Shao Jin, Zhou Yinghong, Xiao Yin. (2017) The molecular mechanisms

underlying the regulatory functions of Notch signalling during the terminal

differentiation of osteoblasts. Bone. Summitted.

3. Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision.

(2017) Molecular Aspects of Medicine (Review)

The following is a list of publications that are not related to the work

performed in this PhD thesis but published during the PhD candidature:

1. Shi Mengchao, Zhou Yinghong, Shao Jin, Chen Zetao, Song Botao, Chang

Jiang, Wu Chengtie, Xiao Yin. (2015) Stimulation of osteogenesis and

angiogenesis of hBMSCs by delivering Si ions and functional drug from

mesoporous silica nanospheres. Acta Biomaterialia, 21, pp. 178–189.

2. Li Shuigen, Shao Jin (Co-first author), Zhou Yinghong, Friis Thor, Yao

Jiangwu, Shi Bin, Xiao Yin. (2016) The impact of Wnt signalling and

hypoxia on osteogenic and cementogenic differentiation in human

periodontal ligament cells. Molecular Medicine Reports, 14, pp. 4975–4982.

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS ix

List of Conference Presentations

1. Shao Jin, Zhou Yinghong, Xiao Yin. The impact of Wnt signaling and

hypoxia on cementgenesis. 93rd International Association for Dental

Research (IADR) General Session. Oral presentation. (Boston, USA;

03/2015)

2. Shao Jin, Zhou Yinghong, Crawford Ross, Xiao Yin. Temporal expression

of Notch signalling regulates the transition from osteoblasts to osteocytes.

Institute of Health and Biomedical Innovation Inspire Conference. Oral

presentation. (Brisbane, Australia; 11/2015)

3. Shao Jin, Zhou Yinghong, Crawford Ross, Xiao Yin. Notch expressed by

osteocytes plays a critical role in mineralisation. 16th Australasian

BioCeramic Symposium. Oral presentation. (Brisbane, Australia; 12/2016)

xNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

List of Figures

Figure 1: Transition from osteoblasts to osteocytes. Certain osteoblasts that are decided to become osteocytes stop proliferation and matrix secretion, then are buried in the matrix. Meanwhile, the cells present morphological alteration in term of generation of dendritic processes. As the dendrites elongate, the cells establish contact with deeper embedded osteocytes. ..................................................................................... 8

Figure 2: DMP1 mediates cell based mineralisation. ................................................. 12

Figure 3: The interaction between Notch receptors and ligands. ............................... 15

Figure 4: Models of supposed contact dimensions alter Notch signalling. ................ 17

Figure 5: Nuclear events in the regulation of Notch signalling. ............................... 19

Figure 6: Scheme of skin renewal. ............................................................................. 22

Figure 7: Summary of previous gene modification research on Notch signalling in osteogenesis. ............................................................................................ 25

Figure 8: Immunohistochemistry staining of Hes1 in rat femur. ............................... 43

Figure 9: Immunofluorescence staining of Hes1 in rBMSCs in the osteogenic culture of 7 days and 14 days. The rBMSCs cultured in osteogenic conditions for 14 days representing late differentiation stage expressed a high level of Hes1. The bar graph displays the ratio of Hes1 positive cells. The number of Hes1 positive cells significantly increased in osteogenic differentiation at 14 days compared with 7 days. n=3. * p < 0.05, unpaired Student’s t test, comparisons between day 7 and day 14. Scale bar: 50 μm. ............................................................................. 43

Figure 10: Western blots of Hes1 and β-catenin in rBMSCs and IDG-SW3 cell line. ............................................................................................................... 45

Figure 11: RT-qPCR results showed the transcription of Hes1, Notch1, and Rbpj all increased during differentiation. n=3 wells per group. * p < 0.05, compared with day 1 (one-way ANOVA with Bonferroni post hoc test). ............................................................................................... 46

Figure 12: Luciferase reporter assay showed Rbpj activity also increased during the differentiation of IDG-SW3 cell line. n=3 wells per group. ** p < 0.01, compared with day 1 (one-way ANOVA with Bonferroni post hoc test). ............................................................................................... 46

Figure 13: Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture. .......................................................................................................... 47

Figure 14: Ki-67 and PCNA immunohistochemistry staining of rat femur samples. ........................................................................................................ 62

Figure 15: EdU labelled rat BMSC in osteogenic culture. ......................................... 63

Figure 16: FACS based on EdU labelled BMSCs in osteogenic culture. .................. 64

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xi

Figure 17: FACS based on EdU labelled BMSCs and MC3T3 cell line in normal culture after 3 days. Inhibition of Notch by adding DAPT in normal culture medium caused decreases of proliferation from 33.7% to 29% in rat BMSCs and 26.9% to 16.6% in MC3T3 cell line. These results indicated an opposite function of Notch on proliferation at the early differentiation stage. ........................................................................... 66

Figure 18: Western blots showed IDG-SW3 cell line expressed DMP1. .................. 67

Figure 19: Live cell fluorescent images showed GFP activity representing DMP1 expression gradually increased during IDG-SW3 cell osteogenic differentiation. The increasing concentration of DAPT added into the culture system led to a gradual decrease of GFP intensities. And when the concentration of DAPT reached 50μM, the GFP was nearly eliminated. Scale bar: 50 μm. ............................................ 68

Figure 20: RT-qPCR results showed the transcription of Hes1, Notch1, DMP1, and E11 after Hes1 expression was intefered by siRNA targeting Hes1 after 3 days of treatment. Control represents normal IDG-SW3 cells, siRNA represents IDG-SW3 cells transfected with universal negative control siRNA, siRNA represents IDG-SW3 cells transfected with siRNA targeting Hes1. n=3 wells per group. * p < 0.05, comparison made between each two groups. (unpaired Student’s t test). There was no significant change between control and negative siRNA groups. .......... 69

Figure 21: IDG-SW3 cells formed mineralised nodules shown by von Kossa staining and TEM images. IDG-SW3 cells (–DAPT) formed more mineralised nodules compared with a group of (+DAPT) as shown by von Kossa staining. TEM images showed (–DAPT) minerals (upper: A, B, and C) were penetrated into and closely related to collagen fibrils (red arrow), while (+DAPT) minerals (lower: D, E, and F) were deposited on the surface of collagen, and it was difficult for the mineral to infiltrate into the gap zone of the collagenous fibrils (red arrow). .......................................................................................................... 70

Figure 22: TEM images of IDG-SW3 showing intracellular mineral particles. ........ 71

Figure 23: SAED analysis revealed the crystal structure of mineral nodules. ........... 72

Figure 24: Binding force assay. ................................................................................. 73

Figure 25: E11 is an osteocyte marker. ...................................................................... 74

Figure 26: E11 expression at both protein and RNA levels. ...................................... 75

Figure 27: Morphological characteristics of IDG-SW3 cells. ................................... 76

Figure 28: Western blot of Hes1 to confirm the effects of both Notch-activating approaches. Both Notch1 antibody coated and Hes1 overexpression vector transfection methods were effective to activate Hes1 expression. And the Hes1 overexpression approach presented a stronger effect. .......... 92

Figure 29: The mechanisms of Notch in regulating the expression of E11 and DMP1. A: The plasmid maps of the Hes1 overexpression vector, TetO-FUW-Hes1, and the luciferase reporter vectors, E11-pGluc basic 2 and DMP1-pGluc basic 2. B: The luciferase assay using the E11-pGluc-Basic 2 vector transfected into the IDG-SW3, MC3T3, and

xiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

293T cell lines. C: The luciferase intensity after a co-transfection with the Hes1 overexpression vector significantly increased in both the IDG-SW3, MC3T3-E1, and 293T cell lines. n=3. P value as indicated, unpaired Student’s t test, comparisons between the Notch activation groups and the control groups, respectively. ................................................ 92

Figure 30: The expressions of DMP1 and E11 at both the RNA and protein levels. Antibody-induced Notch activation (A–C) caused the upregulation of both DMP1 and E11 at both the RNA and protein levels. However, the overexpression of Hes1 (D–F) only triggered E11 expression. n=3. * p < 0.05, unpaired Student’s t test, comparisons between Notch activation groups and control groups, respectively. ................................................................................................. 94

Figure 31: A, B: The expression of DMP1 was directly observed by a fluorescence microscope in live IDG-SW3 cells. GFP could only be observed when Notch was activated by the extracellular antibody (F), but not when Hes1 was overexpressed (D). Scale bar: 50 μm. C, D: The luciferase intensity of DMP1-pGluc-Basic 2 in the IDG-SW3 cell line increased only when Notch was activated by the extracellular antibody (G), while the overexpression of Hes1 did not sufficiently induce DMP1 expression (E). n=3. P value as indicated, unpaired Student’s t test, comparisons between the Notch activation groups and control groups, respectively. ........................................................................ 95

Figure 32: Western blots of β-catenin and Hes1 in the IDG-SW3 cell line osteogenic culture, with the supplementation of either LiCl or DAPT. The expression of β-catenin increased when Notch was inhibited, indicating a functional antagonism between these two signalling pathways. ...................................................................................................... 96

Figure 33: A: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the IDG-SW3 cell line under normal osteogenic condition and Notch inhibition with DAPT for 21 days. B: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the IDG-SW3 cell line plated on the Notch extracellular antibody (left) and IgG (right). The phosphorylation of Akt at the serine 473 site was inhibited by the Notch extracellular antibody. On the other hand, activating Notch by an extracellular antibody inhibited the phosphorylation of Akt at the serine 473 site, leading to the activation of GSK-3β and β-catenin degradation. ..................................................................................... 97

Figure 34: The crosstalk between the Notch and Wnt signalling pathways in rBMSCs. A: Immunofluorescence staining of β-catenin and Hes1 in osteogenically differentiated rBMSCs on day 14. The results showed that more cells expressed β-catenin after Notch blockade. Scale bar: 50 μm. B, C: The Wnt and Notch signalling exhibited an antagonist relationship at the late differentiation stage of the rBMSCs since blocking Notch enhanced β-catenin (B), and the activation of Wnt inhibited Hes1 expression (C). ..................................................................... 98

Figure 35: Immunofluorescent staining of β-catenin in the IDG-SW3 cell line. In the control groups (D–F), β-catenin was mainly expressed in the

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xiii

nucleus. When Notch was activated by the extracellular antibody (A–C), β-catenin was translocated into the cytoplasm (as indicated by white arrows) where it has no function. Scale bar: 10 μm. .......................... 99

Figure 36: The relationship between Notch and Wnt in non-osteogenic rBMSCs. A–F: Immunofluorescent staining of β-catenin in rBMSCs in normal culture. In the control groups (A–C), β-catenin was mainly expressed in the nucleus as indicated by the white arrows. When Notch was inhibited by adding DAPT (D–F), β-catenin was translocated into the cytoplasm where it has no function (as indicated by the white arrows). Scale bar: 30 μm. G: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the rBMSCs in normal culture. ..................................... 100

Figure 37: Statistical analysis of Western blot. ........................................................ 105

Figure 38: Schematic of the U-shaped Notch expression pattern during osteogenesis. In BMSC, Notch maintains the pool of stem cells, and it is required to be downregulated to initiate osteogenic differentiation. During terminal differentiation, Notch is increased again to alter the cubic, amplifying. and matrix secretion osteoblasts to the dendritic, static, and mediating mineralisation osteocytes. ........................................ 109

Figure 39: The schematic shows a potential mechanism in osteoblast fate determination. 1, 2: The connection between osteoblasts is stable and broad, while the contact area between osteoblast and osteocyte is limited due to the dendritic morphology of osteocyte. 3: Osteocytes send burst Notch signalling to the osteoblasts committed to osteocytes according to the reports in a quantitative study of Notch signalling intensity that the limited connection presents burst Notch signalling. 4: Then, the increased Notch enhances the E11 expression through Hes1 activity and promotes DMP1 expression through some unknown mechanisms. E11 plays a role in dendrite formation and DMP1 mediates ordered extracellular mineralisation. NICD also prevents the nuclear translocation of β-catenin; therefore, it inhibits the β-catenin transcriptional activity. The intracellular β-catenin may also combine to E-cadherin to support the generation of cell processes. ......................... 110

Figure 40: Lateral induction and inhibition mechanisms in the transition from osteoblasts to osteocytes. When lateral induction (upper) mechanism is activated, osteoblasts induce surrounding cells to express the same pattern of ligands, thereby keeping the coordinated tempo in cells activities, here, all osteoblasts have the same phenotype and functions-secreting bone matrix. If the committed osteoblasts (red cubic cells in bottom) receive stimulation from osteocytes, they will express unique pattern of ligands and inhibit neighbours to express the same one, leading them maintain osteoblastic phenotype. It is of great interest that the committed cell will differentiate to osteocyte and after it generates new dendrites, it will recruit the next committed osteoblasts, in other words, attract neighbours to adopt the same fate. This transform indicates the topology of cell-to-cell contact has a profound impact on the Notch signalling regulation. ................................................ 117

xivNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

Figure 41: Models of supposed contact dimensions alter Notch signalling. The ligands of Notch signalling present a dynamic behaviour in nature. They diffuse on the cell membrane before engagement with receptors and endocytosis. In the context that a dendritic signals sending cell contact to cubic signals receiving cell (upper), ligands will diffuse a long distance before endocytosis. Hence, the signals intensity is depended on the amount and convergence of ligands diffusion. When two cubic cells contact (bottom), the ligands diffuse a short distance before combination with receptors, in this scenario, the signals intensity is proportional to the contact area. .............................................. 119

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xv

List of Tables

Table 1: The primers for RT-qPCR ........................................................................... 42

Table 2: The primers for RT-qPCR ........................................................................... 60

xviNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

List of Abbreviations

4', 6-diamidino-2-phenylindole DAPI

5-ethynyl-2´-deoxyuridine EdU

activator protein-1 AP1

adenomatosis polyposis coli APC

atomic-force microscopy AFM

basic helix-loop-helix bHLH

bone marrow stromal cell BMSC

bone morphogenetic protein BMP

bone sialoprotein BSP

bovine serum albumin BSA

C promoter-binding factor CBF

CBF1/Suppressor of Hairless/LAG-1 CSL

cyclin-dependent kinases CDK

Delta-like DLL

Delta-Serrate-LAG2 DSL

dentin matrix acidic phosphoprotein 1 DMP1

dentin sialophosphoprotein DSPP

diaminobenzidine DAB

dickkopf Dkk

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xvii

dimethyl sulfoxide DMSO

double-distilled water ddH2O

Dulbecco’s modified eagle medium DMEM

endoplasmic reticulum ER

epidermal growth factor EGF

ethylenediaminetetraacetic acid EDTA

fetal bovine serum FBS

fibroblast growth factor FGF

fluorescence assisted cell sorting FACS

glycogen synthase kinase-3β GSK-3β

green fluorescent protein GFP

hairy and enhancer of split-1 Hes1

hairy and enhancer of split related with YRPW motif 1 Hey1

human papillomavirus HPV

immunohistochemistry IHC

immunofluorescent IF

interferon-γ IFN-γ

Jagged JAG

longevity-assurance gene-1 LAG-1

mammalian achaete-scute homologue Mash1

mastermind-like MAML

xviiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

matrix extracellular phosphoglycoprotein MEPE

membrane-type matrix metalloproteinase MT1-MMP

minimum essential medium MEM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine DAPT t-butyl ester

Notch intracellular domain NICD

nuclear factor kappa-light-chain-enhancer of activated NF-κB B cells

osteopontin OPN

paraformaldehyde PFA

phosphatase and tensin homologue PTEN

phosphatidylinositol 3- kinase PI3K

phosphatidylinositol 3,4,5-trisphosphate PIP3

phosphatidylinositol 4,5-bisphosphate PIP2

phosphate-buffered saline PBS

phosphate-regulating neutral endopeptidase, X-linked PHEX

poly adenosine diphosphate–ribose polymerase-1 PARP1

proliferating cell nuclear antigen PCNA

protein kinase B Akt

quantitative reverse transcription polymerase qRT-PCR chain reaction

receptor tyrosine kinase RTK

recombination signal binding protein for Rbp-jκ immunoglobulin kappa J region

runt-related transcription factor 2 Runx2

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xix

scanning electron microscope SEM

sclerostin SOST

selected area electron diffraction SAED

small integrin-binding ligand N-linked glycoprotein SIBLING

sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS-PAGE

Sonic Hedgehog SHH

T-cell acute lymphoblastic leukaemia T-ALL

T-cell factor TCF

transforming growth factor - β TGF- β

transmission electron microscopy TEM

Wingless-related integration site Wnt

xxNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the

best of my knowledge and belief, the thesis contains no material previously

published or written by another person except where due reference is made.

Signature: QUT Verified Signature

Date: June 2018

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xxi

xxiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS

Acknowledgements

I would like to express a deep felt appreciation and thanks to my supervisor,

Professor Yin Xiao; you have been a tremendous mentor for me. I would like to

thank you for enlightening my research inspirations and supervising my whole PhD

projects. Your support and encouragements have been priceless. I would also like to

thank my team supervisor, Professor Ross Crawford, for your insightful comments

and encouragements, but also for the hard questions at Bone Group meetings, which

gave me the incentive to widen my research. I am indebted to associate supervisor Dr

Yinghong Zhou and want to thank you for letting my research be an enjoyable

journey, and for your brilliant ideas and suggestions.

My sincere thanks also go to all the former and current members of the Bone Group,

especially Dr Thor Friis; thank you for your positively involvement with my cloning

project and detailed instructions on how to make experimental plans and records. I

would also like to thank you for your contribution in editing manuscripts of both

research papers and this thesis. And Dr Zhibin Du, Mr Qiliang Zuo, Ms Jinying Lin,

and Ms Shifeier Lu, thank you for your excellent work in the SEM and TEM areas;

your fundamental exploration rendered my morphological study proceeding

smoothly. Thanks to Ms Wei Shi; thank you for your careful guidance and

instruction on histology and immunostaining. Thanks to Dr Xufang Zhang and Dr

Pingping Han for tutoring me in lab skills. Warm thanks to Mr Patrick Lau and Ms

Inga Mertens-Walker, for their contribution to the experimental design and assistance

in my difficult cloning project. Thanks to kind and considerate Dr Indira Prasadam,

who was the first person who showed me around the lab when I first arrived. I must

also mention Dr Zetao Chen, Dr Xin Wang, Dr Nishant Chakravorth, Dr Anjali

Jaiprakash, Dr Saba Farnaghi, Mr Sunderajhan Sekar, Ms Rong Huang, Dt. Lan Xiao,

Dr Wei Fei, Ms Lingling Chen, Ms Antonia Sun, Mr Shengfang Wang, and Mr Akoy

Akuien; thank you for your companionship and for sharing experiences together

during an important and precious period of my life.

My sincere thanks go to Dr Leonore de Boer, Dr Jeremy Baldwin, Dr Christina

Theodoropoulos, Dr Jiongyu Ren, and other IHBI staff including Mr David Smith,

NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xxiii

Mr Dod Roshanbin, Mr Robert Smeaton, and Mr Scott Tucker for your help in

experimental procedures.

I would also like to express gratitude to Professor Jerry Feng from the Texas A&M

University Baylor College of Dentistry. Thank you for your kind gift of IDG-SW3

cell line and antibodies.

I would like to take this opportunity to thank my GP, Dr Kennedy from QUT

medical centre, and endocrine specialist, Dr Duncan from Royal Brisbane Women’s

Hospital. Thanks for your patience and professional advice to my medical condition

arising from a tumour of the pituitary gland. Thank you for taking care of me, letting

me get through the stressful time.

I would also like to acknowledge the tuition fee waiver from QUT.

Professional editor, Robyn Kent, provided copyediting and proofreading services,

according to the guidelines laid out in the university-endorsed national ‘Guidelines

for editing research theses’. I acknowledged his contribution to this thesis.

At last, I dedicate this thesis to my wife, Ms Lili Huang, for your love, patience, and

understanding that allowed me to spend most of my time on this thesis. Also, thanks

to my parents for their utmost tolerance and support.

Chapter 1: Introduction 1

Chapter 1: Introduction

1.1 BACKGROUND

The skeleton supports stature and locomotion, provides protection to various organs,

and regulates mineral homeostasis, especially calcium and phosphate. The skeleton

itself is vulnerable to trauma, particularly if it of poor quality. Figures from

Osteoporosis Australia show there was one bone fracture every 3.6 minutes in

Australia in 2013. By 2022, there will be one fracture every 2.9 minutes [1].

Moreover, a variety of congenital and progressive diseases can affect the health of

bone, including rickets, osteoporosis, and osteopetrosis [2, 3].

The skeleton conducts modelling during development and remodelling throughout its

whole life. Remodelling removes old or bad bone and replaces it with new bone [4].

Normal remodelling is required for the bone to adapt to mechanical loading and

resist traumatic insult [5]. Innumerable studies have been conducted to explore the

process of bone development and promote bone regeneration. It has been well

established that osteoblasts derived from bone marrow stromal cells secrete organic

collagen, which buries osteoblasts to form a new cell type, osteocytes. More and

more recent research has proved that it is osteocytes that mediate the mineralisation

of collagen, rather than osteoblasts [2, 6]. However, answers to some fundamental

questions are still largely unknown, such as the regulatory mechanisms of

mineralisation and the transition from osteoblasts to osteocytes.

The Notch signalling pathway is a highly conserved signalling system in most

multicellular organisms [7]. There are only four receptors (Notch 1–4) and five

ligands (Delta-like 1, 3 ,4 and Jagged 1, 2) working for this signalling pathway in

mammals, and all receptors and ligands are bound to the cell membrane. Engaged

receptors with ligands lead to the release of the intracellular domain, which further

translocates into the nucleus to regulate target gene expression [8]. Despite quite a

simple constitution, Notch presents complexity in functional output [9, 10]. The

intensive and fundamental functions in cell fate determination render Notch an ideal

candidate to be tested in the osteoblasts’ fate decision.

2 Chapter 1: Introduction

In past decades, Notch was deemed an oncogene related to abnormal proliferation of

stem cells [11]. Hence, little attention was paid to Notch functions in differentiated

cells or even terminally differentiated cells such as osteocytes. Until recently, limited

studies revealed the possibility that Notch is highly expressed by osteocytes as well

[12, 13]. However, the specific functions and regulatory mechanisms still need to be

addressed.

1.2 HYPOTHESIS AND AIMS

Based on the epigenetic evidence issued in 2014, a downstream target effector of

Notch, Hey1, was upregulated more than ten-fold during the transition from

osteoblasts to osteocytes [12]. First, we boldly assumed that Notch plays a critical

role in this transition as well as in the normal functions of osteocytes. To test the

hypothesis, more solid evidence is preferred to confirm the high level of expression

of Notch in osteocytes. Second, Notch will be artificially blocked or activated to test

the impact on osteocyte function, regarding proliferation, morphology, and

mineralisation. Last but not least, we will explore the mechanism mediating this

signalling intensity change.

The specific aims of this thesis are summarised as follows:

Aim 1: To confirm the Notch signalling pathway is upregulated during the terminal

differentiation of osteoblasts towards osteocytes;

Aim 2: To evaluate the impacts on cell proliferation, morphological characteristics

and mineralisation after manipulating Notch signalling;

Aim 3: To explore the mechanisms that regulate activity of Notch signalling.

1.3 SIGNIFICANCE

This thesis clarifies the physical changes of the Notch signalling pathway during the

terminal differentiation of osteoblasts, which provides an explanation of the

controversial views of Notch’s functions in osteogenesis. Exploring the mechanisms

by which Notch regulates osteocytes gene expression will help to establish a new

therapeutical approach to treating osteocytes or mineralisation-related diseases by

precisely manipulating Notch both spatially and temporally.

Chapter 1: Introduction 3

1.4 THESIS OUTLINE

The thesis was designed as three consecutive sections, based on the results reported

by two research papers. The detailed methodology, results, and discussion are

contained in the corresponding chapters.

Section 1: To address aim 1, confirmed the Notch signalling pathway is upregulated

during the terminal differentiation of osteoblasts. (Chapter 3)

In this section, Hes1 was chosen to represent the Notch signalling intensity, and the

expression of Hes1 was tested by immunohistochemistry staining,

immunofluorescent staining, Western blot, and qRT-PCR. The samples included rat

femur, rat BMSC, and IDG-SW3 cell line. Then, we transfected the IDG-SW3 cell

line with Rbp-jκ luciferase reporter to monitor the activity of Notch signal

transduction pathways. Rbp-jκ is necessary for the Notch transcriptional complex

and is a direct modulator of Notch signalling.

Related results were contained as a part of both research papers.

Section 2: To address aim 2, evaluated the impacts on cell proliferation,

morphological characteristics, and mineralisation after artificially blocking or

activating Notch signalling. (Chapter 4)

DAPT was added into the culture medium with both the rat BMSC and IDG-SW3

cell line. Significant abnormal mineralisation was observed through mineral staining,

DMP1 expression test, SEM, TEM, and AFM. The proliferation rate and cell

morphological parameters were changed as well. Then, Notch extracellular antibody

and Hes1 overexpression vector were applied to activate Notch signalling in the

IDG-SW3 cell line. It was found that Hes1 directly regulated the expression of the

earliest osteocytes marker, E11, highly suggesting that Notch signalling contributes

to the osteocyte’s phenotype. Notch was also found to regulate the level of DMP1

expression, although through some unknown downstream factors.


Section 3: To address aim 3, explored the mechanisms underlying the regulatory

functions of Notch signalling. (Chapter 5)

4 Chapter 1: Introduction

In this section, two luciferase reporter vectors were constructed using E11 and DMP1

promotor regions respectively for further transfection experiments. The results

suggest Notch directly regulates E11 expression through Hes1 activity. As the Notch

signalling was upregulated during the terminal differentiation of osteoblasts, the

intensity of Wnt signalling was decreased. Hence, the crosstalk between Notch and

Wnt signalling pathways may control the signalling switch. To figure out how the

connection between Notch and Wnt signalling pathways was established, we tested a

series of relevant protein kinases activities in normal differentiation conditions or in

signal-modified conditions. The phosphorylation of Akt emerged as the bridge

linking these two signalling pathways.


A summary of all the studies is contained in Chapter 6, which includes further

discussion and the limitations of the current study. The proposal of future

implications is also raised in this chapter. A review that focuses on Notch signalling

in osteocytes has been generated based on a comprehensive literature review and our

experiment data.

Chapter 2: Literature Review 5

Chapter 2: Literature Review

2.1 INTRODUCTION

Regulating diversity among differentiated cell types in development involves a

relatively small number of highly evolutionarily conserved signalling pathways,

including Wnt [14], Hedgehog [15], bone morphogenetic proteins (BMPs) [16, 17],

phosphatidylinositol 3-kinase (PI3K) [18], and Notch [19], all of which are the

subject of this review. Each of these pathways receives extracellular information and

relays it into the interior through specific control of transcriptional activities. Among

those signalling pathways, Notch is regarded as a simple one because it has a limited

number of components in signal cascade [8]. Although it has simple components,

Notch has pleiotropic actions in cell proliferation, apoptosis, and activation of

differentiation programmes in a large range of cell types and organs from the brain to

the skin in a cell context-dependent manner [9, 20]. However, there is a lack of clear

evidence that can be shown to draw a conclusion of Notch actions in bone modelling

and remodelling.

In the development of bone, osteoblastic lineage represents a continuous

differentiation process from bone marrow stromal cells (BMSC) towards osteoblasts,

the bone formation cells. Furthermore, osteoblastic lineage has three terminal

consequences: osteocytes, bone lining cells, and apoptosis [21]. The cell fate

determination is regulated by a complex network of signalling pathways, among

which Notch may become a potential mechanism that plays dominant roles [12, 13].

In this review, we try to summarise recent findings on Notch expression and function

in bone tissue and discuss the direction for future research.

2.2 TRANSITION FROM OSTEOBLASTS TO OSTEOCYTES

It is well accepted that osteocytes are derived from osteoblasts and that mature

osteocytes represent a terminal development stage of the osteogenic cells. There are

three potential fates of a mature osteoblast: apoptosis; becoming a bone lining cell,

which is a quiescent cell on the bone surface; and embedded in osteoid to begin a

new life as an osteocyte. The transition process of osteoblasts to osteocytes can be

6 Chapter 2: Literature Review

defined as several different stages from early osteocytes to mature osteocytes that are

deeply embedded in a bone matrix, more specifically, in the spaces named lacunae

and canaliculi [6, 21]. During this transition, the committed osteoblast experiences a

series of substantial changes [22]. First, as it is determined to be an osteocyte, the

cell loses its proliferation capacity due to the limited space enclosed by bone matrix.

Second, the cell generates multiple slender processes (50–60 per cell) with the

appearance of a stellate cell, rather than a cubic cell [23]. These cell processes radiate

through the canaliculi system to deliver and receive signals and materials to and from

surrounding cells. In addition, the generation of dendrites is polarised, which is

characterised as the dendrites are first generated at the contact area between

osteoblasts and osteocytes, followed by arborisation of dendrites towards the bone

surface. [24] Third, the osteoblast produces organic collagen, while osteocytes

secrete minerals on the collagenous frame. In a gene array study, it was reported that

of the 20,754 genes expressed by the osteoblasts and osteocytes tested in the screen,

4,496 genes had been altered during the transition. These data showed that

osteoblasts and osteocytes share significant common features as well as presenting

unique phenotypes. It is of interest that Hey1 gene, a Notch-related transcriptional

factor, was upregulated more than ten-fold–the first direct evidence that osteocytes

had high Notch expression. Furthermore, all the genes related to cell cycle were

down-regulated during the transition, which suggested that Notch impeded cell

proliferation in osteocytes, unlike its role in the mesenchymal stem cells and early

differentiated osteoblasts [12].

Osteocytogenesis has long been regarded as a passive process. It is believed that

osteoblasts are passively buried by osteoid, which the cells themselves secrete.

However, some morphological research found that osteocytes present highly

organised formation in bone matrix, which indicates that osteocytogenesis is a finely

regulated and active process rather than a passive one [6]. Specifically, the embedded

osteocytes appear to be highly ordered in terms of the distance between any two

adjacent cells [25]. Also, in histology, each osteocyte occupies one lacuna and each

lacuna contains only one osteocyte, unless the lacuna is left empty after osteocyte

death. It had never been reported that one lacuna encompasses two or more

osteocytes, which means the osteoblast that is committed to osteocyte prevents its

neighbour cells from adopting the same cell fate. This fine-grained structural


characteristic indicates the transition from osteoblasts to osteocytes is a carefully

tuning developmental event.

During the terminal differentiation, osteocytes express unique markers that are not or

lowly expressed by osteoblasts. After being embedded in bone, the cell undertakes a

dramatic transformation from a cuboidal cell to a multidendritic style; meanwhile,

the distribution of cell skeleton–related proteins, such as fimbrin, cillin, filamin, and

spectrin, experiences significant changes [26]. The cell skeleton–related protein

E11/gp38, which has been considered as the earliest marker of osteocytes [27, 28], is

required to regulate the cell skeleton and morphology [29]. In particular, E11 is

responsible for both arborisation and elongation of dendritic processes [30, 31], and

the surrounding mineralisation promotes E11 expression in turn [32, 33].

A specific secreted protein of osteocytes, dentin matrix protein 1 (DMP1) is critical

for proper mineralisation of bone and dentin [34]. DMP1 is a highly acidic

phosphorylated extracellular non-collagenous protein that was first cloned from rat

teeth [35]. It belongs to a family of proteins called small integrin-binding ligand N-

linked glycoprotein (SIBLINGs), which contain five tandem genes (DSPP, BSP,

MEPE, SPP1, and DMP1) located within a 375,000 bp region on chromosome 4,

indicating that those proteins share unifying genetic characteristics [36]. In bone

tissue, the expression of DMP1 is much higher in osteocytes than in osteoblasts.

Hence, it also can be regarded as an osteocytes marker [37, 38]. It is of note that

osteocytes also highly express MEPE, another member of the SIBLINGs family,

which is important in regulating the phosphate metabolism [39], suggesting that the

SIBLINGs proteins are not only genetically relevant but also functionally related [40,

41]. Moreover, the phosphorylation of matrix proteins by casein kinaseⅡ(CKⅡ) is a

premise for their mineral-related function [34]. And this enzyme is produced in high

amounts by osteocytes but not by osteoblasts [42], which, in contrast, express high

levels of CKⅠ, another serine/threonine specific protein kinase family [43].

