novel inborn error of vitamin b12 metabolism caused by mutations
TRANSCRIPT
![Page 1: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/1.jpg)
Novel inborn error of vitamin B12 metabolism caused by mutations in ABCD4
Jaeseung Kim
Department of Human Genetics
McGill University
Montréal, Québec, Canada
June 2012
A thesis submitted to McGill University in partial fulfillment of the requirements
of the degree of
Master of Science
© Jaeseung Kim 2012
![Page 2: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/2.jpg)
2
ABSTRACT
Vitamin B12 (cobalamin, Cbl) is an essential cofactor for two human
enzymes: methylmalonyl-CoA mutase (MUT) and methionine synthase (MTR).
MUT utilizes 5’-deoxyadenosylcobalamin (AdoCbl) to convert methylmalonyl-
CoA to succinyl-CoA in the mitochondria, whereas MTR utilizes
methylcobalamin (MeCbl) to convert homocysteine to methionine in the
cytoplasm. To date, eight complementation groups (cblA-G and mut), each the
result of mutations at a different gene, have been discovered to be involved in the
intracellular metabolism of cobalamin. A patient presented at birth, following an
abnormal newborn screen, with hypotonia, lethargy, poor feeding and bone
marrow suppression. There were elevated levels of methylmalonic acid and
homocysteine, suggestive of a defect in vitamin B12 metabolism. Studies of
cultured fibroblast showed decreased function of the cobalamin-dependent
enzymes, MTR and MUT. There was increased uptake of labelled
cyanocobalamin (CNCbl) but decreased synthesis of the cobalamin cofactors
MeCbl and AdoCbl, with accumulation of “free” (i.e. non-protein bound) CNCbl
in the cells. The cellular phenotype mimicked that of the cblF disorder caused by
mutations in the LMBRD1 gene encoding the lysosomal membrane protein
LMBD1 that is thought to play a role in transfer of cobalamin across the
lysosomal membrane into the cytoplasm. However, cells from the patient
![Page 3: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/3.jpg)
3
complemented those from all known complementation groups, including cblF,
and no mutations in LMBRD1 were found. Whole-exome sequencing led to the
identification of two mutations in the ABCD4 gene: c.956A>G (p.Y319C) and
c.1746_1747insCT (p.E583LfsX9). Two additional patients with deleterious
ABCD4 mutations were later found. Transfection of patient fibroblasts with wild
type ABCD4 led to rescue of all abnormal cellular phenotypes. This thesis reports
that this novel disorder, named cblJ, is an autosomal recessive disorder caused by
mutations in ABCD4. The findings suggest that ABCD4, an ABC half-transporter,
is another essential component of intracellular cobalamin metabolism.
![Page 4: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/4.jpg)
4
RÉ SUME
La vitamine B12 (cobalamine, Cbl) est un cofacteur essentiel pour deux
enzymes de l'homme: la méthylmalonyl-CoA mutase (MUT) et la méthionine
synthase (MTR). La MUT utilise 5'-deoxyadenosylcobalamin (AdoCbl) pour
convertir la méthylmalonyl-CoA en succinyl-CoA dans la mitochondrie, alors que
MTR utilise la méthylcobalamine (MeCbl) pour convertir l'homocystéine en
méthionine dans le cytoplasme. À ce jour, huit groupes de complémentation
(cblA-G et mut) ont été découverts à être impliqués dans le métabolisme
intracellulaire de la cobalamine. Chacun est le résultat de mutations au niveau
d'un gène différent. Un patient s’est présenté à la naissance, suite à une anomalie
sue le dépistage nouveau-né, avec l’hypotonie, la léthargie, la mauvaise
alimentation et la suppression de la moelle osseuse. Le patient avait des niveaux
élevés d'acide méthylmalonique et d'homocystéine, suggérant un défaut dans le
métabolisme de la vitamine B12. Les études de fibroblastes cultivés ont démontré
une diminution de la fonction des enzymes dépendants sur la cobalamine, MTR et
MUT. Il avait aussi une augmentation de l’absorption de la cyanocobalamine
(CNCbl), mais une diminution de la synthèse de cofacteurs cobalamine la MeCbl
et AdoCbl, avec une accumulation de CNCbl “libre” (c'est à dire non liée aux
protéines plasmatiques) dans les cellules. Le phénotype cellulaire imitait celle de
la maladie cblF, causée par des mutations dans LMBRD1, le gène codant pour la
![Page 5: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/5.jpg)
5
protéine membrane lysosomale LMBRD1, qui semble jouer un rôle dans le
transfert de la cobalamine à travers la membrane lysosomale dans le cytoplasme.
Cependant, les cellules des deux patients complémentaient celles de tous les
groupes de complémentation connus, y compris cblF, et aucune des mutations
dans LMBRD1 ont été trouvés. Le séquençage de l’exome a mené à l'identification
de deux mutations dans le gène ABCD4: c.956A>G (p.Y319C) et
c.1746_1747insCT (p.E583LfsX9). Deux autres patients avec des mutations dans
ABCD4 ont été retrouvés. Toutes les mutations ont été prévues d’être nocives. La
transfection de fibroblastes de patients avec ABCD4 de type sauvage a conduit à
sauver tous les phénotypes cellulaires anormaux. Cette thèse rapporte que ce
trouble inédit, nommé cblJ, est une maladie autosomique récessive causée par des
mutations dans ABCD4. Les résultats suggèrent qu’ABCD4, un demi-ABC
transporteur, est un autre élément essentiel du métabolisme de la cobalamine
intracellulaire.
![Page 6: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/6.jpg)
6
TABLE OF CONTENTS
ABSTRACT .......................................................................................................... 2
RÉ SUME ............................................................................................................... 4
TABLE OF CONTENTS ..................................................................................... 6
LIST OF ABBREVIATIONS ............................................................................ 11
LIST OF FIGURES ........................................................................................... 13
LIST OF TABLES .............................................................................................. 14
ACKNOWLEDGEMENTS ............................................................................... 15
CHAPTER 1: INTRODUCTION ..................................................................... 16
1.1 Vitamin B Group ........................................................................................... 16
1.2 Vitamin B12 .................................................................................................... 16
1.2.1 Historical Aspects ......................................................................... 16
1.2.2 Structure ........................................................................................ 18
1.2.3 Biosynthesis .................................................................................. 20
1.2.4 Function ........................................................................................ 20
1.2.4.1 Cofactor for Three Enzyme Classes ............................. 20
1.2.4.2 Two Human Enzymes ................................................... 23
1.3 Absorption and Transport of Vitamin B12 ..................................................... 23
1.3.1 Carrier Proteins ............................................................................. 23
1.3.2 Absorption and Transport Pathway ............................................... 24
1.3.3 Inborn Errors of Vitamin B12 Absorption and Transport .............. 25
1.3.3.1 Haptocorrin Deficiency ................................................ 26
1.3.3.2 Inherited Intrinsic Factor Deficiency ........................... 26
1.3.3.3 Imerslund-Gräsbeck Syndrome .................................... 28
1.3.3.4 Transcobalamin Deficiency .......................................... 29
![Page 7: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/7.jpg)
7
1.3.3.5 Transcobalamin Receptor Deficiency .......................... 29
1.3.4 Related Proteins ............................................................................ 30
1.3.4.1 Megalin/LRP2 .............................................................. 30
1.3.4.2 ABCC1/MRP1 .............................................................. 31
1.4 Intracellular Metabolism of Vitamin B12 ....................................................... 32
1.4.1 The Patients ................................................................................... 32
1.4.2 Somatic Cell Complementation Analysis ..................................... 33
1.4.3 Discoveries of Eight Complementation Groups ........................... 34
1.4.3.1 Four Complementation Groups .................................... 35
1.4.3.2 A Complementation Group with Three Phenotypes ..... 36
1.4.3.3 Isolated HC with Megaloblastic Anemia ...................... 37
1.4.3.4 Failure of Lysosomal Release of Vitamin B12 .............. 38
1.4.3.5 Heterogeneity Among Patients with HC ...................... 38
1.4.4 Inborn Errors of Vitamin B12 Metabolism .................................... 39
1.4.4.1 cblF, cblC, and cblD ..................................................... 40
1.4.4.2 cblB, cblA, and mut ....................................................... 44
1.4.4.3 cblE and cblG ............................................................... 47
1.4.5 Other Causes of MMA .................................................................. 49
1.4.6 Other Causes of HC ...................................................................... 49
1.5 cblF Disease .................................................................................................. 50
1.5.1 Background on Lysosome ............................................................. 50
1.5.1.1 Role of Lysosome ......................................................... 50
1.5.1.2 Lysosomal Soluble Proteins ......................................... 51
1.5.1.3 Lysosomal Membrane Proteins .................................... 51
1.5.1.4 Disorders of Lysosomal Export .................................... 52
1.5.2 LMBRD1 Gene .............................................................................. 53
1.5.3 Pathophysiology and Treatment ................................................... 54
1.6 Undiagnosed Patients and Gaps in the Pathway ........................................... 56
![Page 8: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/8.jpg)
8
1.7 Evolution of Gene Discovery Approaches .................................................... 57
1.7.1 Limitations of Traditional Approaches ......................................... 57
1.7.2 First Applications of Exome Sequencing ..................................... 58
1.7.3 New Paradigm of Disease Gene Discovery .................................. 59
1.7.4 Exome Sequencing of Undiagnosed Patients ............................... 60
1.8 Peroxisomal ABC Half-Transporters ............................................................ 61
1.8.1 ATP-Binding Cassette Transporters .............................................. 61
1.8.2 ATP-Binding Cassette, Subfamily D ............................................ 62
1.8.3 ABCD4 Gene ................................................................................ 64
1.8.3.1 Discovery and Characterization ................................... 64
1.8.3.2 Subcellular Localization ............................................... 65
RATIONALE AND OBJECTIVES OF STUDY ............................................. 67
CHAPTER 2: MATERIALS AND METHODS .............................................. 68
2.1 Case Reports ................................................................................................. 68
2.1.1 Patient WG4066 ............................................................................ 68
2.1.2 Patient WG4140 ............................................................................ 69
2.1.3 Patient WG3630 ............................................................................ 71
2.2 Cell Culture ................................................................................................... 73
2.3 Selection of Fibroblast Cell Lines ................................................................. 74
2.4 Somatic Cell Complementation Analysis ..................................................... 76
2.5 Exome Sequencing ........................................................................................ 76
2.6 Mutation Analysis ......................................................................................... 77
2.6.1 Polymerase Chain Reaction (PCR) ............................................... 79
2.7 Immortalization of Fibroblasts with E7 and Telomerase .............................. 79
2.8 Transfection of Fibroblasts with Wild Type ABCD4 cDNA ........................ 80
2.8.1 LR Recombination Reaction ......................................................... 80
![Page 9: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/9.jpg)
9
2.8.2 Colony PCR of LR Recombinants ................................................ 80
2.8.3 Transfection .................................................................................. 81
2.9 Transfection of Fibroblasts with Wild Type LMBRD1 cDNA ..................... 82
2.9.1 Gateway Cloning .......................................................................... 82
2.9.2 BP Recombination Reaction ......................................................... 82
2.9.3 Colony PCR of BP Recombinants ................................................ 83
2.9.4 LR Recombination Reaction ......................................................... 83
2.9.5 Colony PCR of LR Recombinants ................................................ 83
2.9.6 Transfection .................................................................................. 84
2.10 Labelled MethylTHF and Propionate Incorporation Assays ....................... 84
2.11 Cobalamin Derivative Distribution Assay .................................................. 85
2.12 Superose 12 Analysis of TC-Bound, Free and Enzyme-Bound Cbl ........... 86
CHAPTER 3: RESULTS ................................................................................... 87
3.1 Identification of Three Patients ..................................................................... 87
3.2 Somatic Cell Complementation Analysis .................................................... 89
3.3 Discovery of Causative Gene in Each Patient .............................................. 92
3.3.1 Patient WG4066 ............................................................................ 92
3.3.2 Patient WG4140 ............................................................................ 95
3.3.3 Patient WG3630 ............................................................................ 95
3.4 Transfections and Assessments of Biochemical Phenotypes ........................ 97
3.4.1 Labelled MethylTHF and Propionate Incorporation Assays ........ 97
3.4.2 Cobalamin Derivative Distribution Assay .................................. 101
3.4.3 Superose 12 Analysis .................................................................. 104
CHAPTER 4: DISCUSSION .......................................................................... 108
4.1 Novel Inborn Error of Vitamin B12 Metabolism ......................................... 108
4.2 Role of ABCD4 in Vitamin B12 Metabolism ............................................... 113
![Page 10: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/10.jpg)
10
ORIGINAL CONTRIBUTIONS TO SCIENCE ........................................... 116
BIBLIOGRAPHY ............................................................................................ 117
APPENDIX A: List of Publications and Presentations ................................ 132
APPENDIX B: Published Abstract ................................................................ 134
![Page 11: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/11.jpg)
11
LIST OF ABBREVIATIONS
ABC transporter: ATP-binding cassette transporter
ABCD4: ATP-binding cassette, subfamily D, member 4
ABCX#: ATP-binding cassette, subfamily X, member # (nomenclature)
AdoCbl: 5’-deoxyadenosylcobalamin
BME: β-mercaptoethanol
Cbl: cobalamin
CBS: cystathionine β-synthase
cDNA: complementary DNA
CNCbl: cyanocobalamin
DMB: 5,6-dimethylbenzimidazole
DTT: dithiothreitol
E. coli: Escherichia coli
Enzyme-Cbl: MUT or MTR-bound cobalamin
ER: endoplasmic reticulum
FAD: flavin adenine dinucleotide
FMN: flavin mononucleotide
GWAS: genome-wide association studies
HC: homocystinuria
HgB: hemoglobin
IF: intrinsic factor
IGS: Imerslund-Gräsbeck syndrome
LIMR: lipocalin-1 interacting membrane receptor
LMBD1: LMBR1 domain-containing protein 1
LMBR: limb region 1
LMP: lysosomal membrane protein
LRP2: low-density lipoprotein receptor-related protein 2
![Page 12: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/12.jpg)
12
MCV: mean corpuscular volume
MeCbl: methylcobalamin
Met: methionine
MMA: methylmalonic aciduria
MMAA: methylmalonic aciduria cblA type
MMAB: methylmalonic aciduria cblB type
MMACHC: methylmalonic aciduria cblC type, with homocystinuria
MMADHC: methylmalonic aciduria cblD type, with homocystinuria
MRP1: multidrug resistance-associated protein 1
M6P: mannose-6-phosphate
MTHFD1: methylenetetrahydrofolate dehydrogenase 1
MTHFR: 5,10-methylenetetrahydrofolate reductase
MTR: methionine synthase
MTRR: methionine synthase reductase
MUT: methylmalonyl-CoA mutase
MW: molecular weight
NBD: nucleotide-binding domain
OHCbl: hydroxocobalamin
PA: pernicious anemia
PEG: polyethylene glycol 1000
RT-PCR: reverse transcription polymerase chain reaction
SNP: single-nucleotide polymorphisms
TC: transcobalamin
TCblR: transcobalamin receptor
THF: tetrahydrofolate
TMD: transmembrane domain
VLCFA: very long chain fatty acids
![Page 13: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/13.jpg)
13
LIST OF FIGURES
Figure 1. Structure of vitamin B12 ........................................................................ 19
Figure 2. Vitamin B12 metabolism ....................................................................... 41
Figure 3. Putative membrane topology of the LMBD1 protein ........................... 55
Figure 4. Putative membrane topology of an ABC, Subfamily D transporter ..... 63
Figure 5. Protein sequence identity and similarity among ABCD proteins ......... 66
Figure 6. DNA sequencing chromatograms of heterozygous mutations in TPRG1,
LRP2, and ABCD4 in the family of WG4066 ...................................................... 93
Figure 7. (A) Pedigree of the family of WG3630 showing plasma homocysteine
levels and genotypes (B) DNA sequencing chromatograms of the ABCD4
c.423C>G (p.N141K) mutation ........................................................................... 96
Figure 8. Cobalamin derivative distributions of 18 cell lines ............................ 103
Figure 9. Elution patterns of Superose 12 analyses ........................................... 106
Figure 10. Superose 12 analyses of 18 cell lines ............................................... 107
![Page 14: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/14.jpg)
14
LIST OF TABLES
Table 1. Fibroblast cell lines used in this study ................................................... 75
Table 2. Primers used in this study ....................................................................... 78
Table 3. Biochemical profiles of three patient fibroblasts ................................... 88
Table 4. Somatic cell complementation of WG4066 ........................................... 90
Table 5. Somatic cell complementation of WG4140 ........................................... 91
Table 6. Segregation analysis of TPRG1, LRP2 and ABCD4 mutations in the
family of WG4066 ............................................................................................... 94
Table 7. Labelled methylTHF incorporations of 24 cell lines ............................. 99
Table 8. Labelled propionate incorporations of 24 cell lines ............................. 100
![Page 15: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/15.jpg)
15
ACKNOWLEDGEMENTS
I express my greatest gratitude to Dr. David Rosenblatt, my research
supervisor. I thank him for allowing me to take on an excellent scientific project,
guiding me through it, and making the experience enjoyable and memorable. He
is an inspiring scientist and a pioneer and I will remember his lessons when I
delve into new areas of science in the future.