Other genes produced by osteocytes include phosphate-regulating gene with

homologies to endopeptidases on the X chromosome (PHEX) [44], a hormone that

regulates phosphate homeostasis in bone tissue [45]. Meanwhile, osteocytes also

produce matrix metalloproteinase 2 and 13, as well as membrane-type matrix

metalloproteinase (MT1-MMP) to remove extracellular matrix accompanying the


arborisation and elongation of dendrites [46-48]. When the differentiation process

comes to an end, osteocytes establish a well-connected network with each other and

the cells on the bone surface. The deep-buried osteocytes express dickkopf (DKK) 1

and sclerostin (encoded by SOST gene) which are both Wnt signalling antagonists

and inhibit excessive mineralisation [49, 50].

The expression of fibroblastic growth factor 23 (FGF23), a phosphaturic hormone, is

quite complex. After FGF23 was identified, it was deemed as predominately

expressed in osteocytes [51, 52]. More recently, Feng et al. showed FGF23 was

highly expressed in osteoblasts rather than osteocytes by in situ hybridisation and

immunohistochemistry. The FGF23 level in osteocytes was dramatically increased in

DMP1 null mice with no significant changes in osteoblasts [53, 54], which supports a

negative effect of FGF23 on bone mineralisation [55]. It is of note that FGF23 is

unable to pass through the gap junctions due to its molecular weight; hence, it is

released into the vascular system by osteoblasts or osteocytes and works as a

circulating factor [6].

In summary, the transition from osteoblasts to osteocytes involves fundamental

changes in the patterns of gene expression leading to the distinct functions of these

two cell types.

Figure 1: Transition from osteoblasts to osteocytes. Certain osteoblasts that are

decided to become osteocytes stop proliferation and matrix secretion, then are buried

in the matrix. Meanwhile, the cells present morphological alteration in term of

generation of dendritic processes. As the dendrites elongate, the cells establish

contact with deeper embedded osteocytes.


2.3 THE ENVIRONMENT OF OSTEOCYTE RESIDENCE AND NETWORK BEHAVIOUR

The lacunae and canaliculi, which accommodate osteocytes, form a complex system

serving as the pathway for the transport of nutrients and signals [56]. It has been

shown that the average number of osteocytes in an adult human is around 42 billion

and those cells form 23 trillion connections via dendrites. The total length of all these

dendrites can be 175,000 km [57]. Such complexity is only comparable to the

neuronal system in the human body [58].

The organisation of this lacunae–canaliculi system is closely related to bone mineral

quality, as the majority of minerals reside within a distance less than 1 µm from the

wall of the lacunae and canaliculi [59]. This observation further confirms that

osteocytes deliver minerals to a relatively long distance along canaliculi through

dendrites, while the minerals have limited ability to penetrate into bone matrix.

Hence, either underdeveloped architecture or high density of the lacunae–canaliculi

system correlates with bone mineral disorders [60]. Besides this anabolic function,

osteocytes can also mediate osteolytic activity in pathological conditions [61], which

has been defined as osteocytic osteolysis [62]. The ability of osteocytes to remove

and replace the mineralised matrix makes them an important access to regulate the

huge mineral reservoir in bone and directly contribute to calcium and phosphate

metabolism in response to hormone and mechanical loading [53, 63, 64]. Multiple

studies have shown that parathyroid hormone (PTH) and PTH-related protein

(PTHrP) are important triggers for osteocytic osteolysis [65-67].

Current understanding about the osteocyte network is that osteocytes communicate

with each other by gap junction [68], cadherins [69], and indirect secreting signalling

[70]. The gap junctions allow small molecules (<1 kDa) to transfer among

osteocytes’ plasma [71] and there have been reports that mechanical loadings on

osteocytes can promote the opening of gap junctions [72]. In addition to this direct

cell-to-cell contact, osteocytes also deliver some soluble signalling molecules in a

short distance, including prostaglandin E2 and ATP, to communicate with adjacent

cells [68, 73]. Aside from those well-documented signals propagation mechanisms

which are lack of specificity, another important type of signalling pathway bounded

on the cell membrane represented by the Notch signalling pathway springs to mind to

execute fine regulatory functions. Other researchers using live cell labelling methods


found the dendrites repeatedly extend and retract to establish a transient connection

with an adjacent cell, indicating that some cell-to-cell signalling can be transduced

through the “handshake” manner [74]. The motions of dendrites provide a

topological basis to Notch signalling regulation [75-77]. Recent studies revealed that

Notch is highly expressed by osteocytes [12, 13], which also supports our hypothesis.

Some dendrites that protrude from an osteocyte’s cell body extend beyond the

canaliculi system and directly contact with osteoblasts located on the bone surface

[78]. It remains unclear what signals are transduced between osteocytes and

osteoblasts. It is thought that pleiotrophin (also known as HB-GAM and OSF-1)

could be the signal mediator between osteocytes and osteoblasts and plays a role in

adult bone and mechanical sensing [79]. However, pleiotrophin-deficient mice

present a normal bone phenotype, which suggests pleiotrophin has a minimal role in

bone tissues [80]. Given that osteocytes express high Notch signalling, it is not

surprising that Notch mediates communication between osteocytes and osteoblasts

and plays a role in the cell fate determination of osteoblasts as well. We have to

admit that there is still no solid evidence to confirm this point. However, some

regulatory mechanisms of Notch signalling can be discussed, and we will give details

in the coming sections to provide a reasonable explanation of the events of cell fate

decision.

2.4 MINERALISATION PROCESS INDUCED BY OSTEOCYTE

It has been well documented that osteoblasts produce an unmineralised collagen

matrix called osteoid, which combines with calcium and phosphates to form

hydroxyapatite, the main component of the calcified bone matrix [81]. As osteoblasts

are far away from the mineral sites, it is believed that the osteocytes embedded in

osteoid play an important role in the mineralisation process [42]. Feng and

colleagues conducted several experiments to prove it is the osteocytes, not the

osteoblasts, that are mediating the biomineralisation. They applied calcein and

Alizarin Red double labelling methods to trace the mineral process. Interestingly, the

mineralisation started at the proximal sites of osteocytes, then extended to the distal

sites, and there was a clear boundary between two fluorochromes. However, in the

DMP1 knocked out mice, the labelling was dispersed and diffuse, indicating the

mineralisation was out of control and mineral deposited randomly. Above findings


suggested that DMP1 produced by osteocytes plays a critical role in regulating

mineralisation. Moreover, they use immuno-gold staining to label DMP1 and

observed samples under SEM. The results revealed that DMP1 was highly abundant

on the canaliculi walls next to the dendrites of osteocytes and then spread to

surrounding areas [82]. In an analogous situation of dentin histology, research has

shown that peritubular dentin is highly mineralised compared with intertubular

dentin [83]. Peritubular dentin surrounds the processes of odontoblast and directly

adsorbs amorphous matrix secreted by the odontoblasts [84]. Also, in elephant and

opossum, the development of peritubular dentin occurs in advance of intertubular

dentin [85]. Although there is no evidence to show that the bone just surrounding

osteocytes’ dendrites is more highly mineralised than the tissue that is some distance

from the osteocyte lacuna and canalicular system, the similarity between the

structure and components of dentin and bone suggests it is likely that the wall of the

lacuno–canalicular pore system is early and mostly developed in bone tissue. Further

histomorphometric research is required to reveal the fact of this important property

of bone tissue in the future. Even after apoptosis, due to the nonexistence of

connection to other types of cell and phagocytosis, the lacuno–canalicular space is

infilled with minerals and the remnant osteocyte’s structure, and components become

mineralised by themselves in vivo [86]. Together, all the evidence reviewed above

indicates osteocytes mediated mineralisation.

DMP1, the protein that plays a vital role in mineralisation, is a non-collagenous

extracellular protein secreted by osteocytes [87]. The function of DMP1 was

confirmed by the gene knockout research that DMP1 null mice present with rickets

and osteomalacia phenotype with hypophosphatemia [82, 88]. DMP1 is highly

anionic and rich in serine residues, which can be phosphorylated by casein kinase I

and II [34]. The unphosphorylated DMP1 is located in the nucleus; during the

transition from osteoblasts to osteocytes and osteocytes maturation, DMP1 is

phosphorylated, then released into the cytoplasm and extracellular matrix [89]. In the

extracellular matrix, DMP1 prevents autonomous precipitation of calcium phosphate

and promotes controlled nucleation of mineral particles by stabilising calcium

phosphate and transferring it to the gap region of collagen where it would then be

deposited and crystallised [34]. This high negatively charged property makes it

possible for DMP1 with a high binding affinity for calcium to initiate the nucleation


of mineralisation [90, 91] (Fig. 2). Currently, the methodology of mainstream

biological experimental is insufficient to discover the low level of nuclear DMP1. As

the phosphorylation initiates, DMP1 is continuously produced and phosphorylated,

leading to the aggregation of the protein, which allows it to be tested using general

methods, for example, Western blot analysis. Hence, DMP1 can still be regarded as a

specific marker for osteocytes.

Figure 2: DMP1 mediates cell based mineralisation.

A: With the presence of DMP1, the highly phosphorylated DMP1 integrates calcium

and phosphate and prevents spontaneous aggregation. Due to the negative charge of

phosphorylated DMP1, it infiltrates into the gap zone of collagen, which is positively

charged. B: In the absence of DMP1, the calcium and phosphate deposit

spontaneously at the surface of the collagen, leading to poor quality mineralisation

[34].


2.5 THE CORE NOTCH PATHWAY: COMPONENTS AND

REGULATORY MECHANISMS

The Notch signalling pathway in mammals contains single-pass transmembrane

ligands (Jagged 1, 2 and Delta-like 1, 3, and 4) and four epidermal growth factor

(EGF)-like Notch receptors (Notch 1–4) that display both redundant and distinct

functions [9]. The activation of receptors initiates a sequence of proteolytic events

with the assistance of ADAM metalloprotease and γ-secretase and eventually

releases Notch intracellular domain (NICD). NICD then translocates into the nucleus

and combines to the DNA-binding protein compound of Rbp-jκ and MAML 1–3 [92,

93] to control specific gene transcription, through transcriptional repressors hairy and

enhancer of split (Hes1–7) and hairy and enhancer of split related with YRPW motif

1 (Hey1, 2, and L) [8, 10].

Despite the simplicity in term of components, Notch adopts a series of complicated

mechanisms at different levels to couple with its versatility in controlling multiple

aspects of development. Some of these mechanisms had been well established:

Lateral induction and lateral inhibition. It is a mechanism of positive transcriptional

feedback to render Notch able to determinate the fates of two identical cells [10].

Initially, those two identical cells express the same levels of Notch ligands and

receptors, i) for lateral induction, the ligand (especially Jag1) expression cells induce

their neighbours to express the same type of ligand to coordinate the cell behaviour,

resulting in a homogenous commitment of cells [94, 95] and ii) for lateral inhibition,

whereby the ligand (especially Dll1) expressing cells inhibit the expression of the

ligand in the adjacent cells. Then a positive feedback loop amplifies the tiny

difference, and eventually, the Dll1 expressing cells prevent their neighbour cells

from adopting the same cell fate and generate a mosaic-like cellular developmental

pattern [96, 97]. Notch signalling both initiates phenotype changes and maintains

proper function; however, those roles may be attributed to different ligands involved

[98-100].

In cis (inhibition) and in trans (activation). Notch function is mediated by the cell-to-

cell contact as all the ligands and receptors are located on the cell membrane [101].

A single cell expresses both ligands and receptors, and it has been confirmed that the


combination of ligands and receptors on the same cell is inhibitory [5, 102] and

prevents the activation of receptors by neighbour cells as the binding sites have been

occupied [75, 103]. The regulation of the ratio of in cis and in trans patterns can

manipulate the Notch signalling at a multicellular level. Moreover, as a result of the

glycosylated modification of Notch receptors by Fringe proteins, the receptors can

only bind to Dll ligands and “free” Jag ligands can send signals to neighbouring cells

[102] (Fig. 3).


Figure 3: The interaction between Notch receptors and ligands.

(A) Notch ligands Jagged (JAG1, 2) and Delta-like (DLL1, 3, 4) possess

extracellular Delta-Serrate-LAG2 (DSL) domain through which the ligands bind to

the EGF-like repeats 11–12 in the extracellular domain of Notch receptors [5]. And

the N-terminals of the ligands present phospholipid-binding property, indicating the

ligands may also anchor to the adjacent cell membrane [104]. (B) Notch receptors

are activated through integration with the ligands located on the neighbour cells,

which is called in trans activation. In the other hand, when the receptors bind to the


ligands expressed on its own membrane, Notch signalling is inhibited, which is

called in cis inhibition. (C) Different ligands compete for the limited binding sites on

the receptors in a random manner (upper). However, the receptors can be

glycosylation modified, which prevents them from combining with JAG ligands and

only allows binding to DLL ligands (lower).

Tissue architecture and morphology. As Notch signalling requires cell-to-cell contact

to transmit a message, the organisation of tissue and cells can also regulate the signal

intensity. This property is unique in the Notch signalling pathway compared with

other signalling pathways that rely on secretive components, for example, the Wnt

signalling pathway. It has been reported that the signalling is proportional to the

contact area between two adjacent cells when the contact area is greater than the

diffusion area of ligands and receptors [105]. In other circumstances, like the cell-to-

cell connecting through cellular protrusions, the contact area is quite limited, leading

to more complex scenarios [106, 107]. It is of interest that the Notch signal through a

small contact area can be higher than through a large area using a mathematical

model of Notch signalling [105]. Moreover, the dynamic of Dll1 diffusion is faster in

protrusion than in the bulk cell body, which may centralise signals on the protrusion

area [108]. Even just transient contact between cells can transmit strong signals,

which has been found in neural crest cells and myotome cells that contact each other

in a “kiss and run” manner [109]. During the transition from osteoblasts to osteocytes,

the cell morphological changes render a different contact manner between adjacent

cells, which can contribute to altering signalling during the transition. Based on the

observation suggesting that osteocytes’ dendrites also present dynamic

characteristics, it is likely the signalling is strong and regulated in a sophisticated

way during the transition from osteoblasts to osteocytes. A possible explanation may

be that the broad interaction is also impacted by repressive factors at a higher level;

however, the protrusions connection is more specific and focuses on the positive

signalling factors (Fig. 4).


Figure 4: Models of supposed contact dimensions alter Notch signalling.

The contact between osteoblasts involves broad gap junctions and a large range of

ligands and receptors working in cis or in trans [110, 111]. The overall signals

transduced between osteoblasts are low but sustained. In the case of contact between

osteoblast and osteocyte, the connection area is small. A limited number of ligands

and receptors work in signalling transduction, while the signals can be burst as

repressive factors may be excluded.

Asymmetric division. It is common sense that a mother cell produces two identical

daughter cells in mitosis. However, there is another scenario when Notch plays a role

in the division. A model has been suggested that Numb protein, an inhibitor of Notch

signalling, is asymmetrically distributed into two daughter cells during cell

replication, which generates a bias of Notch signalling intensity of the daughter cells

[112].

Dosage dependence. A few studies have confirmed that Notch is dosage sensitive as

both ligands and receptors exhibit haploinsufficiency. The regulation of Notch is not

a “zero-sum game.” In contrast, the cells calculate the signal intensity, even just a

small stoichiometric difference, to restrict signal delivery. As an increasing number

of molecules have been added to the set that can interact with Notch components at


various aspects of the pathway, including biosynthesis, trafficking, and degradation,

the regulation of the Notch dosage can be a topic of incredible complexity.

Gutuharsha et al. also suggested that Notch signalling is a system rather than a

“pathway” [113].

Nuclear events. NICD entering the nucleus contributes the common approach of

Notch activation regardless of the types of receptors and ligands. This common way

produces various, or even opposite, outcomes in a cell-specific or stage-specific

manner, which can be attributed to the nuclear context that controls gene expression.

Notch signalling determines cell death or survival in the optic lobes of D.

melanogaster, relying on cooperation with the existing transcription factors [114]. A

proposed model suggested that the selected target gene of NICD-CSL (also known as

Rbpj in humans) complex needed to be prepared by histone acetylation to render the

complex more accessibility [115]. Moreover, the CSL-DNA-binding is dynamic,

leading to the possibility that Notch does not determine which gene would be

expressed intrinsically. In contrast, there may be another program that initiates

expression, and Notch activation will augment that expression [116, 117]. Hence,

epigenetic mechanisms, including histone methylation, which modify the

accessibility of gene promoters may have a profound influence on responses to

Notch signalling, which contributes to the different gene expression pattern mediated

by Notch [118, 119] (Fig. 5).


Figure 5: Nuclear events in the regulation of Notch signalling.

(A): Inhibitory mechanisms. The DNA is coiled around histone and inhibitory factors

present resulting in inhibition of the Notch transcriptional complex recognising and

initiating the gene’s regulatory sites. (B): Active mechanisms. In the presence of

chromatin modifying factors, the histone is highly acetylated and uncoiled to expose

the DNA regulatory sites to Notch transcriptional complex, thus initiating gene

transcription.

Signal crosstalk and integration. Given its pleiotropic nature, Notch signalling can

drive opposed actions in a context-dependent manner [120]. The integration of Notch

and other signalling pathways can provide a possibility for its context-specific

manner. The traditional views of the crosstalk describe signalling pathways as quite

distinct, linear approaches and integration only occurs on a limited number of nodes

shared by several pathways. Recently, as big data has been generated by high-


volume gene screen and microarray, a more representative and realistic model is the

network of signalling, and the interconnection can occur at various points of

pathways through a relatively large number of common members [113].

Oscillated regulation of Notch. A segmentation clock is an intrinsic mechanism that

realises temporal regulation of Notch signalling. During somitogenesis, Hes1

oscillates every two hours, which corresponds to the formation of somite buds from

the presomitic mesoderm [121]. Hes1 therefore restricts the pulse of the biological

clock by negative feedback. Based on this restricted developmental rhythm, another

Notch signalling effector, has a 22 minute half-life. Hirata et al. found mice

expressing mutant Hes7 with a 30 minute half-life presented severely disordered

somite segmentation [122]. Consistent with this, mutations in Jag1 and Dll3 caused

Alagille syndrome and spondylocostal dysostosis, respectively, in humans [123,

124]. Together, the temporal regulation of the Notch signalling pathway contributes

to the development of normal somites. Furthermore, oscillations of Hes1 are essential

for neural development because sustained overexpression of Hes1 negatively

regulates proneural and Notch-related gene expression [125]. The oscillated nature of

Notch signalling suggests that Notch has a self-control system for temporal

regulation. This is an important property because Notch has different expression

patterns throughout the different developmental stages [126, 127].

2.6 NOTCH REGULATES CELL PROLIFERATION

Notch is a signalling pathway that is fundamental to cell fate determination in all

animals. Its most prominent role is the regulation of cell proliferation and

differentiation in both embryonic and postnatal organs [128, 129]. A number of

studies have explored the regulatory function of Notch in stem cells, or progenitor

self-renewal, as well as differentiation of various tissues, such as intestinal [130],

muscle [131, 132], blood vessel [133, 134], haematopoietic [135, 136], neural [137,

138] and mesenchymal progenitor cells [139]. From these studies, it has emerged

that the nature of Notch signalling is multifunctional and multidirectional in a cell

context-dependent manner.

The process of cell proliferation is composed of a series of events defined as the cell

cycle. The cell cycle integrates a continuous growth cycle with a discontinuous

division cycle, which is strictly regulated by a complex molecular mechanism. The


cell cycle can be divided into a series of phases, including the G0 phase (quiescent

phase), G1 phase (cell growth), S phase (DNA synthesis and replication), G2 phase

(damaged DNA detection), and M phase (cell division). The transition between

different phases of the cell cycle is triggered by a network of protein and

phosphatases including cyclins and their cyclin-dependent kinases (CDK).

Specifically, Cyclins A and B trigger the G2–M transition. Cyclin A is synthesised in

the S phase and degraded at prometaphase. Cyclin B (composed of B1 and B2) is

synthesised in the S and G2 phases and degraded following the completion of

chromosome attachment to the mitosis spindle. Cyclins A and E are triggers for G1–

S phase transition. Cyclin C regulates RNA polymerase transcription, whereas

Cyclin D triggers the passing of the restriction point in the G1 phase and Cyclin E

synthesis [140]. During the whole cell cycle, G1–S phase transition is a critical

process that determines the cells to start DNA synthesis and dividing [141].

Dysregulated Notch1 plays a critical role in human T-cell neoplasia, and even the

human Notch1 gene itself was identified from a T-cell acute lymphoblastic

leukaemia (T-ALL) [142, 143]. Following this finding, a series of studies have

revealed that Notch1 interacts with c-Myc [144], Cyclin D1 [145], E2A-PBX1 [146],

and Ikaros [147] to override the G1–S checkpoint and induce proliferation of T-ALL

cells. There are no reports of tumours of myeloid origin following the overexpression

of Notch1, findings that are indicative of the cell- and tissue-specific context of the

Notch signalling pathway.

On the other hand, Notch can be a tumour suppressor in certain circumstances, such

as in the skin. In normal skin tissue, proliferating keratinocytes are located mainly in

the basal layer. The proliferation will cease after they migrate to the spinous layer.

Then, the cells are committed to terminal differentiation upwards to the granular

layer and further, the cornified layer experiencing cell morphology changes [148].

This model is analogous to the terminal differentiation of osteocytes in which the cell

cycle is arrested; cell morphology is changed, and specific proteins are expressed as

well (Fig. 6). Notch1 signalling in keratinocytes directly determines entry into

terminal differentiation by promoting expression of keratin1 and involucrin, both of

which are early differentiation markers. Moreover, Notch1 signalling also

upregulates expression of p21Waf1, a cyclin-dependent kinase inhibitor, leading to

the arrest of the cell cycle and the onset of terminal differentiation [149]. Also,


Notch1 activates NF-κB，which is required in the maturation of epithelial tissue

[150-152]. Notch1 mediates cell cycle arrest through several approaches, including

activator protein-1 (AP1). AP1 is inhibited by Notch1 through repression of c-FOS

expression, resulting in the exit of the cell cycle [153]. In vivo studies also provide

solid evidence to support the tumour-suppressive function of Notch1. Specifically,

knockout of Notch1 in the epidermis presented hyperplasia and basal cell carcinoma.

Meanwhile, the Sonic Hedgehog and Wnt signalling pathways were derepressed,

resulting in the development of tumours in Notch1 deficient mice [154]. Together,

Notch1 functions as a comprehensive tumour suppressor in the skin.

Figure 6: Scheme of skin renewal.

The skin stem cells are in the basal layer and undergo proliferation to maintain the

updating of skin. After the stem cells migrate upwards to the spinous layer, the cell

cycle is arrested, and the cells start to differentiate towards keratinocytes located at

the cornified layer as the terminal stage.

In the case of cervical cancer caused by human papillomavirus (HPV), although

Notch still activates p21Waf1 to inhibit cell proliferation, p21Waf is inactivated by

the E7 protein produced by the HPV [155-157]. Also, p100α and p63 proteins are

amplified in cervical cancer; they inhibit GSK-3β, which is a common inhibitor of

both Wnt and SHH signalling pathways [158, 159], and upregulate the PI3K

signalling pathway, resulting in a high level of proliferation [160, 161]. The


suppressive effect of Notch1 on Wnt and SHH signalling is overcome in HPV

infected cells. In this context, Notch1 has a limited ability to inhibit proliferation.

The diversity of Notch functions in proliferation can be attributed to the complexity

of the regulatory mechanisms discussed in the above sections. Evaluating the

functions of Notch requires a cell context-specific perspective.

2.7 NOTCH IN OSTEOGENESIS

Previous studies using various mouse transgenic models have revealed the function

of Notch in the osteoblastic lineage (Fig. 7). Briefly, Notch maintains the pool of

mesenchymal progenitors by suppressing osteogenic differentiation from early stage

precursors. Downregulation of Notch is required to drive differentiation towards

functional osteoblasts, the matrix secreting cells. Correspondently, mature

osteoblasts express a low level of Notch signalling [162-168]. In physiological

conditions, Notch signalling is decreased as osteoblasts mature, which can explain

the controversial phenotypes observed when Notch is disrupted at different time

points during the formation of mature osteoblasts.

Bone formation contains two sequential steps: first is organic matrix deposited by

osteoblasts, followed by mineralisation mediated by osteocytes that are derived from

osteoblasts [169]. It is of great importance to elucidate the function of Notch in the

final stage of bone formation. However, there is limited research until recently, based

on our best knowledge of that topic, and some key questions, including the specific

mechanism involving physiological regulation during the terminal differentiation, are

yet to be addressed.

It is well established that Runx2 is a core transcriptional factor in triggering the

differentiation of mesenchymal stem cells to osteoblasts [170]. However, no such

key factors have been identified in the transition from osteoblasts to osteocytes,

which is a valuable topic because mineralisation mediated by osteocytes is no less

important than matrix secretion implemented by osteoblasts in its contribution to

bone tissue with normal structure and function.

An epigenetic research [12] revealed striking changes in the transcriptome that

accompanied the transition from osteoblasts to osteocytes. Of the 20,754 genes


expressed by the osteoblasts and osteocytes tested in the screen, 4,496 genes had

altered regulation during the transition. These data showed osteoblasts and osteocytes

share significant common features and unique phenotypes. It is of interest that Hey1

gene, a Notch-related transcriptional factor, was upregulated more than ten-fold –

firm evidence that osteocytes had high Notch expression. Furthermore, all of the

genes related to cell cycle were downregulated during the transition, which suggested

that Notch impeded cell proliferation in osteocytes, contrary to its role in the

mesenchymal stem cells and early differentiated osteoblasts.

Regarding receptors and ligands expressed by osteocytes, the Notch1 receptor and

Jag1 ligand were the main upregulated markers distinct from others. Of the

downstream target genes, expression of Hes1 was increased, while Hes5 was stable

[13]. These findings together indicate a key role for Notch in osteocytes. Moreover,

this putative function should be tested in a more specific perspective that considers

the relevant markers in osteocytes, because opposite functions of Notch in different

organs have been reported due to different receptor–ligand combinations as well as

the downstream targets involved [171, 172].

The main data generated from an osteocyte-specific gene modified mouse model

come from Zanotti’s group [168, 173, 174]. However, it is difficult to make a clear

conclusion of the function of Notch in osteocytes. As reported, both activation and

inactivation of Notch in osteocytes by mating DMP1-Cre+/- mice with Notch 1/2 loxp/loxp and RosaNotch mice, respectively, generated a similar phenotype of increased

trabecular bone mass. There is no reasonable explanation for these results; the only

suggestion we can make is that the data based on the bone morphological analysis

lacks a further mineralisation test. In other words, the quality of the increasing bone

mass has not been determined. It has also been reported that activation of Notch in

mature osteoblasts contributed more osteocytes in cancellous bone of males, while

activation in osteocytes did not exhibit an increase in the number of osteocytes.

However, inactivation of Notch in osteocytes increased osteocyte density in

cancellous bone. A plausable explanation is that the pattern of physiological

expression of Notch in osteoblasts and osteocytes may differ. Given the dosage-

dependent property of Notch signalling, it is difficult for the activation of Notch in

osteocytes to generate a significant phenotype bcause the Notch signalling is already

strong in this context. In the scenario of inactive Notch, the increase in osteocyte


density could be a compensatory mechanism to rescue the defect of Notch signalling.

Although further research into the mechanism is needed, the existing data suggest

Notch might play a role in the transition from osteoblasts to osteocytes. Interestingly,

another finding points to the number of osteocytes in cortical bone not being

affected, whether or not Notch is activated in either sex. This is a further indication

of the sophisticated nature of context-dependent Notch signalling, since it is capable

of distinguishing osteocytes from trabecular bone from osteocytes from cortical bone

and exert a unique function. A more recent study using various Notch reporters and

modulated mice models provided convincing evidence that osteocytes express a high

level of Notch signalling and Notch has an anabolic response on the mature bone

[13]. The physiological fluctuation of signal intensity makes it necessary to uncover

the profound mechanism of Notch regulation, and the perspective of treating bone

diseases by purely activating or inactivating Notch, regardless of spatial and

temporal specificity, would not generate pronounced and consistent effects.

Figure 7: Summary of previous gene modification research on Notch signalling in

osteogenesis.


2.8 SIGNALLING CROSSTALK WITH NOTCH

2.8.1 Notch and Wnt

The Wnt signalling pathway is another important fundamental mechanism in

promoting bone formation [175-177]. It is noted that Wnt signalling should be down-

regulated in osteoblast terminal differentiation. Otherwise, the osteopenic phenotype

can be observed in which osteoblasts produce a large amount of osteoid that cannot

be mineralised properly by osteocytes [50]. This finding is consistent with the fact

that osteocyte expresses Sost, Dkk1, both of which are Wnt antagonists in bone [49,

178-180]. Striking osteopetrosis phenotype throughout the whole skeleton has been

reported after targeted deletion of the Sost gene in osteocytes [181, 182].

Nevertheless, a low level of Wnt signalling in osteocytes is still functional in

mechanosensing [179, 183]. Considering that Notch is upregulated during the

terminal differentiation, Wnt and Notch signalling may have an opposite expression

pattern in osteocytes. Further research is required in regards to which pathway is

dominant, or whether there is a higher mechanism that governs Wnt and Notch. The

results would be valuable to extend our perspective on bone mineralisation.

It is possible that the PI3K/Akt signalling pathway mediates the crosstalk between

Notch and Wnt pathways. The PI3K/Akt pathway is a key control point in

maintaining cell survival. Activation of Akt enhances cell growth by regulating

GSK-3β, which further regulates β-catenin, a downstream effector of canonical Wnt

signalling pathway [184-186]. GSK-3β, on the other hand, can regulate Notch

activity through NICD and Hes1 expression [187-189]. The encoding product of the

phosphatase and tensin homologue (PTEN) gene negatively regulates Akt activity by

dephosphorylating PIP3, an upstream activator of Akt [190]. Decreases of PTEN

result in activation of Akt, which accelerates cell growth and survival in multiple

advanced cancers [191]. Moreover, PTEN itself is inhibited by the Notch signalling

pathway through Hes1, indicating a reciprocal relationship between Notch and Akt

activity [192]. However, in the case of PTEN null cells, Hes1 exerts a direct

suppressive function on Akt, as reported in recent studies that Hes1 expression and

Akt phosphorylation are mutually exclusive during retina development [193-195]. It

has been reported that osteoblasts present a high level of phosphorylated Akt activity,

while recent findings indicate that p-Akt activity decreases during the differentiation


from late stage osteoblast to osteocyte [190]. Based on all aforementioned evidence,

we speculate that a cell context-dependent manner embedded in the crosstalk

between Notch and Wnt signalling can be both antagonistic and synergetic.

2.8.2 Notch and BMP

The BMPs pathway contains several types of ligands: BMP-1 is a metalloprotease

and BMPs 2–7 belong to the transforming growth factor -β (TGF-β) superfamily

[196]. They bind to type I or type II receptors to transduce intercellular cascade

through the Smad1, 5, 8, or p38 mitogen activated protein kinase (p38 MAPK)

pathway [197]. It is of note that those ligands have redundant functions and so do the

receptors [198]. The studies on BMP signalling pathway also lack a clear distinction

between its respective functions in osteoblasts and osteocytes, leading to

dichotomous results [17, 199]. The anabolic function of BMPs in bone (especially

BMP-2, 4, 7) is well established in osteoblast differentiation and chondrogenesis in

endochondral ossification [200, 201]. However, no solid evidence is available to

support the indispensable role of BMP signalling in osteocytes and mineralisation,

which suggests that the main contribution of BMP signalling in bone formation may

be at the matrix formation stage, rather than at the mineralisation stage [202, 203].

Early deletion of BMP-2 in osteogenesis using Prx-Cre or 3.6Col-Cre can cause

severe bone defects including low bone mass, brittle bones, and spontaneous

fractures [204, 205]. However, knocking out BMP-2 in mature osteoblasts by 2.3Col-

Cre does not affect the healing of bone fractures [206], suggesting the limited

function of BMP-2 in late stage of osteogenesis.