I cannot thank Dr. David Watkins enough for mentoring me, editing my
writings, and troubleshooting with me through all my experimental hurdles. I
always knew who to ask when I accidently skipped a step in an experiment or
needed a reagent we did not have.
I am thankful to Drs. Eric Shoubridge and Jacek Majewski for their
guidance and scientific input as supervisory committee members. I also thank
Gail Dunbar for teaching me how to grow and maintain cell cultures, and Thomas
Leslie and Kandace Springer of the HG office for their efforts to answer all my
inquiries and aid me in every way possible.
And I appreciate all the members and collaborators of our laboratory for
being great friends and helping me with any problems: Laura Dempsey-Nunez,
Peg Illson, Alison Brebner, Maria Plesa, Wayne Mah, Stephen Fung, Laura
Benner, Isabelle Miousse, Justin Deme, Jackie Chung, Ross Mackay, and summer
students Francis, Selim, Tracy, Dylan, and Kush. Especially, I will remember
Laura and Peg for the time we shared, lattes we consumed, and random matters
we contemplated on.
Lastly, I am grateful to my family and friends for showing me their
support and faith over the past two years of my graduate studies. They wished for
my success and cheered for my accomplishments. I will treasure the special
relationship I have with each and every one of them.
Due to the collaborative nature of this project, the following
acknowledgement is given to important contributors. Patient WG4066 was
referred to our laboratory by Dr. Nicola Longo, WG4140 by Dr. Brian Fowler, and
WG3630 by Dr. Ni-Chung Lee. Somatic cell complementation was performed by
Jocelyne Lavallée of the Rosenblatt Laboratory. Exome capture sequencings of
WG4066 and WG3630 were performed in collaboration with the laboratory of Dr.
Jacek Majewski. Exome capture sequencing and Sanger sequencings of patient
WG4140 were performed by the research team led by Dr. Brian Fowler and Dr.
Matthias Baumgartner. Immortalization and transfection of fibroblasts were
performed by Timothy Johns and Stephen Fung, respectively, of the Eric
Shoubridge Laboratory. The success of this project would not have been possible
without their amazing work.
![Page 16: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/16.jpg)
16
CHAPTER 1: INTRODUCTION
1.1 Vitamin B Group
Vitamins are essential human nutrients and are comprised of a broad range
of organic compounds. Since human cells are not equipped with de novo
pathways for their syntheses, vitamins must be exogenously obtained through diet
or supplements to sustain health.1 The vitamin B group, once thought of as a
single vitamin, is now a name for a group of eight chemically distinct, water-
soluble organic compounds: thiamin (B1), riboflavin (B2), niacin (B3), pantothenic
acid (B5), pyridoxine (B6), biotin (B7), folic acid (B9), and cobalamin (B12).1 Once
absorbed, the vitamins must be assimilated into their active forms via enzymes
present in the body to perform various functions. For example, riboflavin is
converted into flavin mononucleotide (FMN) or flavin adenine dinucleotide
(FAD), which are electron carriers in redox reactions, such as those in the
oxidative phosphorylation pathway.2
1.2 Vitamin B12
1.2.1 Historical Aspects
The discovery of vitamin B12 in human physiology has special and
specific ties with pernicious anemia (PA). The disease is a type of megaloblastic
anemia and presents with low blood cell count, low hemoglobin concentration,
![Page 17: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/17.jpg)
17
hypochlorhydria, and neuropathy, such as spinal cord degeneration in later
stages.3 It was considered “pernicious” when its etiology was not understood and
no treatments were available to prevent its certain fatality. Although the
importance of diet in patients was argued occasionally, the first dietary therapy
was conceived only when Minot and Murphy discovered the curative effect of a
special diet containing cooked liver.4 However, they were incorrect in implying
that the diet rich in complete proteins and iron was improving patients’ health.
Subsequent studies led to the isolation and purification of the anti-pernicious
anemia factor from liver extracts and demonstrated a very high biological activity
in treatment of PA.5, 6
It was confirmed to be the same material as the LLD factor,
which was necessary for growth of Lactobacillus lactis Dorner and was postulated
to be the active compound in liver extracts used for treating PA.7 This compound
was then properly named vitamin B12 to indicate its nutritional significance.6 This
new B group vitamin was thoroughly studied and was revealed to function as a
cofactor for numerous metabolic enzymes in bacteria and two enzymes in human,
which will be further described in Section 1.2.4.8 The complete pathophysiology
of PA has later been elucidated to be the destruction of stomach parietal cells by
autoimmune antibodies and ensuing abolishment of intrinsic factor production and
vitamin B12 absorption.3 Current treatment for PA varies among countries but the
recommendation is daily intramuscular injection of 5 mg of cyanocobalamin
(CNCbl) for 5 days followed by intramuscular injection of 5 mg of CNCbl every
![Page 18: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/18.jpg)
18
3 months to maintain vitamin B12 storage.3 Oral administration of cobalamin is
recommended in certain countries.
1.2.2 Structure
The complete three-dimensional structure of vitamin B12 was solved by
X-ray crystallography technique in 1956.9 Vitamin B12, also termed cobalamin
(Cbl) for the presence of a central cobalt ion, is an organometallic cofactor and
one of the largest and most structurally complex cofactors in nature.1 The central
cobalt is supported by six coordination sites, four of which are provided by
nitrogen ligands of a planar corrin ring (Figure 1).10
5,6-dimethylbenzimidazole
(DMB) is the lower axial ligand appended to a side chain of the corrin ring and
provides the fifth coordination site to the cobalt ion. Protonation of DMB detaches
it from cobalt and the cobalamin switches from “base-on” to “base-off” state.
On the other hand, the upper axial ligand, which serves as the sixth
coordination site, is diverse in its properties and can be a hydroxyl, cyano, 5’-
deoxyadenosyl or methyl group. As a result, cobalamin can exist as four major
derivatives depending on the upper axial ligand. The oxidation state of cobalt
atom ranges from +1 to +3, and the preferred number of coordinates around it
increases correspondingly from four to six (1). Cobalamin derivatives are
metabolized into methylcobalamin (MeCbl) or 5’-deoxyadenosylcobalamin
(AdoCbl) to become active cofactors in human cells (19).
![Page 19: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/19.jpg)
19
Figure 1. Structure of vitamin B12. Six coordination sites around the cobalt atom
can be envisioned as six vertices of an octahedron. Four coordinates are provided
by nitrogen atoms of pyrrole-like rings of the corrin ring, the lower axial ligand by
the DMB moiety, and the upper axial ligand by various chemical groups,
represented by R. Depending on the chemical nature of the R group, the vitamin
B12 molecule can exist as four cobalamin derivatives, cob(II)alamin, or
cob(I)alamin. Adapted from Motwani et al, 2011.
![Page 20: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/20.jpg)
20
1.2.3 Biosynthesis
Human cells are not equipped with enzymatic pathways for the de novo
synthesis of corrinoids, which refers to corrin-containing compounds and includes
cobalamin.11
As a result, cobalamin is an essential nutrient that must be obtained
exogenously through supplements or animal products in the diet to sustain human
health.12
The ability to produce cobalamin is restricted to bacteria and archaea.
Synthesis of cobalamin from uroporphyrinogen III, the precursor molecule, is a
multi-step process requiring actions of more than 30 enzymes and encompassing
the synthesis of corrin ring, incorporation of cobalt ion, and synthesis of DMB
moiety.13
Interestingly, not all bacteria can produce cobalamin and not all bacteria
require cobalamin for survival. For example, the Gram-negative bacterium,
Escherichia coli (E. coli), depends on cobalamin but has lost the genes to produce
it during evolution; in order to survive, it must scavenge the cobalamin from the
environment and transport it across the outer and inner membranes into the
cytoplasm.13
1.2.4 Function
1.2.4.1 Cofactor for Three Enzyme Classes
Three classes of enzymes, methyltransferases, isomerases, and reductive
dehalogenases, require cobalamin as a cofactor and exploit its unique chemistry in
![Page 21: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/21.jpg)
21
various ways.8 The organometallic bond (Co-C bond) between central cobalt ion
and carbon atom in the methyl or adenosyl group has a weak bond disassociation
energy of ~39 kcal/mol or ~31 kcal/mol, respectively, which can break by
heterolysis or homolysis to create a methyl cation or a free radical, respectively.14
Methyltransferases transfer a methyl group from a methyl donor (X) to a
methyl acceptor (Y), as shown by a generalized chemical equation, Y- + CH3-X
→ CH3-Y + X-.8 Methanol, methyl amines and methyltetrahydrofolate are
exemplary methyl group donors and compounds such as homocysteine and
coenzyme M are possible methyl group acceptors. Because cobalamin-dependent
methyltransferases utilize MeCbl as a methyl carrier, the reaction is divided into
two half reactions; first the methyl group is transferred from the donor to
cob(I)alamin, and second, the methyl group is transferred from MeCbl to the
acceptor. For that reason, a methyltransferase must have the capacity to bind its
substrate, cobalamin, and methyl donor(s).8
Isomerases form a large subfamily of cobalamin-dependent enzymes.
These enzymes catalyze 1,2-rearrangements involving carbon, nitrogen, or
oxygen in various types of substrates; the common characteristic of these
isomerases is that they exploit the deoxyadenosyl radical formed by homolysis of
the labile Co-C bond in AdoCbl.8 Some of the cobalamin-dependent isomerases
are methylmalonyl-CoA mutase, glutamate mutase, ethanolamine ammonia lyase,
β-lysine 5,6-aminomutase, diol dehydrase, glycerol dehydratase, and
![Page 22: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/22.jpg)
22
ribonucleotide reductase. The general reaction mechanism involves, in the
following order, homolysis of AdoCbl, abstraction of a hydrogen atom from
substrate by deoxyadenosyl radical, 1,2-rearrangement, and abstraction of a
hydrogen atom by the intermediate substrate radical.8 For example, the glutamate
mutase catalyzes the isomerization of L-glutamate to and from L-threo-3-
methylaspartate.15
In fact, the glutamate mutase was the first enzyme discovered
to be dependent on vitamin B12 as a coenzyme.
Reductive dehalogenases dependent on cobalamin and iron-sulfur clusters
have been discovered in anaerobic microbes. These enzymes, although absent in
humans, are found in around 20 strains of bacteria and serve to remove halogen
atoms from polyhalogenated compounds; some strains have been shown to link
dehalogenation reaction with the electron transport pathway for anaerobic
respiration.8 Each dehalogenase can catalyze dehalogenation of a specific group
of substrates and has a preference toward which position on the chemicals it
removes a halogen atom from. For instance, Desulfitobacterium chlororespirans
contains the 3-chloro-4-hydroxybenzoate dehalogenase which removes a chlorine
located ortho to a hydroxyl group.16
The mechanism of action and the cobalamin
forms used by the dehalogenases are yet unclear. In Dehalospirillum multivorans,
the tetrachloroethene reductive dehalogenase was found to use a novel
norpseudovitamin B12 as its cofactor.17
![Page 23: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/23.jpg)
23
1.2.4.2 Two Human Enzymes
In human, cobalamin is required for the activity of two intracellular
enzymes: methionine synthase, which is also termed 5-methyltetrahydrofolate-
homocysteine methyltransferase (MTR), and methylmalonyl-CoA mutase
(MUT).18
MeCbl is used as a single-carbon carrier in the transfer of a methyl
group from 5-methyltetrahydrofolate (5-methylTHF) to homocysteine to
synthesize methionine in the cytoplasm. This is an important reaction controlling
levels of several metabolites.19
On the other hand, AdoCbl acts as a radical
intermediate for the isomerization of L-methylmalonyl-CoA to succinyl-CoA in
the mitochondria.18
This reaction is required for the complete metabolism of odd-
numbered chain fatty acids and branched-chain amino acid and feeding succinyl-
CoA into the Krebs cycle. It is notable that approximately 95% of intracellular
cobalamins are bound to MTR in the cytosol or MUT in the mitochondria to form
holoenzymes.18, 20
Defects in MTR or MUT enzymes or deficiencies in the
metabolism of Cbl affecting synthesis of MeCbl or AdoCbl can lead to the
accumulation of precursor molecules in these enzymatic reactions, namely
homocysteine and methylmalonyl-CoA.21
1.3 Absorption and Transport of Vitamin B12
1.3.1 Carrier Proteins
Cobalamin molecules depend heavily on cobalamin-binding carrier
![Page 24: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/24.jpg)
24
proteins for three main reasons; first, cobalamin intermediates are highly reactive
and labile, so they must be protected from the aqueous environment; second,
cobalamin, due to its large size, cannot cross the plasma membrane independently
and requires carrier proteins to shuttle it via receptor-mediated endocytosis; and
third, carrier proteins provide an efficient means of delivery for cobalamins which
exist in low concentrations in the environment and in the body. Three carrier
proteins in human are haptocorrin, intrinsic factor (IF), and transcobalamin
(TC).18
Given the similarity of genomic structures of the three genes, it was
proposed that they were created by duplication events of an ancestral gene during
evolution. IF diverged from a duplicate of TC, and haptocorrin then diverged from
a duplicate of IF. The cobalamin-binding domain is relatively conserved among
the three proteins while receptor binding specificity has differentiated.22
After
much ambiguity on the genetic basis of the three carriers, it has been determined
that haptocorrin is encoded by TCN1, IF is encoded by GIF, and TC is encoded by
TCN2.18
1.3.2 Absorption and Transport Pathway
In the mouth, cobalamin binds to haptocorrin, a salivary glycoprotein,
once it is freed from other food components. Cobalamin is in complex with
haptocorrin in the mouth and stomach until the glycoprotein is degraded by
pancreatic proteases in the acidic environment of the small intestine. Then,
![Page 25: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/25.jpg)
25
cobalamin binds to IF, which is secreted by gastric parietal cells that also produce
HCl-containing gastric acid. Absorption of IF-Cbl complex at the distal ileum is
mediated by a membrane receptor termed cubam, which is a heterodimer of
cubilin and amnionless proteins. Inside the enterocyte, IF is degraded and
cobalamin finally binds to TC and is released into the blood plasma.18, 23
Approximately 20% of circulating cobalamin, which are bound to TC, represents
functional cobalamin while the remaining 80%, bound to haptocorrin, is not
known to have a clear function.24
The transcobalamin receptor (TCblR) is
specialized to sequester the TC-Cbl complex into most cell types in the body;
attachment of TC-Cbl complex triggers a receptor-mediated endocytosis of the
supercomplex, and here on starts the intracellular metabolism of cobalamin.25
Inside the somatic cells, an adequate level of cobalamin is required for the normal
activities of cobalamin-dependent enzymes.
1.3.3 Inborn Errors of Vitamin B12 Absorption and Transport
Defects in aforementioned proteins result in decreased absorption of
vitamin B12 by the human body as illustrated by pernicious anemia, which is
caused by a decrease in production and secretion of IF into the stomach. Inherited
cobalamin malabsorption disorders can be caused by germline mutations in genes
encoding haptocorrin, IF, cubam, TC, and TCblR and are inherited in autosomal
recessive manner. They are individually described below.
![Page 26: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/26.jpg)
26
1.3.3.1 Haptocorrin Deficiency
Haptocorrin is a cobalamin-binding protein and has previously been
known as TCI, TCIII, cobalophilin, R-binder, and salivary binder.24
Since the
cloning and mapping of the TCN1 gene, the field has started to consistently refer
to its 433-amino acid gene product as haptocorrin.26, 27
Other than the fact that
80% of circulating cobalamin is bound to haptocorrin, its function and role in
pathophysiology is not known.24
Low level of serum cobalamin has been
associated with haptocorrin deficiency in a single study.28
Two mutations,
c.270delG and c.315C>T, have been identified in three families and severe or
mild haptocorrin deficiency was linked to compound heterozygous or
heterozygous genotypes of patients, respectively.29
It must be emphasized that
haptocorrin deficiency is not definitively proven to cause any clinical
manifestations in patients. Absence of clinical outcomes in patients will extend
the hypothesis that normal level of TC-Cbl is necessary and sufficient for the
uptake of cobalamin by cells.18
1.3.3.2 Inherited Intrinsic Factor Deficiency
The gastric intrinsic factor is encoded by the GIF gene and specifically
produced by the parietal cells. IF is a 417-amino acid long protein and it is
essential for carrying cobalamin and binding the cubam receptor to trigger
endocytosis into enterocytes of the ileum.30
The rare, inherited IF deficiency is
![Page 27: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/27.jpg)
27
caused by mutations in the GIF gene, such as the c.183_186delGAAT founder
mutation.31
Mutations may abolish the production of IF, decrease its affinity for
cobalamin, decrease its affinity for cubam, or increase susceptibility to
proteolysis.32, 33
Symptoms present between age of 1 to 5 years in affected patients
and include megaloblastic anemia, developmental delay, decreased serum
cobalamin level, and mild methylmalonic aciduria (MMA) and homocystinuria
(HC).18
Inherited IF deficiency is unlike pernicious anemia in that the physiology
of parietal cells is normal and autoimmune antibodies targeting those cells are not
detected. In the past, the Schilling test was used to measure intestinal absorption
of radiolabelled cobalamin; oral administration of labelled cobalamin is followed
by intramuscular injection of a large quantity of unlabelled cobalamin to flush the
radiolabel into the urine. Patients with inherited IF deficiency show decreased
excretion of radiolabel in the urine compared to reference subjects because
cobalamin is not absorbed into the blood and filtered by the kidneys.32, 33
The test
can be repeated with the addition of an exogenous source of IF to observe an
increase in the absorption of radiolabelled cobalamin. An effective medical
treatment involves intramuscular injection of hydroxocobalamin (OHCbl) or
CNCbl to bypass the gastric cobalamin absorption until internal storage is restored
and then lower doses to maintain blood cobalamin at an appropriate level.18
![Page 28: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/28.jpg)
28
1.3.3.3 Imerslund-Gräsbeck Syndrome
Imerslund-Gräsbeck syndrome (IGS) is a disorder of defective transport
of IF-Cbl complex by enterocytes. IGS is a more common form of cobalamin
malabsorption than IF deficiency and is genetically heterogeneous as it can be
caused by mutations in CUBN and AMN.34, 35
The CUBN and AMN genes encode
cubilin and amnionless, respectively, and heterodimerization leads to the
formation of cubam, which is an enterocytic receptor for IF-Cbl. Cubilin is a very
large membrane protein of 460 kDa that is responsible for binding cobalamin
while amnionless is a smaller membrane protein of 45-50 kDa that is responsible
for trafficking of cubilin and anchoring it to the enterocyte membrane.36
The
disease has primarily been studied from Finnish and Norwegian families and its
prominent symptoms are megaloblastic anemia, low serum vitamin B12 level, and
proteinuria possibly due to decreased cubilin-mediated uptake of albumin.36, 37
A
high prevalence of the IGS in the Scandinavia has been attributed to founder
effects of mutations in the two genes.38
Previously, IGS was distinguished from
inherited IF deficiency based on Schilling test which was negative even with the
addition of an exogenous source of IF. Since this test has been discontinued from
the medical practice, mutation screening is the most accurate method of molecular
diagnosis for patients with hereditary cobalamin malabsorption.39
Nonetheless, it
has been noted that screening for mutations in CUBN and AMN is not an easy task
because CUBN has 67 exons and AMN has a very high GC-content.40
![Page 29: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/29.jpg)
29
1.3.3.4 Transcobalamin Deficiency
Transcobalamin is a 43 kDa plasma protein encoded by the TCN2 gene.41
TC-bound cobalamin account for only ~20% of the serum cobalamin but this
represents the functional subgroup that can be taken up by most cell types in the
body.42
Patients with the TC deficiency therefore do not show a noticeable
decrease in serum cobalamin level; however, they present with megaloblastic
anemia, failure to thrive, vomiting, and weakness within the first few months of
life.18
Mainly protein truncating mutations, such as frameshifting
insertions/deletions, nonsense mutations, and splice site mutations, have been
identified in the TCN2 gene.43
These mutations either decrease the synthesis of TC
protein or disrupt the ability of mutant TC to bind cobalamin.42
1.3.3.5 Transcobalamin Receptor Deficiency
The transcobalamin receptor is encoded by the CD320 gene which
translates into a native protein of 282 amino acids.25
TCblR is heavily
glycosylated and cleavage of the putative N-terminal signal peptide leaves a 252-
amino acid long plasma membrane protein. It is composed of an extracellular
domain of 199 amino acids, which contains two LDL-receptor class A domains, a
transmembrane region of 21 amino acids, and a cytoplasmic domain of 32 amino
acids.25
Six patients were positive for elevated MMA on newborn screening test
and were referred to medical genetics laboratories. The c.262_264delGAG
![Page 30: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/30.jpg)
30
mutation on a common haplotype was identified in 10 mutant alleles and the
c.297delA mutation was identified in the other two alleles.44, 45
Cultured
fibroblasts indicated diminished uptake of TC-Cbl complex as expected. Whether
CD320 mutations can lead to severe disease outcomes must be determined by
follow-up studies on the reported patients who were at the time asymptomatic.
1.3.4 Related Proteins
There are two important human proteins that are neither directly involved
in the assimilation of cobalamin for utilization nor involved in the intracellular
metabolism of cobalamin. Megalin is a multi-ligand binding receptor mainly
responsible for reabsorption of filtered TC-Cbl complex in the kidney,46
and
ABCC1 is an ABC transporter responsible for efflux of cobalamin across the
basolateral membrane of intestinal epithelial cells among others.47
Presumably,
both proteins function to maintain the homeostasis of cobalamin distribution.
1.3.4.1 Megalin/LRP2
Megalin/low-density lipoprotein receptor-related protein 2 (LRP2),
located mainly on the apical surface of intestinal and renal epithelia, is a multi-
ligand binding receptor and can take up various ligands, such as lipoproteins,
sterols, vitamin-binding proteins and hormones.48
The TC-Cbl complex, among
other proteins, filters through the kidney glomeruli and ends up in the ultrafiltrate,
![Page 31: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/31.jpg)
31
and megalin is crucial in reabsorbing the complex at the apical brush border of
proximal tubule.46
Mutations in the LRP2 gene have been identified to cause the
Donnai-Barrow and Facio-oculo-acoustico-renal syndrome.48
Clinical phenotypes
common to majority of the patients are agenesis of corpus callosum, congenital
diaphragmatic hernia, proteinuria, facial dysmorphology, ocular anomalies,
sensorineural hearing loss, and developmental delay.49
Since these patients do not
have elevated MMA or HC, megalin does not seem to have a critical impact on
the cobalamin metabolism in the body.
1.3.4.2 ABCC1/MRP1
Recently, an ABC transporter named, ATP-binding cassette, subfamily C,
member 1 (ABCC1)/multidrug resistance-associated protein 1 (MRP1), was
identified as the exporter of cobalamin from the cells.50
As its name suggests,
ABCC1 was initially discovered as a drug efflux pump in a multidrug-resistant
lung cancer cell line,51
and has been shown to confer resistance to anthracyclines,
Vinca alkaloids, epipodophyllotoxins, and heavy metal oxyanions.52
While
searching for a potential ABC transporter responsible for cellular efflux of free
cobalamin, Beedholm-Ebsen et al. observed 50% reduction of cobalamin efflux in
human HELA cells by siRNA-mediated knockdown of ABCC1 mRNA.47
In
Mrp1(−/−)
mice, a disturbance in the cobalamin homeostasis was observed;
cobalamin levels were decreased in the plasma, liver, and kidney and increased in
![Page 32: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/32.jpg)
32
the ileum and colon. It was thus hypothesized that ABCC1 governs the
distribution of cobalamin throughout the body and is particularly necessary for the
release of cobalamin across the basolateral membrane of polarized ileum
enterocytes.47
After that study, a cohort of 18 unrelated patients and mothers of 2
additional patients, who were presumed to have hereditary cobalamin
malabsorption but carried no mutations in AMN, CUBN, or GIF, was screened for
sequence changes in the ABCC1 gene.53
A total of 27 changes were detected but
none were deemed deleterious; 4 intronic insertions/deletions, 2 missense, 6 silent,
and 15 intronic single-nucleotide polymorphisms (SNPs). Even the 2 missense
mutations, creating p.G671V and p.R723Q substitutions, were reported as
naturally-occurring SNPs in the population. As a result, it still remains to be seen
whether mutations in ABCC1 can lead to a human disease. Given the difference
between men and mice, it is possible that ABCC1 mutations manifest with
phenotypes different from those seen in mice and/or different from other inborn
errors of cobalamin absorption.
1.4 Intracellular Metabolism of Vitamin B12
1.4.1 The Patients
Early biochemical studies on the function of vitamin B12 led to the
discovery of many cobalamin-dependent enzymes in microbes and mammals.54
![Page 33: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/33.jpg)
33
Although it was then known that the human MTR and MUT enzymes depend on
two forms of cobalamin, it was in 1967 that Oberholzer et al. reported the first
patient with inborn error of metabolism leading to methylmalonic aciduria.55
It
was soon followed by more reports of methylmalonic aciduria in children without
vitamin B12 deficiency; in these children, methylmalonate excretion could be
lowered by parenteral administration of vitamin B12.56, 57
Patients were often
diagnosed early in life and symptoms included failure to thrive, lethargy,
hypotonia, vomiting, and severe acidosis.20
Subsequently, enzymatic studies on intact fibroblasts and cell-free liver
extracts revealed the existence of vitamin B12-responsive and vitamin B12-
unresponsive patients, and it was speculated that the former has a defect in
metabolizing or synthesizing AdoCbl while the latter has a defect in the MUT
apoenzyme.58, 59
As the number of patient reports increased, so did our
understanding of the biology of vitamin B12 in humans.
1.4.2 Somatic Cell Complementation Analysis
Because most patients present at an early age and are born to unaffected
parents, the inborn errors of vitamin B12 metabolism are genetic diseases with
autosomal recessive mode of inheritance.55
One functional copy of a gene,
mutated in patients with a recessive disorder, is enough to produce a normal
phenotype, as seen in heterozygous carriers.
![Page 34: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/34.jpg)
34
Somatic cell complementation has been an essential technique in
assigning patient cell lines into specific complementation groups. In this
experiment, two cell lines with defects in cobalamin metabolism are fused
together by exposure to Sendai virus or polyethylene glycol to create
heterokaryons, which are multinucleated cells carrying the genetic materials of
both cell lines.60, 61
Heterokaryons are then assessed by in vitro measurements of
MTR and MUT functions to observe whether the original cells’ biochemical
phenotypes can be rescued or not. If restoration does not occur, they have
mutations at the identical genetic locus and are assigned to the same
complementation group. If restoration occurs, then they harbour distinct genetic
defects and are assigned to two different complementation groups.18
1.4.3 Discoveries of Eight Complementation Groups
Prior to the present study, eight complementation groups, cblA-cblG and
mut, have been discovered in the intracellular metabolism of cobalamin.23
This
thesis reports the description of patients with a novel inborn error of cobalamin
metabolism, the designation of a new complementation group, and the
identification of the responsible gene. Thus, I will describe the discoveries of
eight complementation groups in the following subsections, and then provide the
genetic and functional information pertinent to each gene in Section 1.4.4.
![Page 35: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/35.jpg)
35
1.4.3.1 Four Complementation Groups
First inborn errors of vitamin B12 metabolism were described from
patients with MMA due to decreased activity of the MUT enzyme. When a patient
with MMA, HC, and cystathioninemia was reported, it was deduced that the
patient’s metabolic block was located before the cobalamin metabolism branches
into AdoCbl synthesis and MeCbl synthesis, leading to decreased activities of
both MUT and MTR.62, 63
While the patients shared MMA as a common
phenotype, patient cell lines could be biochemically differentiated into four
groups: mut mutants produced defective MUT apoenzyme; cblA mutants failed to
synthesize AdoCbl in intact fibroblasts but had normal synthesis in crude cell
extracts; cblB mutants failed to synthesize AdoCbl in both intact fibroblasts and
crude cell extracts; cblC mutants failed to synthesize both AdoCbl and MeCbl.64
Genetic heterogeneity was confirmed by somatic cell complementation
experiments which demonstrated enhancement of MUT enzyme function, as
shown by [14
C]-labelled propionate incorporation, when cells from different
groups were fused together (see Section 2.4). As a consequence, the existence of
four distinct gene loci was proposed.61
Additionally, the mut defect was subdivided into two categories; muto
mutants had undetectable enzyme activity (~0.1%) and were refractory to
increasing doses of OHCbl, and mut− mutants had detectable residual enzyme
activity (0.5-50%), decreased binding affinity to AdoCbl, and displayed dose-
![Page 36: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/36.jpg)
36
dependent responsiveness to OHCbl.65, 66
1.4.3.2 A Complementation Group with Three Phenotypes
Two patients, who were two brothers in a sibship of seven, were reported
to have both MMA and HC.67
This biochemical phenotype was comparable to
cblC but dissimilar from cblA, cblB, or mut due to the presence of HC. They were
not included in the previous study that classified the initial four complementation
groups. Later, during an endeavour by Rosenberg et al. to confirm and assign 21
new patients into the four complementation groups, they observed that cell lines
from the two brothers complemented with cells from all four complementation
groups. Accordingly, they were assigned into a new group, cblD.68
A puzzling situation arose when a patient, initially suspected of the cblA
defect, was found to complement with 28 cblA lines.60, 69
The answer came when
three patients, classified as cblD by somatic cell complementation, presented with
two biochemical phenotypes that were different from the original description; two
patients presented with isolated HC and one patient presented with isolated MMA.