The mainstream opinion is that Notch enhances BMP activity in bone formation

[207, 208], although the fact can be much more complex. It has been reported that

osteocyte produce BMP-7, rather than BMP-2, in response to mechanical loading

[209]. Furthermore, sclerostin produced by osteocytes competitively binds with BMP

receptors to reduce BMP signalling, thereby preventing sclerosteosis [210]. In

normal physical conditions, the BMP signalling pathway is under strict regulation to

prevent ectopic ossification. Gremlin 1 and 2, antagonists of BMP-2, 4, and 7, have

been identified as special markers of skeletal stem cells with potential to turn into

bone and cartilage [211-215]. It is of interest that Gremlin1 shares great similarity

with Jag1 and Hes1 in promoter structure [216]. And Jagged-Notch signalling also


triggers Gremlin2 expression in the intermediate and dorsal domains in facial skeletal

development [217]. Notch also controls expression of another BMP signalling

antagonist, namely Noggin, which inhibits osteoblastic differentiation of BMSCs

[218, 219]. Administration of Noggin can rescue the altered phenotype in Rbpj

knock-out mice and improve bone formation [172]. All these data together suggest a

close relationship between BMP and Notch signalling pathways.

As mentioned above, one of the obstacles for the clinical application of BMP

signalling is the possibility of ectopic bone formation [220-224]. This suggests that

BMP signalling is an aggressive mechanism and may lead to excessive expression of

osteogenic genes in tissues that should not be ossified, for example, skeletal muscle.

Owen and Friedenstein proposed the classical concept of inducible skeletal

progenitors as early as 1988 [225]. Those progenitors are found in extraskeletal

tissues and committed to osteogenesis after BMP reprogramming, resulting in

ectopic bone formation. Meanwhile, Notch signalling has also been reported to

induce ectopic mineralisation in vascular smooth muscle cells via activating the

Msx2 gene [226]. Msx2 is also a target gene of the BMP2 pathway and responsible

for vascular calcification; however, Notch is able to directly activate Msx2

independent of BMP-2 [227], although Notch still enhances the responsiveness of

BMP-2 on Msx2 [228].

In summary, Notch and BMP may present an antagonistic relationship in physical

conditions, and BMP signalling is likely not involved in the terminal differentiation

and fate determination of osteoblasts cells. However, dysregulation of those

signalling pathways may lead to bone abnormality.

2.8.3 Notch and TGF-β

TGF-β signalling comprises three soluble ligands: TGF-β1, TGF-β2, and TGF-β3

[229]. Among them, TGF-β1 is the most abundant in bone matrix (200 μg/kg) [230].

TGF-βs elicit signals transduction through TGF-β receptors and activate Smad2/3 to

regulate target genes [229]. Similar to the BMP signalling, TGF-β also has an

alternative Smad-dependant pathway through p38 MAPK or extracellular signal

regulated kinase (Erk1/2) [231]. TGF-βs are deposited in extracellular matrix as

latent precursor molecules, which are cleaved by proteases like MMPs when

remodelling happens, resulting in the release of activated TGF-βs [232]. TGF-β


signalling induces migration of BMSCs to the bone formation sites and enhances

their proliferation [233]. However, it inhibits the maturation of osteoblasts,

mineralisation, and terminal differentiation [234]. A unique effect of TGF-β in

osteogenesis is that it prevents the apoptosis of osteoblasts to maintain a large cell

pool of osteoblasts; hence, it indirectly contributes to osteocyte formation [235].

Since osteocytes express high levels of Notch signalling and produce MMPs, Notch

signalling may be able to regulate TGF-β signalling through MMPs and couple the

osteolysis with bone formation. As a matter of fact, Notch regulates MMP2 and

MMP9 through the NF-κB pathway [236]. Notch also activates MMP13 expression

via an unknown mechanism [237]. It is unlikely that TGF-β acts as a decision maker

to determinate cell fate due to its own nature; however, it may amplify other signals

through its function in regulating cell numbers. It is reasonable to propose that after

being buried in matrix, osteocytes secrete MMPs to make room for the arborisation

and elongation of dendrites. During this process, the latent TGF-βs are also released

from matrix, diffuse along canaliculi structures to the bone surface, and eventually

contact with cells in bone marrow to regulate their viability. TGF-β signalling also

has a synergistic function with Notch, which is mediated by the interaction between

NICD and Smad3 [238, 239]. Taking into consideration the high density of the

canaliculi system, a substantial amount of active TGF-βs may be released in the

process. It seems that Notch and TGF-β signalling are mutually reinforced in signal

intensity and exert complementary functions.

2.8.4 Notch and Hypoxia-Inducible Factor (HIF)-1

HIF-1 is a dimeric transcription factor that controls the cell response to low oxygen

tension [240]. The functions of HIF-1 in bone formation are controversial based on

current findings [241-244]. It is believed that osteocytes are exposed to low oxygen

tension due to their limited access to vascular supply and this hypoxic environment

also contributes to the transition from osteoblasts to osteocytes [245]. Since the fate

of the committed osteoblasts – to become osteocytes – has been predetermined

before they are trapped in matrix, HIF-1 may not be the critical factor in this

transition; however, it still can have a role in facilitating the process.

Although the direct measurement of oxygen tension in osteocytes is unavailable,

existing data can help us analyse the microenvironment in which osteocytes reside.

Using two-photon phosphorescence lifetime microscopy, Spencer and colleagues


have directly measured the oxygen tension in blood vessels entering bone marrow

from bone matrix [246]. The results have shown that the oxygen tension dropped

from 31.8 mm Hg in bone matrix to 22.2 mm Hg in bone marrow, suggesting that

bone marrow consumes a large proportion of oxygen due to its dense cellularity and

high perfusion. This view is supported by another study showing haematopoietic

cells in relatively hypoxic status throughout bone marrow [247].

It has been reported that hypoxia stimulates the expression of Hes1 and Hey2 [248].

Furthermore, HIF-1 can stabilise NICD and enhance its transcriptional activity [249].

During the transition from osteoblasts to osteocytes, HIF-1 signalling can assist

Notch signalling to ensure the cells adapt to environmental changes and maintain

their viability.

In a brief summary, as yet there is no clear clue to describe the signal crosstalk

within those fundamental signalling pathways. The bewilderment and controversy

can be attributed to the complexity of the interconnected network. As the connection

among the components shared by various signalling pathways can occur at any level

and at any point of the pathway cascade, the overall output must be assessed in

detail, which is a quite new and demanding topic requiring advanced experimental

and analytical tools. However, big data generated by microarray analysis can provide

abundant information and shed light on research into signalling pathways [113].

Another limitation of the current bone research is that many studies on signalling

crosstalk focus on the early stage of osteoblast differentiation, while little attention

has been given to the terminal differentiation, which is a core process that switches

matrix secretion to mineralisation. And the most commonly used parameters to

evaluate bone formation are bone morphological data, which cannot reflect the

quality of the bone mass. Therefore, more detailed investigation on mineralisation,

mineral ultrastructure, and crystal structure is warranted in the future.

2.9 IN VITRO AND IN VIVO MODELS FOR STUDYING OSTEOCYTES

Because it is embedded in the mineralised bone matrix, the osteocyte is a challenging

cell type for functional study. One of the most difficult processes is the isolation of

osteocytes from bone tissues. Traditional methods for isolating osteocytes use

sequential EDTA and collagenase digestions, but the yields are limited, and the

osteocyte phenotype cannot be maintained in vitro [250, 251]. Recently, Stern et al.


used a tissue homogeniser to reduce the bone fragment to a suspension of bone

particles (50 µm in size) for culture, which makes it possible to obtain substantial

yields of osteocytes [252]. There are also some osteocyte-like cell lines available for

functional research. Among these cell lines, MLO-Y4 is the one most frequently

used. MLO-Y4 is representative of osteocytes at an early stage, expressing high

levels of the early osteocyte marker E11 and low levels of the mature osteocyte

marker Sost [253-255]. However, MLO-Y4 cannot fully simulate the gene

expressions and morphology changes in vitro, which represent the transition from

osteoblasts to osteocytes in physiological conditions. This is partly attributed to the

difficulty of constructing an ideal three-dimensional cell culture system in vitro to

mimic the physiological environment in vivo [256]. Until recently, Woo et al. have

developed a new ideal late osteoblasts cell line called IDG-SW3, which is derived

from the so-called immortomouse crossed with the Dmp1-GFP mouse, the latter

possessing an IFN-γ and temperature-sensitive SV40 large T antigen. This cell line

can maintain proliferation at 33°C with IFN-γ but undergo cell differentiation at

culture conditions of 37°C, which replicates the differentiation of osteoblasts to

mature osteocytes. The IDG-SW3 cell line expresses early and late osteocytes

markers, such as E11, Dmp1, Phex, MEPE Sclerostin, as well as Fgf23 [256].

With the development of advanced transgene and gene target technology, the

generation of the DMP1-Cre mouse, which expresses Cre recombinase under the

control of 10 kb Dmp1 promoter, has become an ideal strategy for in vivo research of

osteocyte function [257]. As Dmp1 is a specific marker of osteocytes and

odontoblasts, the Cre activity is predominantly restricted in these two cell types.

Therefore, researchers can establish a loss-of-function or overexpress model for the

genes of interest in osteocytes. Kramer et al. intercrossed DMP1-Cre mice with the

β-catenin gene-targeted mice, in which exons 2 to 6 of the β-catenin gene are located

within loxP sites. The homozygous progenies of these mice present with a low bone

mass phenotype that is characterised by absent cancellous bone mass and thinner

cortical bone in comparison with the wild type [258]. A recently released study using

animal models with heterozygous deletion of the β-catenin gene in osteocytes

demonstrated that the β-catenin signalling pathway is required for bone formation in

response to mechanical loading [259].


2.10 SUMMARY AND IMPLICATIONS

Stem cell therapy is a promising approach for bone regeneration [260, 261].

However, it is challenging to steer the differentiation and proliferation of stem cell. It

is certain that the Notch signalling pathway plays a fundamental role in this cell fate

decision, which renders it possible to control the fate of the stem cell by

manipulating the Notch pathway, where another difficulty is faced in that Notch

needs sophisticated regulation in osteogenesis. More specifically, a low level of

Notch signal is preferred for initiating osteoblastic differentiation and organic matrix

secretion while the high-intensity signal is required for terminal differentiation and

mineral deposition. If new light could be shed on the regulation mechanism used by

Notch signalling, the application of stem cell treatment in bone regeneration will be

possible. Precise methods that enable the Notch signalling pathway to be

manipulated spatially and temporally are also prerequisites. In a more detailed

perspective, the manipulation of the Notch pathway should be based on a niche level

or even on the individual cell as well.

The collagen matrix secreted by osteoblasts and the following mineral combined

with it under strict direction by osteocytes are essential for normal mineral tissue

with physical function – reaching an equilibrium between rigidity and resilience.

Notch signalling promotes the highly organised combination of collagen and mineral

through activating DMP1 expression, which has been confirmed in our study, and

possibly other noncollagenous proteins. With a better understanding of the

relationship between Notch and mineralisation, it may be possible to develop new

therapies and biomaterials for bone diseases. Based on these findings, we propose the

feasibility of specially designed biomaterials that can manipulate the Notch

signalling pathway in vivo in a spatial and temporal-specific manner.

Chapter 3: Research Part One 33

Chapter 3: Research Part One

A temporal switch from Wnt to Notch is

a physiological process during the

transition from osteoblasts to osteocytes

—To demonstrate the activity of Notch

signalling is increased while Wnt signalling

is decreased during that transition

34 Chapter 3: Research Part One


Suggested Statement of Contribution of Co-Authors for Chapter by

Published Paper

In the case of this chapter

Title: A temporal switch from Wnt to Notch is a physiological process during the

transition from osteoblasts to osteocytes.

Date, status, journal: Nov 2017, Submitted, received comments and under revision,

Journal of International Molecular Medicine

Contributor Signature Statement of contribution

Jin Shao Designed of the research, performed laboratory

experiments, data analysis and interpretation. Wrote

the manuscript.

Yinghong Zhou Design of the project, data analysis and reviewed

the manuscript, contribute equally to the manuscript

with Jin Shao

Jinying Lin Assisted with laboratory experiments and data

analysis

Rong Huang Assisted with laboratory experiments

Trung Dung

Nguyen

Assisted with laboratory experiments and data

analysis

Yuantong Gu Assisted with data analysis

Thor Friis Reviewed the manuscript

Ross Crawford Reviewed the manuscript

Yin Xiao Involved in the conception and design of the

project, supervised this work.

Principal Supervisor Confirmation


I have sighted email or other correspondence from all Co-authors confirming their

certifying authorship.

Name: Prof Yin Xiao Signature: Date:

04/Dec/2017


3.1 ABSTRACT

The osteogenic process contains several sequential steps including differentiation

from BMSC to osteogenic progenitors, which further differentiate towards pre-

osteoblasts, mature osteoblasts, and osteocytes as the terminal differentiation cell

type. As a highly conserved mechanism in cell fate determination, the Notch

signalling pathway has been intensively studied in osteogenesis. However, most

attention has been given to the early stage of osteogenic differentiation. In this

chapter, we investigated Notch expression during terminal differentiation. A

prominent target of the Notch signalling pathway, Hes1 transcriptional factor was

chosen as the indicator of Notch signalling. Immunostaining of Hes1 was performed

both in vivo and in vitro. Also, the transcriptions of Hes1, Notch1, and Rbp-jκ were

tested. To further confirm the Notch signalling intensity, a Rbp-jκ luciferase reporter

was transfected into an IDG-SW3 cell line to reflect Notch signalling. β-catenin was

tested to assess the signalling crosstalk and reveal the relationship between Wnt and

Notch signalling. The results are consistent with indications that Notch signalling

was increased during the terminal differentiation, whereas conversely, Wnt signalling

was decreased.

3.2 INTRODUCTION

It is now universally accepted that osteocytes are derived from osteoblasts [262],

which indicates that osteocytes may share some common points with osteoblasts, but

have their own unique characteristics. For example, osteocytes stop proliferation,

generate dendrites, and mediate mineralisation [22]. However, the precise

mechanism controlling this terminal differentiation process is largely unknown. A

few studies have revealed that the Wnt signalling pathway could play a role in this

transition. It has been reported that dickkoft 2 (Dkk2), a Wnt signalling antagonist, is

required for the terminal differentiation of osteoblasts and normal mineralisation.

The Dkk2 defective mice produced a large amount of organic collagen without the

mineralisation, which indicates Wnt signalling is naturally downregulated in this

transition process [50]. By contrast, osteocytes express another Wnt signalling

antagonist, sclerostin (Sost), exclusively among all cell types of osteoblastic lineage

[49]. The Wnt signalling is maintained at a low level but is still indispensable in

osteocytes to monitor and respond to mechanical loading [183]. The existing


evidence is still insufficient to conclude that the downward trend of Wnt signalling

determines and initiates the terminal differentiation.

The Notch signalling pathway in mammals contains single-pass transmembrane

ligands and four EGF-like Notch receptors that display both redundant and distinct

functions [9]. The activation of receptors initiates a sequence of proteolytic events

with the assistance of ADAM metalloprotease and γ-secretase and eventually

releases Notch intracellular domain (NICD). NICD then translocates into the nucleus

and combines to the DNA-binding protein compound of RBP-jκ and MAML 1-3 [92,

93] to control specific gene transcription, through transcriptional repressors hairy and

enhancer of split (Hes1-7) and hairy and enhancer of split related with YRPW motif

1 (Hey1, 2, and L) [8, 10]. The highly conserved Notch signalling pathway has

fundamental functions in determining the fates of various cells, including

maintenance of the osteoblastic progenitor cell pool. Notch signalling is expressed by

BMSCs to maintain their self-renewal. Using a transgenic mice model, knock-out of

Notch in BMSCs resulted in high bone mass at early ages, but starkly, low bone mass

at old ages, indicating that the progenitor pool is exhausted too early without Notch

signalling [162, 163]. On the other hand, Notch has to be down-regulated in order to

initiate the osteoblastic differentiation. In vitro studies suggest that Notch enhances

osteoblastic differentiation through direct activation of Runx2 by Hes1 activity [263].

However, controversial results have been generated with knock-out of Notch in the

osteoblasts in vivo [167, 168, 173, 264-270]. A problem embedded in those studies is

that none of them takes into account the natural expressional pattern of Notch

signalling in the differentiation process. In other words, there is still a lack of direct

evidence of the Notch functions in the terminal differentiation of osteoblastic lineage.

Limited studies focus on the functions of Notch in the terminal differentiation

towards osteocytes. Activation of Notch in osteocytes presents a high bone mass

phenotype [168]. But this effect should also be attributed to the inhibition of

osteoclastogenesis by Notch. Recently, two studies provided indirect evidence that

Notch is highly expressed in osteocytes [12, 13]. Specifically, Hey1, a target gene of

Notch signalling, was upregulated by more than 10-fold based on a gene array using

an IDG-SW3 cell line. Also, in the Notch reporter mouse model, osteocytes

expressed GFP that represented Notch signalling.


The temporal interaction of Notch and Wnt signalling plays a role in the key steps of

differentiation in a wide range of tissues and organs, including muscle, liver, cochlea,

and breast cancer [271-273]. Whether it also applies to osteogenesis is still unknown.

In this part, we performed both in vivo and in vitro studies to discuss the expressional

fluctuation between Notch and Wnt signalling pathways corresponding to various

phases during the transition from osteoblasts to osteocytes.

3.3 MATERIALS AND METHODS

3.3.1 Immunohistochemistry

The femoral samples from a 6 months female Wistar rat were decalcified in 10%

EDTA and embedded in paraffin. Serial sections of 5 µm thick were cut from the

paraffin blocks with a microtome. Briefly, after dewaxing and hydration, slides were

heated at 75 °C in a pressure cooker for antigen retrieval. The endogenous

peroxidase activity was eliminated by incubating in 3% H2O2 for 15 min. Non-

specific proteins were blocked with 10% swine serum for 1 h. Samples were

incubated with primary antibodies against Hes1 (ab71559, Abcam; 1:100) overnight

at 4 ºC, followed by incubation with a biotinylated swine-anti-mouse, rabbit, goat

secondary antibody (DAKO) for 15 min at room temperature, and then with

streptavidin peroxidase (DAKO) for 15 min. Diaminobenzidine (DAB) solution

(DAKO) was then added for 3 min to visualise the antibody complexes. The samples

were counterstained with Mayer’s haematoxylin for 15 s. Images of the stained slides

were then captured using Axion software under a light microscope (Carl Zeiss

Microimaging) at various magnifications.

3.3.2 Immunofluorescence

IDG-SW3 cells (kind gift from Professor Jerry Feng) and rat bone marrow–derived

mesenchymal stromal cells (BMSCs) were plated on 8-well chamber slides (177445,

Lab-Tek) at a density of 4,000 cells per well. The cells were washed 3 times with

ice-cold PBS followed by fixing with 2% paraformaldehyde (PFA) for 10 min at

room temperature. The cells were then incubated with 0.2% triton for cell

permeabilisation. Nonspecific proteins were blocked with the incubation of 1% BSA

in PBST for 30 min at room temperature. The primary antibodies, rabbit anti-Hes1

(ab71559, Abcam; 1:100) and anti-β-catenin (#9581, Cell Signaling Technology,

1:100), in PBST with 1% BSA were applied and incubated at room temperature for


1 h. The samples were then incubated with goat anti-mouse Alex Fluor 488 (A31560,

Life Technologies) and goat anti-rabbit Alex Fluor 647 (A21246, Life Technologies)

at room temperature for 30 min to detect the primary antibodies. The slides were

counterstained with DAPI (D1306, Life Technologies) and mounted with ProLong®

Gold Antifade Reagent (P10144, Life Technologies). The images were captured

using a Nikon EclipseTi-S microscope and a Leica SP5 confocal microscope. Cell

counting was performed using Image J software.

3.3.3 Cell culture

Rat BMSCs were isolated and cultured based on protocols from previous studies

[274]. Briefly, 12-week-old female Wistar rats were sacrificed by CO2 asphyxiation.

Femurs and tibias were dissected from surrounding tissues. The epiphyseal growth

plates were removed, and the marrow was collected by flushing with Dulbecco’s

Modified Eagle Medium (DMEM) (11885, Gibco), containing 100 U/mL of

penicillin, 100 μg/mL of streptomycin, and 10% fetal bovine serum (FBS), with a

21G needle. Single cell suspension was prepared by passing the cell clumps through

an 18G needle. The obtained cells were seeded into the tissue culture flasks

containing DMEM with 100 U/mL of penicillin, 100 μg/mL of streptomycin, and

10% FBS. On day 2, half of the medium containing nonadherent cells was replaced

with fresh medium. The medium was changed on day 4. Only cells at an early

passage (P1–P2) were used in this study. After the cells had reached 70%–80%

confluence, the medium was changed completely with DMEM containing 100 U/mL

of penicillin, 100 μg/mL of streptomycin, and 10% FBS supplemented with

50 μg/mL of ascorbic acid, 10 nM of dexamethasone, and 8 mM of β-

glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The medium was

changed every 2–3 days for the duration of the experiment. IDG-SW3 cells were

expanded in proliferation conditions -33 °C in α-MEM (12571, Gibco) with 10%

FBS, 100 U/mL of penicillin, 50 µg/mL of streptomycin, and 50 U/mL of IFN-γ

(PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in 0.2 M acetic acid)-

coated plates. IDG-SW3 cells were induced to differentiate towards osteocytes by

plating out 80,000 cells/cm2 in osteogenic differentiation conditions (37 °C with the

supplementation of 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the

absence of IFN-γ). Collagen-coated plates were necessary for both proliferation and

differentiation culture [256]. To inhibit the Notch signalling pathway, DAPT


(D5942, Sigma) diluted in DMSO was added to the culture at concentrations

indicated. The same amount of DMSO was applied as a control.

3.3.4 Western blot

The whole cell lysates were collected by adding 250 µL cell lysis buffer with

protease inhibitor (cOmplete, EDTA-free 04693132001, Roche) and phosphatase

inhibitor (PhosSTOP, 04906845001, Roche) for the Western blotting detection. A

total of 15 μg of proteins from each sample were separated on SDS-PAGE gels and

then transferred onto a nitrocellulose membrane (Pall Corporation). After being

blocked in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences),

the membranes were incubated with primary antibodies against Hes1 (1:1000,

ab71559, Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from

Professor Jerry Feng of the Texas A&M University Baylor College of Dentistry), and

α-Tubulin (1:2000, ab15246, Abcam) overnight at 4 °C. The membranes were then

incubated with anti-mouse/rabbit fluorescence conjugated secondary antibodies at

1:10000 dilutions for 1 h at room temperature. The protein bands were visualised

using the Odyssey Infrared Imaging System (LI-COR Biosciences). The relative

intensity of protein bands was quantified using Image J software. The experiments

were repeated three times and a representative blot is displayed.

3.3.5 Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzol reagent (15596-018, Life Technologies) for

RT-qPCR detection. Measurement of RNA yield was performed using a NanoDrop

1000 spectrophotometer (Thermo Fisher Scientific). Complementary DNA was

synthesised from 500 ng of total RNA using DyNAmoTM cDNA Synthesis Kit (F-

470L, Finnzymes, Thermo Scientific) following the manufacturer’s instructions. RT-

qPCR primers (Table 1) were designed based on cDNA sequences from the NCBI

Sequence database. SYBR Green qPCR Master Mix (4344463, Invitrogen) was used

for detection, and the target mRNA expressions were assayed on the 7500 Fast Real-

Time PCR System (Applied Biosystems). Experiments were performed in triplicate.

The mean cycle threshold (Ct) value of each target gene was normalised to the Ct

value of the housekeeping gene GAPDH.


Table 1: The primers for RT-qPCR

Fwd_Hes1 CAGCTGACAAGGAGGACTGA

Rev_Hes1 GTCACCTCGTTCATGCACTC

Fwd_Notch1 TGTTGTGCTCCTGAAGAACG

Rev_Notch1 TCCATGTGATCCGTGATGTC

Fwd_Rbpj CTCCACCCAAACGACTCACT

Rev_Rbpj CATCCATCTCGCTTCCATTT

Fwd_Universal_GAPDH TCAGCAATGCCTCCTGCAC

Rev_Universal_GAPDH TCTGGGTGGCAGTGATGGC

3.3.6 Rbpj luciferase reporter assay

The Cignal Rbpj reporter kit (CCS-014L) was purchased from QIAGEN. IDG-SW3

cells were seeded in 96-well plates and transfected with the reporter vector using

Lipofectamine 2000 (11668019, Thermo Fisher) as per the manufacturer’s

instructions. Luciferase activity was tested by Dual luciferase assay kit (E1910,

Promega) and detected using a POLARstar Omega Microplate Reader (BMG

LABTECH).

3.3.7 Statistical analysis

Different statistical methods and comparisons were used as indicated in the figures

and legends.

3.4 RESULTS

3.4.1 Osteocytes express high levels of Notch signalling related markers

In order to examine the pattern of Notch expression in osteocytes, we chose Hes1, a

downstream target of Notch signalling for immunohistochemistry staining of rat

femur. We found that Hes1 is highly expressed in the osteocytes buried in bone

matrix, while osteoblasts located at the surface of the bone matrix were almost

negatively stained (Fig. 8). An in vitro osteogenic culture model of rat bone marrow–


derived mesenchymal stromal cells (rBMSCs) was also used to confirm the

expression of Hes1. After 14 days of osteogenic culture, which represented the late

stage of osteogenesis, Hes1 was highly expressed in rBMSCs compared with a 7-day

culture, as shown by immunofluorescent staining (Fig. 9). This result was consistent

with the Western blot and qRT-PCR analysis that Hes1 was upregulated during the

osteogenic culture at both protein and mRNA levels (Fig. 10, 11). The IDG-SW3

cells under osteogenic conditions also showed the same pattern of Notch expression.

Figure 8: Immunohistochemistry staining of Hes1 in rat femur.

Immunohistochemistry staining of Hes1 in rat femur showed positive staining in

osteocytes (black arrow) and negative staining in osteoblasts (triangle).

Figure 9: Immunofluorescence staining of Hes1 in rBMSCs in the osteogenic culture

of 7 days and 14 days. The rBMSCs cultured in osteogenic conditions for 14 days


representing late differentiation stage expressed a high level of Hes1. The bar graph

displays the ratio of Hes1 positive cells. The number of Hes1 positive cells

significantly increased in osteogenic differentiation at 14 days compared with 7 days.

n=3. * p < 0.05, unpaired Student’s t test, comparisons between day 7 and day 14.

Scale bar: 50 μm.

To further confirm these findings, we used a Rbp-jκ luciferase reporter to transfect

the IDG-SW3 cells, and we found that there was a significant increase of Rbpj

activities in the late differentiation stage of osteocytes (Fig. 12). Also, the mRNA

levels of Notch1 and Rbp-jκ were upregulated in IDG-SW3 cells’ differentiation (Fig.

11).

Expression of Notch in osteocytes is a new topic as Notch is usually related to stem

cells and cancer, while osteocytes are terminally differentiated cells without

proliferation ability. Our results here were consistent with a study on transcriptome

changes during the transition from osteoblasts to osteocytes, which showed a more

than 10-fold increase of Hey1 in osteocytes [12], and another recent study based on

Notch reporter transgenic mouse models [13].


Figure 10: Western blots of Hes1 and β-catenin in rBMSCs and IDG-SW3 cell line.

Hes1 expression at protein level increased during late osteogenic differentiation of

rBMSCs and IDG-SW3 cell line. The bar graph represents relative bands intensity.

Protein expression has been normalised to α-tubulin. n=3 wells per group. * p < 0.05,

compared as indicated (one-way ANOVA with Bonferroni post hoc test).


Figure 11: RT-qPCR results showed the transcription of Hes1, Notch1, and Rbpj all

increased during differentiation. n=3 wells per group. * p < 0.05, compared with

day 1 (one-way ANOVA with Bonferroni post hoc test).

Figure 12: Luciferase reporter assay showed Rbpj activity also increased during the

differentiation of IDG-SW3 cell line. n=3 wells per group. ** p < 0.01, compared

with day 1 (one-way ANOVA with Bonferroni post hoc test).

3.4.2 Wnt signalling is downregulated during osteocyte formation

Although is has been established that Wnt antagonists, such as Dkk2 and Sost, are

expressed at appreciable levels in osteocytes, there is still a lack of direct data from

in vitro models to illustrate the intensity of Wnt signalling duringthe differentiation

of the mature osteoblasts . In this part of the research, we chose β-catenin as the

indicator of the Wnt signalling pathway and conducted immunofluorescent staining

in rat BMSC osteogenic culture. The results showed that expression of β-catenin had

significantly declined from day 7 to day 14 of osteogenic culture, which represents


the terminally differentiated stage of osteoblastic lineage (Fig. 13). The Western bolt

results using both BMSC and the IDG-SW3 cell line were consistent with the

immunostaining. The β-catenin at protein level was reduced from day 7 to day 14 in

BMSC and day 3 to day 7 in the IDG-SW3 cell line. And there is no significant

difference between day 7 and day 14 in the IDG-SW3 cell line (Fig. 10).

Figure 13: Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture.

Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture indicated

that Wnt signalling was decreased during the terminal differentiation of osteoblasts;

meanwhile, Notch signalling increased. Scale bar: 50 μm.

3.5 DISCUSSION

Bone matrix is deposited by osteoblasts, followed by mineralisation, which is

executed by osteocytes. Osteoblasts and osteocytes belong to the same lineage and

represent continuous differentiation stages. The mineralisation process accompanies

the transition from osteoblasts to osteocytes and fundamental epigenetic changes. It

has been reported that Hey1, a downstream target of Notch signalling, is upregulated

more than 10-fold during cell differentiation towards osteocytes [12]. Consistent with


this observation, we also reported here that Rbp-jκ, a nuclear effector for Notch

signalling transduction, increased in osteocytes. It has been reported that the function

of Notch in bone is Rbpj dependent. Tao et al. reported that the inactivation of Rbp-

jκ in a Notch gain-of-function model presented no phenotype, while Notch gain-of-

function solely induced osteosclerosis. However, this osteosclerosis phenotype was

due to the proliferation of immature osteoblasts that were restrained from terminal

differentiation; therefore, the high bone mass was of low quality. This can be proved

by the Notch gain-of-function mouse displaying a thickened skeleton but smaller

body size [166]. Our results here clearly showed that Notch is expressed at a high

level that involved the mineralisation modulated by osteocytes. However, because

Notch signalling is a complex and fundamental pathway related to various biological

activities, especially in cell fate decision and cancer [8, 275, 276], it is still difficult

to reach a conclusion as to why and how Notch signalling is expressed by osteocytes,

the terminally differentiated cells without proliferation ability. Research follow-up

would try to address this confusing problem.

Osteocytes are derived from osteoblasts, which are generated from BMSCs through

osteogenic differentiation [22]. During osteogenesis, Notch maintains the

osteoblastic progenitor pool located in bone marrow, and then it needs to be

downregulated to initiate osteogenesis; therefore, osteoblasts express Notch at a

relatively low level [163, 167, 267]. Osteocytes represent osteoblasts at the terminal

differentiation stage without redundant functions. It is well accepted that osteoblasts

are the collagenous matrix–producing cells and osteocytes are responsible for

mineralisation and load sensing [86, 277]. A possible mechanism of those functional

changes could be the high expression of Notch in osteocytes but not in osteoblasts.

Wnt signalling is another regulatory signal in osteogenesis and presents complex

crosstalk with Notch signalling [278]. Wnt induces osteoblastic differentiation and

bone formation and inhibits bone resorption [279, 280]. It is of interest to note that

Wnt is inhibited in osteocytes, as Dkk2, a Wnt antagonist, is required for

mineralisation [281]. The expression of Sost, another Wnt antagonist, is restricted in

osteocytes and some chondrocytes [22, 181]. It seems that the expression pattern of

Wnt in osteogenic differentiation is opposite to that of Notch. This phenomenon can

be explained by the different processes of bone matrix secretion and mineralisation.

More specifically, Wnt promotes osteoblasts’ differentiation and organic bone matrix


production, whereas Notch is expressed in osteocytes and takes charge in the

mineralisation process. When enough bone matrix is produced, Wnt is switched to

Notch to prevent excessive production of bone; otherwise, it may lead to

osteopetrosis. A similar temporal switch between Wnt and Notch has been observed

in muscle stem cells, where Notch and Wnt affect each other through GSK-3β

phosphorylation regulation [271]. We suppose this interaction of Notch and Wnt can

also affect osteogenesis and mineralisation and the effects can be different because

Notch signalling has a cell context-dependent nature. However, other research using

an overexpression model suggested that Notch can enhance Wnt signalling in

osteocytes by suppressing Sost [168]. It is possible that the function of Notch is also

concentration-dependent. Therefore, further studies are warranted to determine the

interaction of Notch and Wnt in osteocytes.

3.6 CONCLUSIONS

During the transition from osteoblasts to osteocytes, Notch signalling is increased,

whereas Wnt signalling is downregulated. The functions of Notch in terminal

differentiation and the exact interaction between Notch and Wnt signalling pathways

needs to be elucidated in future research.