These subgroups were then designated as cblD-variant 1/cblD-HC and cblD-
variant 2/cblD-MMA, respectively.70
The classic cblD first identified in the
sibship has been referred to as cblD-combined or cblD-MMA/HC in later reports.
![Page 37: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/37.jpg)
37
1.4.3.3 Isolated HC with Megaloblastic Anemia
Since the early discoveries of patients with inborn errors of cobalamin
metabolism, it was presumed that there may be patients with HC, but not MMA,
due to a specific deficiency in the synthesis of MeCbl or activity of MTR
apoenzyme.71
The first case of isolated HC was eventually identified when an
infant was described with severe developmental delay, megaloblastic anemia, and
HC. The patient, whose defect was designated cblE, showed no elevation of
methylmalonic acid or deficiency of folate and cobalamin, and he was responsive
to injections of OHCbl but not to folate.72
From the observation that MeCbl
synthesis and 14
C-labelled 5-methylTHF incorporation were decreased in intact
fibroblasts but methionine synthase activity was normal in crude cell extracts, the
authors inferred that the defect was in intracellular cobalamin metabolism to
synthesize MeCbl. It was noted that β-mercaptoethanol (BME), a reducing agent,
in the reaction mixture might have obscured the findings since the reduction of
cob(III)alamin to cob(I)alamin as a prerequisite to MeCbl synthesis had been well
documented.72
Interestingly, when methionine synthase activity was measured without
BME, the patient’s cell extract showed significantly lower enzyme activity than
the control.73
The MTR activity could be increased by adding increasing
concentrations of dithiothreitol (DTT), another reducing agent, into the reaction
mixture. Therefore, it was postulated that cblE is a defect in a reduction step
![Page 38: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/38.jpg)
38
required for MTR activity. The authors remarked that E. coli employs two
flavoproteins as a coupled reducing system to maintain the reduced state of MTR-
bound cobalamin.73
1.4.3.4 Failure of Lysosomal Release of Vitamin B12
A defect in translocation of cobalamin from lysosome to cytoplasm was
reported in a single patient with MMA, developmental delay, and no HC or
megaloblastic anemia.74
After 4-day incubation with 25 pg/mL of [57
Co]-labelled
CNCbl, cultured fibroblasts showed an accumulation of free cobalamin as
exogenous, unmetabolized CNCbl, suggesting an inability to transfer cobalamin
from the lysosome to the cytoplasm after release from TC. When cell extracts
were fractionated by Percoll gradient, 93% of radioactive labels in patient cells
were located in the lysosomal and mitochondrial fraction while 62% of labels in
control cells were located in the lower density, cytoplasmic fraction. A defect in
endocytosis of TC-Cbl complex was excluded because addition of chloroquine,
which arrests lysosomal proteolysis, resulted in accumulation of TC-Cbl in
control and patient fibroblasts alike.74
The patient cell line complemented with all
five known complementation groups with MMA and was designated cblF.75
1.4.3.5 Heterogeneity Among Patients with HC
After the first identification of a patient with the cblE defect, more
![Page 39: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/39.jpg)
39
patients with isolated HC and megaloblastic anemia were reported. However, a
subgroup of patients were reported to be biochemically distinct from the earlier
patients. The methionine synthase activities in patients’ cell extracts were
decreased when suboptimal or optimal concentrations of reducing agent, BME or
DTT, were added.76, 77
Somatic cell complementation and measurement of
methionine synthase activity demonstrated genetic heterogeneity among patient
cell lines; the defect in patients with normal MTR activity was retained as cblE,
and the new defect in patients with decreased MTR activity was named cblG.
Furthermore, the authors raised the possibility that the cblG mutations may affect
the MTR enzyme itself.78
1.4.4 Inborn Errors of Vitamin B12 Metabolism
Based on the current clinical, biochemical, and genetic knowledge of the
genes involved in the vitamin B12 metabolism, a model pathway has been
constructed (Figure 2).18
After TC-Cbl-TCblR supercomplex enters the cell by
receptor-mediated endocytosis, the late endosome fuses with the lysosome, TC is
rapidly degraded by lysosomal proteases, and free cobalamin is released inside the
lysosomal lumen.79
Cobalamin in the cytoplasm is further modified by a
multifunctional chaperone protein, and it either remains in the cytoplasm for
MeCbl synthesis and MTR activity or gets transported into the mitochondria for
AdoCbl synthesis and MUT activity.18
Identifications of eight genes in the
![Page 40: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/40.jpg)
40
pathway have further elucidated the intricate biology of genes and gene products
in cobalamin metabolism. Nevertheless, information on the functions and
structures of proteins is still very limited and remains to be studied.
The known eight inborn errors, each the result of mutations at a unique
genetic locus, have been divided into three clinical phenotypes depending on the
location of the defect in the cobalamin pathway. Combined MMA and HC is seen
in the cblF, cblC, and cblD-combined defects which block the early passage of
cobalamin through the cell. Isolated MMA is the result of cblD-variant 2, cblB,
cblA, and mut defects which affect the synthesis and utilization of AdoCbl. On the
other hand, isolated HC is caused by cblD-variant 1, cblE, and cblG defects which
affect the synthesis and utilization of MeCbl.18
1.4.4.1 cblF, cblC, and cblD
Gene identification for the cblF defect involved homozygosity mapping
of 12 unrelated patients and microcell-mediated chromosome transfer.80
In the
latter technique, microcells carrying a single copy of each human chromosome
were fused in sequence with a patient cell line until the specific chromosome that
corrected the biochemical phenotype was detected. The success of both
techniques led to the discovery of mutations in the LMBRD1 gene, which encodes
the LMBD1 (LMBR1 domain-containing protein 1) protein.80
Fifteen unrelated
patients have been reported with the disease and a common c.1056delG mutation
![Page 41: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/41.jpg)
41
Figure 2. Vitamin B12 metabolism. This pathway outlines known steps of
intracellular B12 metabolism carried out by genes responsible for each
complementation class. In this simplified diagram, circles represent cobalamins,
arrows represent metabolic steps in the pathway, and italicized names represent
disease names/complementation classes. Proteins that bind to cobalamin
molecules inside the cell, such as MMACHC, MTR, and MUT, are not depicted.
Each disease in cobalamin metabolism results in the blockage of a metabolic
step(s) shown by the arrow(s). TC, transcobalamin; TCblR, transcobalamin
receptor.
![Page 42: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/42.jpg)
42
occurred in 13 out of 15 cases.81, 82
Based on the protein’s strong homology to
LMBR1 (limb region 1) and LIMR (lipocalin-1 interacting membrane receptor),
LMBD1 was predicted to be a lysosomal membrane protein with nine
transmembrane regions (Figure 3).80
Because the cblF defect disrupts the
cobalamin transport from lysosomes to cytoplasm,83
LMBD1 was characterized as
a putative lysosomal cobalamin exporter. Various aspects of cblF are discussed in
greater detail in Section 1.5.
The cblC defect is the most common inborn error of cobalamin
metabolism with more than 500 patients from all over the world reported to date.
The gene commonly mutated in the patients was identified by linkage analysis,
homozygosity mapping, and haplotype analysis and was named MMACHC
(methylmalonic aciduria cblC type, with homocystinuria).84
The primary sequence
of MMACHC protein does not show any resemblance to known protein families,
but residues 181-282 of MMACHC display homology to residues 152-239 of
bacterial TonB protein, which has a role in cobalamin transport across the outer
membrane.84
This cblC locus has long been speculated to encode a reductase of
cob(III)alamin to cob(II)alamin before conversion into MeCbl and AdoCbl and/or
a chaperone.2, 85, 86
Although the primary function of MMACHC protein is still
uncertain, this seemingly multifunctional, cytosolic protein is shown to induce
decyanation and dealkylation of cobalamin derivatives and conversion of newly
![Page 43: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/43.jpg)
43
internalized cobalamin into the “base-off” conformation which may be necessary
for binding to MTR and MUT.87, 88
This molecular chaperone interacts with
MMADHC for an unclear purpose.89
Structural study of MMACHC reported that
it is a divergent member of the NADPH-dependent flavin reductase family and
uses FMN or FAD to catalyze decyanation of CNCbl.90
AdoCbl binds to the
protein’s nitroreductase scaffold in a base-off, five-coordinate configuration and
glutathione binds to an adjacent arginine-rich pocket for the dealkylation of
various alkylcobalamins. Moreover, cobalamin binding triggers a dimerization
event and the PNRRP loop of each monomer provides capping for the upper axial
ligand.91
The genetic etiology of the cblD defect was studied by microcell-
mediated chromosome transfer and refined genetic mapping, and it was found to
be caused by mutation in the MMADHC (methylmalonic aciduria cblD type, with
homocystinuria) gene.92
A unique characteristic of the cblD defect is that it can
present with three distinct biochemical findings. As a result, it has since been sub-
classified into cblD-combined (MMA and HC), cblD-variant 2 (MMA), and cblD-
variant 1 (HC).70, 93
A total of 17 patients have been reported; five patients with
cblD-combined, six with cblD-variant 2, and six with cblD-variant 1.94
Investigations into the genotype-phenotype correlation of three variants found that
truncating mutations close to the N-terminus in cblD-variant 2 allow for re-
![Page 44: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/44.jpg)
44
initiation of translation at Met62 or Met116 and cytoplasmic MeCbl synthesis is
unaffected while mitochondrial activity is compromised. Meanwhile, missense
mutations toward the C-terminus, mostly between residues 246 and 259, in cblD-
variant 1 result in particular abrogation of cytoplasmic activity and leaves
mitochondrial AdoCbl synthesis intact.94
This domain is one of the five predicted
interaction sites between MMADHC and MMACHC and missense mutations may
affect proper binding of MMADHC for its cytoplasmic activity.89
Coupled
decrease in AdoCbl and MeCbl synthesis is caused by truncating mutations
downstream of Met116 which remove large portions of the C-terminal domain.
Initial analysis of the protein sequence identified a putative cobalamin-binding
motif, a putative mitochondrial targeting sequence, and a stretch of 91 amino
acids with similarity to the ATPase component of a putative ATP-binding cassette
transporter although the significance of this similarity has not been validated.92
Despite the lack of knowledge regarding MMADHC function, it can be projected
that this protein has a role in target-directed distribution of cobalamin to
mitochondrial or cytosolic compartments for the usages by MUT or MTR,
respectively.
1.4.4.2 cblB, cblA, and mut
The MMAB (methylmalonic aciduria cblB type) gene encodes for
ATP:cob(I)alamin adenosyltransferase or MMAB protein, and mutations in this
![Page 45: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/45.jpg)
45
gene are the causes of the cblB defect.95
The gene was identified by selecting
human orthologs of bacterial genes in operons containing the methylmalonyl-CoA
mutase gene and verifying by finding mutations in cblB patients. Knowing that
the gene of interest may encode an adenosyltransferase was the key to this success
and its 45% similarity to adenosyltransferase PduO from Salmonella provided
further confirmation. MMAB contains a mitochondrial leader sequence and
converts the reduced cob(I)alamin to AdoCbl in the mitochondria.95
Crystal
structure of MMAB demonstrated that it exists as a homotrimer and sterically
favours the binding of ATP over GTP.96
Although the authors did not produce a
structure with a bound cobalamin, they hypothesized that an oval-shaped opening
near the ATP-binding active site may allow positioning of cobalamin for catalysis.
Functional analysis of mutations in patients has suggested that majority of
mutations, clustered in exon 7, affect highly conserved residues and decrease the
catalytic activity of the enzyme.96-98
The mechanism by which cob(II)alamin is
reduced to cob(I)alamin before adenosylation remains unsolved. Evidence
suggests that one or more unknown proteins may bind cobalamin in the
mitochondria and have a role in B12 metabolism.20
The gene responsible for the cblA defect was discovered by Dobson et al.