Chapter 4: Research Part Two 51

Chapter 4: Research Part Two

Notch signalling pathway is required for

cell cycle arrest, morphological change, and

mineralisation of osteocytes

—To demonstrate the inhibition of

Notch signalling causes abnormal cell

proliferation, morphology, and

mineralisation

52 Chapter 4: Research Part Two



Published Paper


Title: Notch signalling pathway is required for osteocytes differentiation


Bone




the manuscript.

Yinghong Zhou Assisted with data analysis and reviewed the

manuscript







04/Dec/2017


4.1 ABSTRACT

The finding presented in the previous part that Notch was upregulated during the

osteoblastic terminal differentiation generated the requirement to explore the

functions of Notch in osteocytes. During the transition from osteoblasts to osteocytes,

the cubic, proliferation, and collagen-secreting cells become dendritic, static, and

mineralisation-mediating cells. In this study, Notch signalling was inhibited by the

addition of DAPT or through siRNA interference, and changes in cell proliferation,

cell morphology, and mineralisation were evaluated to illustrate the Notch functions

in osteocytes. Specifically, FACS based on EdU labelled proliferation cells was

performed. To assess the cell morphological change, SEM was utilised as well as the

immunostaining of E11 proteins. In the mineralisation aspect, DMP1 expression was

verified plus with SEM and TEM images to evaluate the mineral structure,

transportation, and mechanical properties. The results suggested a comprehensive

role of Notch in osteocytes. After blocking Notch, the proliferation rate was

increased in the late differentiated osteoblasts. Also, it was difficult for cells to

generate dendritic processes when Notch signalling was deficient. Moreover, the

mineral could not infiltrate into the gap zone of collagenous fibrils after Notch

blockage. Under the same conditions, the crystal structure and binding force of

mineral nodules were also impacted. Moreover, intracellular mineral transportation

was abnormal with small particles that were not efficient for normal extracellular

mineral deposition. In summary, the data generated in this part provided relatively

solid evidence to support a critical role of Notch in osteocytes.

4.2 INTRODUCTION

Osteocytes embedded in bone matrix represent the most abundant bone cells. They

are derived from osteoblasts and experience a series of changes during the transition

that includes cessation of proliferation, morphological alteration (generation of

multicell dendrites), and biological function shift from secreting organic matrix to

guiding mineralisation [6]. Proliferation of the buried osteocytes is unlikely due to

the limited space enclosed by bone matrix.

Corresponding to these changes, osteocytes express identical markers like E11, (also

known as gp38 and podoplanin) and dentin matrix protein (DMP1). E11 is an early

osteocyte marker and necessary for the generation of dendritic processes [32]. The


protein is highly hydrophobic and negatively charged [282]. The structure of the

protein is composed of extracellular and transmembrane domains as well as a

cytoplasm-tail, which can bind to other coeffective proteins. In osteocytes, E11

proteins are located only at the dendritic processes [28] and overexpression of E11

renders elongation of the dendrites in vitro [283]. E11 regulates the generation of

dendritic processes through binding to CD44 and ezrin-radixin-moesin complexes

[284, 285]. The cytoplasmic-tail region of CD44 in combinationwith ezrin-radixin-

moesin complexes is important in regulating the actin cytoskeleton [286-291].

DMP1 has been intensively investigated for its primary role in regulating

mineralisation [292]. DMP1 belongs to the SIBLING (small integrin-binding ligand

N-linked glycoproteins) family, which comprises most noncollagenous proteins in

bone. The highly phosphorylated property of DMP1 makes it possible to regulate

mineral formation and organisation, as well as phosphate homeostasis [2, 82, 293].

DMP1 binds to Ca2+ and then is phosphorylated to form a DMP1 complex. Only this

complex formation of DMP1 can be transferred to the extracellular matrix to direct

biomineralisation [294]. The highly negatively charged nature of DMP1 renders it

bind to the positively charged gap zone of collagenous fibrils and transfer the

calcium and phosphate in an amorphous style into the mineral sites [295-297].

Some evidence showing the regulation of E11 is available. It has been reported that

transcriptional factor Sp1/3 can upregulate E11 expression under the trigger by

hyperoxic pressure [298, 299]. Also, AP-1 regulates the transcription of E11 [300].

However, regulation of DMP1 was poorly understood until a recent study found that

TCF11 regulates DMP1 transcription in both osteocytes and odontoblasts [301].

Interestingly, TCF11 is closely related to the Notch signalling pathway, leading us to

consider the function of Notch in osteocytes [302, 303].

The results presented in the previous chapter showed Notch signalling is increased in

osteocytes, which is consistent with several recent findings [12, 13]. However, the

functions of Notch in osteocytes are largely unknown. So far, accumulating evidence

shows that Notch differentially regulates proliferation in a cell context-dependent

manner. In this chapter, we will discuss the specific function of Notch in the

proliferation of osteocytes. Further, the roles of Notch in osteocytes’ morphological

changes and cell mediated mineralisation will be tested as well.



4.3.1 Immunohistochemistry

The femoral samples from 6-month-old female Wistar rats were decalcified in 10%

EDTA and embedded in paraffin. Serial sections of 5 µm thick were cut from the

paraffin blocks with a microtome. Briefly, after dewaxing and hydration, slides were

heated at 75 °C in a pressure cooker for antigen retrieval. The endogenous

peroxidase activity was eliminated by incubating in 3% H2O2 for 15 min. Non-

specific proteins were blocked with 10% swine serum for 1 h. Samples were

incubated with primary antibodies against ki-67 (ab16667, Abcam; 1:100),

proliferation cell nuclear antigen (PCNA, M0879, DAKO; 1:100) and E11(ab10288,

Abcam;1:100) overnight at 4 ºC, followed by incubation with a biotinylated swine-

anti-mouse, rabbit, goat secondary antibody (DAKO) for 15 min at room

temperature, and then with streptavidin peroxidase (DAKO) for 15 min.

Diaminobenzidine (DAB) solution (DAKO) was then added for 3 min to visualise

the antibody complexes. The samples were counterstained with Mayer’s

haematoxylin for 15 s. Images of the stained slides were then captured using Axion

software under a light microscope (Carl Zeiss Microimaging) at various

magnifications.



mesenchymal stromal cells (BMSCs) were plated on 8-well chamber slides (177445,

Lab-Tek) at a density of 4,000 cells per well. The cells were washed 3 times with

ice-cold PBS followed by fixing with 2% paraformaldehyde (PFA) for 10 min at

room temperature. The cells were then incubated with 0.2% triton for cell

permeabilisation. Nonspecific proteins were blocked with the incubation of 1% BSA

in PBST for 30 min at room temperature. The primary antibodies, rabbit anti-Hes1

(ab71559, Abcam; 1:100) and mouse anti-E11 (ab10288, Abcam; 1:100), in PBST

with 1% BSA were applied and incubated at room temperature for 1 h. The samples

were then incubated with goat anti-mouse Alex Fluor 488 (A31560, Life

Technologies) and goat anti-rabbit Alex Fluor 647 (A21246, Life Technologies) at

room temperature for 30 min to detect the primary antibodies. The slides were

counterstained with DAPI (D1306, Life Technologies) and mounted with ProLong®


Gold Antifade Reagent (P10144, Life Technologies). The images were captured

using a Nikon EclipseTi-S microscope and a Leica SP5 confocal microscope. Cell

counting was performed using Image J software.

4.3.3 Cell culture


[274]. Briefly, 12-week-old female Wistar rats were sacrificed by CO2 asphyxiation.

Femurs and tibias were dissected from surrounding tissues. The epiphyseal growth

plates were removed, and the marrow was collected by flushing with Dulbecco’s

Modified Eagle Medium (DMEM) (11885, Gibco), containing 100 U/mL of

penicillin, 100 μg/mL of streptomycin, and 10% fetal bovine serum (FBS) with a

21G needle. Single cell suspension was prepared by passing the cell clumps through

an 18G needle. The obtained cells were seeded into the tissue culture flasks

containing DMEM with 100 U/mL of penicillin, 100 μg/mL of streptomycin, and

10% FBS. On day 2, half of the medium containing nonadherent cells was replaced

with fresh medium. The medium was changed completely on day 4. Only cells at an

early passage (P1–P2) were used in this study. After the cells had reached 70%–80%

confluence, the medium was changed completely with DMEM containing 100 U/mL

of penicillin, 100 μg/mL of streptomycin, and 10% FBS supplemented with

50 μg/mL of ascorbic acid, 10 nM of dexamethasone, and 8 mM of β-

glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The medium was

changed every 2–3 days for the duration of the experiment. IDG-SW3 cells were

expanded in proliferation conditions -33 °C in α-MEM (12571, Gibco) with 10%

FBS, 100 U/mL of penicillin, 50 µg/mL of streptomycin, and 50 U/mL of IFN-γ

(PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in 0.2 M acetic acid)-

coated plates. IDG-SW3 cells were induced towards osteocytes differentiation by

plating at 80,000 cells/cm2 in osteogenic differentiation conditions (37 °C with the

supplementation of 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the



(D5942, Sigma) diluted in DMSO was added to the culture medium at concentrations

indicated. The same amount of DMSO was applied as a control.


4.3.4 siRNA knockdown

For knockdown of Hes1, IDG-SW3 cells were transfected with mouse siRNA

oligonucleotides targeting Hes1 (NM_008235, Sigma-Aldrich) using RNAimax

(Invitrogen) according to the manufacturer’s instructions and previous research

[166]. Briefly, IDG-SW3 cells were seeded on 6-well plates at 1*106 cells per well

one day before transfection. 50 nM siRNA targeting Hes1 and fluorescent universal

negative control siRNA (Sigma-Aldrich) were transfected with RNAimax reagent

(Invitrogen) in opti-MEM (Gibco) without serum for 6 h before the cells were

washed with PBS and changed to osteogenic medium. Samples were collected at 1,

3, and 7 days after transfection.

4.3.5 EdU labelling and FACS

Click-iT® EdU Alexa Fluor® 488 Flow Cytometry Assay Kit (C10420, Life

Technologies) was used in this experiment as per the manufacturer’s instructions.

Briefly, 10 μM EdU was added to the culture medium to label the proliferation cells

for 6 h [304]. For FACS, cells were harvested by 0.25% trypsin, followed by fixation

and adding Click-iT® reaction cocktail. The Alexa Fluor 488 quantify was performed

using a BD FACSAria3 cell sorter (BD Biosciences, CA, USA) with 530/30 nm

filter. The data were analysed by FACSDiva version 6.1.3. For fluorescent

microscope observation, cells were fixation directly on the cell plates after 6 hours’

incubation with EdU and detection. Images were taken by Nikon EclipseTiS

microscope.

4.3.6 Western blot



inhibitor (PhosSTOP, 04906845001, Roche) for the Western blotting detection. A

total of 15 μg of proteins from each sample were separated on SDS-PAGE gels and

then transferred onto a nitrocellulose membrane (Pall Corporation). After being

blocked in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences),

the membranes were incubated with primary antibodies against Hes1 (1:1000,

ab71559, Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from

Professor Jerry Feng of the Texas A&M University Baylor College of Dentistry), and

α-Tubulin (1:2000, ab15246, Abcam) overnight at 4°C. The membranes were then







4.3.7 Quantitative reverse transcription polymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzol reagent (15596-018, Life Technologies) for

RT-qPCR detection. RNA yield was measured using a NanoDrop 1000

spectrophotometer (Thermo Fisher Scientific). Complementary DNA was

synthesised from 500 ng of total RNA using DyNAmoTM cDNA Synthesis Kit (F-

470L, Finnzymes, Thermo Scientific) following the manufacturer’s instructions. RT-

qPCR primers (Table 1) were designed based on cDNA sequences from the NCBI

Sequence database. SYBR Green qPCR Master Mix (4344463, Invitrogen) was used

for detection, and the target mRNA expressions were assayed on the 7500 Fast Real-

Time PCR System (Applied Biosystems). Experiments were performed in triplicate.

The mean cycle threshold (Ct) value of each target gene was normalised to the Ct

value of the housekeeping gene GAPDH.

Table 2: The primers for RT-qPCR

Fwd_DMP1 GCATCCTGCTCATGTTCCTTTG

Rev_DMP1 GAGCCAAATGACCCTTCCATTC

Fwd_E11 GTCCAGGCGCAAGAACAAAG

Rev_E11 GGTCACTGTTGACAAACCATCT

4.3.8 SEM

IDG-SW3 cells cultured for 3 weeks were fixed in 2.5% glutaraldehyde at 4 °C for

1 h and dehydrated through a series of increasing concentrations of ethanol (50%,

70%, 90%, 100%, and 100% vol/vol) for 5 min each. Samples were coated with 1–

2 nm gold–palladium and viewed under a Zeiss Sigma variable-pressure (VP) field-

emission scanning electron microscope (SEM).


4.3.9 TEM

Mineralised cultures were fixed in 2.5% glutaraldehyde at 4 °C for 1 h, postfixed in

osmium tetroxide, dehydrated in a graded ethanol series, treated with acetonitrile,

and finally infiltrated with a Quetol-based resin. Embedded samples were

polymerised at 60 °C for 24 h, sectioned (75 nm) using a Leica EM UC7 ultra

microtome and collected on bare 300 mesh copper TEM grids followed by post-

staining with uranyl acetate and lead citrate. Transmission electron microscope

(TEM) observation and selected area electron diffraction were performed using

JOEL 1400 at 80 kV.

4.3.10 AFM

The binding forces were measured using a method described previously [305].

Briefly, samples were prepared using a protocol for SEM; images were taken before

and after the AFM tests to calculate the level of mineral removal. The AFM system

Nano surf FlexAFM (Nanosurf AG, Switzerland) and the rectangular cantilever

ACLA (AppNano) were used. The cantilever tip has a pyramidal tip with a front

angle of 9°. The cantilever spring constant was determined to be around 40.46 N/m.

The sensitivity calibration S of the cantilever is performed by indenting a hard

surface to measure the slope of the force–height curve. The lateral detachment force

was determined based on the total compression of the cantilever, probe geometry,

and cantilever orientation.

4.3.11 Calcium concentration

The calcium concentration of cells was determined using the calcium detection kit

(ab102505, Abcam). The optical densities (ODs) were tested on a Bio-Rad

microplate reader at 575 nm. All the results were normalised to the (–DPAT) group.

Three independent experiments were performed in triplicate.

4.3.12 Statistical analysis

Different statistical methods and comparisons were used as indicated in the figures

and legends.


4.4 RESULTS

4.4.1 Notch inhibits proliferation of late osteoblasts

The fact that osteocytes do not undertake proliferation is widely accepted; however,

the proliferation rate of osteoblasts, especially mature osteoblasts, still causes

controversy [306, 307]. Immunohistostaining of samples from rat femur were

conducted to assess expression of the proliferation markers PCNA and ki-67 to

provide more solid evidence to clarify this question. The results showed negative

staining of those markers in osteocytes, which was consistent with the exist

understanding of osteocytes. We also found that some mature osteoblasts located on

the bone surface still presented proliferation activity (Fig. 14). These findings

supported the view that mature and functional osteoblasts that secreted organic

matrix are still in the cell cycle. Osteoblasts have three destinations: apoptosis, bone

lining cells, and osteocytes [308], so the proliferation of osteoblasts is important to

replenish the cells lost.

Figure 14: Ki-67 and PCNA immunohistochemistry staining of rat femur samples.

Ki-67 (left) and PCNA (right) immunohistochemistry staining of rat femur samples.

Osteoblasts and osteocytes as indicated. None of the osteocytes embedded in the

bone matrix stained positive for the proliferation markers. By contrast, osteoblasts

located on the bone surface stained positive for these markers. Scale bar: 10 μm.

We also conducted osteogenic culture of rat BMSCs and observed the proliferation

rates by EdU labelling at different differentiation time points. The results showed

that the proliferation rate was increased during the early differentiation stages from

day 1 to day 3. Interestingly, however, the proliferation rate was strikingly declined


at the late stage of differentiation, indicating that most cells presented an osteocyte

phenotype at that stage (Fig. 15).

Figure 15: EdU labelled rat BMSC in osteogenic culture.

At day 7 of osteogenic culture, the cell proliferation rate was dramatically decreased,

indicating that at that stage, differentiated cells composed the majority of the

population. The bar graph shows the counting of EdU positive cells. Scale bar:

50 μm. n=3, unpaired Student’s t test, comparison as indicated, * p < 0.05.

Comparison as indicated.


Figure 16: FACS based on EdU labelled BMSCs in osteogenic culture.

At late differentiated stages day 7 and day 14, only 4.9% and 2.5% of cells were in

proliferation, showing most of the cells had exited from the cell cycle. When LiCl

was added into the osteogenic culture, the proliferation rates rose to 11.7% and 17.7%

respectively. These results suggested Wnt’s sole role in promoting cell proliferation.

When Notch was inhibited by adding DAPT, the proliferation rate was 4.7% at day 7,

but no significant changes were observable in normal osteogenic culture. But the rate


increased robustly to 54.0% at day 14, indicating a further late function of Notch in

repressing cell proliferation. The bar graph shows cell proliferation ratios based on

EdU labelled cell counting. Of note, BMSCs in normal culture presented relatively

high proliferation rates at both day 7 and day 14, which further confirmed that most

cells lost proliferation capacity in late osteogenic culture. n=3, unpaired Student’s t

test, comparison as indicated, * p < 0.05. Comparison as indicated.

The EdU labelled cells were also quantified by FACS. Consistent with the above

results, the cells presented low proliferation rates at the terminal differentiation

stages: 4.9% at day 7 and 2.5% at day 14 (Fig. 16). Another interesting finding was

that proliferation rates underwent significant changes when Wnt and Notch

signalling pathways were chemically induced. Specifically, proliferation rate was

increased when Wnt was activated by adding LiCl at both day 7 and day 14. When

Notch signalling was inhibited by DAPT, the proliferation rate was not changed on

day 7 but increased significantly to 54% by day 14, which suggested Notch might

have an important role to stop cell proliferation at the terminal differentiation. This

phenomenon was quite different from the undifferentiated and early differentiated

stages, in which Notch promoted cell proliferation (Fig. 17). Our findings presented

here suggest that Notch indeed regulates proliferation differently in a cell context-

dependent manner. More specifically, although Notch promotes proliferation in stem

cells and early differentiated cells, it facilitates the exit of the cell cycle in the

terminal differentiation, just like its role in the skin [309, 310].

Osteocytes lose the capacity to proliferate since the lacunar space in which

osteocytes are embedded provides limited space for cell growth. However,

osteoblasts are highly metabolic cells with proliferation, which implies that the

cessation of proliferation may represent a major event during the transition from

osteoblasts to osteocytes. The role of Notch in supressing proliferation in late

differentiated osteoblastic cells renders that if Notch does not determine, it is at least

required for, the formation of osteocytes.

Consistent with the arrest of the cell cycle, the Wnt/β-catenin signalling pathway is

decreased during the terminal differentiation, which is highly related to proliferation.

To the best of our knowledge, no report shows that Wnt signalling can inhibit cell

proliferation, indicating the sole role of Wnt in the cell cycle in contrast to the


versatile Notch signalling pathway [311, 312]. Hence, we suppose here that the

Notch signalling pathway plays an active role in interaction with the Wnt signalling

in regulating the cell cycle in terminal differentiation.

Figure 17: FACS based on EdU labelled BMSCs and MC3T3 cell line in normal

culture after 3 days. Inhibition of Notch by adding DAPT in normal culture medium

caused decreases of proliferation from 33.7% to 29% in rat BMSCs and 26.9% to

16.6% in MC3T3 cell line. These results indicated an opposite function of Notch on

proliferation at the early differentiation stage.

4.4.2 Notch is required for cell mediated mineralisation

Notch is required for the expression of osteocyte markers

For a decade, DMP1 has been considered as a critical marker of osteocyte that has an

important role in mineralisation. The IDG-SW3 cells express GFP under the

direction of the DMP1 promotor. This property makes this cell line a powerful tool

for osteocyte research. We blocked Notch signalling by adding a gradient

concentration of DAPT, a γ-secretase inhibitor and an indirect deactivator of Notch,

to test whether Notch regulates DMP1 expression. IDG-SW3 cells expressed

intensive GFP after 14 days of culture in osteogenic differentiation medium;

however, the intensity of GFP gradually decreased with the increasing concentration


of DAPT. The GFP could not be detected when IDG-SW3 cells were cultured with

50 μM DAPT (Fig. 19). This downregulation of DMP1 by blocking Notch had also

been confirmed at both transcription and translation levels (Fig. 18).

Figure 18: Western blots showed IDG-SW3 cell line expressed DMP1.

The expression was inhibited remarkably after the supplementation of DAPT to

block Notch signalling. Relative band intensity was calculated based on Western

blotting results. RT-qPCR results were consistent with Western blots. n=3,

* p < 0.05, ** p < 0.01, unpaired Student’s t test, comparisons between –DAPT and

+DAPT groups at the corresponding time points.

qRT-PCRWestern blot


Figure 19: Live cell fluorescent images showed GFP activity representing DMP1

expression gradually increased during IDG-SW3 cell osteogenic differentiation. The

increasing concentration of DAPT added into the culture system led to a gradual

decrease of GFP intensities. And when the concentration of DAPT reached 50μM,

the GFP was nearly eliminated. Scale bar: 50 μm.

In order to exclude the possibility that DAPT may affect normal cell activities,

siRNA interference was performed to knock down the expression of Hes1. The result

was consistent with the DAPT treated experiment; that is, when Hes1 expression was

interfered by siRNA, the expressions of both DMP1 and E11 were significantly

reduced compared with the groups transfected with universal negative control siRNA.


Figure 20: RT-qPCR results showed the transcription of Hes1, Notch1, DMP1, and

E11 after Hes1 expression was intefered by siRNA targeting Hes1 after 3 days of

treatment. Control represents normal IDG-SW3 cells, siRNA represents IDG-SW3

cells transfected with universal negative control siRNA, siRNA represents IDG-SW3

cells transfected with siRNA targeting Hes1. n=3 wells per group. * p < 0.05,

comparison made between each two groups. (unpaired Student’s t test). There was no

significant change between control and negative siRNA groups.

Inhibition of Notch signalling disturbs both extracellular and intracellular mineralisation mediated by osteocytes

The general mineralisation was examined by von Kossa staining. After 14-day

osteogenic differentiation, many mineral nodules were formed by IDG-SW3 cells,

while the number and diameter of the nodules were significantly reduced in the

DAPT group (Fig. 21). Moreover, the ultrastructures of the mineral nodules were

observed under TEM. In normal mineralisation, plenty of mineral particles are

closely attached to collagen fibrils; in contrast, the mineral particles were randomly

deposited and showed a lack of tight connection to collagen. As the main function of

DMP1 is to prevent the spontaneous deposition of calcium phosphate and modulate

the transportation and integration of CaP to the gap zone of collagen fibrils [294],

this abnormal mineralisation could be attributed to the lack of DMP1 in the DAPT

group. In accordance with a series of reports on intracellular mineralisation [295,

297, 313, 314], mineral vesicles with appropriate size were observed in the

cytoplasm. However, when cultured with the supplementation of DAPT, the

intracellular mineral particles were much smaller and sparsely distributed in the


cytoplasm (Fig. 22). Intracellular mineralisation is a key step for normal

biomineralisation, although the mechanism that controls this process is largely

unknown. The calcium concentration in cells had been determined, and the results

showed a decrease in Notch-inhibited IDG-SW3 cells. This evidence supported the

findings of Narayanan and co-workers, which suggested unphosphorylated DMP1

promotes the influx of calcium ions from extracellular fluid [34].

Figure 21: IDG-SW3 cells formed mineralised nodules shown by von Kossa staining

and TEM images. IDG-SW3 cells (–DAPT) formed more mineralised nodules

compared with a group of (+DAPT) as shown by von Kossa staining. TEM images

showed (–DAPT) minerals (upper: A, B, and C) were penetrated into and closely

related to collagen fibrils (red arrow), while (+DAPT) minerals (lower: D, E, and F)

were deposited on the surface of collagen, and it was difficult for the mineral to

infiltrate into the gap zone of the collagenous fibrils (red arrow).


Figure 22: TEM images of IDG-SW3 showing intracellular mineral particles.

TEM images of IDG-SW3 (–DAPT) cells showed aggregated minerals located in

plasma. In contrast, there were only sparse and small minerals observed in (+DAPT)

cells. The bar graph showed intracellular calcium concentration also decreased in

(+DAPT) cells. n=3, * p < 0.05, unpaired Student’s t test, normalised to –DAPT

group.

Notch signalling influenced the mechanical properties of mineralisation

Most previous studies focused on the quantity of mineral nodules to reflect

mineralisation [13]. However, the quality, more specifically the mechanical

properties of the mineralisation, should also be considered. In this study, we tested

the crystal structure of the nodules using selected area electron diffraction (SAED)

[315]. The nodules formed by IDG-SW3 cells in differentiation condition presented a

similar diffraction pattern to that of normal bone, indicating the structure of normal

nodules resembled normal bone. In contrast, after Notch was inhibited the diffraction

pattern was less distinct, which meant that the crystal structure of nodules formed by

osteocytes was abnormal due to the lack of Notch signalling (Fig. 23). To provide

more convincing evidence, we also performed an AFM test to determine the binding

force of the mineral nodules [316]. After a detachment force of 35 μN was applied,


there were nearly no nodules that could be removed in the normal group (Fig. 24 A

and B). However, evidently most nodules were removed from cell culture plates in

the DAPT group under the same detachment force (Fig. 25 C and D). For

quantitative analysis, three levels of mineral nodule removal were established

according to the percentage of mineral nodules removed: high (42%), medium

(18%), and low (8%), respectively. Significantly higher detachment force was

required to remove mineral nodules in the IDG-SW3 normal mineralisation group. In

other words, normal mineral nodules combined more tightly to collagen (Fig. 24 E).

Figure 23: SAED analysis revealed the crystal structure of mineral nodules.

The crystal structure of minerals formed by IDG-SW3 (–DAPT) cells resembled that

of normal bone, which was distinct from that of the (+DAPT) group. Arrows indicate

crystalline standard diffraction planes of 002, 211, and 004, which are characteristics

of native bone.


Figure 24: Binding force assay.

Three levels of removal were defined as high (42%), medium (18%), and low (8%).

At all these levels, the forces applied to detach minerals were higher in the (–DAPT)

group than the (+DAPT) group, indicating the binding force of minerals was greater

in the (–DAPT) group. All the data are shown as mean ± standard deviation;

* p < 0.05 indicated the significant difference of the forces between –DAPT and

+DAPT groups using unpaired Student’s t test.

4.4.3 Notch plays a role in the morphological change from osteoblasts to

osteocytes

E11 is the earliest osteocyte that is expressed on the cell membrane and involves the

generation of dendrites. The immunofluorescent staining of E11 and ki-67 showed

mutually exclusive expression of these two markers, which further confirmed that

osteocytes lose proliferation ability (Fig. 25 A, B). The expression of E11 was


restricted in osteocytes (Fig. 25.C). All these data suggested that E11 is an osteocyte-

specific marker and an ideal indicator to represent the transition towards osteocytes.

Figure 25: E11 is an osteocyte marker.

(A): Immunofluorescence staining of E11 and ki-67 of rat BMSC osteogenic culture

at 7 and 14 days. The immunofluorescence staining showed that some cells started to

express E11 7 days after osteogenic induction. Interestingly, the E11 positive cells

were surrounded by ki-67 positive cells. Scale bar: 50 μm. (B): Confocal microscope

image of rat BMSC osteogenic culture on day 14. Confocal microscope observation

showed that the cells stained positive for E11 were mainly expressed at the typical

multidendrites as morphological characteristics of osteocytes. Scale bar: 20 μm. (C):

Immunohistochemistry staining of E11 in rat femoral tissues, which confirmed that

E11 was expressed in the osteocytes (as indicated by black arrow) but not in the

osteoblasts.

Scale bar: 20 μm.


Figure 26: E11 expression at both protein and RNA levels.

Western blots showed the IDG-SW3 cell line expressed E11 as the osteogenic

culture. The expression was inhibited remarkably after the supplementation of DAPT

to block Notch signalling. Relative band intensity was calculated based on Western

blotting results. RT-qPCR results were consistent with Western blots. n=3,

** p < 0.01, unpaired Student’s t test, comparisons between –DAPT and +DAPT

groups.

E11 plays a role in the development of dendrites, which is a unique morphological

characteristic of osteocytes. We conducted immunofluorescent (IF) staining of E11

in IDG-SW3 cells. As the fixation procedure could destroy the GFP activity, the

spontaneous GFP would not affect the IF staining. Confocal images confirmed that

E11 was strongly expressed in the cytoplasm of IDG-SW3 cells cultured in

differentiation medium, while the expression was obviously inhibited when DAPT

was added (Fig. 27), which was consistent with the Western blot and qRT-PCR

results (Fig. 26). Morphological analysis showed a significant decline in both

dendrite length and dendrite number when Notch signalling was inhibited (Fig. 27).

Western blot qRT-PCR


Figure 27: Morphological characteristics of IDG-SW3 cells.

Immunofluorescent staining of E11 (green) and DAPI (blue) were observed under

confocal microscope. IDG-SW3 (–DAPT) cells presented clear dendrite structure

and high expression of E11 (A). No clear dendrite structure was found in IDG-SW3

(+DAPT) cells (D). Scale bar: 75 μm. SEM images (right column) also revealed


similar morphological changes in the (+DAPT) group (B, C and E, F). Scale bar:

10 μm. (G) Statistical analysis based on the confocal images using Autoquant and

Imaris software as described by Ren et al.[317] confirmed both length and number of

dendrites were significantly reduced in the (+DAPT) group. n=3, ** p < 0.01,

unpaired Student’s t test, comparisons between –DAPT and +DAPT groups.

4.5 DISCUSSION

The Notch signalling pathway is versatile in nature in correlations with various

contexts [318, 319]. More confusingly, Notch promotes proliferation and tumour

development in some circumstances such as T-cell leukaemia [320, 321] but cell

apoptosis or proliferation suppression in others such as small-cell lung cancer [322-

324]. Notch was even found to present both oncogenic and tumour-suppressive

properties in cervical cancer [325-327]. Osteocytes cannot proliferate because they

are surrounded by hard bone tissue. In other words, exit from the cell cycle is a

prerequisite for cells to become osteocytes. Consistent with those reports, the data

presented here showed that Notch promoted proliferation of BMSCs and osteoblastic

progenitors but inhibited proliferation of late stage osteoblasts. This paradoxical

nature of Notch exactly supports the cell context-dependent manner of its biological

functions, as introduced previously [10].

On the other hand, the relationship between proliferation and the Wnt signalling

pathway is quite simple and direct. The Wnt signalling pathway remarkably

promotes cell proliferation regardless of cell type and differentiated stage [328-330].

So, it is easy to understand that Wnt signalling is suppressed during the terminal

differentiation of osteoblasts because the proliferation is stopped. It seems that in

determining cell cycle exit, Notch signalling plays an active role while Wnt is

passively downregulated due to the high Notch activity. Detailed studies will be

conducted to illustrate the relationship between Notch and Wnt signalling pathways

in the next chapter.

Bones need both rigidity and resilience to maintain physical function. The

compromise between rigidity and resilience can be attributed to the proper ratio of

organic collagen to the mineral component, as well as the structure of mineral

crystallite in terms of shape, size, and crystallinity [331]. Bone matrix is deposited by


osteoblasts, then mineralisation is executed by osteocytes. As osteoblasts are far

away from the mineral frontline, it is believed that the osteocytes embedded in

osteoid have an important role in the mineralisation process [42]. Feng and

colleagues found that the mineralisation started at the proximal sites of osteocytes,

then extended to the distal sites, and there was a clear boundary between two

fluorochromes [2]. Quantitative information has also been reported, showing that

60% of the minerals reside within a distance less than 1 μm from the canaliculi and

80% of the minerals are located within a distance of 1.4 μm [59]. Even after

apoptosis, because access for other cell types is nonexistent, the lacuno–canalicular

space is infilled with minerals and the remnant osteocyte structures become

mineralised by themselves, leaving the dead osteocytes as a fossil [86]. Taken

together, all the evidence reviewed above indicates it is osteocyte, rather than

osteoblast, that mediates collagen mineralisation.

The collagen acts as the scaffold and template to guide mineralisation. Moreover, it

positively promotes the infiltration of amorphous calcium phosphate [332]. The

major mineral component of bone, hydroxyapatite, does not crystallise spontaneously

as it depends on specific extracellular matrix proteins to form nucleated amorphous

calcium phosphate (ACP) particles. ACP particles then ripen and expand in scale,

and eventually form hydroxyapatite [333]. Intensive studies have focused on the

mineral regulatory function of noncollagenous proteins, among which DMP1 is the

best known player, in matrix-mediated mineralisation. DMP1 has binding sites to

both calcium phosphate and collagen [334]. It has been reported that the c-terminal

fragment of DMP1 mediated osteocyte maturation and mineralisation [2]. In an in

vitro study, DMP1 has been shown to prevent unregulated calcium phosphate

precipitation in solution and promote controlled nucleation of mineral particles by

stabilising calcium phosphate and transferring it to the gap region of collagen where

it would then be deposited and crystallised. This process can also be attributed to that

phosphorylated DMP1 can form negatively charged mineral complexes and this

property helps mineral to infiltrate into collagen fibrils carrying a positive charge

[294, 332]. Consistent with this observation, an unregulated spontaneous mineral

precipitation that is randomly deposited without normal organisation or connection

with collagen has been found in osteocytes lacking DMP1 in our experiment. The

relationship between DMP1 and mineralisation is clear, although the specific


mechanism involved in this process in vivo is still largely unknown. We have

presented solid evidence in this report that Notch is required for the normal

expression of DMP1, providing clear explanations for the role of Notch in cellular

mineralisation.

In this study, an abnormal intracellular mineralisation has been observed in

osteocytes with Notch signalling blockage. Normally, calcium phosphate deposits are

located intracellularly in osteocytes, especially in mitochondria with an average size

of 50~80 nm, but in Notch-inhibited osteocytes, the globules are smaller with

disordered morphologies [297, 313]. These abnormal mineral particles are secreted

into the extracellular matrix, delivered by vesicles containing calcium phosphate.

Hence, the intracellular mineralisation is a key step in normal biomineralisation.

However, the specific mechanism that controls this process remains unknown [295].

We have provided evidence that shows that intracellular mineralisation is disturbed

when Notch signalling is inhibited. It is possible that Notch not only affects

extracellular mineralisation by inhibiting DMP1 but also interferes with intracellular

mineralisation via unknown mechanisms. Karthikeyan et al. suggested that

nonphosphorylated DMP1 can activate accumulation of intracellular calcium ion.

Furthermore, this influx of calcium into the cell involves controlling gene

transcription [34]. The latest research has already revealed that intracellular transport

of calcium plays a critical role during bone formation and DMP1 can trigger the

release of calcium from endoplasmic reticulum (ER) stores [335]. There is a

possibility that DMP1 can also regulate intracellular mineral activities, which may

explain our observations of disordered intracellular mineralisation in osteocytes

when Notch signalling is inhibited.

The collagen matrix secreted by osteoblasts and the mineral that infiltrates into

collagen under strict direction from osteocytes are essential to normal mineral tissues

with physical function – reaching an equilibrium between rigidity and resilience. Our

study has demonstrated that Notch signalling promotes a highly organised integration

of collagen and mineral through activating DMP1 expression with the possible

involvement of other noncollagenous proteins. Further research on the relationship

between Notch signalling and mineralisation is warranted to provide new knowledge

in this little studied area and form a basis for developing novel approaches and

biomaterials for bone regenerative applications.


The morphological transformation from a cube-like cell to a multidendritic

appearance is the most intuitionistic change from osteoblasts to osteocytes. E11 is an

important factor controlling the changes in cell skeleton [29]. Here, we showed that

E11 was severely impacted after Notch was inhibited by supplementation with

DAPT during IDG-SW3 cell line differentiation. The formation of dendrites was also

deficient, as expected. In summary, our findings presented in this chapter suggest

that Notch plays a key role in regulating the morphological transformation of cells

during the formation of osteocytes.

4.6 CONCLUSIONS

In conclusion, the data generated in this part of the research provided clear evidence

to support a comprehensive role of Notch in osteocytes in terms of regulating

proliferation, cell morphology, and mineralisation.

Chapter 5: Research Part Three 81

Chapter 5: Research Part Three

The regulatory mechanism of Notch

signalling in osteocyte and its crosstalk with

other signalling pathways

—To explore how Notch regulates

osteocytes markers DMP1 and E11, as well

as the crosstalk between Notch, Akt, and

Wnt signalling pathways



Published Paper


Title: The regulatory mechanism of Notch signalling in osteocyte and its

crosstalk with other signalling pathways


Bone




the manuscript.

Yinghong Zhou Assisted with data analysis and reviewed the

manuscript







04/Dec/2017

84 Chapter 5: Research Part Three


5.1 ABSTRACT

In order to gain insight into the mechanisms underlying the functions of Notch in

regulating osteocytes’ metabolism and functions, we performed luciferase assay by

cloning the proximal E11 and DMP1 promotor regions into pGluc-Basic 2 vectors,

which were subsequently transfected into IDG-SW3, MC3T3, and 293T cell lines.

To activate Notch signalling, we utilised two approaches; one was using a Notch1

extracellular antibody coated cell culture plate, and the other was co-transfecting a

Hes1 overexpression vector. The interactions between the Notch and Wnt signalling

pathways were probed by Western blot analysis to assess the expression of a series of

phosphorylated proteins involved in the cascade of both signalling pathways. Our

data suggested that Notch signalling regulates E11 expression through Hes1 activity,

while Hes1 only could not initiate the expression of DMP1. It is of interest that the

regulatory function of E11 by Hes1 was not observed in the 293T cell line, indicating

a cell context-dependent manner of the Notch signalling pathway. In the signals

crosstalk, we found that Notch inhibited Wnt signalling at the late differentiated

stage by both directly repressing phosphorylation of Akt and preventing the nuclear

aggregation of β-catenin.

5.2 INTRODUCTION

In the previous chapters, we have shown that Notch signalling plays a critical role in

osteocyte formation and function. In this research chapter, the mechanism of how

Notch regulates those biological processes will be investigated.

The Notch intracellular domain (NICD) is the sole intracellular active component in

the Notch signalling cascade. However, NICD executes transcriptional regulation by

targeting a broad range of transcriptional factors. Most notably, Notch target genes in

mammals are hairy/enhancer of split (Hes1-7) and Hesrelated transcriptional factor

(Hey1, 2, and l) gene families [9], which both belong to basic helix-loop-helix

(bHLH) transcription factors working as transcriptional repressors [336]. The bHLH

proteins are composed of the basic and HLH domains, which have distinct functions.

Specifically, the basic domain determines to bind with specific DNA sequences,

while the HLH domain helps to form a dimer as an active configuration [337]. Hes

and Hey are subclassified to class C of bHLH proteins and bind to class C sites

(CACGNG), N-box (CACNAG), and (CANGTG), which are subtypes of the E-box


(CANNTG) [338-341]. Each bHLH family has highly conserved amino acid

sequences, and the distinction between Hes and Hey is a proline residue in the basic

region on Hes while a glycine is on the corresponding site [342].

The Hes family is classified as transcriptional repressor, which does not completely

describe its nature. Actually, the regulatory mechanisms of Hes proteins’ mediated

transcriptional activities are quite complex [343]. Indeed, accumulating evidence

supports its repressive role and reveals the detailed molecular mechanisms [344-347].

In an active model, Hes proteins recruit histone deacetylase to restrain the chromatin

structure and seal the transcriptional start sites [348]. In a passive model, Hes

proteins form a heterodimer with other transactive bHLH proteins, resulting in

repression of those transactive factors [349]. However, there has been some evidence

to suggest that Hes1 can directly activate some genes in combination with

transcriptional complex [350]. For instance, Hes1 has been reported to directly

activate the promotor of mammalian achaete-scute homologue (Mash1) in

neurogenesis with the help of poly adenosine diphosphate–ribose polymerase-

1(PARP1) [324, 351, 352]. Although the molecular mechanisms modulating Hes1

functions remain elusive, accumulating reports have shown the dual function of Hes1

in transcriptional regulation in a cell context-dependent manner.

The main types of receptor and ligand involved in osteogenesis are Notch1 and

Jagged (Jag1) [208]. During the transition from osteoblasts to osteocytes, Hes1 is

upregulated rather than Hes3 and Hes5. Together with the Hes3 and Hes5 null mice

displayed no skeletal phenotype, indicating that Hes1 is a major target of Notch

signalling conduction in the skeleton [353, 354]. Several studies suggest that Sp1/3

regulates E11 expression in lung type I cells [298]. And AP-1 promotes E11

expression in osteosarcoma [300]. A more recent study reveals that TCF-11 regulates

DMP1 expression in odontoblasts and osteocytes [301]. The TCF-11 transcription

factor is closely related to Notch signalling through transcription factor GATA3

[355]. The Dll/Notch combination induces GATA3 mRNA expression in T-lineage

[356]. However, whether the Notch signalling pathway directly regulates E11 and

DMP1 expression in osteocytes remains to be addressed.

The temporal interaction of Notch and Wnt signalling has been found to play a role

in key steps of differentiation in a wide range of tissues and organs including muscle,

liver, cochlea, and breast cancer [271-273]. And a series of intracellular molecules


have been identified as potential cross points that bridge these two signalling

pathways. For example, glycogen synthase kinase-3 (GSK-3β) is involved in the

temporal switch between Notch and Wnt in mouse myogenesis [271]. Active GSK-

3β induces the degradation of β-catenin when phosphorylated at tyrosine 216,

whereas it stabilises β-catenin when phosphorylated at serine 9 as inactive mode

[186, 357, 358]. An upstream regulator of GSK-3β is the serine-threonine kinase

(Akt) in the PI3K/Akt signalling pathway, which enhances phosphorylation at the

tyrosine 216 site [359, 360]. Akt itself is regulated by Notch signalling in a cell

context-dependent manner. Notch presents a positive relationship with p-Akt through

inhibiting the phosphatase and tensin homologue (PTEN), a suppressor of p-Akt

[190, 192, 361]. However, in the case of absent PTEN, Notch directly inhibits p-Akt

through Hes1 activity [193, 194]. It is still unclear which regulatory mechanism

dominates the relationship between Notch and p-Akt in osteoblastic lineage.

In bone formation, it has been well established that Wnt signalling is downregulated

during the terminal differentiation of osteoblasts [50]. However, few studies had

focused on Notch signalling in the terminal differentiation before Liu et.al showed

that Notch was required in bone mineralisation [13]. Although this new finding

revealed an important role of Notch in the terminal differentiation of osteoblasts, the

mechanism of Notch in the osteoblasts’ fate decision is still largely unknown. In

terms of the crosstalk of Notch and Wnt in the transition from osteoblasts to

osteocytes, there is not any report on this topic, leaving a huge knowledge gap to be

addressed.

In this study, we established an expression pattern of a temporal switch from Notch

to Wnt during the terminal differentiation of osteoblasts. Then, we revealed that

Notch directly regulated the earliest marker of osteocyte, E11, through Hes1 activity,

which was the first evidence of Notch’s essential role in the terminal differentiation

towards osteocytes. To address the crosstalk between Notch and Wnt signalling, we

also found that GSK-3β might be a molecular bridge that contributes an antagonistic

relationship between these two signalling pathways in osteocyte formation.



5.3.1 Cell culture


[274]. Briefly, six 24-week-old female Wistar rats were sacrificed by CO2

asphyxiation. Femurs and tibias were dissected from surrounding tissues. The

epiphyseal growth plates were removed, and the marrow was collected by flushing

with DMEM (11885, Gibco) containing 100 U/mL of penicillin, 100 μg/mL of

streptomycin, and 10% FBS with a 21G needle. Single cell suspension was prepared

by passing the cell clumps through an 18G needle. The obtained cells were seeded

into the tissue culture flasks containing DMEM containing 100 U/mL of penicillin,

100 μg/mL of streptomycin, and 10% FBS. On day 2, half of the medium containing

nonadherent cells was replaced with fresh medium. The medium was changed

completely on day 4. Only early passage (p1) of cells were used in this study. After

cells had reached 70%–80% confluence, the medium was changed completely with

DMEM containing 100 U/mL of penicillin, 100 μg/mL of streptomycin, and 10%

FBS supplemented with 50 μg/ml of ascorbic acid, 10 nM of dexamethasone, and

8 mM of β-glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The

medium was changed every 2–3 days for the duration of the experiment. IDG-SW3

cells were expanded in proliferation conditions 33 °C in α-MEM (12571, Gibco) with

10% FBS, 100 units/mL of penicillin, 50 µg/mL of streptomycin (Gibco), and

50 U/mL of IFN-γ, (PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in

0.2 M acetic acid) coated plates. IDG-SW3 cells were induced towards osteocyte

differentiation by plating at 80,000 cells/cm2 in osteogenic differentiation conditions

(37 °C adding 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the



(D5942, Sigma) diluted in DMSO was added to the culture medium at the

concentration indicated. The same amount of DMSO was added as a control.

5.3.2 Vector construction and plasmid transfection

In order to confirm the mechanism of Notch regulating the osteocytes markers, we

cloned a 762 base pairs human E11 promotor region and a 792 base pairs human

DMP1 promotor region (the sequences are listed in the supplements) into pGluc

Basic 2 vector respectively at EcoRI and Xhol restriction enzyme sites named as


E11-pGluc and DMP1-pGluc. The promotor fragments were designed by gene

screening and synthesised by TOLO Biotechnology (Shanghai, China). The Hes1

overexpression vector (TetO-FUW-Hes1) was obtained from Addgene #61534. Cells

were plated in 6-well plates and 96-well plates and cultured with medium not

containing antibiotics 2 days before transfection with Lipofectamine® 2000 reagent

following the manufacturer’s instructions. At the transfection day, for the 96-well

plate, 0.2 μg plasmid DNA was incubated with 25 μL Opti-MEM (31985070, Gibco)

without serum and antibiotics for 5 min at room temperature; 1.2 μL Lipofectamine®

2000 was incubated with 25 μL Opti-MEM as well. Then plasmid DNA and

Lipofectamine® 2000 solution was mixed well and incubated at room temperature for

20 min. Fifty microliters of the mixture was added to each well and incubated with

cells for 6 h. Then, fresh medium was changed to prevent cytotoxicity [362]. For the

6-well plate, the reactions were scaled up to 1 μg plasmid DNA and 6 μl

Lipofectamine® 2000 added to each well. For co-transfections, 0.1 μg E11-pGluc and

0.1 μg TetO-FUW-Hes1 was first mixed to form 0.2 μg plasmid DNA mixture; the

mixture was then incubated with 25 μL Opti-MEM and followed by incubation with

Lipofectamine® 2000 as described above. The same ratio used in the case of DMP1-

pGluc and TetO-FUW-Hes1 co-transfection. Tetracycline was added to the medium

at the final concentration of 1 μg/mL to induce Hes1 overexpression [363].

5.3.3 Notch activation

Artificially activating Notch by Notch (8G10) antibody was reported by Conboy et

al. [364] Briefly, culture plates were coated with collagen I as described above.

Further, the plates were coated with anti-Notch1 antibody, extracellular, clone 8G10,

(MAB5414, Merck Millipore) at 1:100 dilution in PBS at 4 °C overnight. For control

groups, the plates were coated with goat IgG. Cells were plated and cultured on the

coated plates as usual.

5.3.4 Luciferase assay

The pGluc-Basic2 vector expresses a secreted gaussia luciferase protein [365]. The

luciferase activity was tested 48 hours after treatment using Pierce Gaussia

Luciferase Flash Assay Kit (16158, Thermo Fisher Scientific). Briefly, 20 μL of

medium was taken from each well and transferred to a white, opaque 96-well plate.

Fifty microliters of Working Solution was added to each well and light signals


detected with a BMG POLARstar Omega microplate reader (BMG Labtech, Thermo

Fisher Scientific). The raw data was interpreted by MARS Data Analysis Software.

5.3.5 Western blot



inhibitor (PhosSTOP, 04906845001, Roche) for the Western blot detection. A total

of 15 μg of proteins from each sample were separated on SDS-PAGE gels and then

transferred onto a nitrocellulose membrane (Pall Corporation). After being blocked

in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences), the

membranes were incubated with primary antibodies against Hes1 (1:1000, ab71559,

Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from Professor

Jerry Feng of the Texas A&M University Baylor College of Dentistry), β-catenin

(#9581, Cell Signaling Technology, 1:1000), total Akt and phosphorylated Akt

(Ser473) (#2920, #4060, Cell Signaling Technology, 1:1000), total PTEN and

phosphorylated PTEN (Ser380) (#9551, #9552, Cell Signaling Technology, 1:1000)

total GSK-3β and GSK-3β (py216) (ab31826, ab75745, Abcam, 1:1000) and α-

Tubulin (1:2000, ab15246, Abcam) overnight at 4 °C. The membranes were then








mesenchymal stromal cells (BMSCs) were plated on collagen pre-coated 8-well

chamber slides (177445, Lab-Tek) at a density of 4,000 cells per well. The cells were

washed 3 times with ice-cold PBS followed by fixing with 2% paraformaldehyde

(PFA) for 10 minutes at room temperature. The cells were then incubated with 0.2%

Triton for cell permeabilisation. Nonspecific proteins were blocked with the

incubation of 1% BSA in PBST for 30 min at room temperature. The primary

antibodies, rabbit anti-β-catenin (#9581, Cell Signaling Technology, 1:100) in PBST

with 1% BSA and incubated at room temperature for 1 h. Goat anti-mouse Alex


Fluor 488 (A31560, Life Technologies) and goat anti-rabbit Alex Fluor 647(A21246,

Life Technologies) were incubated at room temperature for 30 min to detect the

primary antibodies. The slides were counterstained with DAPI (D1306, Life

Technologies) and mounted with ProLong® Gold Antifade Reagent (P10144, Life

Technologies). The images were captured using a Nikon EclipseTiS microscope and

a Leica SP5 confocal microscope. Cell counting was performed using Image J

software.

5.4 RESULTS

5.4.1 Notch signalling pathway directly regulates E11 expression through Hes1

activity.

Our previous work both in vivo and in vitro had confirmed that E11 is an important

osteocyte marker that is expressed on the cell membrane and required for dendrite

generation and elongation (Fig. 25, 27). To demonstrate that Notch signalling

regulates the expression of E11, we cloned a 762 bp human E11 promotor region into

a pGluc-Basic 2 vector to transfect IDG-SW3, MC3T3-E1, and 293T cell lines. The

IDG-SW3 and MC3T3 cell lines were cultured in non-osteogenic medium. The

luciferase intensity of the IDG-SW3 cell line was significantly increased in the

condition that Notch signalling was activated by the extracellular antibody (clone

8G10). However, the increase was not significant in the MC3T3-E1 and 293T cell

lines (Fig. 30). We also performed co-transfection with E11-pGluc-Basic 2 and

TetO-FUW-Hes1 into all three cell lines with tetracycline to induce the

overexpression of Hes1. The effect of Hes1 overexpression was confirmed by

Western blot (Fig. 29). The luciferase intensity was significantly increased in both

IDG-SW3 and MC3T3-E1 cell lines. Unsurprisingly, the 293T cell line did not

present a change in luciferase intensity after Hes1 overexpression (Fig. 30). In brief

summary, the results from the luciferase assay suggested Notch signalling directly

promotes E11 expression through Hes1 transcriptional factor in the IDG-SW3 cell

line rather than 293T, a non-osteoblastic cell line.


Figure 28: Western blot of Hes1 to confirm the effects of both Notch-activating

approaches. Both Notch1 antibody coated and Hes1 overexpression vector

transfection methods were effective to activate Hes1 expression. And the Hes1

overexpression approach presented a stronger effect.

Figure 29: The mechanisms of Notch in regulating the expression of E11 and DMP1.

A: The plasmid maps of the Hes1 overexpression vector, TetO-FUW-Hes1, and the

luciferase reporter vectors, E11-pGluc basic 2 and DMP1-pGluc basic 2. B: The

luciferase assay using the E11-pGluc-Basic 2 vector transfected into the IDG-SW3,


MC3T3, and 293T cell lines. C: The luciferase intensity after a co-transfection with

the Hes1 overexpression vector significantly increased in both the IDG-SW3,

MC3T3-E1, and 293T cell lines. n=3. P value as indicated, unpaired Student’s t test,

comparisons between the Notch activation groups and the control groups,

respectively.

5.4.2 Notch signalling pathway regulates DMP1 expression in a Hes1

independent manner

To further figure out the function of Notch on osteocytes, we also cloned a 792bp

human DMP1 promotor region into the pGluc Basic 2 vector and transfected the

IDG-SW3 cell line. Surprisingly, we found the luciferase intensity was increased

only when Notch was activated by the extracellular antibody, while overexpression

of Hes1 could not sufficiently induce DMP1 expression, which means that Notch

signalling regulates DMP1 expression through some unknown mechanism rather

than Hes1 (Fig. 32.A, B). Further, as the IDG-SW3 cell line expresses GFP under the

control of DMP1 promotor-a 623 bp fragment of mouse DMP1 promotor (289), the

expression of DMP1 can be directly observed under a fluorescence microscope in

living cells. In contrast with the luciferase assay, GFP could only be observed when

Notch was activated by the extracellular antibody (Fig. 32.C, D). As the culture

medium did not contain any osteogenic component, it seems Notch can promote the

expression of DMP1 by itself in osteoblastic cell types. The expressions of DMP1 at

RNA and protein levels were tested as well, and the results were consistent.

Antibody-induced Notch activation caused upregulation of both DMP1 and E11 at

both RNA and protein levels. However, overexpression of Hes1 only triggered E11

expression (Fig. 31).


Figure 30: The expressions of DMP1 and E11 at both the RNA and protein levels.

Antibody-induced Notch activation (A–C) caused the upregulation of both DMP1

and E11 at both the RNA and protein levels. However, the overexpression of Hes1

(D–F) only triggered E11 expression. n=3. * p < 0.05, unpaired Student’s t test,

comparisons between Notch activation groups and control groups, respectively.


Figure 31: A, B: The expression of DMP1 was directly observed by a fluorescence

microscope in live IDG-SW3 cells. GFP could only be observed when Notch was

activated by the extracellular antibody (F), but not when Hes1 was overexpressed

(D). Scale bar: 50 μm. C, D: The luciferase intensity of DMP1-pGluc-Basic 2 in the

IDG-SW3 cell line increased only when Notch was activated by the extracellular

antibody (G), while the overexpression of Hes1 did not sufficiently induce DMP1

expression (E). n=3. P value as indicated, unpaired Student’s t test, comparisons

between the Notch activation groups and control groups, respectively.

5.4.3 The switch of Wnt to Notch in osteocytes formation is mediated by Akt

and PTEN

As mentioned above, the switch from Wnt to Notch occurred spontaneously in

normal osteocyte development. It is of no surprise that Hes1 expression was reduced

when LiCl or DAPT were added to interfere with the natural switching process (Fig.

33). Interestingly, when Wnt was artificially activated at the late stage of

differentiation in the IDG-SW3 cells by LiCl supplementation, we found that β-

catenin continued to decrease as part of the osteogenic culture process. However, this

decreasing trend was inverted when Notch signalling was inhibited (Fig. 33), which

suggested that Notch may be the dominant factor controlling this self-switching

process.


Figure 32: Western blots of β-catenin and Hes1 in the IDG-SW3 cell line osteogenic

culture, with the supplementation of either LiCl or DAPT. The expression of β-

catenin increased when Notch was inhibited, indicating a functional antagonism

between these two signalling pathways.

To further characterise the crosstalk between the Wnt and Notch signalling pathways

during the terminal differentiation of osteocytes, we tested the phosphorylated

proteins involved in the Wnt signalling cascade using IDG-SW3 cells at the terminal

differentiation stage, during which Notch signalling was inhibited (Fig. 34 A).

Interestingly, the phosphorylation of PTEN was at a low level at the late stage of

differentiation, and in this scenario, phosphorylated Akt increased when DAPT was

added to the culture medium (Fig. 34 A). Under the same condition, we also found

that active GSK-3β was decreased in correlation with the upregulation of β-catenin.

These Western blot results together indicated that, consistent with well-documented

reports [186, 357-360], Akt-GSK-3β- β-catenin formed a signal transduction cascade

and mediated the antagonistic relationship between the Wnt and Notch signalling

pathways. Similar antagonistic expressions of β-catenin and Hes1 were found in

rBMSCs at the late stage of osteogenic differentiation (Fig. 35 A–C).


Figure 33: A: Western blots of the phosphorylated proteins involved in the signalling

crosstalk between Notch and Wnt in the IDG-SW3 cell line under normal osteogenic

condition and Notch inhibition with DAPT for 21 days. B: Western blots of the

phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt

in the IDG-SW3 cell line plated on the Notch extracellular antibody (left) and IgG

(right). The phosphorylation of Akt at the serine 473 site was inhibited by the Notch

extracellular antibody. On the other hand, activating Notch by an extracellular

antibody inhibited the phosphorylation of Akt at the serine 473 site, leading to the

activation of GSK-3β and β-catenin degradation.


Figure 34: The crosstalk between the Notch and Wnt signalling pathways in

rBMSCs. A: Immunofluorescence staining of β-catenin and Hes1 in osteogenically

differentiated rBMSCs on day 14. The results showed that more cells expressed β-

catenin after Notch blockade. Scale bar: 50 μm. B, C: The Wnt and Notch signalling

exhibited an antagonist relationship at the late differentiation stage of the rBMSCs

since blocking Notch enhanced β-catenin (B), and the activation of Wnt inhibited

Hes1 expression (C).

Immunofluorescence staining of β-catenin showed that Notch signalling prevented its

nuclear aggregation, whereas β-catenin combined to T-cell factor/lymphoid enhancer

factor (TCF/LEF) to regulate the transcription of Wnt target genes (Fig. 35 A–F).


Figure 35: Immunofluorescent staining of β-catenin in the IDG-SW3 cell line. In the

control groups (D–F), β-catenin was mainly expressed in the nucleus. When Notch

was activated by the extracellular antibody (A–C), β-catenin was translocated into

the cytoplasm (as indicated by white arrows) where it has no function. Scale bar:

10 μm.

Finally, antagonism does not represent a comprehensive relationship between Wnt

and Notch. For example, solid evidence also suggests a synergistic relationship in

stem cells [366-368]. In the current study, we also found that blocking Notch

signalling in undifferentiated rBMSCs facilitated the membrane anchoring of β-

catenin (Fig. 37 A–F), which was the opposite phenomenon compared with the IDG-

SW3 cells. In addition, we tested the signal transduction cascade in rBMSCs and

confirmed the existence of phosphorylated PTEN, while there was an extremely low

level of activated Akt (Fig. 37 G). In this cell context, the inhibition of p-Akt by

PTEN might be the dominant regulatory mechanism, and thus, Notch did not

regulate β-catenin by repressing p-Akt. Quantitative analysis of Western blots

suggested that there was no significant change in the bands’ intensity between those

two groups (Fig. 38 G).

A B C

D E F


Figure 36: The relationship between Notch and Wnt in non-osteogenic rBMSCs. A–

F: Immunofluorescent staining of β-catenin in rBMSCs in normal culture. In the

control groups (A–C), β-catenin was mainly expressed in the nucleus as indicated by

the white arrows. When Notch was inhibited by adding DAPT (D–F), β-catenin was

translocated into the cytoplasm where it has no function (as indicated by the white

arrows). Scale bar: 30 μm. G: Western blots of the phosphorylated proteins involved

in the signalling crosstalk between Notch and Wnt in the rBMSCs in normal culture.

5.5 DISCUSSION

This study revealed the molecular regulatory signalling pathway involved in the

osteoblast fate decision during the terminal stage of bone formation and shed light on

functional crosstalk between Notch and Wnt signalling pathways. It has been well

established that Wnt signalling promotes early stage osteoblastic differentiation

while inhibiting terminal differentiation [369, 370]. It induces the expression of a

series of key osteogenic relevant proteins including sp7 and Runx2 [371]. In the case

of the Notch signalling pathway, it prevents the early differentiation of progenitors

and maintains the stem cell pool in the bone marrow [372]. Hence, low Notch

activity is essential to initiate the early stage differentiation of osteoblasts. We have

previously shown that Notch is indispensable in osteocyte function and bone

mineralisation, leading to a full description of Notch and Wnt signalling in the whole

process of bone development from the induction of bone marrow stem cells to the

formation of mineral tissue. Specifically, Notch experiences a U-shaped expression

pattern in osteogenesis and presents an antagonistic relationship with Wnt during the

transition from osteoblasts to osteocytes; in other words, from collagen matrix to

mineral tissue in terms of the functions of these two cell types, respectively.


Due to the timing of the regulation of the Notch and Wnt signalling pathways, fine-

tuning the temporal up and down of Notch and Wnt activity might regulate normal

osteogenesis. Consistent with this prediction, tuning up Wnt activity by knocking out

Dkk2 in mice promoted premature formation of bone tissue, which contained a large

amount of organic collagen but an absence of mineralisation [50]. The ideal

osteogenesis should be a successive process of osteoblast differentiation, collagen

secretion, and mineralisation, so this abnormal mineralisation has a detrimental effect

on bone formation and regeneration. Our in vitro study also revealed a similar

phenomenon when exogenous Wnt added or inhibited Notch during the terminal

differentiation of osteoblasts. The natural expression pattern of Notch during

osteogenesis also provides a possible explanation for the controversial results

generated by a number of studies using Notch knockout and overexpression

transgenic mouse models [167, 168, 173, 265, 267-270, 373-376]. None of these

studies took the original Notch activity into account. It is reasonable to predict that

knocking out Notch at an early stage of osteoblasts would not present a significant

phenotype when Notch activity is already very low. However, a profound impact can

be seen when Notch is knocked out in bone marrow stromal cells, which normally

have a high level of Notch activity. The existing findings suggested that the cell fate

decision of late stage osteoblasts is controlled by a precise balance between the

Notch and Wnt signalling pathways.

It had been reported that GSK-3β may mediate the crosstalk between Notch and Wnt

signalling [271]. However, in the current study, we further identified that the kinase

activity in PI3K/Akt signalling pathway can be the upstream regulator of GSK-3β

and bridge the Notch and Wnt signalling. During the transition from osteoblasts to

osteocytes, as the Notch signalling increased, the p-Akt activity was decreased,

leading to the low level of phosphorylation at the serine 9 site on GSK-3β as

inactivated status but a high level of phosphorylation at the tyrosine 216 site, which

degraded β-catenin in the canonical Wnt signalling pathway. Notch activation leads

to activation or inhibition of p-Akt according to the different pathways of regulatory

mechanisms. The first mechanism involves the encoding product of PTEN gene that

negatively regulates Akt activity by dephosphorylating PIP3, an upstream activator

of Akt [361]. Notch inhibits PTEN through Hes1 expression, resulting in the

activation of p-Akt [192]. Another mechanism is that Hes1 directly represses p-Akt


in a PTEN independent manner [193-195]. PTEN is a critical selector that determines

which wiring would exert regulatory function.

The detailed mechanisms whereby Notch facilitates the transition towards osteocytes

remain to be determined. At least, however, our study suggested Hes1 can be an

important downstream effecter adopted by Notch in osteoblast fate determination.

Hes1 is one of seven Hesgene family members that are main nuclear effectors, which

are direct targets of Notch signalling. The upregulation of Hes1 indicates that Notch

is activated in the terminal differentiation of late stage osteoblasts [13]. Moreover,

the results presented here show that Hes1 directly regulates the expression of the

promoter of E11, an earliest osteocytes marker, suggesting that Notch works as a

critical switch to initiate osteocytes’ properties. As shown in the current study, the

activation of E11 by Hes1 was observed only in the MC3T3 and IDG-SW3 cell lines,

which are both of osteoblastic lineage. In contrast, Notch activated by coated

antibody or Hes1 overexpression could not induce the expression of E11 in the 293T

cell line, indicating that the transcriptional regulatory function of Hes1 depends on

cell types. This phenomenon was consistent with previous studies that revealed the

versatile nature of Notch in various contexts [318, 319]. It is worth noting that the

existing evidence cannot exclude other regulatory mechanisms adopted by Hes1.

Hes1 has also been regarded as a transcriptional suppressor, so it is still possible that

Hes1 increases E11 expression through repressing some E11 inhibited transcriptional

factors. The direct activation role of Hes1 on E11 remains to be investigated in the

future through chromatin immunoprecipitation [377] and electrophoretic mobility

shift assay [378].