in parallel with MMAB identification using the same approach of homology
searching.99
It was appropriately named MMAA (methylmalonic aciduria cblA
![Page 46: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/46.jpg)
46
type) and deleterious mutations were detected in five cblA patients. Subsequently,
many patients with the cblA defect have been reported and most of the mutations
are located in exons 2 to 4 including the common c.433C>T (~43%) mutation.100-
102 Although it was described as a member of the G3E family of P-loop GTPases
and was speculated to be an accessory protein in mitochondrial translocation of
cobalamin, unraveling its exact function has long been elusive.99
Pathobiology of
MMAA mutations was initially studied by mapping point mutations onto the
bacterial MeaB counterpart and mutations were predicted to damage the folding
and stability of MMAA.103
The recently solved crystal structure of MMAA
provided greater insight into its function and revealed it to form a homodimer.104
Interestingly, it also demonstrated that MMAA and MUT interact with each other
preferably when MMAA is bound to GMPPNP, a nonhydrolyzable GTP analog,
and when MUT is not bound to its cofactor. In the mitochondrial milieu, MMAA
plays a gatekeeping role in which it channels AdoCbl to MUT and maintains
AdoCbl bound to MUT holoenzyme in its active form.104, 105
The mut defect is caused by mutations in the MUT enzyme itself,
encoded by the MUT gene.106, 107
Identified by screening human liver and placenta
cDNA expression libraries with anti-MUT antibody, this was the first gene in the
vitamin B12 pathway to be cloned. The mut defect represents the most common
cause of isolated MMA and mutations are frequently found in exons 2, 3, 6, and
![Page 47: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/47.jpg)
47
11.23, 108
More patients have been reported to have the muto defect with
undetectable enzyme activity than the mut− defect with residual enzyme
activity.100, 108
The MUT enzyme has a 32-amino acid mitochondrial leader
sequence and catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA,
an intermediate molecule in the Krebs cycle which can then be completely
metabolized. Structural and size exclusion chromatography studies estimate MUT
homodimers to interact with MMAA homodimers in 1:2 ratio to form the core
structure of cobalamin assimilation machinery.104
1.4.4.3 cblE and cblG
The cblE defect is caused by mutations in the MTRR gene which encodes
methionine synthase reductase (MTRR).109
Based on enzymatic assays on patient
fibroblasts and comparison to flavodoxin/flavodoxin reductase system in E. coli,
it was deduced that the cblE complementation group is a disorder of reductive
reactivation of MeCbl bound to MTR.78
Searching for FMN, FAD, and NADPH
binding sites, Leclerc et al. discovered MTRR to be a dual flavoprotein reductase
capable of binding all three cofactors. On the primary protein sequence, the
flavodoxin domain is positioned near the N-terminus and the flavodoxin reductase
domain near the C-terminus.109
Various sequence changes lead to truncation,
inclusion of a pseudoexon, or missense mutations affecting the cofactor-binding
sites.110, 111
The cblE patients often present early in life with neurological findings
![Page 48: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/48.jpg)
48
and megaloblastic anemia.18
Cob(I)alamin, which is always bound to the active
holoenzyme, can be inactivated by accidental oxidation once in approximately
every 2000 catalytic cycles.8 MTRR performs reductive methylation of inactive
cob(II)alamin using S-adenosylmethionine as a methyl donor to regenerate MeCbl
and maintain the activity of MTR.109
The cblG defect results from mutations in the MTR gene encoding the
MTR enzyme.19
The MTR cDNA was cloned by performing RT-PCR with primers
to four homologous regions of methionine synthases from different organisms and
reconstituting the human cDNA. MTR catalyzes methyltransferase reactions
during which a methyl group is transferred from 5-methylTHF to MeCbl and then
to homocysteine, producing THF and methionine. For its function, MTR is
divided into a homocysteine-binding domain, a 5-methylTHF-binding domain, a
cobalamin-binding domain, and an activation domain.112
The enzyme recycles the
bound cob(I)alamin and accidental oxidation of cob(I)alamin to cob(II)alamin can
be restored by MTRR.109
Mutations have been identified throughout the entire
gene in over 30 patients.112, 113
Patients suffer from megaloblastic anemia, as in
cblE, because inadequate amount of THF is reverted back to 5,10-methyleneTHF
for the production of thymidylate. Megaloblastic anemia seen in cblE and cblG is
indistinguishable from that seen in folate deficiency.114
![Page 49: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/49.jpg)
49
1.4.5 Other Causes of MMA
It is important to note that the eight defects described above are not the
only causes of methylmalonic aciduria. For instance, mild methylmalonic aciduria
can be caused by mutations in methylmalonyl-CoA epimerase (MCEE), which
converts D-methylmalonyl-CoA into L-methylmalonyl-CoA,115
or by mutations in
the succinyl-CoA ligase (SUCLG1, SUCLA2), which metabolizes succinyl-CoA
through the Krebs cycle.116
Recent exome sequencing endeavours discovered
mutations in the putative malonyl-CoA and methylmalonyl-CoA synthetase
(ACSF3) that result in combined malonic and methylmalonic aciduria;117, 118
the
more common etiology for this metabolic phenotype is deficiency of the malonyl-
CoA decarboxylase (MLYCD), which converts malonyl-CoA into acetyl-CoA.119
1.4.6 Other Causes of HC
Furthermore, accumulation of homocysteine can be the result of
decreased activities of three enzymes: MTR, 5,10-methyleneTHF reductase
(MTHFR), and cystathionine β-synthase (CBS).114
MTR, as described earlier,
converts homocysteine to methionine, MTHFR converts 5,10-methyleneTHF to
5-methylTHF which is the methyl donor for MTR,120
and CBS catalyzes
condensation of homocysteine and serine to form cystathionine.121
Mutations
affecting the three proteins have been identified and they lead to varying degrees
of homocystinuria in patients. Although phenotypically overlapping, MTHFR
![Page 50: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/50.jpg)
50
deficiency and CBS deficiency are not inborn errors of cobalamin metabolism.
1.5 cblF Disease
This thesis, although not focused on the cblF disease, has tight
connections with it. Therefore, the exact biology of this disease, including the
passage of cobalamin through the lysosomal compartment of the cell, must be
addressed to provide a proper context to succeeding sections.
1.5.1 Background on Lysosome
1.5.1.1 Role of Lysosome
Lysosomes are ubiquitous membrane-bound organelles found in nearly all
human cell types, except erythrocytes, and they mainly function as the primary
degradative compartment. Substrates enter the lysosomes via endocytosis,
phagocytosis, or autophagy, and are digested by the acidic environment and
hydrolase enzymes in intra-lysosomal vesicles. It has been estimated that
lysosomes contain ~50 soluble hydrolases and ~25 integral lysosomal membrane
proteins (LMPs), some of which carry particles between lysosomal lumen and
cytosol. The acidic pH is essential for the activity of hydrolases and is maintained
by vacuolar-type H+-ATPase, a proton pump.
122, 123
![Page 51: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/51.jpg)
51
1.5.1.2 Lysosomal Soluble Proteins
Lysosomal soluble proteins are synthesized at the rough endoplasmic
reticulum (ER) and are translocated to the ER lumen by the N-terminal targeting
sequence. Inside the ER, the targeting sequence is cleaved and proteins undergo
N-glycosylation before they are transported to the Golgi apparatus.122
Glycosylation is performed by oligosaccharyltransferase which attaches an
oligosaccharide chain to the asparagine residue of “Asn-X-Ser/Thr” tripeptide
motif where X is any amino acid but proline.124
Lysosomal hydrolases, with few
notable exceptions, depend on the mannose-6-phosphate (M6P) tag for transport
from the Golgi network to the lysosomes. The M6P moiety is added to the
hydrolases by the actions of N-acetylglucosaminyl-1-phosphotransferase and N-
acetylglucosamine-1-phosphodiester α N-acetylglucosaminidase (diesterase).
Hydrolases are then recognized by the M6P receptors on the Golgi membrane and
are transported to the lysosomes.125
M6PR-independent transport pathways have
been reported also; LIMP2/SCARB2 serves as a transport receptor for β-
glucocerebrosidase and sortilin serves as a transport receptor for neurotensin,
lipoprotein lipase, and the precursors of sphingolipid activator proteins.125
1.5.1.3 Lysosomal Membrane Proteins
LMPs do not acquire the M6P tag and are thus not transported through the
M6PR-dependent pathway. Studies have suggested that LMPs can either travel
![Page 52: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/52.jpg)
52
directly from the Golgi network to the lysosome or travel first to the plasma
membrane and then reach the lysosomes by a retrograde endocytic pathway.123
Although our understanding of the transport mechanism for LMPs is still limited,
the LAMP/LIMP family of proteins and several other LMPs contain the tyrosine-
based (YXXØ ) or dileucine-based ([DE]XXXL[LI]) motifs, which are common
Golgi sorting and endocytic signals. The lysosomal targeting seems to be
conferred by the placement of these motifs near the transmembrane domain and
generally also near the C-terminal domain, but the exact relationship has not been
proven.125
LMPs are glycosylated on the luminal domain while in the Golgi
network through the same N-glycosylation mechanism as the soluble proteins.123
1.5.1.4 Disorders of Lysosomal Export
Mutations in genes encoding lysosomal hydrolases or LMPs result in
various metabolic diseases known as lysosomal storage diseases. They are
characterized by the intra-lysosomal accumulation of specific substrates.122
For
example, Tay-Sachs disease is caused by mutations in β-N-acetylhexosaminidase
A enzyme and an accumulation of GM2 ganglioside and related glycolipids is
observed.126
The cell biology and pathophysiology of LSDs have been extensively
reviewed elsewhere.122, 126
A subset of these diseases results from a failure of lysosomal export of a
substrate by a transporter on the lysosomal membrane. Two disorders of
![Page 53: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/53.jpg)
53
lysosomal export are well-characterized; cystinosis is caused by mutations in
cystinosin which transports cystine, a dimeric amino acid, out of the lysosome,
and Salla disease is caused by mutations in sialin which transports sialic acids and
acidic hexoses out of the lysosome.123
Similarly, the cblF defect and the novel
defect identified in this thesis are caused by failures of lysosomal export of
cobalamin. However, the pathology of these defects in cobalamin transport is
caused by the deficiency of substrate in the cytoplasm and mitochondria while the
pathology of cystinosis and Salla disease is attributed to the accumulation of
substrates in the lysosome.127
1.5.2 LMBRD1 Gene
The cblF disease is a rare disorder of lysosomal export caused by
mutations in the LMBRD1 gene. The gene discovery was achieved by a
combination of microcell-mediated chromosome transfer with homozygosity
mapping. Twelve unrelated patients in the study were from diverse ethnic
backgrounds, but a common haplotype of 1.34 Mb was identified on chromosome
6q13. The high frequency of the c.1056delG mutation, which occurs in 20 out of
30 mutant alleles in 15 patients, is predicted to be the result of a founder effect.80,
82 Eight other mutations have been identified in these patients; c.515_516delAC
and c.1405delG are homozygous mutations in two patients and c.404delC,
c.712_713delAC, c.842_845delAGAG, c.916-1G>T, c.1339-1G>T, and c.70-
![Page 54: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/54.jpg)
54
4298_246+2311del6785 are compound heterozygous mutations with the common
c.1056delG.82
All reported mutations are either frameshifting short deletions,
splice acceptor site mutations, or a large deletion, and therefore truncate the
encoded protein.
LMBD1 is a lysosomal membrane protein with nine transmembrane
regions and 6 N-glycosylation sites on the intra-lysosomal face (Figure 3). Its
primary sequence shares 15.9% and 13.7% identity, or 31.5% and 27.8%
similarity, with LMBR1 and LIMR proteins, respectively.80
The function of LIMR
is to internalize lipocalins, which are extracellular carriers of lipophilic
compounds. The mechanism by which LMBD1 mediates cobalamin transport
across the lysosomal membrane remains unclear.
1.5.3 Pathophysiology and Treatment
Clinical and pathological findings in an LSD can often be attributed to the
accumulation of a specific substrate in a cell type/ tissue.126
Unlike other LSDs,
the disease phenotypes in cblF are not direct consequences of cobalamin
accumulation in the lysosome, but outcomes of decreased availability of active
cofactors to MTR and MUT enzymes. Enlargement of cells or tissues is not
observed most likely because cobalamin is not endogenously synthesized and
does not need to be broken down.
Common clinical findings in the cblF patients, aside from MMA and HC,
![Page 55: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/55.jpg)
55
Figure 3. Putative membrane topology of the LMBD1 protein.
Transmembrane regions, numbered from 1 to 9, are schematically shown in grey
across the lysosomal membrane. Small numbers inside a rectangle represent the
start and end residues of each transmembrane region. Six putative N-glycosylation
sites are shown in green with numbers corresponding to the positions of
asparagine residues. Adapted from Rutsch et al., 2009.
![Page 56: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/56.jpg)
56
include failure to thrive, developmental delay, low serum cobalamin level,
abnormal Schilling test results, small for gestational age, feeding difficulties, C3
carnitine elevation secondary to MMA, stomatitis/glossitis, megaloblastic anemia,
hypotonia, and cardiac defects.128
Symptoms often present during the first year of
life and they strongly suggest the importance of cobalamin metabolism in early
child development. Patients diagnosed with cblF are treated by parenteral
administration of 1.0 to 1.5 mg of OHCbl per day until homocysteine and
methylmalonic acid levels normalize. The amount of OHCbl is then titrated to a
minimal dose with optimal biochemical response in the patient.128
1.6 Undiagnosed Patients and Gaps in the Pathway
Patients are suspected to have an inborn error of cobalamin metabolism
when they present with methylmalonic aciduria and/or homocystinuria among
other symptoms. If dietary causes are ruled out, their skin fibroblasts are obtained
for somatic cell complementation and biochemical assays, and their blood-
extracted DNA are screened for mutations in known genes. Over the years, certain
patients could not be genetically diagnosed with any of the known defects. They
were either determined to carry no mutations in all genes associated with
cobalamin metabolism, showed normal phenotype upon biochemical assays with
fibroblasts, or could not be successfully classified by somatic cell
complementation. Focused investigation into each unsolved case could lead to the
![Page 57: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/57.jpg)
57
identification of mutations, but even with these limited successes, no patient has
been correctly assigned into a new complementation group since cblG was
designated as the eighth in 1988.78
Nevertheless, it has always been a possibility that there are more genes
involved in vitamin B12 metabolism. Mutations in new genes may not have been
reported due to reasons ranging from functional redundancy to severity of
mutation that is incompatible with life.23
Presently, there are question marks
scattered across the vitamin B12 metabolism pathway and the clinicians and
scientists in the field are devoted to finding answers. Two proteins, seemingly
necessary to complete the cobalamin metabolism pathway, have not been
accounted by the known eight genes; one is a mitochondrial membrane transporter
of cobalamin and the other is an adapter or energy-provider to LMBD1 for
lysosomal egress of cobalamin.23, 129
If determined to be true, they would both be
involved in the transport of cobalamin across organellar membranes.
1.7 Evolution of Gene Discovery Approaches
1.7.1 Limitations of Traditional Approaches
Genetic diseases in human can be roughly divided into rare, monogenic,
simple diseases and common, multigenic, complex diseases. The former were
mostly investigated by linkage analyses and Sanger sequencing of candidate
genes130
while the latter were subjected to genome-wide association studies
![Page 58: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/58.jpg)
58
(GWAS).131
This dichotomy by no means encapsulates the entirety of genetic
diseases, and the other diseases that fall between the two classifications were
studied by combinations of various gene discovery approaches. Over the many
successes with linkage analysis and GWAS, scientists have witnessed their
limitations also; linkage analysis required well-characterized families and were
very time-consuming, while GWAS required the recruitment of a large cohort of
cases and controls and only a few associations could be consistently
reproduced.132
1.7.2 First Applications of Exome Sequencing
Rare, monogenic diseases, also termed Mendelian diseases for their
classical pattern of inheritance, often result from major changes to protein
sequences encoded by the mutated genes. Hence, the human exome, which refers
to all protein-coding sequences called exons in the genome, represents an
enriched source of disease-causing genetic variants.133
Given that the exome is
~1% of the human genome134
and that missense, nonsense, small
insertion/deletion/indel, and splicing mutations account for ~88% of disease-
associated mutations (Human Gene Mutation Database; http://www.hgmd.org),
whole-exome sequencing presented a far more cost-effective method of disease
gene discovery than whole-genome sequencing. With the development of next-
generation sequencing technologies, high-throughput DNA sequencing is
![Page 59: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/59.jpg)
59
becoming faster, cheaper, and more practical than ever before.
In 2009, Ng et al. published a seminal work in modern human genetics
with their proof-of-principle paper on disease gene discovery by exome capture
and massively-parallel sequencing. They sequenced exomes of twelve individuals,
including four unrelated patients with Freeman-Sheldon syndrome, and confirmed
that all four patients carried mutations in the MYH3 gene, without utilizing any
additional data.134
Subsequently, the same team demonstrated gene discovery in
Miller syndrome, for which the genetic cause was unknown, by exome
sequencing and it was approved as an accurate and efficient approach.135
Their
method was quickly taken up and improved by the scientific community to
identify the causes for numerous Mendelian disorders.136
Although the name
derives from exome capture and massively-parallel sequencing, it is unarguable
that a critical component of exome sequencing is really the bioinformatics. The
complex process of using bioinformatics tools to align DNA sequences, detect
variants, filter out false positives and false negatives, and algorithmically select
damaging variants is what differentiates a successful exome sequencing project
from one that is not.