The differences in cell context involve various modified mechanisms at different

levels. For example, the glycosylation of Notch extracellular domain leads to

selective binding to Dll ligands rather than Jag1, and different ligands involved will

induce different output [102, 379, 380]. Dll4 induced Notch activity inhibits

angiogenesis while Jag1 induced Notch promotes vessel growth in long bones [171,

172]. Other mechanisms include histone acetylation and methylated modification to

present or block the selective genes that are targeted by Notch transcriptional

complex [119, 381, 382]. If it is the true nature of Notch signalling, it seems there

should be a higher dominant mechanism that exists to initiate the response to Notch

signalling; on the other hand, Notch just exerts the “order” regarding the responses


rather than controlling the switch. There is evidence supporting the existence of those

higher mechanisms that Notch signalling activity is regulated by segmentation clock,

which is a molecular oscillator through negative feedback in the somitogenesis [121,

122]. We can also make a reasonable hypothesis that only certain subsets of genes

are modified to guarantee their accessibility to Notch signalling. Hence, no matter

what level of Notch signalling, it cannot regulate other genes not included in the

subsets. As reported above, in the case of 293T cells, which have no relationship

with osteogenesis, the promotor and enhancer of E11 are not open to being regulated

by Notch signalling. It seems that Notch is a smart signalling pathway that obeys

some basic natural principles.

In the current study, we also observed that Notch activated by extracellular antibody

could induce expression of DMP1 in IDG-SW3 cell lines. However, the expression

of DMP1 was not affected by transfection of Hes1 overexpression vector, which

indicated that the regulatory function on DMP1 by Notch signalling was not

mediated through Hes1 transcriptional factor. It seems that some other elements

targeted by Notch regulate the expression of DMP1 protein, which is indispensable

in bone mineralisation. TCF11/Nrf1 and JunB transcriptional factors were found to

regulate the expression of DMP1, according to the limited literature [383, 384].

Interestingly, both those transcriptional factors present close connections with the

Notch signalling pathway, indicating a putative regulatory function of Notch on

DMP1 [302, 355, 385, 386]. Further studies are preferred to figure out the specific

regulatory mechanism of DMP1.

5.6 CONCLUSIONS

In conclusion, the study presented above supports that Notch plays a critical role in

the transition from osteoblasts to osteocytes, through promoting the expression of

important osteocyte markers through different transcriptional regulatory

mechanisms, even if it does not work as the principal switch. Moreover, a model of

the antagonist relationship between Notch and Wnt signalling during the terminal

transition was established, which is mediated by phosphorylated regulation of Akt.

These findings may contribute to clarify the controversial opinions regarding the

function of Notch on osteogenesis.


5.7 SUPPLEMENTS

DMP1 promotor: 780bp gtgattgattgaccaacagaatatggaaaaatgatattctaggaactcttggcccccagc cttcaggttgtgagaaggccaagccaaggagaggccatgtaaagaactaaagtgctcaga attacagctccagctgagctctcaggtaacaactatgaaagtggcatctgaaatgttctg ccccaactgagtcttcagatgactacaatgctagctgtgagagataagaaaatggtagtt gttttaaaatgcaaagtattgaagtggtttttgatatagcaatagataacaaaaatgcct agttttattgtaaatgttatccacagttttcaattttgttatctaattgctcctctgttt ttatgtagggatttgaagagagtctaaaataatgtcttgtaatgcaatctgcccaaatct gcccagaatccaattctgtcataagattataaggttcttctagcatagatctcagttaag acccatgaaaccatcagagagtgtaattcagaaccagagcaaatcacagggaatttatag cttccccatatggactttggctttctaatcaaccctaaatgaaaatagacatctctttcc tcattgtctgcaccaccctcccccgcatattatagttcacactaaatatgttgataatcc atatatctgacattagttgcctgaataaattgggcactctaattttctagatccatgtta ggagcatcagctcaattttttttttaacaattaaagcatttttttaaaagttacagtgag

E11 promotor 750bp Ttacctcccactcctccatcctgatcaaaaggtcatgtgaccaaccttctagattctagacacatccgggggtgtgggattagttgcatgtaacccaatctcccccacctaggcttcactgtgtttcaatctttttgaataaagcgggccatctttctttctgtgtgtgaccttggagttacacataagcagaatagatgtgcatctattctccatctaacaggctcaacagacaatgcactattcctcctgtcaacagacattattgacactagagtcataaaatgcatctccaagatggggaagtcagttcaagaaagagtatctgtatcacgagttttctctttacatttccaactccttggctctaggggtgttgccgctacccctcatcttctaggttcaggtgctcagctcctgtttgtagccccaggacaagacgttacctgggagatctttagaaatgcagaatctctccctatcccacaacagaattgcacctgcataaccagtgccccaggtagatctggctgagaagctatgatgaagggcaaggtttgccaaatgttcatggggacaagttctccagcgacactggtttaaaataggaattccgaaaaggtctgattaatgagtttggggtggaacccaggaaactgggcatttatttaaaacaatctctcctgtgattcttagaaagtaaatttataatggggaggggtcaaagataagcatctgaaaacaattttc


Figure 37: Statistical analysis of Western blot.

A and B: Statistical analysis of relative band intensity from Western blot in Figure 33.

Two-way ANOVA with Bonferroni post hoc test was performed. C and D: Statistical

analysis of relative band intensity from Western blot in Figure 34. One-way ANOVA

with Student’s t test was performed. * p < 0.05. E and F: Statistical analysis of

relative band intensity from Western blot in Figure 35. One-way ANOVA with

Student’s t test was performed. * p < 0.05. G: Statistical analysis of relative band


intensity from Western blot in Figure 37. One-way ANOVA with Student’s t test was

performed. * p < 0.05.

Chapter 6: Conclusions and Discussion 107

Chapter 6: Conclusions and Discussion


6.1 RESEARCH SUMMARY

In the three research chapters, we first discovered a U-shaped expression pattern of

Notch signalling in the whole osteogenic process, which promotes profound

understanding of Notch signalling in osteogenesis, especially in the terminal stage of

osteogenic differentiation (Fig. 39). Next, the functions of Notch signalling in

terminal differentiation were studied, and the results indicated a comprehensive role

of Notch in osteocytes including regulating cell proliferation, morphology, and

mineralisation. Finally, our findings from mechanism research suggested that Notch

regulates cell morphology through direct transcriptional activation of E11 mediated

by Hes1 transcriptional factor. However, Notch impacts mineralisation by regulating

DMP1 expression in a Hes1 dispensable manner. Also, we found an antagonistic

relationship between Notch and Wnt signalling pathways at the late stage of

osteogenesis.

Figure 38: Schematic of the U-shaped Notch expression pattern during osteogenesis.

In BMSC, Notch maintains the pool of stem cells, and it is required to be

downregulated to initiate osteogenic differentiation. During terminal differentiation,

Notch is increased again to alter the cubic, amplifying. and matrix secretion

osteoblasts to the dendritic, static, and mediating mineralisation osteocytes.

110 Chapter 6: Conclusions and Discussion

Figure 39: The schematic shows a potential mechanism in osteoblast fate

determination. 1, 2: The connection between osteoblasts is stable and broad, while

the contact area between osteoblast and osteocyte is limited due to the dendritic

morphology of osteocyte. 3: Osteocytes send burst Notch signalling to the

osteoblasts committed to osteocytes according to the reports in a quantitative study

of Notch signalling intensity that the limited connection presents burst Notch

signalling. 4: Then, the increased Notch enhances the E11 expression through Hes1

activity and promotes DMP1 expression through some unknown mechanisms. E11

plays a role in dendrite formation and DMP1 mediates ordered extracellular

mineralisation. NICD also prevents the nuclear translocation of β-catenin; therefore,

it inhibits the β-catenin transcriptional activity. The intracellular β-catenin may also

combine to E-cadherin to support the generation of cell processes.

6.2 DISCUSSION

Dendritic osteocytes comprise 90% of all bone cells and form complex cellular

networks throughout the mineralised bone matrix [22]. This cellular network enables

bone to function as a dynamic organ in response to hormonal and mechanical

changes [387, 388]. A prerequisite for the proper function of this network is the

ability of osteocytes to recognise and communicate with neighbouring cells. The


current understanding of osteocyte communication is limited on the gap junctions

[68], cadherins [69], and the soluble short range intercellular signalling molecules

represented by extracellular adenosine triphosphate (ATP) and purinergic receptors

[389, 390]. All the programs mentioned above lack specificity; therefore, they may

be incompetent to process fine and intricate cellular signals. A previous

morphological study showed the reciprocate expanding and retracting manner of

osteocytes’ dendrites, suggesting the existence of a fine-tuned regulatory mechanism

that relies on cell-to-cell contacts [391]. If it is true, Notch signalling is likely the

candidate among the membrane bounded signalling systems that utilises this

topographic characteristic to control the osteocyte functions and the differentiation

from osteoblasts to osteocytes in the niche context.

Our current study revealed a molecular regulatory mechanism involved in the

osteoblast fate decision during the terminal stage of bone formation and shed light on

the functional crosstalk between the Notch and Wnt signalling pathways. It is well

established that Wnt signalling promotes early stage osteoblast differentiation and

inhibits terminal differentiation [369, 392]. The Notch signalling pathway prevents

early differentiation of progenitors and maintains the stem cell pool in the bone

marrow [372]. Hence, low Notch activity is essential to initiate the early stage

differentiation of osteoblasts. It is of interest that Notch is indispensable during

osteocyte formation and bone mineralisation, as we have reported in the previous

chapters. During the whole osteogenesis process, Notch experiences a U-shaped

expression pattern and interacts with Wnt signalling in different manners at different

developmental stages. Given the fluctuant signalling intensity in the osteoblastic

differentiation, a fine-tuning of the temporal up and down activity of Notch and Wnt

might regulate normal osteogenesis.

To the best of our knowledge, the fundamental question of how Notch signalling

increases in the natural process of osteocyte formation is yet to be answered. Indeed,

many processes of cell fate decision occur concurrently with changes in cell

morphology [393-395], and these changes in cell morphology or contact patterns

may be approaches of modulating the magnitude of signalling. Here, in the case of

Notch signalling, a model is suggested based on a quantitative study that adjacent

cells with a limited contact area transit stronger Notch signalling [396]. We speculate

the reason is that the broader contact involves a more complicated engagement of


Notch receptors and ligands, which trigger both the positive and negative effects and

the overall signalling output might be mutually offset, while the limited contact

might focus on the unitary effect. It is possible that osteoblasts present a low Notch

signalling intensity as the contact areas between the osteoblasts are broad due to the

cubic appearance. However, when an osteoblast contacts a dendritic osteocyte, the

contact area is reduced starkly, and the osteoblast receives a burst of Notch signalling

to initiate differentiation towards osteocytes (Fig. 40). In support of this hypothesis,

another report, also based on a mathematic model, predicts that cells with a smaller

contact area are more likely to become signal-sending cells [397]. Here, these signal-

sending cells are represented by osteocytes, using slender dendrites to contact the

cubic osteoblasts, which are the signal-receiving cells.

In terms of the crosstalk between Notch and Wnt signalling pathways, our current

studies have revealed GSK-3β as the bridge molecular linking those two pathways.

Further, a series of phosphlated regulation sites have been identified to illuminate the

mutual relationship of Notch and Wnt. Those phosphlated proteins included but are

not limited to β-catenin, PI3K, Akt, and PTEN. (Discussed in detail in Chapter 5.5.)

It is of note that β-catenin is not only an integral component of Wnt signalling in the

nucleus but is also a component of the cadherin–catenin complex to participate in

dendritic morphogenesis in cytoplasm [398]. In other words, the functions of β-

catenin are dependent upon its location [399, 400]. Yu et al. showed that high levels

of intracellular β-catenin enhance dendritic arborisation in rat neurons in a Wnt

transcriptional independent manner [401]. Rosso et al. further demonstrated that it

was the noncanonical Wnt signalling, rather than canonical Wnt, through the

transcriptional activity of β-catenin, that regulated dendritic development. [402]. The

regulation of β-catenin translocation is well documented. A serine/threonine selective

protein kinase – Casein kinaseⅠ (CKⅠ) phosphorylates the amino terminal region

of β-catenin at the serine 45 site, which is sequentially phosphorylated by GSK-3β

and earmarked for degradation, resulting in keeping β-catenin from reaching the

nucleus [403-406]. Whereasprotein kinase CKⅡ phosphorylates the amino terminal

region of β-catenin at Ser29, Thr102, and Thr112 and stabilises the cadherin–catenin

complex to prevent degradation by CKⅠ and GSK-3β [407, 408]. There was also

evidence showing that CKⅡ positively regulates Notch1 signalling through a direct


phosphorylation reaction at the Ser847 site of Notch1 [409]. Moreover, CKⅡ

enhances Notch signalling through a pathway that cross-talks with Hedgehog

signalling [410, 411]. In our immunofluorescence observation, we found that Notch1

prevented the nuclear translocation of β-catenin (Fig. 36 A–F). Taken together that

osteocytes express high levels of CKⅡ, a possible explanation of our findings might

be that CKⅡ stabilises both Notch1 and the cytoplasm cadherin–catenin complex,

which also plays a role in dendrite formation in addition to regulating E11 functions.

Our study suggested that Hes1 might be an important downstream effecter adopted

by Notch in osteoblast fate determination although the detailed mechanisms remain

unknown. We had observed that Hes1 directly regulates the transcriptional activity of

E11 promotor in a cell context-dependent manner. (Discussed in detail in Chapter

5.5.) The differences in cell context involve various regulatory mechanisms at

different levels. For example, the glycosylation of the Notch extracellular domain

leads to the selective binding to Dll ligands rather than Jag1, and different ligands

induce different outputs [97, 102, 361]. Dll4-induced Notch activity inhibits

angiogenesis, while Jag1-induced Notch promotes vessel growth in long bones [171,

172]. Moreover, other mechanisms, which include but are not limited to histone

acetylation and methylated modifications, also regulate the Notch transcriptional

complex [119, 381, 382]. Unfortunately, we had little knowledge about the functions

of those epigenetic mechanisms in bone. Our findings contained in this thesis have

revealed just the tip of the iceberg, and increasing questions needed to be answered

before Notch could be a potential therapeutic target to treat bone and mineral-related

diseases.

In conclusion, the study presented here supports that Notch plays a critical role in the

transition from osteoblasts to osteocytes, through promoting the expression of

important osteocyte markers, even if it does not work as the principal switch.

Moreover, a model of the antagonist relationship between Notch and Wnt signalling

during terminal transition has been established, which is mediated by the

phosphorylated regulation of Akt. These findings may contribute to clarifying the

controversial opinions regarding the functions of Notch in osteogenesis.


6.3 LIMITATIONS

Our findings revealed that Notch is highly regulated in osteogenesis. However,

whether this regulation is controlled by itself or some upper mechanisms remains to

be addressed. As the intensity and functions of Notch signalling are different at each

stage of osteogenic differentiation, any small-scale change could induce significant

biological alteration. Our research also raised the importance and necessity of

quantitatively evaluating Notch signalling intensity before we can manipulate the

signalling intensity to treat bone diseases. The quantisation of signalling is still a

greatly challenging area in molecular biology. However, it really represents the

future direction leading to an accurate understanding of signalling in cells. With the

development of bioinformatics, impressive evidence has been accumulated from a

huge range of gene and protein screens, requiring us to update the traditional view of

signalling pathway as linear events. Actually, Notch signalling is affected and

modified by an extraordinarily complex network [113]. The current mainstream

methods, such as testing the expression of certain Notch ligands, receptors, and

effectors, are increasingly unsatisfactory to uncover the real activity of the signalling.

It is possible that the cells that express more ligands and receptors present lower

signalling intensity. To the best of our knowledge, there is no broadly accepted

definition of the unit of measurement of signalling. However, a mathematic model

established in epithelial cells can quantitatively measure the intensity of Notch

signalling [105], which might be a potential approach to developing advanced

systems for quantitative analysis of signalling activity.

The complexity of the signalling network also renders limitations to the transgenic

animal models research. After modifying certain components in the signalling

cascade, other factors involved in the complex interaction with those components

would affect each other in an uncontrollable manner and generate measurable

consequences in the overall signalling outcomes. Without comprehensive

clarification of how the signalling network works, the significance of the research

into modified genes is limited.

At last, all the data in this thesis were generated from animal models and cell lines,

which is favourable to be tested in human cells. However, this is a challenging task

due to the low yield of human osteocytes based on existing technology for cell

extraction and culture [412, 413]. There is demand for an advanced methodology to


be developed to gain a substantial yield of osteocytes from human specimens for in

vitro study. Alternatively, it had been reported that researchers used biphasic calcium

phosphate (BCP) constituted by hydroxyapatite (HA) and tricalcium phosphate (TCP)

as the 3D scaffold to host the commercialised human primary osteoblasts to

recapitulate the differentiation towards osteocytes [414]. This method provided a tool

to obtain primary osteocytes in vitro to study the biology of osteocytes, including the

signalling exchange between osteoblasts and osteocytes.

6.4 FUTURE IMPLICATIONS

For future implications, Notch signalling is required to be precisely manipulated

based on the quantitative study to control the outcomes in certain tissue to realise the

therapeutic aims. For example, in the case of hypomineralisation, Notch signalling

can be artificially manipulated to a certain level that can improve the bone

mineralisation and not excess a safe range resulting in hypermineralisation or other

abnormal phenotypes.

In this thesis, we found Notch signalling is highly expressed in osteocytes and has a

regulatory role in the expression of critical osteocytes markers. The terminal

differentiation towards osteocytes is a fine-grained feature that adjacent cells can

adopt distinct fate. According to this, the cell fate determination factors in this

scenario must be specific at single cell level. Unlike gap junctions and secreted

factors working on general or local basis, the cell-to-cell contact dependent Notch

signalling pathway meets the criteria, hence, the nature of Notch and its implication

in osteoblasts fate decision are worthy to be discussed. Here, we try to suggest some

models which apply Notch natures reviewed in Chapter 2 to regulate osteoblast cell

fate.

Implications of lateral induction and lateral inhibition in the transition from

osteoblasts to osteocytes: Jag1 is a documented factor in bone formation and disease.

Jag1 mutation is related to Alagille syndrome featured by low bone mass and high

risk of fracture [123, 415-417]. The detailed analysis has shown that the main

function is on the early stage of osteogenesis [418, 419]. Dll1 function is less

reported in bone tissue; however, in vitro studies suggested Dll1 enhances Notch

activation in osteoblasts [420]. Those data enable us to propose a model in osteoblast

cell fate determination: before transition happening, each osteoblast maintains low


Notch signalling by expressing Jag1 ligand and coordinates the behaviour of adjacent

osteoblasts to produce bone matrix synchronously in local area. In contrast, during

the transition, the osteoblast which is committed to osteocyte expresses Dll1 ligand

and inhibits its neighbours to express the same ligand, leading to discrepancy in

Notch signalling intensity, thereby preventing the immediately surrounding cells

from differentiating to osteocytes. This model can explain the histology observations

that there are not two adjacent osteoblasts buried by matrix and becoming osteocytes

together.


Figure 40: Lateral induction and inhibition mechanisms in the transition from

osteoblasts to osteocytes. When lateral induction (upper) mechanism is activated,

osteoblasts induce surrounding cells to express the same pattern of ligands, thereby

keeping the coordinated tempo in cells activities, here, all osteoblasts have the same

phenotype and functions-secreting bone matrix. If the committed osteoblasts (red

cubic cells in bottom) receive stimulation from osteocytes, they will express unique

pattern of ligands and inhibit neighbours to express the same one, leading them

maintain osteoblastic phenotype. It is of great interest that the committed cell will


differentiate to osteocyte and after it generates new dendrites, it will recruit the next

committed osteoblasts, in other words, attract neighbours to adopt the same fate. This

transform indicates the topology of cell-to-cell contact has a profound impact on the

Notch signalling regulation.

Many cell fate determination processes occur concurrently with changes in cell

morphology [421]. During the transition from osteoblasts to osteocytes, the cell

morphological changes render different contact manner between adjacent cells,

which can contribute to altering signalling during the transition. Based on the

observation suggesting that osteocytes dendrites also present dynamic characteristics,

it is likely that osteocytes send a strong Notch signalling to the osteoblast which has

been chosen as osteocytes candidates. Then, this osteoblast starts to transform

towards osteocyte phenotype, meanwhile, through lateral inhibition mechanism,

prevents its neighbours from receiving high Notch signals.


Figure 41: Models of supposed contact dimensions alter Notch signalling. The

ligands of Notch signalling present a dynamic behaviour in nature. They diffuse on

the cell membrane before engagement with receptors and endocytosis. In the context

that a dendritic signals sending cell contact to cubic signals receiving cell (upper),

ligands will diffuse a long distance before endocytosis. Hence, the signals intensity is


depended on the amount and convergence of ligands diffusion. When two cubic cells

contact (bottom), the ligands diffuse a short distance before combination with

receptors, in this scenario, the signals intensity is proportional to the contact area.

This research emphasised the regulatory function of Notch on the transition from

osteoblasts to osteocytes. The transition is a fine-grained and carefully regulated

process that only the single committed osteoblasts differentiates to osteocytes and its

surrounding cells cannot adopt the same cell fate. According to this characteristic,

the juxtaposed Notch signalling may be the mechanism that can determinate cell fate

at single cell level. In contrast, other signalling pathways through soluble factors

cannot elicit this precise regulation at single cell level, instead, they regulate cell fate

in at a niche level containing cells cluster.

As osteocytes are close related to the mineralisation and bone remodelling,

application of Notch modulation to improve bone quality springs out our minds.

However, this program confronts great challenges due to the complexity of the

regulatory mechanisms under physical conditions. In the normal differentiation, the

committed osteoblasts need exogenous Notch stimulations, while others are laterally

inhibited which can explain that compulsive activating Notch in mature osteoblasts

resulting in dysregulation of differentiation and high risk of osteoblastic malignant

proliferation. This unique behaviour manner of Notch in osteocytes necessitates more

careful design of approaches when targeting Notch in bone diseases.

The main problems impeded the clinical application of modulating Notch signalling

are: i) the difficulty of precise measurement of Notch signals intensity and ii) the

complexity of Notch signalling itself as well as crosstalk with other signalling

pathways. The traditional molecular biological methods that measure proteins and

genes expression are far from sufficient to reflect the real signals intensity. To

address the first problem, collection of comprehensive data from Notch receptors,

ligands and effectors and establishment mathematical models to calculate the final

signals output could represent the future direction. Several models have been

reported, however, optimisation and test are still required to generate convince

results.

After the Notch signals can be accurately measured, we can move to how to

modulating Notch signalling which is a nascent area [422]. There are several


strategies for drug development are being tested at preclinical or clinical stages.

However, almost all those drugs are designed to target tumours from breast cancer to

lymphoblastic leukaemia [422]. It seems there is a long journey to go for modulating

Notch signalling to treat bone diseases. At least, some Notch components have been

identified as mutation sites responsible for bone abnormalities. Such as Dll3

mutation causes spondylocostal dysostosis (SD) [124] and gain-of-function mutation

in Notch is responsible for the rare Hajdu-Cheney syndrome [423, 424]. These

targets may be where the first breakthrough can be made.

References 123

References

1. ennifer J Watts, J.A.-O.a.K.M.S., Osteoporosis costing all Australians: a new burden of disease analysis – 2012 to 2022. . Osteoporosis Australia, 2013.

2. Lu, Y., et al., The Biological Function of DMP-1 in Osteocyte Maturation Is Mediated by Its 57-kDa C-terminal Fragment. Journal of Bone and Mineral Research, 2011. 26(2): p. 331-340.

3. Elder, C.J. and N.J. Bishop, Rickets. Lancet, 2014. 383(9929): p. 1665-1676. 4. Martin, T.J., Bone remodelling: its local regulation and the emergence of

bone fragility. Best Pract Res Clin Endocrinol Metab, 2008. 22(5): p. 701-722.

5. Cordle, J., et al., A conserved face of the Jagged/Serrate DSL domain is involved in Notch trans-activation and cis-inhibition. Nat Struct Mol Biol, 2008. 15(8): p. 849-857.

6. Dallas, S.L., M. Prideaux, and L.F. Bonewald, The Osteocyte: An Endocrine Cell … and More. Endocrine Reviews, 2013. 34(5): p. 658-690.

7. Artavanis-Tsakonas, S., M.D. Rand, and R.J. Lake, Notch Signaling: Cell Fate Control and Signal Integration in Development. Science, 1999. 284(5415): p. 770-776.

8. Kopan, R. and M.X.G. Ilagan, The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell, 2009. 137(2): p. 216-233.

9. Andersson, E.R., R. Sandberg, and U. Lendahl, Notch signaling: simplicity in design, versatility in function. Development, 2011. 138(17): p. 3593-3612.

10. Bray, S.J., Notch signalling in context. Nat Rev Mol Cell Biol, 2016. advance online publication.

11. Reya, T., et al., Stem cells, cancer, and cancer stem cells. Nature, 2001. 414(6859): p. 105-111.

12. John, H.C.S., et al., The Osteoblast to Osteocyte Transition: Epigenetic Changes and Response to the Vitamin D3 Hormone. Molecular Endocrinology, 2014. 28(7): p. 1150-1165.

13. Liu, P., et al., Anabolic actions of Notch on mature bone. Proceedings of the National Academy of Sciences, 2016. 113(15): p. E2152-E2161.

14. Reya, T. and H. Clevers, Wnt signalling in stem cells and cancer. Nature, 2005. 434(7035): p. 843-850.

15. Taipale, J. and P.A. Beachy, The Hedgehog and Wnt signalling pathways in cancer. Nature, 2001. 411(6835): p. 349-354.

16. Hogan, B.L., Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes & Development, 1996. 10(13): p. 1580-1594.

17. Lin, G.L. and K.D. Hankenson, Integration of BMP, Wnt, and notch signaling pathways in osteoblast differentiation. Journal of Cellular Biochemistry, 2011. 112(12): p. 3491-3501.

18. Hennessy, B.T., et al., Exploiting the PI3K/AKT Pathway for Cancer Drug Discovery. Nat Rev Drug Discov, 2005. 4(12): p. 988-1004.

19. Mumm, J.S. and R. Kopan, Notch Signaling: From the Outside In. Developmental Biology, 2000. 228(2): p. 151-165.

124 Reference

20. Liu, J., et al., Chapter Twelve - Notch Signaling in the Regulation of Stem Cell Self-Renewal and Differentiation, in Current Topics in Developmental Biology, K. Raphael, Editor. 2010, Academic Press. p. 367-409.

21. Franz-Odendaal, T.A., B.K. Hall, and P.E. Witten, Buried alive: How osteoblasts become osteocytes. Developmental Dynamics, 2006. 235(1): p. 176-190.

22. Bonewald, L.F., The amazing osteocyte. Journal of Bone and Mineral Research, 2011. 26(2): p. 229-238.

23. van Hove, R.P., et al., Osteocyte morphology in human tibiae of different bone pathologies with different bone mineral density — Is there a role for mechanosensing? Bone, 2009. 45(2): p. 321-329.

24. Pazzaglia, U.E., et al., The shape modulation of osteoblast–osteocyte transformation and its correlation with the fibrillar organization in secondary osteons. Cell and Tissue Research, 2010. 340(3): p. 533-540.

25. Marotti, G., The structure of bone tissues and the cellular control of their deposition. Ital J Anat Embryol, 1996. 101(4): p. 25-79.

26. Kamioka, H., et al., Terminal Differentiation of Osteoblasts to Osteocytes Is Accompanied by Dramatic Changes in the Distribution of Actin-Binding Proteins. Journal of Bone and Mineral Research, 2004. 19(3): p. 471-478.

27. Wetterwald, A., et al., Characterization and cloning of the E11 antigen, a marker expressed by Rat Osteoblasts and Osteocytes. Bone, 1996. 18(2): p. 125-132.

28. Schulze, E., et al., Immunohistochemical investigations on the differentiation marker protein E11 in rat calvaria, calvaria cell culture and the osteoblastic cell line ROS 17/2.8. Histochem Cell Biol, 1999. 111(1): p. 61-9.

29. Ramirez, M.I., et al., T1alpha, a lung type I cell differentiation gene, is required for normal lung cell proliferation and alveolus formation at birth. Dev Biol, 2003. 256(1): p. 61-72.

30. Schacht, V., et al., T1alpha/podoplanin deficiency disrupts normal lymphatic vasculature formation and causes lymphedema. EMBO J, 2003. 22(14): p. 3546-56.

31. Scholl, F.G., et al., Identification of PA2.26 antigen as a novel cell-surface mucin-type glycoprotein that induces plasma membrane extensions and increased motility in keratinocytes. J Cell Sci, 1999. 112 ( Pt 24): p. 4601-13.

32. Zhang, K., et al., E11/gp38 Selective Expression in Osteocytes: Regulation by Mechanical Strain and Role in Dendrite Elongation. Molecular and Cellular Biology, 2006. 26(12): p. 4539-4552.

33. Prideaux, M., et al., Extracellular Matrix Mineralization Promotes E11/gp38 Glycoprotein Expression and Drives Osteocytic Differentiation. PLoS ONE, 2012. 7(5): p. e36786.

34. Narayanan, K., et al., Dual Functional Roles of Dentin Matrix Protein 1: IMPLICATIONS IN BIOMINERALIZATION AND GENE TRANSCRIPTION BY ACTIVATION OF INTRACELLULAR Ca2+ STORE. Journal of Biological Chemistry, 2003. 278(19): p. 17500-17508.

35. George, A., et al., Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. Journal of Biological Chemistry, 1993. 268(17): p. 12624-30.

36. Bellahcène, A., et al., Small Integrin-Binding LIgand N-linked Glycoproteins (SIBLINGs): Multifunctional proteins in cancer. Nature reviews. Cancer, 2008. 8(3): p. 212-226.

References 125

37. Toyosawa, S., et al., Dentin Matrix Protein 1 Is Predominantly Expressed in Chicken and Rat Osteocytes But Not in Osteoblasts. Journal of Bone and Mineral Research, 2001. 16(11): p. 2017-2026.

38. Butler, W.T., et al., Extracellular Matrix Proteins and the Dynamics of Dentin Formation. Connective Tissue Research, 2002. 43(2-3): p. 301-307.

39. Rowe, P.S., et al., MEPE has the properties of an osteoblastic phosphatonin and minhibin. Bone, 2004. 34(2): p. 303-19.

40. Nampei, A., et al., Matrix extracellular phosphoglycoprotein (MEPE) is highly expressed in osteocytes in human bone. J Bone Miner Metab, 2004. 22(3): p. 176-84.

41. Harris, S.E., et al., DMP1 and MEPE expression are elevated in osteocytes after mechanical loading in vivo: Theoretical role in controlling mineral quality in the perilacunar matrix. Journal of musculoskeletal & neuronal interactions, 2007. 7(4): p. 313-315.

42. Mikuni-Takagaki, Y., et al., Matrix mineralization and the differentiation of osteocyte-like cells in culture. J Bone Miner Res, 1995. 10(2): p. 231-42.

43. Knippschild, U., et al., The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal, 2005. 17(6): p. 675-89.

44. Paic, F., et al., Identification of differentially expressed genes between osteoblasts and osteocytes. Bone, 2009. 45(4): p. 682-92.

45. Bonewald, L.F. and M.J. Wacker, FGF23 production by osteocytes. Pediatr Nephrol, 2013. 28(4): p. 563-8.

46. Tang, S.Y., et al., Matrix Metalloproteinase-13 is Required for Osteocytic Perilacunar Remodeling and Maintains Bone Fracture Resistance. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2012. 27(9): p. 1936-1950.

47. Inoue, K., et al., A crucial role for matrix metalloproteinase 2 in osteocytic canalicular formation and bone metabolism. J Biol Chem, 2006. 281(44): p. 33814-24.

48. Holmbeck, K., et al., The metalloproteinase MT1-MMP is required for normal development and maintenance of osteocyte processes in bone. Journal of Cell Science, 2005. 118(1): p. 147-156.

49. Bezooijen, R.L.v., et al., SOST/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine & Growth Factor Reviews, 2005. 16(3): p. 319-327.

50. Li, X., et al., Dkk2 has a role in terminal osteoblast differentiation and mineralized matrix formation. Nat Genet, 2005. 37(9): p. 945-952.

51. Liu, S., et al., Regulation of Fibroblastic Growth Factor 23 Expression but Not Degradation by PHEX. Journal of Biological Chemistry, 2003. 278(39): p. 37419-37426.

52. Liu, S., et al., Pathogenic role of Fgf23 in <em>Hyp</em> mice. American Journal of Physiology - Endocrinology And Metabolism, 2006. 291(1): p. E38-E49.

53. Feng, J.Q., L. Ye, and S. Schiavi, Do osteocytes contribute to phosphate homeostasis? Current opinion in nephrology and hypertension, 2009. 18(4): p. 285-291.

54. Schiavi, S.C., Bone talk. Nat Genet, 2006. 38(11): p. 1230-1231. 55. Wang, H., et al., Overexpression of fibroblast growth factor 23 suppresses

osteoblast differentiation and matrix mineralization in vitro. J Bone Miner Res, 2008. 23(6): p. 939-48.

126 Reference

56. Scheiner, S., et al., Investigation of nutrient transport mechanisms in the lacunae-canaliculi system. IOP Conference Series: Materials Science and Engineering, 2010. 10(1): p. 012129.

57. Buenzli, P.R. and N.A. Sims, Quantifying the osteocyte network in the human skeleton. Bone, 2015. 75: p. 144-50.

58. Turner, C.H., et al., Do Bone Cells Behave Like a Neuronal Network? Calcified Tissue International, 2002. 70(6): p. 435-442.

59. Kerschnitzki, M., et al., Architecture of the osteocyte network correlates with bone material quality. J Bone Miner Res, 2013. 28(8): p. 1837-45.

60. Blouin, S., et al., Hypermineralization and High Osteocyte Lacunar Density in Osteogenesis Imperfecta Type V Bone Indicate Exuberant Primary Bone Formation. J Bone Miner Res, 2017.

61. Rodionova, N.V., V.S. Oganov, and N.V. Zolotova, Ultrastructural changes in osteocytes in microgravity conditions. Advances in Space Research, 2002. 30(4): p. 765-770.

62. Wysolmerski, J.J., Osteocytic osteolysis: time for a second look? BoneKEy Reports, 2012. 1: p. 229.

63. Pajevic⁎, P.D., et al., Osteocytes and calcium homeostasis. Bone. 47: p. S23. 64. Marenzana, M., et al., Bone as an ion exchange organ: Evidence for

instantaneous cell-dependent calcium efflux from bone not due to resorption. Bone, 2005. 37(4): p. 545-554.

65. Tazawa, K., et al., Osteocytic osteolysis observed in rats to which parathyroid hormone was continuously administered. Journal of Bone and Mineral Metabolism, 2004. 22(6): p. 524-529.

66. Bélanger, L.F., Osteocytic osteolysis. Calcified Tissue Research, 1969. 4(1): p. 1-12.

67. Mosekilde, L. and F. Melsen, A tetracycline-based histomorphometric evaluation of bone resorption and bone turnover in hyperthyroidism and hyperparathyroidism. Acta Med Scand, 1978. 204(1-2): p. 97-102.

68. Genetos, D.C., et al., Oscillating fluid flow activation of gap junction hemichannels induces atp release from MLO-Y4 osteocytes. Journal of Cellular Physiology, 2007. 212(1): p. 207-214.

69. Lai, C.F., et al., Accentuated ovariectomy-induced bone loss and altered osteogenesis in heterozygous N-cadherin null mice. J Bone Miner Res, 2006. 21(12): p. 1897-906.

70. Schaffler, M.B., et al., Osteocytes: master orchestrators of bone. Calcif Tissue Int, 2014. 94(1): p. 5-24.

71. Goodenough, D.A. and D.L. Paul, Gap Junctions. Cold Spring Harbor Perspectives in Biology, 2009. 1(1): p. a002576.

72. Batra, N., et al., Mechanical stress-activated integrin alpha5beta1 induces opening of connexin 43 hemichannels. Proc Natl Acad Sci U S A, 2012. 109(9): p. 3359-64.

73. Cherian, P.P., et al., Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the release of prostaglandin. Mol Biol Cell, 2005. 16(7): p. 3100-6.

74. Veno PA, L.Y., Kamel S, Feng J, Bonewald LF, Dallas SL, A membrane targeted GFP selectively expressed in osteocytes reveals cell and membrane dynamics in living osteocytes. J Bone Miner Res. , 2010. 25(suppl 1)(S56).

75. Sprinzak, D., et al., Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature, 2010. 465(7294): p. 86-90.

References 127

76. Rios, A.C., et al., Neural crest regulates myogenesis through the transient activation of NOTCH. Nature, 2011. 473(7348): p. 532-535.

77. Bray, S.J., Notch signalling in context. Nat Rev Mol Cell Biol, 2016. 17(11): p. 722-735.

78. Kamioka, H., T. Honjo, and T. Takano-Yamamoto, A three-dimensional distribution of osteocyte processes revealed by the combination of confocal laser scanning microscopy and differential interference contrast microscopy. Bone, 2001. 28(2): p. 145-149.

79. Imai, S., et al., Osteocyte-derived HB-GAM (pleiotrophin) is associated with bone formation and mechanical loading. Bone, 2009. 44(5): p. 785-794.

80. Lehmann, W., et al., Absence of mouse pleiotrophin does not affect bone formation in vivo. Bone, 2004. 35(6): p. 1247-55.

81. Sapir-Koren, R. and G. Livshits, Bone mineralization and regulation of phosphate homeostasis. IBMS BoneKEy, 2011. 8(6): p. 286-300.

82. Feng, J.Q., et al., Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet, 2006. 38(11): p. 1310-5.

83. Dorvee, J.R., et al., Peritubular dentin, a highly mineralized, non-collagenous, component of dentin: isolation and capture by laser microdissection. Connect Tissue Res, 2014. 55 Suppl 1: p. 9-14.

84. Goldberg, M., et al., Dentin: Structure, Composition and Mineralization: The role of dentin ECM in dentin formation and mineralization. Frontiers in Bioscience (Elite Edition), 2011. 3: p. 711-735.

85. Azevedo, N. and M. Goldberg, [Post-natal development of tooth structures in Didelphis albiventris]. J Biol Buccale, 1987. 15(1): p. 23-35.

86. Bell, L.S., M. Kayser, and C. Jones, The mineralized osteocyte: a living fossil. Am J Phys Anthropol, 2008. 137(4): p. 449-56.

87. Lu, Y., et al., The biological function of DMP-1 in osteocyte maturation is mediated by its 57-kDa C-terminal fragment. J Bone Miner Res, 2011. 26(2): p. 331-40.

88. Ling, Y., et al., DMP1 Depletion Decreases Bone Mineralization In Vivo: An FTIR Imaging Analysis. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2005. 20(12): p. 2169-2177.

89. George, A., et al., Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. J Biol Chem, 1993. 268(17): p. 12624-30.

90. Rios, H.F., et al., DMP1 is essential for osteocyte formation and function. J Musculoskelet Neuronal Interact, 2005. 5(4): p. 325-7.

91. van de Lest, C.H. and A.B. Vaandrager, Mechanism of cell-mediated mineralization. Current Opinion in Orthopaedics, 2007. 18(5): p. 434-443.

92. Nam, Y., et al., Structural Basis for Cooperativity in Recruitment of MAML Coactivators to Notch Transcription Complexes. Cell, 2006. 124(5): p. 973-983.

93. Wilson, J.J. and R.A. Kovall, Crystal Structure of the CSL-Notch-Mastermind Ternary Complex Bound to DNA. Cell, 2006. 124(5): p. 985-996.

94. Neves, J., et al., Jagged 1 regulates the restriction of Sox2 expression in the developing chicken inner ear: a mechanism for sensory organ specification. Development, 2011. 138(4): p. 735-44.

128 Reference

95. Hartman, B.H., T.A. Reh, and O. Bermingham-McDonogh, Notch signaling specifies prosensory domains via lateral induction in the developing mammalian inner ear. Proc Natl Acad Sci U S A, 2010. 107(36): p. 15792-7.

96. Brooker, R., K. Hozumi, and J. Lewis, Notch ligands with contrasting functions: Jagged1 and Delta1 in the mouse inner ear. Development, 2006. 133(7): p. 1277-86.

97. Petrovic, J., et al., Ligand-dependent Notch signaling strength orchestrates lateral induction and lateral inhibition in the developing inner ear. Development, 2014. 141(11): p. 2313-24.

98. Daudet, N., L. Ariza-McNaughton, and J. Lewis, Notch signalling is needed to maintain, but not to initiate, the formation of prosensory patches in the chick inner ear. Development, 2007. 134(12): p. 2369-78.

99. Pan, W., et al., Notch signaling is required for the generation of hair cells and supporting cells in the mammalian inner ear. Proc Natl Acad Sci U S A, 2010. 107(36): p. 15798-803.

100. Boareto, M., et al., Jagged–Delta asymmetry in Notch signaling can give rise to a Sender/Receiver hybrid phenotype. Proceedings of the National Academy of Sciences, 2015. 112(5): p. E402-E409.

101. D’Souza, B., L. Meloty-Kapella, and G. Weinmaster, Chapter Three - Canonical and Non-Canonical Notch Ligands, in Current Topics in Developmental Biology, K. Raphael, Editor. 2010, Academic Press. p. 73-129.

102. Luca, V.C., et al., Structural basis for Notch1 engagement of Delta-like 4. Science, 2015. 347(6224): p. 847-853.

103. Fehon, R.G., et al., Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell, 1990. 61(3): p. 523-534.

104. Chillakuri, C.R., et al., Structural analysis uncovers lipid-binding properties of Notch ligands. Cell Rep, 2013. 5(4): p. 861-7.

105. Khait, I., et al., Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Reports, 2016. 14(2): p. 225-233.

106. Cohen, M., et al., Dynamic filopodia transmit intermittent Delta-Notch signaling to drive pattern refinement during lateral inhibition. Dev Cell, 2010. 19(1): p. 78-89.

107. Hamada, H., et al., Involvement of Delta/Notch signaling in zebrafish adult pigment stripe patterning. Development, 2014. 141(2): p. 318-24.

108. Mattila, P.K. and P. Lappalainen, Filopodia: molecular architecture and cellular functions. Nat Rev Mol Cell Biol, 2008. 9(6): p. 446-454.

109. Rios, A.C., et al., Neural crest regulates myogenesis through the transient activation of NOTCH. Nature, 2011. 473(7348): p. 532-5.

110. Jiang, J.X., A.J. Siller-Jackson, and S. Burra, Roles of gap junctions and hemichannels in bone cell functions and in signal transmission of mechanical stress. Frontiers in bioscience : a journal and virtual library, 2007. 12: p. 1450-1462.

111. Schirrmacher, K., et al., Characterization of gap junctions between osteoblast-like cells in culture. Calcified Tissue International, 1992. 51(4): p. 285-290.

112. Fortini, M.E., Notch Signaling: The Core Pathway and Its Posttranslational Regulation. Developmental Cell. 16(5): p. 633-647.

References 129

113. Guruharsha, K.G., M.W. Kankel, and S. Artavanis-Tsakonas, The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat Rev Genet, 2012. 13(9): p. 654-666.

114. Bertet, C., et al., Temporal Patterning of Neuroblasts Controls Notch-Mediated Cell Survival through Regulation of Hid or Reaper. Cell, 2014. 158(5): p. 1173-1186.

115. Skalska, L., et al., Chromatin signatures at Notch‐regulated enhancers reveal large‐scale changes in H3K56ac upon activation. The EMBO Journal, 2015. 34(14): p. 1889-1904.

116. Castel, D., et al., Dynamic binding of RBPJ is determined by Notch signaling status. Genes & Development, 2013. 27(9): p. 1059-1071.

117. Wang, H., et al., NOTCH1–RBPJ complexes drive target gene expression through dynamic interactions with superenhancers. Proceedings of the National Academy of Sciences, 2014. 111(2): p. 705-710.

118. Martinez, A.-M., et al., Polyhomeotic has a tumor suppressor activity mediated by repression of Notch signaling. Nat Genet, 2009. 41(10): p. 1076-1082.

119. Endo, K., et al., Chromatin modification of Notch targets in olfactory receptor neuron diversification. Nat Neurosci, 2012. 15(2): p. 224-233.

120. South, A.P., R.J. Cho, and J.C. Aster, The double-edged sword of Notch signaling in cancer. Seminars in Cell & Developmental Biology, 2012. 23(4): p. 458-464.

121. Hirata, H., et al., Oscillatory Expression of the bHLH Factor Hes1 Regulated by a Negative Feedback Loop. Science, 2002. 298(5594): p. 840-843.

122. Hirata, H., et al., Instability of Hes7 protein is crucial for the somite segmentation clock. Nat Genet, 2004. 36(7): p. 750-754.

123. Li, L., et al., Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat Genet, 1997. 16(3): p. 243-251.

124. Bulman, M.P., et al., Mutations in the human Delta homologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis. Nat Genet, 2000. 24(4): p. 438-441.

125. Shimojo, H., T. Ohtsuka, and R. Kageyama, Oscillations in Notch Signaling Regulate Maintenance of Neural Progenitors. Neuron, 2008. 58(1): p. 52-64.

126. Lewis, A.K., et al., Distinct expression patterns of notch family receptors and ligands during development of the mammalian inner ear. Mechanisms of Development, 1998. 78(1–2): p. 159-163.

127. Reed, R.D. and M.S. Serfas, Butterfly Wing Pattern Evolution Is Associated with Changes in a Notch/Distal-less Temporal Pattern Formation Process. Current Biology, 2004. 14(13): p. 1159-1166.

128. Chiba, S., Notch signaling in stem cell systems. Stem Cells, 2006. 24(11): p. 2437-47.

129. Lai, E.C., Notch signaling: control of cell communication and cell fate. Development, 2004. 131(5): p. 965-73.

130. Fre, S., et al., Notch signals control the fate of immature progenitor cells in the intestine. Nature, 2005. 435(7044): p. 964-968.

131. Bjornson, C.R., et al., Notch signaling is necessary to maintain quiescence in adult muscle stem cells. Stem Cells, 2012. 30(2): p. 232-42.

132. Wen, Y., et al., Constitutive Notch Activation Upregulates Pax7 and Promotes the Self-Renewal of Skeletal Muscle Satellite Cells. Molecular and Cellular Biology, 2012. 32(12): p. 2300-2311.

130 Reference

133. Dufraine, J., Y. Funahashi, and J. Kitajewski, Notch signaling regulates tumor angiogenesis by diverse mechanisms. Oncogene, 0000. 27(38): p. 5132-5137.

134. Phng, L.K. and H. Gerhardt, Angiogenesis: A Team Effort Coordinated by Notch. Developmental Cell. 16(2): p. 196-208.

135. Kunisato, A., et al., HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood, 2003. 101(5): p. 1777-83.

136. Hadland, B.K., et al., A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development. Blood, 2004. 104(10): p. 3097-3105.

137. de la Pompa, J.L., et al., Conservation of the Notch signalling pathway in mammalian neurogenesis. Development, 1997. 124(6): p. 1139-48.

138. Hitoshi, S., et al., Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes & Development, 2002. 16(7): p. 846-858.

139. Dong, Y., et al., RBPjkappa-dependent Notch signaling regulates mesenchymal progenitor cell proliferation and differentiation during skeletal development. Development, 2010. 137(9): p. 1461-71.

140. Graña, X. and E.P. Reddy, Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene, 1995. 11(2): p. 211-219.

141. Bertoli, C., J.M. Skotheim, and R.A.M. de Bruin, Control of cell cycle transcription during G1 and S phases. Nature reviews. Molecular cell biology, 2013. 14(8): p. 518-528.

142. Reynolds, T.C., S.D. Smith, and J. Sklar, Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the beta T cell receptor gene in human lymphoblastic neoplasms. Cell, 1987. 50(1): p. 107-17.

143. Ellisen, L.W., et al., TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 1991. 66(4): p. 649-61.

144. Girard, L., et al., Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes & Development, 1996. 10(15): p. 1930-1944.

145. Ronchini, C. and A.J. Capobianco, Induction of Cyclin D1 Transcription and CDK2 Activity by Notchic: Implication for Cell Cycle Disruption in Transformation by Notchic. Molecular and Cellular Biology, 2001. 21(17): p. 5925-5934.

146. Feldman, B.J., T. Hampton, and M.L. Cleary, A carboxy-terminal deletion mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic mice. Blood, 2000. 96(5): p. 1906-13.

147. Beverly, L.J. and A.J. Capobianco, Perturbation of Ikaros isoform selection by MLV integration is a cooperative event in NotchIC-induced T cell leukemogenesis. Cancer Cell, 2003. 3(6): p. 551-564.

148. Alonso, L. and E. Fuchs, Stem cells in the skin: waste not, Wnt not. Genes & Development, 2003. 17(10): p. 1189-1200.

References 131

149. Rangarajan, A., et al., Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J, 2001. 20(13): p. 3427-36.

150. Takeda, K., et al., Limb and Skin Abnormalities in Mice Lacking IKKα. Science, 1999. 284(5412): p. 313-316.

151. Seitz, C.S., et al., Alterations in NF-κB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-κB. Proceedings of the National Academy of Sciences, 1998. 95(5): p. 2307-2312.

152. Nickoloff, B.J., et al., Jagged-1 mediated activation of notch signaling induces complete maturation of human keratinocytes through NF-kappaB and PPARgamma. Cell Death Differ, 2002. 9(8): p. 842-55.

153. Chu, J., et al., Repression of activator protein-1-mediated transcriptional activation by the Notch-1 intracellular domain. J Biol Chem, 2002. 277(9): p. 7587-97.

154. Nicolas, M., et al., Notch1 functions as a tumor suppressor in mouse skin. Nat Genet, 2003. 33(3): p. 416-421.

155. McLaughlin-Drubin, M.E. and K. Münger, The Human Papillomavirus E7 Oncoprotein. Virology, 2009. 384(2): p. 335-344.

156. Helt, A.M., J.O. Funk, and D.A. Galloway, Inactivation of both the retinoblastoma tumor suppressor and p21 by the human papillomavirus type 16 E7 oncoprotein is necessary to inhibit cell cycle arrest in human epithelial cells. J Virol, 2002. 76(20): p. 10559-68.

157. Westbrook, T.F., et al., E7 abolishes raf-induced arrest via mislocalization of p21(Cip1). Mol Cell Biol, 2002. 22(20): p. 7041-52.

158. Sharma, M., W.W. Chuang, and Z. Sun, Phosphatidylinositol 3-kinase/Akt stimulates androgen pathway through GSK3beta inhibition and nuclear beta-catenin accumulation. J Biol Chem, 2002. 277(34): p. 30935-41.

159. Patturajan, M., et al., DeltaNp63 induces beta-catenin nuclear accumulation and signaling. Cancer Cell, 2002. 1(4): p. 369-79.

160. Ma, Y.Y., et al., PIK3CA as an oncogene in cervical cancer. Oncogene, 2000. 19(23): p. 2739-44.

161. Yang, A., et al., p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell, 1998. 2(3): p. 305-16.

162. Engin, F., et al., Dimorphic effects of Notch signaling in bone homeostasis. Nat Med, 2008. 14(3): p. 299-305.

163. Hilton, M.J., et al., Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nat Med, 2008. 14(3): p. 306-14.

164. Tu, X., et al., Physiological Notch Signaling Maintains Bone Homeostasis via RBPjk and Hey Upstream of NFATc1. PLoS Genet, 2012. 8(3): p. e1002577.

165. Salie, R., et al., Ubiquitous overexpression of Hey1 transcription factor leads to osteopenia and chondrocyte hypertrophy in bone. Bone, 2010. 46(3): p. 680-694.

166. Tao, J., et al., Osteosclerosis owing to Notch gain of function is solely Rbpj-dependent. Journal of Bone and Mineral Research, 2010. 25(10): p. 2175-2183.

167. Zanotti, S., et al., Notch Inhibits Osteoblast Differentiation and Causes Osteopenia. Endocrinology, 2008. 149(8): p. 3890-3899.

132 Reference

168. Canalis, E., et al., Osteoblast Lineage-Specific Effects of Notch Activation in the Skeleton. Endocrinology, 2013. 154(2): p. 623-634.

169. Kronenberg, H.M., Developmental regulation of the growth plate. Nature, 2003. 423(6937): p. 332-6.

170. Komori, T., Regulation of skeletal development by the Runx family of transcription factors. Journal of Cellular Biochemistry, 2005. 95(3): p. 445-453.

171. Benedito, R., et al., The Notch Ligands Dll4 and Jagged1 Have Opposing Effects on Angiogenesis. Cell, 2009. 137(6): p. 1124-1135.

172. Ramasamy, S.K., et al., Endothelial Notch activity promotes angiogenesis and osteogenesis in bone. Nature, 2014. 507(7492): p. 376-380.

173. Canalis, E., et al., Canonical Notch activation in osteocytes causes osteopetrosis. American Journal of Physiology - Endocrinology and Metabolism, 2016. 310(2): p. E171-E182.

174. Canalis, E., L. Schilling, and S. Zanotti, Effects of Sex and Notch Signaling on the Osteocyte Cell Pool. Journal of Cellular Physiology, 2016: p. n/a-n/a.

175. Baron, R. and M. Kneissel, WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat Med, 2013. 19(2): p. 179-192.

176. Krishnan, V., H.U. Bryant, and O.A. MacDougald, Regulation of bone mass by Wnt signaling. The Journal of Clinical Investigation. 116(5): p. 1202-1209.

177. Gaur, T., et al., Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression. Journal of Biological Chemistry, 2005. 280(39): p. 33132-33140.

178. Morvan, F., et al., Deletion of a Single Allele of the Dkk1 Gene Leads to an Increase in Bone Formation and Bone Mass. Journal of Bone and Mineral Research, 2006. 21(6): p. 934-945.

179. Bonewald, L.F. and M.L. Johnson, Osteocytes, mechanosensing and Wnt signaling. Bone, 2008. 42(4): p. 606-615.

180. Li, X., et al., Sclerostin Binds to LRP5/6 and Antagonizes Canonical Wnt Signaling. Journal of Biological Chemistry, 2005. 280(20): p. 19883-19887.

181. Li, X., et al., Targeted Deletion of the Sclerostin Gene in Mice Results in Increased Bone Formation and Bone Strength. Journal of Bone and Mineral Research, 2008. 23(6): p. 860-869.

182. Collette, N.M., et al., Targeted deletion of Sost distal enhancer increases bone formation and bone mass. Proceedings of the National Academy of Sciences, 2012. 109(35): p. 14092-14097.

183. Javaheri, B., et al., Deletion of a Single β-Catenin Allele in Osteocytes Abolishes the Bone Anabolic Response to Loading. Journal of Bone and Mineral Research, 2014. 29(3): p. 705-715.

184. Downward, J., PI 3-kinase, Akt and cell survival. Seminars in Cell & Developmental Biology, 2004. 15(2): p. 177-182.

185. Li, Vivian S.W., et al., Wnt Signaling through Inhibition of β-Catenin Degradation in an Intact Axin1 Complex. Cell, 2012. 149(6): p. 1245-1256.

186. Wu, D. and W. Pan, GSK3: a multifaceted kinase in Wnt signaling. Trends in biochemical sciences, 2010. 35(3): p. 161-168.

187. Foltz, D.R., et al., Glycogen Synthase Kinase-3β Modulates Notch Signaling and Stability. Current Biology, 2002. 12(12): p. 1006-1011.

References 133

188. Espinosa, L., et al., Phosphorylation by Glycogen Synthase Kinase-3β Down-regulates Notch Activity, a Link for Notch and Wnt Pathways. Journal of Biological Chemistry, 2003. 278(34): p. 32227-32235.

189. Yun Hye, J., et al., Regulation of Notch1/NICD and Hes1 Expressions by GSK-3alpha/beta. Mol. Cells, 2009. 27(1): p. 15-19.

190. Liu, X., et al., Lifelong accumulation of bone in mice lacking Pten in osteoblasts. Proceedings of the National Academy of Sciences, 2007. 104(7): p. 2259-2264.

191. Steck, P.A., et al., Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet, 1997. 15(4): p. 356-362.

192. Palomero, T., et al., Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat Med, 2007. 13(10): p. 1203-1210.

193. Jo, H.S., et al., Pten coordinates retinal neurogenesis by regulating Notch signalling. The EMBO Journal, 2012. 31(4): p. 817-828.

194. Gough, N.R., Limiting Notch Signaling with Akt. Science Signaling, 2012. 5(212): p. ec60-ec60.

195. Hales, E.C., et al., Notch1 regulates AKT activation loop (T308) dephosphorylation through modulation of the PP2A phosphatase in PTEN-null T-cell acute lymphoblastic leukemia cells. Journal of Biological Chemistry, 2013.

196. Even, J., M. Eskander, and J. Kang, Bone Morphogenetic Protein in Spine Surgery: Current and Future Uses. Journal of the American Academy of Orthopaedic Surgeons, 2012. 20(9): p. 547-552.

197. Guo, X. and X.F. Wang, Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res, 2009. 19(1): p. 71-88.

198. Yoon, B.S., et al., Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(14): p. 5062-5067.

199. Salazar, V.S., L.W. Gamer, and V. Rosen, BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol, 2016. 12(4): p. 203-221.

200. Wu, M., G. Chen, and Y.-P. Li, TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. 2016. 4: p. 16009.

201. Bandyopadhyay, A., et al., Genetic Analysis of the Roles of BMP2, BMP4, and BMP7 in Limb Patterning and Skeletogenesis. PLOS Genetics, 2006. 2(12): p. e216.

202. Wu, L.-a., et al., Development and characterization of a mouse floxed Bmp2 osteoblast cell line that retains osteoblast genotype and phenotype. Cell and tissue research, 2011. 343(3): p. 545-558.

203. Hughes-Fulford, M. and C.F. Li, The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization. J Orthop Surg Res, 2011. 6: p. 8.

204. Tsuji, K., et al., BMP2 activity, although dispensable for bone formation, is required for the initiation of fracture healing. Nat Genet, 2006. 38(12): p. 1424-9.

205. Yang, W., et al., Bmp2 in osteoblasts of periosteum and trabecular bone links bone formation to vascularization and mesenchymal stem cells. J Cell Sci, 2013. 126(Pt 18): p. 4085-98.

134 Reference

206. Mi, M., et al., Chondrocyte BMP2 signaling plays an essential role in bone fracture healing. Gene, 2013. 512(2): p. 211-218.

207. Tezuka, K.-I., et al., Stimulation of Osteoblastic Cell Differentiation by Notch. Journal of Bone and Mineral Research, 2002. 17(2): p. 231-239.

208. Nobta, M., et al., Critical Regulation of Bone Morphogenetic Protein-induced Osteoblastic Differentiation by Delta1/Jagged1-activated Notch1 Signaling. Journal of Biological Chemistry, 2005. 280(16): p. 15842-15848.

209. Santos, A., et al., Mechanical Loading Stimulates BMP7, But Not BMP2, Production by Osteocytes. Calcified Tissue International, 2011. 89(4): p. 318-326.

210. Winkler, D.G., et al., Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. The EMBO Journal, 2003. 22(23): p. 6267-6276.

211. Worthley, D.L., et al., Gremlin 1 identifies a skeletal stem cell with bone, cartilage, and reticular stromal potential. Cell, 2015. 160(1-2): p. 269-84.

212. Khokha, M.K., et al., Gremlin is the BMP antagonist required for maintenance of Shh and Fgf signals during limb patterning. Nat Genet, 2003. 34(3): p. 303-307.

213. Jaeger, E., et al., Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1. Nat Genet, 2012. 44(6): p. 699-703.

214. Chan, Charles K.F., et al., Identification and Specification of the Mouse Skeletal Stem Cell. Cell, 2015. 160(1–2): p. 285-298.

215. Kassem, M. and P. Bianco, Skeletal Stem Cells in Space and Time. Cell, 2015. 160(1–2): p. 17-19.

216. Walsh, D.W., et al., Co-regulation of Gremlin and Notch signalling in diabetic nephropathy. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 2008. 1782(1): p. 10-21.

217. Zuniga, E., et al., Gremlin 2 regulates distinct roles of BMP and Endothelin 1 signaling in dorsoventral patterning of the facial skeleton. Development (Cambridge, England), 2011. 138(23): p. 5147-5156.

218. Wu, X.B., et al., Impaired osteoblastic differentiation, reduced bone formation, and severe osteoporosis in noggin-overexpressing mice. J Clin Invest, 2003. 112(6): p. 924-34.

219. Canalis, E., et al., Conditional inactivation of noggin in the postnatal skeleton causes osteopenia. Endocrinology, 2012. 153(4): p. 1616-26.

220. Spiro, A.S., et al., BMP-7–induced ectopic bone formation and fracture healing is impaired by systemic NSAID application in C57BL/6-mice. Journal of Orthopaedic Research, 2010. 28(6): p. 785-791.

221. Scott, M.A., et al., Brief Review of Models of Ectopic Bone Formation. Stem Cells and Development, 2012. 21(5): p. 655-667.

222. Zhao, B., et al., Heparin Potentiates the in Vivo Ectopic Bone Formation Induced by Bone Morphogenetic Protein-2. Journal of Biological Chemistry, 2006. 281(32): p. 23246-23253.

223. Zara, J.N., et al., High Doses of Bone Morphogenetic Protein 2 Induce Structurally Abnormal Bone and Inflammation In Vivo. Tissue Engineering Part A, 2011. 17(9-10): p. 1389-1399.

224. Shore, E.M., et al., A recurrent mutation in the BMP type I receptor ACVR1 causes inherited and sporadic fibrodysplasia ossificans progressiva. Nat Genet, 2006. 38(5): p. 525-7.

References 135

225. Owen, M. and A.J. Friedenstein, Stromal stem cells: marrow-derived osteogenic precursors. Ciba Foundation symposium, 1988. 136: p. 42-60.

226. Shimizu, T., et al., Notch Signaling Induces Osteogenic Differentiation and Mineralization of Vascular Smooth Muscle Cells. Role of Msx2 Gene Induction via Notch-RBP-Jk Signaling, 2009. 29(7): p. 1104-1111.

227. Shao, J.-S., et al., Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals. Journal of Clinical Investigation, 2005. 115(5): p. 1210-1220.

228. Shimizu, T., et al., Notch Signaling Pathway Enhances Bone Morphogenetic Protein 2 (BMP2) Responsiveness of Msx2 Gene to Induce Osteogenic Differentiation and Mineralization of Vascular Smooth Muscle Cells. Journal of Biological Chemistry, 2011. 286(21): p. 19138-19148.

229. Feng, X.H. and R. Derynck, Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol, 2005. 21: p. 659-93.

230. Seyedin, S.M., et al., Purification and characterization of two cartilage-inducing factors from bovine demineralized bone. Proc Natl Acad Sci U S A, 1985. 82(8): p. 2267-71.

231. Chen, G., C. Deng, and Y.P. Li, TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci, 2012. 8(2): p. 272-88.

232. Crane, J.L. and X. Cao, Bone marrow mesenchymal stem cells and TGF-β signaling in bone remodeling. The Journal of Clinical Investigation, 2014. 124(2): p. 466-472.

233. Tang, Y., et al., TGF-beta1-induced migration of bone mesenchymal stem cells couples bone resorption with formation. Nat Med, 2009. 15(7): p. 757-65.

234. Matsunobu, T., et al., Critical roles of the TGF-beta type I receptor ALK5 in perichondrial formation and function, cartilage integrity, and osteoblast differentiation during growth plate development. Dev Biol, 2009. 332(2): p. 325-38.

235. Karsdal, M.A., et al., Matrix Metalloproteinase-dependent Activation of Latent Transforming Growth Factor-β Controls the Conversion of Osteoblasts into Osteocytes by Blocking Osteoblast Apoptosis. Journal of Biological Chemistry, 2002. 277(46): p. 44061-44067.

236. Li, L., et al., Notch-1 Signaling Promotes the Malignant Features of Human Breast Cancer through NF-κB Activation. PLoS ONE, 2014. 9(4): p. e95912.

237. Blaise, R., et al., Involvement of the notch pathway in the regulation of matrix metalloproteinase 13 and the dedifferentiation of articular chondrocytes in murine cartilage. Arthritis & Rheumatism, 2009. 60(2): p. 428-439.

238. Blokzijl, A., et al., Cross-talk between the Notch and TGF-β signaling pathways mediated by interaction of the Notch intracellular domain with Smad3. The Journal of Cell Biology, 2003. 163(4): p. 723-728.

239. Asano, N., et al., Notch1 signaling and regulatory T cell function. J Immunol, 2008. 180(5): p. 2796-804.

240. Carmeliet, P., et al., Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 1998. 394(6692): p. 485-90.

241. Frey, J.L., et al., Hypoxia-inducible factor-1α restricts the anabolic actions of parathyroid hormone. 2014. 2: p. 14005.