1.7.3 New Paradigm of Disease Gene Discovery
In traditional approaches, it was not a simple task to identify a disease-
causing gene for a rare Mendelian disorder from a small cohort of unrelated
![Page 60: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/60.jpg)
60
patients. Reasons for such difficulty included availability of small number of
cases, uncertainty of degree of penetrance, locus heterogeneity, and low
reproductive fitness.136
As an extreme example, the identification of heterozygous
de novo mutations in a few unrelated patients with an autosomal dominant
disorder was nearly impossible. But whole-exome sequencing is an efficient,
unbiased method of identifying a disease-causing gene commonly mutated in
patients with an inherited disorder.137, 138
An efficient workflow for disease gene
discovery using exome sequencing would be to first select patients with definitive,
textbook phenotypes, sequence their exomes, find a commonly mutated gene, and
then follow-up by Sanger sequencing the gene in other patients with the
disorder.139
1.7.4 Exome Sequencing of Undiagnosed Patients
Patients with methylmalonic aciduria and/or homocystinuria that could
not be diagnosed before are now candidates for exome sequencing approach to
find novel mutations in genes presently not included in the vitamin B12 pathway.
Although many are unrelated patients with unique, disparate phenotypes, it was
hypothesized by Dr. David Rosenblatt that exome sequencing of a single proband
with an autosomal recessive disease could lead to the identification of the disease-
causing gene by meticulously filtering for variants, selecting candidate genes, and
validating by Sanger re-sequencing.140
![Page 61: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/61.jpg)
61
Affirming the validity of this method, exome sequencing was performed
on the genomic DNA of a patient with megaloblastic anemia, severe combined
immunodeficiency, hyperhomocysteinemia, and methylmalonic aciduria.141
It
resulted in the discovery of mutations in the MTHFD1 gene which encodes a
trifunctional enzyme that acts as methyleneTHF dehydrogenase, methenylTHF
cyclohydrolase, and formylTHF synthetase. Because the MTHFD1 protein is
strictly involved in the folate metabolism including the generation of 5-
methylTHF, the presence of methylmalonic aciduria in the patient was considered
incidental. The present study, as will be discussed later, was also initiated by
exome sequencing of an unusual patient for whom a genetic diagnosis could not
be made by traditional methods.
1.8 Peroxisomal ABC Half-Transporters
1.8.1 ATP-Binding Cassette Transporters
ATP-binding cassette (ABC) transporters have diverse structural designs,
membrane orientations, mechanisms of action, and transported substrates in
prokaryotes and eukaryotes.142
Their common characteristic is that they all harvest
ATP hydrolysis for energy production and, in most cases, a full, functional
transporter is constituted by two transmembrane domains (TMD) and two
nucleotide-binding domains (NBD). The diversity in transport and regulation
mechanisms originates from protein sequence differences, structural variability,
![Page 62: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/62.jpg)
62
and existence of additional domains in certain cases.
Human ABC transporters have been grouped into seven subfamilies,
ABCA to ABCG, based on structural and functional properties. The most studied
transporters have often been the ones tightly associated with human diseases; P-
glycoprotein/MDR1/ABCB1 in multidrug-resistant cancer;143
CFTR/ABCC7 in
cystic fibrosis;144
ALD/ABCD1 in X-linked adrenoleukodystrophy;145
and
CERP/ABCA1 in Tangier disease.146
1.8.2 ATP-Binding Cassette, Subfamily D
The peroxisomes are ubiquitous membrane-bound organelles with various
specialized metabolic functions. These include β-oxidation of fatty acids,
especially very long chain fatty acids (VLCFA), hydrogen peroxide detoxification,
synthesis of bile acid, plasmalogen, and cholesterol, glyoxylate detoxification, and
lysine catabolism.147, 148
This organelle utilizes hydrogen peroxide to perform
some of its reactions, and the generation and degradation of hydrogen peroxide
are tightly regulated to prevent this strong oxidizing agent from inflicting damage
to the cell itself.
The ABC subfamily D is a group of four ABC half-transporters
containing one TMD and one NBD (Figure 4); ABCD1/ALDP,145
ABCD2/ALDR,149
ABCD3/PMP70,150, 151
and ABCD4/P70R.152, 153
Among them,
ABCD1, ABCD2, and ABCD3 are located on the peroxisomal membrane and
![Page 63: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/63.jpg)
63
Figure 4. Putative membrane topology of an ABC, Subfamily D transporter.
Members of the ABC subfamily D each contain one TMD and one NBD, so are
half the size of a full ABC transporter. The TMD contains six transmembrane
regions in the N-terminal domain of the transporter, and the NBD contains Walker
A, Walker B, and ABC signature motifs in the C-terminal domain. Adapted from
Morita & Imanaka, 2012.
![Page 64: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/64.jpg)
64
they function to translocate VLCFA from the cytosol to the peroxisomes.148
It has
been suggested that they homo- or heterodimerize to form a full, active transporter
of VLCFA with varying substrate specificities.154, 155
ABCD1 is the most-studied
peroxisomal ABC transporter because mutations in the gene are responsible for
causing X-linked adrenoleukodystrophy.145
The disease is biochemically
characterized by elevated levels of saturated VLCFA in the plasma and tissue, and
very long chain acyl-CoA synthetase was considered a candidate gene for this
disease until it was proven otherwise.
1.8.3 ABCD4 Gene
1.8.3.1 Discovery and Characterization
The fourth member of the ABC subfamily D was identified by Shani et al.
and Holzinger et al. independently by searching the human expressed sequence
tags database for a cDNA clone with homology to ABCD1 and ABCD3.152, 153
The
ABCD4 (ATP-binding cassette, subfamily D, member 4) gene is located on
chromosome 14 and maps to q24.3 region.152
The gene consists of 19 coding
exons, which produce a 1821-base pair mRNA transcript, which in turn produces
a 606-amino acid polypeptide with a predicted molecular mass of 68.6 kD.153
Although ABCD4 was initially reported as a peroxisomal half-transporter as a
result of its homology to the others, it is the most divergent member of the
subfamily (Figure 5) and its N-terminus begins with a hydrophobic
![Page 65: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/65.jpg)
65
transmembrane region while the others begin with a hydrophilic cytosolic
segment.156
The ABCD4 protein, albeit not well-characterized, contains the two
principle domains of ABC transporters: a TMD (residues 39-332) and an NBD
(residues 389-603) (http://www.uniprot.org/uniprot/O14678).
1.8.3.2 Subcellular Localization
Although initially reported to be peroxisomal,152
a more recent study
suggested that ABCD4 is localized to the endoplasmic reticulum.156
Moreover,
proteomic studies aimed at characterizing all peroxisomal proteins in rat and
mouse peroxisomes failed to detect ABCD4 under conditions where the three
other ABCD proteins were detected.157-159
In addition, an in vitro study reported
that PEX19p, a peroxisomal biogenesis protein, binds ABCD1, ABCD2 and
ABCD3, but not ABCD4.160
Its lack of N-terminal hydrophilic region has been
suggested to be the cause of its deviation from peroxisomal targeting.156
![Page 66: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/66.jpg)
66
Figure 5. Protein sequence identity and similarity among ABCD proteins.
NCBI blastp (http://blast.ncbi.nlm.nih.gov) was operated by inputting the primary
sequence of each protein (vertical list) and retrieving the percentage identity and
percentage similarity (shown in brackets) against the other transporters (horizontal
list). Four proteins always aligned against each other with lowest E-values
amongst all human proteins in the Swissprot database. Protein sequence identity is
the number of identical residues divided by the length of overlapping sequence.
Protein sequence similarity is the sum of number of identical residues and number
of conserved residues divided by the length of overlapping sequence.
![Page 67: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/67.jpg)
67
RATIONALE AND OBJECTIVES OF STUDY
Despite recent advances in understanding various aspects of vitamin B12
metabolism, many questions still remain to be answered. Intracellular metabolism
of vitamin B12 in humans has been found to involve at least eight genes with each
gene product responsible for one step of the pathway. Recently, our laboratory
investigated three patients with phenotypes resembling the cblF defect but not
belonging to any of the known eight complementation groups. My objective was
to identify mutations in the gene causing this novel inborn error of vitamin B12
metabolism and confirm its role by transfecting cultured fibroblasts with a wild
type copy of the gene. Gene identification was accomplished by leveraging the
strength of exome capture and massively-parallel sequencing (exome sequencing),
which had become a new paradigm for gene identification in rare Mendelian
diseases. Correction of biochemical phenotypes was demonstrated by performing
assays designed to measure different parameters of normal versus abnormal
vitamin B12 metabolism. Enzymatic functions of MTR and MUT, synthesis of
active cofactors from labelled CNCbl, and proportions of free and protein-bound
state of cobalamin were assessed. All experiments, except those acknowledged to
be performed by others, were performed by the author.
![Page 68: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/68.jpg)
68
CHAPTER 2: MATERIALS AND METHODS
2.1 Case Reports
2.1.1 Patient WG4066
Patient WG4066 was the second child of healthy, non-consanguineous
parents of northern European ancestry. She was noted to have hypotonia, lethargy,
feeding difficulties, periodic breathing, and episodes of posturing. There was
evidence of bone marrow suppression requiring red blood cells and platelet
transfusions. Newborn screening showed an elevated C3 (propionyl) carnitine at
11.9 (reference <5) µmol/L. Initial laboratory testing failed to show metabolic or
lactic acidosis or ketonuria. The infant was started on OHCbl and transferred to a
tertiary facility at 2 weeks of age. On admission, plasma amino acids indicated
low methionine of 5 (reference 17-53) µmol/L, absent free homocystine, and
elevated total plasma homocysteine at 20 (reference <12) µmol/L. The serum
methylmalonic acid was 20.25 (reference <0.4) µmol/L. Urine organic acids
indicated an isolated increase in methylmalonic acid at 154 (reference <5)
mmol/mol creatinine. Above findings, including hypotonia and feeding difficulties,
were strongly suggestive of the cblF inborn error of cobalamin metabolism. Blood
counts were significant for neutropenia (absolute neutrophil count 0.3 K/µL ,
reference 1.5-10 K/µL) and thrombocytopenia (55-106 K/µL, reference 150-400
K/µL). The patient was started on Colony-Stimulating Factor which corrected
![Page 69: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/69.jpg)
69
neutrophil and platelet counts. She was continued on a regular diet (breast milk),
intramuscular injections of OHCbl (2 mg per day), oral MeCbl (2 mg twice a day),
5-methylTHF (3 mg twice a day), pyridoxal phosphate (35 mg twice a day), and
betaine (100 mg/kg per day divided into 3 doses). With this treatment, the plasma
amino acids normalized completely, as did total plasma homocysteine and serum
methylmalonic acid levels.
Following discharge from the hospital at 36 days of age, the patient did
well with no other hospitalizations, except one at 7 months of age for the elective
repair of a left inguinal hernia. She is normal from a developmental standpoint.
The therapy consists of intramuscular injections of OHCbl (2.5 mg twice a week),
oral MeCbl (2 mg twice a day), 5-methylTHF (3 mg twice a day), and pyridoxal
phosphate (35 mg twice a day). Betaine was stopped at 6 months of age. With this
therapy, plasma amino acids and total plasma homocysteine are persistently
within the reference range, while methylmalonic acid is mildly elevated in serum
(0.68-1.45 µmol/L, reference <0.4 µmol/L) and urine (6-13 mmol/mol creatinine,
reference <5 mmol/mol creatinine).
2.1.2 Patient WG4140
Patient WG4140 was the second child of non-consanguineous German
parents. Physical examination revealed hypertelorism, micrognathia, wide inter-
mamillary distance, a bell-shaped thorax, horizontal ribs and short extremities.
![Page 70: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/70.jpg)
70
Cardiac catheterization showed atrial septal defect, coarctation of the aorta, small
left ventricle, enlarged right ventricle and pulmonary hypertension. He was treated
with antibiotics, diuretics and digoxin.
Newborn screening was reportedly unremarkable and chromosome
analysis revealed a normal male karyotype. The clinical course during the first
months of life was complicated by feeding difficulties, generalized hypotonia and
developmental delay. Cerebral ultrasound revealed mild cerebral atrophy at 4
months of age. Repeated cardiac catheterization at 6 months revealed increased
narrowing of the aortic isthmus and a hemodynamically relevant type II atrial
septal defect. Therefore, corrective surgery of the aorta and closure of a patent
ductus arteriosus was performed. At the age of 13 months, Noonan syndrome was
suspected based on symptoms but the mutation analysis of the PTPN11 gene was
negative. At this time, his weight was 6400g (below 1st centile), length 64 cm
(below 1st centile), and head circumference 43 cm (above 97th centile). Skeletal
X-rays of pelvis, hand, knee and spine revealed a delayed bone age.
At the age of 16 months, methylmalonic aciduria was noted. Plasma
homocysteine was 50 (reference <15) µmol/L, and plasma cobalamin was 815
(reference 190-880) pg/mL. These findings, in addition to cardiac defects, feeding
difficulties, hypotonia, developmental delay, and etc, were suggestive of the cblF
defect. Moreover, fibroblast studies revealed findings consistent with this
hypothesis. Therefore, at the age of 18 months, he received his first intramuscular
![Page 71: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/71.jpg)
71
injection of 1.0 mg OHCbl and the homocysteine levels dropped to 15 µmol/L.
Monthly injections with OHCbl were started to restore body storage of cobalamin.
The patient showed some progress in psychomotor development and started to
speak two word sentences at the age of 20 months. At the age of 22 months, he
had a bilateral inguinal hernia repair and a bilateral orchiopexy for cryptorchidism.
At the age of 2.5 years, he had a complicated febrile convulsion. At the age of 5
years, he was treated with intramuscular injections of 1.0 mg OHCbl every 4 to 5
weeks. He showed gradual progress in his psychomotor development, but still had
low weight (13.0 kg, below 1st centile) and short stature (92 cm, below 1st
centile). Developmental delay and small for gestational age are common findings
among patients with the cblF defect.
At the age of 7 years, he developed a pneumococcal septic arthritis of the
right hip, during an episode of neutropenia (leukocyte count 3700/µL, absolute
neutrophil count 1300/µL), requiring surgery of the hip and prolonged systemic
antibiotic therapy. Intramuscular injections with OHCbl were continued at a dose
of 1.0 mg every three weeks. Currently, at the age of seven and a half years, both
plasma homocysteine (15.5 µmol/L) and serum methylmalonic acid (1.13
µmol/L) levels remain elevated.
2.1.3 Patient WG3630
Patient WG3630 was a second child of non-consanguineous Han Chinese
![Page 72: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/72.jpg)
72
parents. At the age of 4 years, he was noted to have hyperpigmentation and gray
hair. He complained of dizziness and headache occasionally for 2-3 years. At the
age of 7 years, he had a transient ischemic attack with 1-2 months of left limping
gait which recovered spontaneously. MRI/MRA of the brain revealed decreased
flow in the left middle cerebral artery (M2) region.
At the age of 8 years, serial workup showed elevated plasma
homocysteine level (71.47 µmol/L, reference 3.4-15.6 µmol/L), relatively low
methionine level (17.3 µmol/L, reference 18-42 µmol/L), low serum cobalamin
level (152 pg/ml, reference 179-1132 pg/ml), and relatively high serum folate
level (>15 ng/mL, reference 3-12 ng/mL). Mild microcytic anemia with MCV
(mean corpuscular volume) of 70 fL and HgB of 11 g/dL was noted. In addition,
urine organic acid analysis revealed presence of methylmalonic acid and
methylcitrate, suggesting an inborn error of cobalamin metabolism.
The patient has been responding well to treatment with oral
administration of MeCbl (0.5 mg three times a day) over the last 6 years. After the
first week of treatment, plasma homocysteine level dropped to 24.15 µmol/L and
a further drop to 15.77 µmol/L was seen after two weeks with addition of folate.