242. Gross, T.S., et al., Selected Contribution: Osteocytes upregulate HIF-1α in response to acute disuse and oxygen deprivation. Journal of Applied Physiology, 2001. 90(6): p. 2514-2519.

136 Reference

243. Wang, Y., et al., The hypoxia-inducible factor α pathway couples angiogenesis to osteogenesis during skeletal development. The Journal of Clinical Investigation, 2007. 117(6): p. 1616-1626.

244. Riddle, R.C., et al., Hypoxia-inducible Factor-1α Protein Negatively Regulates Load-induced Bone Formation. Journal of Biological Chemistry, 2011. 286(52): p. 44449-44456.

245. Hirao, M., et al., Oxygen tension is an important mediator of the transformation of osteoblasts to osteocytes. J Bone Miner Metab, 2007. 25(5): p. 266-76.

246. Spencer, J.A., et al., Direct measurement of local oxygen concentration in the bone marrow of live animals. Nature, 2014. 508(7495): p. 269-273.

247. Nombela-Arrieta, C., et al., Quantitative imaging of haematopoietic stem and progenitor cell localization and hypoxic status in the bone marrow microenvironment. Nat Cell Biol, 2013. 15(5): p. 533-543.

248. Gustafsson, M.V., et al., Hypoxia Requires Notch Signaling to Maintain the Undifferentiated Cell State. Developmental Cell, 2005. 9(5): p. 617-628.

249. Cejudo-Martin, P. and R.S. Johnson, A New Notch in the HIF Belt: How Hypoxia Impacts Differentiation. Developmental Cell, 2005. 9(5): p. 574-576.

250. Shah, K.M., et al., Osteocyte isolation and culture methods. BoneKEy Rep, 2016. 5.

251. van der Plas, A. and P.J. Nijweide, Isolation and purification of osteocytes. J Bone Miner Res, 1992. 7(4): p. 389-96.

252. Stern, A.R., et al., Isolation and culture of primary osteocytes from the long bones of skeletally mature and aged mice. Biotechniques, 2012. 52(6): p. 361-73.

253. Kato, Y., et al., Establishment of an osteocyte-like cell line, MLO-Y4. J Bone Miner Res, 1997. 12(12): p. 2014-23.

254. Bellido, T., et al., Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology, 2005. 146(11): p. 4577-83.

255. Papanicolaou, S.E., et al., Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology, 2009. 46(5): p. 389-99.

256. Woo, S.M., et al., Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differentiation in vitro and accelerates bone formation in vivo. Journal of Bone and Mineral Research, 2011. 26(11): p. 2634-2646.

257. Lu, Y., et al., DMP1-targeted Cre expression in odontoblasts and osteocytes. J Dent Res, 2007. 86(4): p. 320-5.

258. Kramer, I., et al., Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Mol Cell Biol, 2010. 30(12): p. 3071-85.

259. Javaheri, B., et al., Deletion of a single beta-catenin allele in osteocytes abolishes the bone anabolic response to loading. J Bone Miner Res, 2014. 29(3): p. 705-15.

260. Gomez-Barrena, E., et al., Bone regeneration: stem cell therapies and clinical studies in orthopaedics and traumatology. J Cell Mol Med, 2011. 15(6): p. 1266-86.

261. Zaidi, N. and A.J. Nixon, Stem cell therapy in bone repair and regeneration. Ann N Y Acad Sci, 2007. 1117: p. 62-72.

References 137

262. Gegenbaur, C., Untersuchungen zur vergleichenden anatomie der wirbelthiere. 1864, Leipzig: W. Engelmann.

263. McLarren, K.W., et al., The mammalian basic helix loop helix protein HES-1 binds to and modulates the transactivating function of the runt-related factor Cbfa1. J Biol Chem, 2000. 275(1): p. 530-8.

264. Tao, J., S. Chen, and B. Lee, Alteration of Notch signaling in skeletal development and disease. Ann N Y Acad Sci, 2010. 1192: p. 257-68.

265. Zanotti, S. and E. Canalis, NOTCH REGULATION OF BONE DEVELOPMENT AND REMODELING AND RELATED SKELETAL DISORDERS. Calcified Tissue International, 2012. 90(2): p. 69-75.

266. Zanotti, S. and E. Canalis, Notch and the skeleton. Mol Cell Biol, 2010. 30(4): p. 886-96.

267. Deregowski, V., et al., Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/β-Catenin but Not Bone Morphogenetic Protein Signaling. Journal of Biological Chemistry, 2006. 281(10): p. 6203-6210.

268. Mead, T.J. and K.E. Yutzey, Notch Signaling and the Developing Skeleton, in Notch Signaling in Embryology and Cancer, J. Reichrath and S. Reichrath, Editors. 2012, Springer US: New York, NY. p. 114-130.

269. Chen, S., B.H. Lee, and Y. Bae, Notch signaling in Skeletal Stem Cells. Calcified tissue international, 2014. 94(1): p. 68-77.

270. Zanotti, S. and E. Canalis, The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the RosaNotch Allele. Journal of Cellular Biochemistry, 2016. 117(5): p. 1222-1232.

271. Brack, A.S., et al., A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis. Cell Stem Cell, 2008. 2(1): p. 50-59.

272. Boulter, L., et al., Macrophage-derived Wnt opposes Notch signaling to specify hepatic progenitor cell fate in chronic liver disease. Nat Med, 2012. 18(4): p. 572-579.

273. Takebe, N., et al., Targeting Notch, Hedgehog, and Wnt pathways in cancer stem cells: clinical update. Nature reviews. Clinical oncology, 2015. 12(8): p. 445-464.

274. Kalajzic, I., et al., Use of Type I Collagen Green Fluorescent Protein Transgenes to Identify Subpopulations of Cells at Different Stages of the Osteoblast Lineage. Journal of Bone and Mineral Research, 2002. 17(1): p. 15-25.

275. Rizzo, P., et al., Rational targeting of Notch signaling in cancer. Oncogene, 2008. 27(38): p. 5124-5131.

276. Androutsellis-Theotokis, A., et al., Notch signalling regulates stem cell numbers in vitro and in vivo. Nature, 2006. 442(7104): p. 823-826.

277. Yajima, A., et al., Increased osteocyte death and mineralization inside bone after parathyroidectomy in patients with secondary hyperparathyroidism. J Bone Miner Res, 2010. 25(11): p. 2374-81.

278. Duncan, A.W., et al., Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol, 2005. 6(3): p. 314-322.

279. Krishnan, V., H.U. Bryant, and O.A. MacDougald, Regulation of bone mass by Wnt signaling. Journal of Clinical Investigation, 2006. 116(5): p. 1202-1209.

138 Reference

280. Chen, J. and F. Long, β-catenin promotes bone formation and suppresses bone resorption in postnatal growing mice. Journal of Bone and Mineral Research, 2013. 28(5): p. 1160-1169.

281. Diarra, D., et al., Dickkopf-1 is a master regulator of joint remodeling. Nat Med, 2007. 13(2): p. 156-163.

282. Gonzalez, R.F. and L.G. Dobbs, Purification and analysis of RTI40, a type I alveolar epithelial cell apical membrane protein. Biochim Biophys Acta, 1998. 1429(1): p. 208-16.

283. Sprague, L., A. Wetterwald, U. Heinzman, and M. J. Atkinson. , Phenotypic changes following over-expression of sense or antisense E11 cDNA in ROS 17/2.8 cells. J. Bone Miner. Res. , 1996. 11(S132).

284. Ohizumi, I., et al., Association of CD44 with OTS-8 in tumor vascular endothelial cells. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 2000. 1497(2): p. 197-203.

285. Arpin, M., et al., Emerging role for ERM proteins in cell adhesion and migration. Cell Adhesion & Migration, 2011. 5(2): p. 199-206.

286. Ponta, H., L. Sherman, and P.A. Herrlich, CD44: From adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol, 2003. 4(1): p. 33-45.

287. Tsukita, S., et al., ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J Cell Biol, 1994. 126(2): p. 391-401.

288. Legg, J.W. and C.M. Isacke, Identification and functional analysis of the ezrin-binding site in the hyaluronan receptor, CD44. Curr Biol, 1998. 8(12): p. 705-8.

289. Yonemura, S., et al., Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol, 1998. 140(4): p. 885-95.

290. Fehon, R.G., A.I. McClatchey, and A. Bretscher, Organizing the Cell Cortex: The role of ERM proteins. Nature reviews. Molecular cell biology, 2010. 11(4): p. 276-287.

291. Saarikangas, J., H. Zhao, and P. Lappalainen, Regulation of the Actin Cytoskeleton-Plasma Membrane Interplay by Phosphoinositides. Physiological Reviews, 2010. 90(1): p. 259-289.

292. Feng, J.Q., et al., Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet, 2006. 38(11): p. 1310-1315.

293. Deshpande, A.S., et al., Primary Structure and Phosphorylation of Dentin Matrix Protein 1 (DMP1) and Dentin Phosphophoryn (DPP) Uniquely Determine Their Role in Biomineralization. Biomacromolecules, 2011. 12(8): p. 2933-2945.

294. He, G., et al., Spatially and Temporally Controlled Biomineralization Is Facilitated by Interaction between Self-Assembled Dentin Matrix Protein 1 and Calcium Phosphate Nuclei in Solution. Biochemistry, 2005. 44(49): p. 16140-16148.

295. Boonrungsiman, S., et al., The role of intracellular calcium phosphate in osteoblast-mediated bone apatite formation. Proceedings of the National Academy of Sciences, 2012. 109(35): p. 14170-14175.

296. Mahamid, J., et al., Amorphous calcium phosphate is a major component of the forming fin bones of zebrafish: Indications for an amorphous precursor

References 139

phase. Proceedings of the National Academy of Sciences, 2008. 105(35): p. 12748-12753.

297. Mahamid, J., et al., Bone mineralization proceeds through intracellular calcium phosphate loaded vesicles: A cryo-electron microscopy study. Journal of Structural Biology, 2011. 174(3): p. 527-535.

298. Cao, Y.X., M.I. Ramirez, and M.C. Williams, Enhanced binding of Sp1/Sp3 transcription factors mediates the hyperoxia-induced increased expression of the lung type I cell gene T1alpha. J Cell Biochem, 2003. 89(5): p. 887-901.

299. Hantusch, B., et al., Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells. BMC Mol Biol, 2007. 8: p. 20.

300. Kunita, A., et al., Podoplanin is regulated by AP-1 and promotes platelet aggregation and cell migration in osteosarcoma. Am J Pathol, 2011. 179(2): p. 1041-9.

301. Jacob, A., Y. Zhang, and A. George, Transcriptional regulation of dentin matrix protein 1 (DMP1) in odontoblasts and osteoblasts. Connect Tissue Res, 2014. 55 Suppl 1: p. 107-12.

302. Wei, G., et al., Genome-wide analyses of transcription factor GATA3-mediated gene regulation in distinct T cell types. Immunity, 2011. 35(2): p. 299-311.

303. Radtke, F., H.R. MacDonald, and F. Tacchini-Cottier, Regulation of innate and adaptive immunity by Notch. Nat Rev Immunol, 2013. 13(6): p. 427-37.

304. Haines, K.M., E.L. Feldman, and S.I. Lentz, Visualization of Mitochondrial DNA Replication in Individual Cells by EdU Signal Amplification. 2010(45): p. e2147.

305. Deupree, S.M. and M.H. Schoenfisch, Quantitative Method for Determining the Lateral Strength of Bacterial Adhesion and Application for Characterizing Adhesion Kinetics. Langmuir, 2008. 24(9): p. 4700-4707.

306. Chau, J.F., W.F. Leong, and B. Li, Signaling pathways governing osteoblast proliferation, differentiation and function. Histol Histopathol, 2009. 24(12): p. 1593-606.

307. Raucci, A., et al., Osteoblast proliferation or differentiation is regulated by relative strengths of opposing signaling pathways. Journal of Cellular Physiology, 2008. 215(2): p. 442-451.

308. Salazar, V.S., et al., Specification of osteoblast cell fate by canonical Wnt signaling requires <em>Bmp2</em>. Development, 2016.

309. Blanpain, C. and E. Fuchs, Epidermal Stem Cells of the Skin. Annual review of cell and developmental biology, 2006. 22: p. 339-373.

310. Pan, Y., et al., γ-Secretase Functions through Notch Signaling to Maintain Skin Appendages but Is Not Required for Their Patterning or Initial Morphogenesis. Developmental Cell, 2004. 7(5): p. 731-743.

311. Peifer, M. and P. Polakis, Wnt Signaling in Oncogenesis and Embryogenesis--a Look Outside the Nucleus. Science, 2000. 287(5458): p. 1606-1609.

312. Lie, D.-C., et al., Wnt signalling regulates adult hippocampal neurogenesis. Nature, 2005. 437(7063): p. 1370-1375.

313. Dey, A., et al., The role of prenucleation clusters in surface-induced calcium phosphate crystallization. Nat Mater, 2010. 9(12): p. 1010-1014.

314. Sutfin, L.V., M.E. Holtrop, and R.E. Ogilvie, Microanalysis of Individual Mitochondrial Granules with Diameters Less Than 1000 Angstroms. Science, 1971. 174(4012): p. 947-949.

140 Reference

315. Li, Y. and C. Aparicio, Discerning the Subfibrillar Structure of Mineralized Collagen Fibrils: A Model for the Ultrastructure of Bone. PLoS ONE, 2013. 8(9): p. e76782.

316. Thurner, P.J., Atomic force microscopy and indentation force measurement of bone. Wiley Interdiscip Rev Nanomed Nanobiotechnol, 2009. 1(6): p. 624-49.

317. Ren, Y., et al., A Novel Way to Statistically Analyze Morphologic Changes in Dmp1-Null Osteocytes. Connective tissue research, 2014. 55(0 1): p. 129-133.

318. Hu, X.-B., et al., Blockade of Notch Signaling in Tumor-Bearing Mice May Lead to Tumor Regression, Progression, or Metastasis, Depending on Tumor Cell Types. Neoplasia (New York, N.Y.), 2009. 11(1): p. 32-38.

319. Radtke, F. and K. Raj, The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev Cancer, 2003. 3(10): p. 756-767.

320. Reynolds, T.C., S.D. Smith, and J. Sklar, Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the β T cell receptor gene in human lymphoblastic neoplasms. Cell, 1987. 50(1): p. 107-117.

321. Ellisen, L.W., et al., TAN-1, the human homolog of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 1991. 66(4): p. 649-661.

322. Borges, M., et al., An achaete-scute homologue essential for neuroendocrine differentiation in the lung. Nature, 1997. 386(6627): p. 852-855.

323. Sriuranpong, V., et al., Notch Signaling Induces Cell Cycle Arrest in Small Cell Lung Cancer Cells. Cancer Research, 2001. 61(7): p. 3200-3205.

324. Ito, T., et al., Basic helix-loop-helix transcription factors regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development, 2000. 127(18): p. 3913-3921.

325. Hahn, W.C., et al., Creation of human tumour cells with defined genetic elements. Nature, 1999. 400(6743): p. 464-468.

326. Zagouras, P., et al., Alterations in Notch signaling in neoplastic lesions of the human cervix. Proceedings of the National Academy of Sciences, 1995. 92(14): p. 6414-6418.

327. Weijzen, S., et al., Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nat Med, 2002. 8(9): p. 979-986.

328. Polakis, P., Wnt Signaling in Cancer. Cold Spring Harbor Perspectives in Biology, 2012. 4(5): p. a008052.

329. Polakis, P., Wnt signaling and cancer. Genes & Development, 2000. 14(15): p. 1837-1851.

330. Teo, J.L. and M. Kahn, The Wnt signaling pathway in cellular proliferation and differentiation: A tale of two coactivators. Adv Drug Deliv Rev, 2010. 62(12): p. 1149-55.

331. Addison, W.N., et al., Extracellular matrix mineralization in murine MC3T3-E1 osteoblast cultures: An ultrastructural, compositional and comparative analysis with mouse bone. Bone, 2015. 71: p. 244-256.

332. Nudelman, F., et al., The role of collagen in bone apatite formation in the presence of hydroxyapatite nucleation inhibitors. Nat Mater, 2010. 9(12): p. 1004-1009.

333. He, G., et al., Nucleation of apatite crystals in vitro by self-assembled dentin matrix protein 1. Nat Mater, 2003. 2(8): p. 552-558.

References 141

334. He, G. and A. George, Dentin Matrix Protein 1 Immobilized on Type I Collagen Fibrils Facilitates Apatite Deposition in Vitro. Journal of Biological Chemistry, 2004. 279(12): p. 11649-11656.

335. Eapen, A., et al., Calcium-mediated Stress Kinase Activation by DMP1 Promotes Osteoblast Differentiation. Journal of Biological Chemistry, 2010. 285(47): p. 36339-36351.

336. Borggrefe, T. and F. Oswald, The Notch signaling pathway: Transcriptional regulation at Notch target genes. Cellular and Molecular Life Sciences, 2009. 66(10): p. 1631-1646.

337. Murre, C., et al., Structure and function of helix-loop-helix proteins. Biochim Biophys Acta, 1994. 1218(2): p. 129-35.

338. Ohsako, S., et al., Hairy function as a DNA-binding helix-loop-helix repressor of Drosophila sensory organ formation. Genes Dev, 1994. 8(22): p. 2743-55.

339. Van Doren, M., et al., Negative regulation of proneural gene activity: hairy is a direct transcriptional repressor of achaete. Genes Dev, 1994. 8(22): p. 2729-42.

340. Fisher, A. and M. Caudy, The function of hairy-related bHLH repressor proteins in cell fate decisions. Bioessays, 1998. 20(4): p. 298-306.

341. Jennings, B.H., D.M. Tyler, and S.J. Bray, Target specificities of Drosophila enhancer of split basic helix-loop-helix proteins. Mol Cell Biol, 1999. 19(7): p. 4600-10.

342. Davis, R.L. and D.L. Turner, Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene, 2001. 20(58): p. 8342-57.

343. Iso, T., L. Kedes, and Y. Hamamori, HES and HERP families: Multiple effectors of the notch signaling pathway. Journal of Cellular Physiology, 2003. 194(3): p. 237-255.

344. Gao, F., et al., Hes1 is involved in the self-renewal and tumourigenicity of stem-like cancer cells in colon cancer. Scientific Reports, 2014. 4: p. 3963.

345. Murata, K., et al., Hes1 Directly Controls Cell Proliferation through the Transcriptional Repression of p27(Kip1). Molecular and Cellular Biology, 2005. 25(10): p. 4262-4271.

346. Kobayashi, T. and R. Kageyama, Hes1 regulates embryonic stem cell differentiation by suppressing Notch signaling. Genes to Cells, 2010. 15(7): p. 689-698.

347. Kato, T., et al., Hes1 suppresses acute myeloid leukemia development through FLT3 repression. Leukemia, 2015. 29(3): p. 576-85.

348. Chen, G., et al., A functional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development. Genes Dev, 1999. 13(17): p. 2218-30.

349. Sasai, Y., et al., Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and Enhancer of split. Genes Dev, 1992. 6(12B): p. 2620-34.

350. Kannan, S., et al., Notch/HES1-mediated PARP1 activation: a cell type–specific mechanism for tumor suppression. Blood, 2011. 117(10): p. 2891-2900.

351. Ju, B.-G., et al., Activating the PARP-1 Sensor Component of the Groucho/ TLE1 Corepressor Complex Mediates a CaMKinase IIδ-Dependent Neurogenic Gene Activation Pathway. Cell, 2004. 119(6): p. 815-829.

142 Reference

352. Mannervik, M., et al., Transcriptional Coregulators in Development. Science, 1999. 284(5414): p. 606-609.

353. Zanotti, S., A. Smerdel-Ramoya, and E. Canalis, HES1 (Hairy and Enhancer of Split 1) Is a Determinant of Bone Mass. Journal of Biological Chemistry, 2011. 286(4): p. 2648-2657.

354. Zhang, H., et al., Use of Hes1-GFP reporter mice to assess activity of the Hes1 promoter in bone cells under chronic inflammation. Bone, 2016. 90: p. 80-89.

355. Wan, Y.Y., GATA3: A master of many trades in immune regulation. Trends in immunology, 2014. 35(6): p. 233-242.

356. Taghon, T.N., et al., Delayed, asynchronous, and reversible T-lineage specification induced by Notch/Delta signaling. Genes Dev, 2005. 19(8): p. 965-78.

357. Gao, C., G. Xiao, and J. Hu, Regulation of Wnt/β-catenin signaling by posttranslational modifications. Cell & Bioscience, 2014. 4(1): p. 13.

358. Metcalfe, C. and M. Bienz, Inhibition of GSK3 by Wnt signalling – two contrasting models. Journal of Cell Science, 2011. 124(21): p. 3537-3544.

359. Endo, H., et al., Activation of the Akt/GSK3β Signaling Pathway Mediates Survival of Vulnerable Hippocampal Neurons after Transient Global Cerebral Ischemia in Rats. Journal of Cerebral Blood Flow & Metabolism, 2006. 26(12): p. 1479-1489.

360. Reis, C.R., et al., Crosstalk between Akt/GSK3β signaling and dynamin-1 regulates clathrin-mediated endocytosis. The EMBO Journal, 2015. 34(16): p. 2132-2146.

361. Li, J., et al., PTEN, a Putative Protein Tyrosine Phosphatase Gene Mutated in Human Brain, Breast, and Prostate Cancer. Science, 1997. 275(5308): p. 1943-1947.

362. Dalby, B., et al., Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications. Methods, 2004. 33(2): p. 95-103.

363. Gossen, M. and H. Bujard, Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences of the United States of America, 1992. 89(12): p. 5547-5551.

364. Conboy, I.M., et al., Notch-Mediated Restoration of Regenerative Potential to Aged Muscle. Science, 2003. 302(5650): p. 1575-1577.

365. Wu, C., C. Suzuki-Ogoh, and Y. Ohmiya, Dual-reporter assay using two secreted luciferase genes. Biotechniques, 2007. 42(3): p. 290, 292.

366. Fre, S., et al., Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proceedings of the National Academy of Sciences, 2009. 106(15): p. 6309-6314.

367. Munnamalai, V. and D.M. Fekete, Notch-Wnt-Bmp crosstalk regulates radial patterning in the mouse cochlea in a spatiotemporal manner. Development, 2016.

368. Morris, S.-A.L. and S. Huang, Crosstalk of the Wnt/β-catenin pathway with other pathways in cancer cells. Genes & Diseases, 2016. 3(1): p. 41-47.

369. Baron, R. and G. Rawadi, Targeting the Wnt/β-Catenin Pathway to Regulate Bone Formation in the Adult Skeleton. Endocrinology, 2007. 148(6): p. 2635-2643.

References 143

370. Regard, J.B., et al., Wnt Signaling in Bone Development and Disease: Making Stronger Bone with Wnts. Cold Spring Harbor Perspectives in Biology, 2012. 4(12): p. a007997.

371. Stewart, S., et al., Sequential and Opposing Activities of Wnt and BMP Coordinate Zebrafish Bone Regeneration. Cell Reports, 2014. 6(3): p. 482-498.

372. Hilton, M.J., et al., Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nat Med, 2008. 14(3): p. 306-314.

373. Tao, J., S. Chen, and B. Lee, Alteration of Notch signaling in skeletal development and disease. Annals of the New York Academy of Sciences, 2010. 1192: p. 257-268.

374. Zanotti, S. and E. Canalis, Notch and the Skeleton. Molecular and Cellular Biology, 2010. 30(4): p. 886-896.

375. Tao, J., et al., Osteosclerosis Due to Notch Gain of Function Is Solely Rbpj-dependent. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2010. 25(10): p. 2175-2183.

376. Canalis, E., et al., Notch Signaling in Osteocytes Differentially Regulates Cancellous and Cortical Bone Remodeling. Journal of Biological Chemistry, 2013. 288(35): p. 25614-25625.

377. Gade, P. and D.V. Kalvakolanu, Chromatin Immunoprecipitation Assay as a Tool for Analyzing Transcription Factor Activity. Methods in molecular biology (Clifton, N.J.), 2012. 809: p. 85-104.

378. Smith, A.J. and S.E. Humphries, Characterization of DNA-binding proteins using multiplexed competitor EMSA. J Mol Biol, 2009. 385(3): p. 714-7.

379. Panin, V.M., et al., Fringe modulates Notch-ligand interactions. Nature, 1997. 387(6636): p. 908-912.

380. Petrovic, J., et al., Ligand-dependent Notch signaling strength orchestrates lateral induction and lateral inhibition in the developing inner ear. Development, 2014. 141(11): p. 2313-2324.

381. Hein, K., et al., Site-specific methylation of Notch1 controls the amplitude and duration of the Notch1 response. Science Signaling, 2015. 8(369): p. ra30-ra30.

382. Guarani, V., et al., Acetylation-dependent regulation of endothelial Notch signalling by the SIRT1 deacetylase. Nature, 2011. 473(7346): p. 234-238.

383. Jacob, A., Y. Zhang, and A. George, Transcriptional regulation of dentin matrix protein 1 (DMP1) in odontoblasts and osteoblasts. Connective Tissue Research, 2014. 55(sup1): p. 107-112.

384. Narayanan, K., et al., Transcriptional Regulation of Dentin Matrix Protein 1 by JunB and p300 during Osteoblast Differentiation. Journal of Biological Chemistry, 2004. 279(43): p. 44294-44302.

385. Santaguida, M., et al., JunB Protects against Myeloid Malignancies by Limiting Hematopoietic Stem Cell Proliferation and Differentiation without Affecting Self-Renewal. Cancer Cell, 2009. 15(4): p. 341-352.

386. Zamurovic, N., et al., Coordinated Activation of Notch, Wnt, and Transforming Growth Factor-β Signaling Pathways in Bone Morphogenic Protein 2-induced Osteogenesis: Notch TARGET GENE Hey1 INHIBITS MINERALIZATION AND Runx2 TRANSCRIPTIONAL ACTIVITY. Journal of Biological Chemistry, 2004. 279(36): p. 37704-37715.

144 Reference

387. Neer , R.M., et al., Effect of Parathyroid Hormone (1-34) on Fractures and Bone Mineral Density in Postmenopausal Women with Osteoporosis. New England Journal of Medicine, 2001. 344(19): p. 1434-1441.

388. Robinson, J.A., et al., Wnt/β-Catenin Signaling Is a Normal Physiological Response to Mechanical Loading in Bone. Journal of Biological Chemistry, 2006. 281(42): p. 31720-31728.

389. Iwamoto, T., et al., The role of extracellular ATP-mediated purinergic signaling in bone, cartilage, and tooth tissue. Journal of Oral Biosciences, 2014. 56(4): p. 131-135.

390. Xing, Y., et al., The Roles of P2Y2 Purinergic Receptors in Osteoblasts and Mechanotransduction. PLOS ONE, 2014. 9(9): p. e108417.

391. Veno P, N.D., Sivakumar P, Kalajzic I, Rowe D, Harris SE, Bonewald L, Dallas SL., Live imaging of osteocytes within their lacunae reveals cell body and dendrite motions. Journal of Bone and Mineral Research, 2006. 21(S38).

392. Regard, J.B., et al., Wnt Signaling in Bone Development and Disease: Making Stronger Bone with Wnts. Cold Spring Harbor Perspectives in Biology, 2012. 4(12).

393. Thiery, J.P., Epithelial-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol, 2003. 15(6): p. 740-6.

394. Jakobsson, L., et al., Endothelial cells dynamically compete for the tip cell position during angiogenic sprouting. Nat Cell Biol, 2010. 12(10): p. 943-53.

395. Kornberg, T.B. and S. Roy, Cytonemes as specialized signaling filopodia. Development, 2014. 141(4): p. 729-36.

396. Khait, I., et al., Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Rep, 2016. 14(2): p. 225-33.

397. Shaya, O., et al., Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Developmental Cell, 2017. 40(5): p. 505-511.e6.

398. Townsley, F.M., A. Cliffe, and M. Bienz, Pygopus and Legless target Armadillo/[beta]-catenin to the nucleus to enable its transcriptional co-activator function. Nat Cell Biol, 2004. 6(7): p. 626-633.

399. MacDonald, B.T., K. Tamai, and X. He, Wnt/β-catenin signaling: components, mechanisms, and diseases. Developmental cell, 2009. 17(1): p. 9-26.

400. Wu, X., et al., Rac1 Activation Controls Nuclear Localization of β-catenin during Canonical Wnt Signaling. Cell, 2008. 133(2): p. 340-353.

401. Yu, X. and R.C. Malenka, Beta-catenin is critical for dendritic morphogenesis. Nat Neurosci, 2003. 6(11): p. 1169-77.

402. Rosso, S.B., et al., Wnt signaling through Dishevelled, Rac and JNK regulates dendritic development. Nat Neurosci, 2005. 8(1): p. 34-42.

403. Amit, S., et al., Axin-mediated CKI phosphorylation of β-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes & Development, 2002. 16(9): p. 1066-1076.

404. Liu, C., et al., Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell, 2002. 108(6): p. 837-47.

405. He, X., et al., LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development, 2004. 131(8): p. 1663-77.

406. Zeng, X., et al., A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature, 2005. 438(7069): p. 873-7.

References 145

407. Bek, S. and R. Kemler, Protein kinase CKII regulates the interaction of beta-catenin with alpha-catenin and its protein stability. J Cell Sci, 2002. 115(Pt 24): p. 4743-53.

408. Nelson, W.J. and R. Nusse, Convergence of Wnt, beta-catenin, and cadherin pathways. Science, 2004. 303(5663): p. 1483-7.

409. Zhang, S., et al., Inhibition of CK2α down-regulates Notch1 signalling in lung cancer cells. Journal of Cellular and Molecular Medicine, 2013. 17(7): p. 854-862.

410. Zhang, S., et al., Inhibition of CK2α Down-Regulates Hedgehog/Gli Signaling Leading to a Reduction of a Stem-Like Side Population in Human Lung Cancer Cells. PLOS ONE, 2012. 7(6): p. e38996.

411. Katoh, M., Networking of WNT, FGF, Notch, BMP, and Hedgehog signaling pathways during carcinogenesis. Stem Cell Rev, 2007. 3(1): p. 30-8.

412. Gu, G., et al., Isolated primary osteocytes express functional gap junctions in vitro. Cell and Tissue Research, 2006. 323(2): p. 263-271.

413. A., v.d.P. and N. P.J., Isolation and purification of osteocytes. Journal of Bone and Mineral Research, 1992. 7(4): p. 389-396.

414. Florian, B., et al., Human Primary Osteocyte Differentiation in a 3D Culture System. Journal of Bone and Mineral Research, 2009. 24(11): p. 1927-1935.

415. Oda, T., et al., Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat Genet, 1997. 16(3): p. 235-242.

416. Olsen, I.E., et al., Deficits in size-adjusted bone mass in children with Alagille syndrome. J Pediatr Gastroenterol Nutr, 2005. 40(1): p. 76-82.

417. Bales, C.B., et al., Pathologic lower extremity fractures in children with Alagille syndrome. J Pediatr Gastroenterol Nutr, 2010. 51(1): p. 66-70.

418. Youngstrom, D.W., et al., Jagged1 expression by osteoblast-lineage cells regulates trabecular bone mass and periosteal expansion in mice. Bone, 2016. 91: p. 64-74.

419. Lawal, R.A., et al., The Notch Ligand Jagged1 Regulates the Osteoblastic Lineage by Maintaining the Osteoprogenitor Pool. Journal of Bone and Mineral Research, 2017. 32(6): p. 1320-1331.

420. Zanotti, S. and E. Canalis, Parathyroid hormone inhibits Notch signaling in osteoblasts and osteocytes. Bone, 2017. 103: p. 159-167.

421. Shaya, O., et al., Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Dev Cell, 2017. 40(5): p. 505-511 e6.

422. Andersson, E.R. and U. Lendahl, Therapeutic modulation of Notch signalling [mdash] are we there yet? Nat Rev Drug Discov, 2014. 13(5): p. 357-378.

423. Isidor, B., et al., Truncating mutations in the last exon of NOTCH2 cause a rare skeletal disorder with osteoporosis. Nat Genet, 2011. 43(4): p. 306-308.

424. Simpson, M.A., et al., Mutations in NOTCH2 cause Hajdu-Cheney syndrome, a disorder of severe and progressive bone loss. Nat Genet, 2011. 43(4): p. 303-305.

notch sigalling pathway regulates the terminal … · 2018. 7. 25. · shao jin, zhou yinghong,...

Documents