Serum cobalamin increased from 152 to 407 pg/mL, but MCV surprisingly
decreased from 70 to 62.7 fL. Meanwhile, the patient’s elder sister was also
observed to have elevated homocysteine level (21.08 µmol/L) and serum
cobalamin level (228 pg/mL) at the low end of the reference range. Her
![Page 73: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/73.jpg)
73
homocysteine level was 14.76 µmol/L at the second clinical visit before treatment
and it dropped to 5-6 µmol/L after treatment with folate and cobalamin.
A family history of thalassemia was reported by the parents. Blood tests
on the father, aunt, sister, and proband all showed small RBC with MCV around
64-70 fL and HgB around 11 g/dL. Moreover, a high level of plasma
homocysteine was observed in the father (29.22 µmol/L) and aunt (51.02 µmol/L)
in addition to the sister and proband. Screening the MTHFR gene for the
c.677C>T polymorphism revealed that the father, aunt, and mother were
heterozygotes while the proband and sister were homozygotes (Figure 7). This
polymorphism had been known to be associated with increase in plasma
homocysteine levels.114
2.2 Cell Culture
Human skin fibroblasts grown from skin tissue biopsy is the conventional
cell culture type used for biochemical assays of vitamin B12 metabolism.64
Cell
lines were provided by the Repository of Mutant Human Cell Strains located at
the Montreal Children’s Hospital. At the Repository, which undertakes the long-
term storage and quality control of cell lines, cells are designated with a code
number in the following manner; control cells are named as MCH followed by a
2-digit number, and patient cells are named as WG followed by a 4-digit number.
For instance, MCH64 is a control and WG4066 is a patient cell line.
![Page 74: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/74.jpg)
74
Cells were routinely maintained in minimum essential medium plus non-
essential amino acids (Gibco) supplemented with 5% fetal bovine serum
(Intergen) and 5% iron enriched calf serum (Intergen) (Watkins, 2000). Cells
transfected with pBABE retroviral expression vector, as described in Section 2.8
and 2.9, were maintained in medium with 1 µg/mL puromycin (InvivoGen).
2.3 Selection of Fibroblast Cell Lines
In addition to the fibroblast cell lines of WG4066, WG4140, and
WG3630, two wild type controls (MCH64, MCH46), two cblF patient cell lines
(WG3365, WG3377), one cblD cell line (WG3646), and one cblC cell line
(WG4095) were selected (Table 1). For the control and the cblF defect, two cell
lines were selected for each to demonstrate consistency in each type. The cblD
and cblC defects acted as negative controls in transfection experiments and one
cell line was selected for each.
Eight fibroblast cell lines, except WG3630, were used for immortalization,
transfection, and biochemical assays to measure vitamin B12 metabolism. Cells
were immortalized because immortalization both increased growth rates and
prevented senescence. It has been shown previously that cellular cobalamin
metabolism is not affected by immortalization (also see section 2.7).84
The
primary cell line of WG3630 was used for biochemical assays without
immortalization or transfection.
![Page 75: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/75.jpg)
75
Cell Line Type Gene Mutated1
MCH64 Control -
MCH46 Control -
WG4066 Unknown Unknown
WG4140 Unknown Unknown
WG3365 cblF LMBRD1
WG3377 cblF LMBRD1
WG3646 cblD MMADHC
WG4095 cblC MMACHC
WG3630 Unknown Unknown
Table 1. Fibroblast cell lines used in this study. All cell lines except WG3630
were immortalized and transfected. 1Mutations in these genes are responsible for
the inborn error of cobalamin metabolism in each patient. The gene mutated in
WG4066, WG4140, and WG3630 was unknown at this point in time.
![Page 76: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/76.jpg)
76
2.4 Somatic Cell Complementation Analysis
Somatic cell complementation has been an essential tool in establishing
complementation groups and accurately diagnosing patients with a defect in
vitamin B12 metabolism. Equal numbers of patient fibroblasts and fibroblasts from
known complementation groups were mixed and fused by exposure to 40% (w/v)
polyethylene glycol 1000 (PEG). Propionate incorporation, described in Section
2.10, was compared in parallel fused and un-fused cultures. Incorporation was
increased by two-fold or greater in fused than un-fused cultures from different
complementation groups because each fibroblast provided the gene that the other
was defective in. Conversely, no complementation took place if cultures came
from the same complementation group.60
Somatic cell complementation was
performed by Jocelyne Lavallée of the Rosenblatt Laboratory.
2.5 Exome Sequencing
Exome capture sequencings of WG4066 and WG3630 were performed in
collaboration with the laboratory of Dr. Jacek Majewski of McGill University. A
total of 3 µg of genomic DNA was used for exome capture using the Agilent
SureSelect All Exon v1 kit and massively-parallel sequencing using Illumina
GAIIx 76 nucleotide reads, as previously described,117
to generate a mean 30X
coverage of the targeted regions. Variants were compared against a pool of in-
house exomes and those previously seen in two or more individuals were
![Page 77: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/77.jpg)
77
discarded. Novel variants were defined as those absent from dbSNP and having an
allele frequency of less than 0.005 in the 1000 Genomes Project. This allowed us
to consider variants observed in 1000 Genomes at very rare frequencies.
Potentially damaging variants included non-synonymous substitutions caused by
missense and nonsense single-nucleotide polymorphisms (SNP), splice-site SNP,
and frameshift changes due to indels.117
Candidate genes were selected as those
containing either a homozygous or two potentially compound heterozygous
variants in the same gene, satisfying the above criteria.
2.6 Mutation Analysis
For patient WG4066 and family members, primer design, PCR, and
Sanger sequencing of candidate genes were performed by Aurelie Masurel at the
McGill University and Genome Quebec Innovation Centre. Mutation analysis was
performed by the author. For patient WG4140, all steps were performed by the
group under the supervision of Dr. Brian Fowler and Dr. Matthias Baumgartner.
For patient WG3630 and family members, primer design, PCR, and mutation
analysis of the ABCD4 gene were performed by the author. Sanger sequencing
was performed at the McGill University and Genome Quebec Innovation Centre.
Sequencing primers and PCR protocol used for the sequencing of ABCD4 exon 4
in patient WG3630 and family members are described below.
![Page 78: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/78.jpg)
78
Usage Name Sequence from 5’ to 3’
A
ABCD4 exon 4
sequencing
(Section 2.6.1)
ABCD4_Exon4_primer_F GGGATGGGTCAGCGGAGGCT
ABCD4_Exon4_primer_R CCCCCATGACTCTGGGCAGC
B
ABCD4 cDNA
sequencing
(Section 2.8.2)
ABCD4_seq_primer_F AAGTGGGGCTTGGACACACCCCC
ABCD4_seq_primer_R GCTCCCGAAGGGTCCCGTCAGTG
ABCD4_int_primer_5 ATACAGCAGGTTGCAGGTGAACTG
ABCD4_int_primer_3 GCAGGCCTGTCCAACTTGGTGGCA
C
LMBRD1 attB1/2
cloning
(Section 2.9.1)
LMBRD1_attB1_Forward GGGGACAAGTTTGTACAAAAAAGCAG
GCTTCACCATGGCGACTTCTGGCGCG
LMBRD1_attB2_Reverse GGGGACCACTTTGTACAAGAAAGCTG
GGTGTTAAGCAGAATAGACAGAGGG
D
LMBRD1 cDNA
sequencing
(Section 2.9.3)
LMBRD1_seq_primer_5_R ATATAACAGAATATAAAGTATAGTA
LMBRD1_seq_primer_3_F AATATGTTATGTATGGAAGCCAAAA
LMBRD1_int_primer_5_F AAAAAGCAAAGATGGTCGACCTTT
LMBRD1_int_primer_3_R TCCACCAGCTGTTTTCAATGAATT
Table 2. Primers used in this study. For LMBRD1 attB1/2 cloning primers, the
red-coloured bases represent regions overlapping with 5’ and 3’ ends of the
LMBRD1 cDNA for forward and reverse primers, respectively.
![Page 79: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/79.jpg)
79
2.6.1 Polymerase Chain Reaction (PCR)
Primers were designed using the online program Primer-BLAST, which is
a combination Primer3 and BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-
blast) to sequence the exon 4 of the ABCD4 gene (Table 2A). The forward primer
was positioned 76 bp upstream and the reverse primer was positioned 117 bp
downstream of the exon to cover the entire exon 4. PCR was performed to
amplify the exon 4 from gDNA of patient WG4066 and family members. Standard
PCR conditions were used and Taq polymerase was replaced with HotStarTaq
(Qiagen). The PCR protocol consisted of the following: initial denaturation at
96ºC for 10 min, 40 cycles of {melting at 96ºC for 30 sec, annealing at 62ºC for 1
min, and amplification at 72ºC for 40 sec}, and final elongation at 72ºC for 10
min. PCR amplification was verified by gel electrophoresis in 1.2% agarose gels.
2.7 Immortalization of Fibroblasts with E7 and Telomerase
Eight fibroblast cell lines (Table 1) were immortalized with the E7 gene
from human papilloma virus type-16 and human telomerase as previously
described.161
Immortalization of cell lines did not affect the cellular phenotype as
assessed by cellular incorporation of [14
C]methylTHF and [14
C]propionate
substrates (data not shown). Immortalization of fibroblasts was performed by
Timothy Johns of the Eric Shoubridge Laboratory.
![Page 80: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/80.jpg)
80
2.8 Transfection of Fibroblasts with Wild Type ABCD4 cDNA
2.8.1 LR Recombination Reaction
Wild type human ABCD4 cDNA in pENTR221 vector (Kanamycin
resistance; DQ892847.2) was purchased from DNAFORM (Yokohama, Japan)
and cloned into the Gateway-modified retroviral expression vector pBABE
(Ampicillin resistance)161
using LR Clonase II Enzyme Mix (Invitrogen). The LR
recombination reaction was performed by mixing 9 µL of pENTR221-ABCD4 (50
ng/µL), 1 µL of pBABE (150 ng/µL), 2 µL of TE buffer pH 8.0, and 3 µL of LR
Clonase and incubating overnight at 25°C. The reaction was terminated by adding
1 µL of Proteinase K solution and incubating for 10 minute at 37°C. OneShot
TOP10 E. coli (Invitrogen) was transformed with 1 µL of reaction mixture and
transformants were plated on LB/Amp 100 µg/mL and LB/Kan 30 µg/mL agar
plates. Colonies positive for pBABE-ABCD4 and negative for pENTR221-
ABCD4 were selected for colony PCR.
2.8.2 Colony PCR of LR Recombinants
Colony PCR was performed to check the presence of ABCD4-harbouring
vector in the selected colonies. Colonies were picked and resuspended in 50 µL of
milliQ water and boiled for 10 minutes. For the PCR reaction, 10 µL of boiled
colony was used as the template, and primers “ABCD4_seq_primer_F” and
“ABCD4_seq_primer_R” were used to create a PCR product of 316 bp (Table
![Page 81: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/81.jpg)
81
2B). Standard PCR conditions for Taq polymerase (Qiagen) were used. The PCR
protocol consisted of the following: initial denaturation at 94ºC for 3 min, 40
cycles of {melting at 94ºC for 30 sec, annealing at 58ºC for 1 min, and
amplification at 72ºC for 30 sec}, and final elongation at 72ºC for 10 min. PCR
amplification was verified by gel electrophoresis in 1.2% agarose gels. Positive
colonies were grown in LB broth overnight at 37°C and plasmids were extracted
using QIAprep Spin Miniprep Kit (Qiagen). The fidelity of the retroviral pBABE-
ABCD4 constructs was validated by Sanger sequencing with primers
“ABCD4_int_primer_3” and “ABCD4_int_primer_5”, which are designed to
check the 5’ and 3’ ends of the ABCD4 insert for correct reading frame (Table 2B).
2.8.3 Transfection
The retroviral pBABE-ABCD4 construct was transiently transfected into
a Phoenix Amphotrophic packaging cell line via using the HEPES-buffered saline
/Ca3(PO4)2 method (http://www.stanford.edu/group/nolan/retroviral_systems/
phx.html). After 48-hour incubation, virus-containing medium was collected,
supplemented with 4 μg/ml polybrene and used to infect eight immortalized
fibroblast cell lines (Table 1). Fibroblasts were grown for 2 weeks in medium
containing 1 μg/mL of puromycin (InvivoGen) for selection.84
Transfection of
fibroblasts was performed by Stephen Fung of the Eric Shoubridge Laboratory.
![Page 82: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/82.jpg)
82
2.9 Transfection of Fibroblasts with Wild Type LMBRD1 cDNA
2.9.1 Gateway Cloning
Wild type human LMBRD1 cDNA in pBlueScriptR vector (BC047073.1)
was purchased from Open Biosystems (Lafayette, CO). PCR was performed to
produce the LMBRD1 insert flanked by attB1/attB2 sites using Gateway-cloning
primers (Table 2C). Standard PCR conditions for Taq polymerase (Qiagen) were
used. The PCR protocol consisted of the following: initial denaturation at 94ºC
for 3 min, 40 cycles of {melting at 94ºC for 30 sec, annealing at 58ºC for 1 min,
and amplification at 72ºC for 2 min}, and final elongation at 72ºC for 10 min.
PCR amplification was verified by gel electrophoresis in 1.2% agarose gels. The
attB1-LMBRD1-attB2 PCR product was extracted using QIAquick Gel Extraction
Kit (Qiagen).
2.9.2 BP Recombination Reaction
The attB1-LMBRD1-attB2 PCR product was cloned into the empty
pDONR221 vector using BP Clonase II Enzyme Mix (Invitrogen). The BP
recombination reaction was performed by mixing 5 µL of attB1-LMBRD1-attB2
PCR product (35 ng/µL), 1 µL of pDONR221 (150 ng/µL), 2 µL of TE buffer pH
8.0, and 2 µL of BP Clonase and incubating overnight at 25°C. The reaction was
terminated by adding 1 µL of Proteinase K solution and incubating for 10 minutes
at 37°C. Chemically-competent E. coli DH5α was transformed with 1 µL of
![Page 83: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/83.jpg)
83
reaction mixture and transformants were plated on LB/Kan 30 µg/mL and
LB/Amp 100 µg/mL agar plates. Colonies positive for pENTR221-LMBRD1 were
selected for colony PCR.
2.9.3 Colony PCR of BP Recombinants
The procedure was identical to Section 2.8.2, except that primers
“LMBRD1_attB1_Forward” and “LMBRD1_attB2_Reverse” were used to create
a PCR product of 1687 bp (Table 2C), and amplification at 72ºC was for 1 minute
and 50 sec. The fidelities of the pENTR221-LMBRD1 constructs were validated
by Sanger sequencing with primers “LMBRD1_seq_primer_5_R”,
“LMBRD1_seq_primer_3_F”, “LMBRD1_int_primer_5_F”, and
“LMBRD1_seq_primer_3_R”, which are designed to cover the entire LMBRD1
cDNA insert (Table 2D).
2.9.4 LR Recombination Reaction
The procedure was identical to Section 2.8.1, except that 9 µL of
pENTR221-LMBRD1 (56 ng/µL) was used for LR recombination reaction, and
OneShot Mach1-T1 E. coli (Invitrogen) was used for transformation.
2.9.5 Colony PCR of LR Recombinants
The procedure was identical to Section 2.9.3.
![Page 84: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/84.jpg)
84
2.9.6 Transfection
The procedure was identical to Section 2.8.3.
2.10 Labelled MethylTHF and Propionate Incorporation Assays
Fibroblast cell lines with a defect in cobalamin metabolism pathway can
be tested for their ability to utilize methionine synthase and methylmalonyl-CoA
mutase enzymes. Measurement of incorporation of label from [14
C]methylTHF or
[14
C]propionate into cellular macromolecules provides an indirect method of
measuring the function of MTR or MUT, respectively, in intact cells. In the former,
MTR catalyzes the transfer of labelled carbon from methylTHF to cobalamin and
then to homocysteine to produce methionine, which is incorporated into
macromolecules. In the latter, propionate is converted to propionyl-CoA, (S)-
methylmalonyl-CoA, and then (R)-methylmalonyl-CoA, which is catalyzed by
MUT into succinyl-CoA and incorporated into macromolecules. Incorporation of
radiolabel is decreased if MTR or MUT function is diminished. Fibroblasts were
plated in 35 mm tissue culture dishes at a density of 400,000 cells/dish. Cultures
were incubated for 18 hours in a medium containing 8.6 µM [14
C]methylTHF or
0.1 µM [14
C]propionate.60, 162
After incubation, cellular macromolecules were
precipitated in 5% trichloroacetic acid and radioactivity of precipitate resuspended
in 0.2 N NaOH was determined by liquid scintillation counting. Protein values
were measured by the Lowry assay to account for the difference in number of
![Page 85: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/85.jpg)
85
cells between each P35 tissue culture dish. Each cell line was assayed in triplicate.
2.11 Cobalamin Derivative Distribution Assay
This assay measured the ability of fibroblast lines to synthesize AdoCbl
and MeCbl from CNCbl. Confluent fibroblasts in T175 culture flasks were used
for the assay, and 20 µL of [57
Co]-CNCbl (MP Biomedicals) was pre-incubated
with 2 mL of human serum for 30 min at 37°C to allow binding of cobalamin to
transcobalamin. Serum with [57
Co]-CNCbl was mixed with 23 mL of serum-free
MEM and filter-sterilized. Fibroblasts were incubated for 96 hours in this final
medium containing 25 pg/mL of [57
Co]-CNCbl. Cells were harvested by
trypsinization and disrupted by freezing and thawing, cobalamins were extracted
in hot ethanol (80°C), and cobalamin derivatives were separated by high
performance liquid chromatography using a LiChrosorb RP-C8 column
(Phenomenex).93
Because this is a reverse phase chromatography, polar
compounds eluted faster than non-polar compounds. Consequently, cobalamin
derivatives were obtained in the order of OHCbl, CNCbl, AdoCbl, and MeCbl.
Radioactivity of fractions, co-eluting with each cobalamin derivative, was
quantitated by gamma-counting, and distribution of cobalamin was expressed as a
percentage of radioactivity in all fractions.
![Page 86: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/86.jpg)
86
2.12 Superose 12 Analysis of TC-Bound, Free and Enzyme-Bound Cbl
This assay measured the ability of fibroblast lines to take up TC-bound
cobalamin and deliver it to cellular compartments for association with enzymes.
Confluent fibroblasts in T175 culture flasks were used for the assay, and 20 µL of
[57
Co]-CNCbl (MP Biomedicals) was pre-incubated with 2 mL of human serum
for 30 min at 37°C to allow binding of cobalamin to transcobalamin. Serum with
[57
Co]-CNCbl was mixed with 23 mL of serum-free MEM and filter-sterilized.
Fibroblasts were incubated for 96 hours in this final medium containing 25 pg/mL
of [57
Co]-CNCbl. Cells were harvested by trypsinization, resuspended in 0.1M
potassium phosphate buffer (pH 7.4) and broken open by sonication using
Soniprep 150 (MSE Scientific Instruments). Disrupted cell membranes were
removed by ultracentrifugation at 171,500 x g, 5°C for 30 min, and free Cbl, TC-
bound Cbl (TC-Cbl) and MUT or MTR-bound cobalamin (enzyme-Cbl) were
separated by fast protein liquid chromatography using a Superose 12 column (GE
Healthcare Life Sciences). Because this is a size exclusion chromatography, high
MW compounds eluted faster than low MW compounds. Consequently, enzyme-
Cbl eluted first, TC-Cbl eluted next, and free Cbl eluted last. Radioactivity of
collected fractions was quantitated by gamma-counting, and distribution of
cobalamin was expressed as a percentage of radioactivity in all fractions.
![Page 87: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/87.jpg)
87
CHAPTER 3: RESULTS
3.1 Identification of Three Patients
Three patients were suspected to have inborn errors of cobalamin
metabolism upon detection of methylmalonic aciduria and hyperhomocysteinemia
by the referring clinicians. Ethnic background, age at diagnosis, and clinical
course of each patient greatly varied from one another. For WG4066 and WG4140,
fibroblast cell studies revealed a combined decrease in incorporation of labelled
methylTHF and propionate, an increase in uptake of labelled CNCbl, nearly
absent synthesis of AdoCbl and MeCbl, and an accumulation of large amounts of
unmetabolized CNCbl (Table 3). Their cellular phenotypes mimicked those of the
cblF disorder but no mutations in the LMBRD1 gene were found. Somatic cell
complementation and exome sequencing were performed on WG4066 and
WG4140 independently to identify the causes of their diseases. WG3630, referred
to our laboratory before the other two, was very difficult to diagnose because
incorporations of labelled propionate and methylTHF by fibroblasts were within
reference ranges and too high to allow for complementation analysis (Table 3). It
could not be determined whether it belonged to any known complementation
groups or not. Nonetheless, decreased synthesis of both AdoCbl and MeCbl and
moderate accumulation of unmetabolized CNCbl were observed. Eventually,
exome sequencing was performed on the genomic DNA of WG3630.
![Page 88: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/88.jpg)
88
WG4066 WG4140 WG3630 Reference Range
cblF Control
[14
C]MethylTHF
Incorporation
(pmoles/mg
protein/18h)
− OHCbl 43.6 26.4 98.9 43 ± 11 191 ± 112
+ OHCbl 111.8 68.1 231.0 297 ± 165 312 ± 207
[14
C]Propionate
Incorporation
(nmoles/mg
protein/18h)
− OHCbl 1.0 2.1 15.3 1.9 ± 1.7 13.1 ± 4.1
+ OHCbl 4.7 4.4 16.8 7.2 ± 3.0 14.2 ± 4.5
Cobalamin Distribution
(%)
OHCbl 2.8 2.6 10.2 8 ± 4 6 ± 3
CNCbl 91.2 90.2 58.5 81 ± 7 15 ± 13
AdoCbl 0.7 1.6 6.8 2.4 ± 0.6 15 ± 3
MeCbl 1.0 0.2 13.4 1.3 ± 1.1 56 ± 8
Table 3. Biochemical profiles of three patient fibroblasts. Biochemical
measurements were obtained from the initial assays performed on primary cell
lines at our medical genetics laboratory. Reference ranges are based on 12
measurements of cblF cell lines and around 200 measurements of control cell
lines in our laboratory over the years.
![Page 89: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/89.jpg)
89
3.2 Somatic Cell Complementation Analysis
WG4066 fibroblasts were fused with cells from all complementation
groups known to cause combined MMA and HC, namely cblC (WG3897,
WG4053), cblD (WG3646), and cblF (WG3365). Complementation was
performed with and without the addition of PEG to observe the effect of PEG-
induced cell fusion on increase of [14
C]propionate incorporation. Three-fold or
greater increase in incorporation was observed when WG4066 was fused with
each of the four cell lines. This meant that the defect in WG4066 is neither cblC,
cblD, nor cblF (Table 4).
WG4140 fibroblast cells were fused with cells from cblC (WG4136),
cblF (WG3365, WG3377), and WG4066. Complementation was performed as
above. A two to three-fold increase in incorporation was observed when WG4140
was fused each of the cblC or cblF cell lines. No complementation was observed
when WG4140 and WG4066 were fused together. This meant that the defect in
WG4140 is neither cblC nor cblF but identical to the one in WG4066 (Table 5).
![Page 90: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/90.jpg)
90
Cell Line Complementation
Group
Cell line
propionate
incorporation
before
complementation
[14
C]propionate/propionate
incorporation (nmoles/mg protein/18h)
Complementation
without cell fusion
(w/o PEG)
Complementation
with cell fusion
(+ PEG)
WG4066 0.7
0.7 0.7 0.8
WG3897 cblC 0.6 1.0 3.0
0.6 0.6 0.7 1.0 1.0 1.0 3.0 3.2 2.9
WG4053 cblC 1.9 1.2 3.6
1.9 1.9 1.8 1.1 1.1 1.2 3.4 3.8 3.7
WG3646 cblD 0.7 1.1 4.5
0.6 0.7 0.7 1.1 1.1 1.1 4.4 4.5 4.5
WG3365 cblF 1.8 1.3 4.9
1.8 1.7 2.0 1.3 1.3 1.4 5.0 4.8 5.0
Table 4. Somatic cell complementation of WG4066. Complementation analysis
was performed by pairing WG4066 cell line with two cblC, one cblD, and one
cblF cell lines. Baseline [14
C]propionate incorporation was measured before
complementation for each cell line. Complementations were performed and level
of [14
C]propionate incorporations in those without cell fusion and those with cell
fusion were compared. Bold numbers represent averages of triplicates for each
condition.
![Page 91: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/91.jpg)
91
Cell Line Complementation
Group
Cell line
propionate
incorporation
before
complementation
[14
C]propionate/propionate
incorporation (nmoles/mg protein/18h)
Complementation
without cell fusion
(w/o PEG)
Complementation
with cell fusion
(+ PEG)
WG4140 1.9
1.9 1.8 1.9
WG4136 cblC 0.2 1.1 2.5
0.2 0.2 0.2 1.2 1.0 1.1 2.3 2.5 2.5
WG3365 cblF 1.5 1.6 4.8
1.4 1.5 1.5 1.6 1.6 1.7 4.4 4.9 5.0
WG3377 cblF 1.0 1.4 4.8
0.9 1.0 1.0 1.4 1.4 1.3 5.0 4.7 4.8
WG4066 Unknown 1.5 1.6 1.9
1.5 1.5 1.5 1.5 1.6 1.5 1.9 2.0 1.9
Table 5. Somatic cell complementation of WG4140. Complementation analysis
was performed by pairing WG4140 cell line with one cblC, two cblF, and
WG4066 cell lines. Baseline [14
C]propionate incorporation was measured before
complementation for each cell line. Complementations were performed and level
of [14
C]propionate incorporations in those without cell fusion and those with cell
fusion were compared. Bold numbers represent averages of triplicates for each
condition.
![Page 92: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/92.jpg)
92
3.3 Discovery of Causative Gene in Each Patient
3.3.1 WG4066
The exome sequencing and variant filtering process identified three
candidate genes, TPRG1, LRP2, and ABCD4, each containing two heterozygous,
potentially damaging mutations (Figure 6). The LRP2 gene was initially noted as
a possible candidate because of its role in cobalamin absorption. Nonetheless, the
three genes were re-sequenced in the father, mother, elder sister, and proband to
check the fidelity of massively-parallel sequencing and eliminate candidate genes
based on segregation pattern of mutations (Table 6).
Both mutations in TPRG1 were detected in the paternal DNA by Sanger
sequencing, meaning that they were present in cis and passed down to the patient
on a single allele. In fact, the c.422G>T mutation did not affect the gene product
because the upstream c.183_192del (p.Tyr61Stop) mutation created a premature
stop codon. Since the patient must have inherited the maternal, wild type allele,
TPRG1 mutations do not cause the patient’s disorder. For LRP2, the father and
mother were heterozygous for each of the mutant alleles, but the asymptomatic
sibling was found to be a compound heterozygote. Therefore, LRP2 mutations are
also not responsible for the defect. For ABCD4, the father and mother were again
heterozygous for each of the mutant alleles, c.956A>G and c.1746_1747insCT,
respectively. However, unlike LRP2, the sibling did not carry either of the
mutations. This pinpointed ABCD4 as the disease-causing gene.
![Page 93: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/93.jpg)
93
TPRG1
LRP2
ABCD4
Homozygous
wild type
c.183_192del
p.Tyr61Stop
c.422G>T
p.Ser141Ile
Heterozygous
mutant
c.3932G>A
p.Arg1311His
c.10937G>A
p.Arg3646His
c.956A>G
p.Tyr319Cys
c.1746_1747insCT
p.Glu583LeufsX9
Glu C
C
G
C
G
A
C
G
A
A
G
G
A
C
G
C
C
T
C
T
T
C
T
T
G
G
A
A
G
G
A
A
A
A
G
G
Leu
![Page 94: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/94.jpg)
94
Figure 6. DNA sequencing chromatograms of heterozygous mutations in
TPRG1, LRP2, and ABCD4 in the family of WG4066. For each chromatogram,
the black box indicates the affected codon and the black arrow indicates the
mutant base. For the frameshift insertion in ABCD4, wild type GAG, coding for
glutamic acid, and mutant CTG, coding for leucine, are sequenced out of frame by
2 nucleotides because the exon was sequenced in the reverse direction. The red
box indicates the dinucleotide insertion. Left column: homozygous wild type;
right column: heterozygous mutant.
TPRG1 LRP2 ABCD4
Father c.183_192del c.422G>T WT c.10937G>A c.956A>G WT
Mother WT WT c.3932G>A WT WT c.1746_1747insCT
Sibling WT WT c.3932G>A c.10937G>A WT WT
Patient c.183_192del c.422G>T c.3932G>A c.10937G>A c.956A>G c.1746_1747insCT
Table 6. Segregation analysis of TPRG1, LRP2 and ABCD4 mutations in the
family of WG4066. Three candidate genes were re-sequenced to validate the
presence of each heterozygous mutation in the father, mother, asymptomatic
sibling, and/or proband. Nucleotide numbering is based on the cDNA sequence of
each gene with 1 corresponding to the A of the ATG translation initiation codon.
WT, wild type.
![Page 95: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/95.jpg)
95
3.3.2 WG4140
Concurrent with our efforts to uncover the molecular basis of the defect in
WG4066, the research team led by Dr. Brian Fowler investigated the patient
WG4140 to find disease-causing mutations. Microcell-mediated chromosome
transfer identified chromosome 14 as the site of the mutated gene, and exome
sequencing of chromosome 14 led to the identification of nine variants in eight
genes. Further evaluation of the variants allowed them to narrow down to two
variants in the ABCD4 gene, c.542+1G>T and c.1456G>T, as the best candidates.
3.3.3 WG3630
Exome sequencing discovered potentially damaging variants in six
candidate genes, MUTYH, IL17RD, TECPR1, VPS13B, ABCD4, and ANGEL1,
each with compound heterozygous or homozygous mutations. A homozygous
mutation in ABCD4 was instantly recognized as the best candidate because
mutations in this gene had already been identified and confirmed to be causative
in WG4066 and WG4140. Exon 4 of the ABCD4 gene, containing the c.423C>G
mutation, was sequenced in the aunt, father, mother, elder sister, proband, and
younger brother to confirm the correct segregation pattern of mutation (Figure 7).
![Page 96: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/96.jpg)
96
A.
Hcy 4.71 μmol/L
MTHFR C/C
ABCD4 C/G
I-B
II-A
I-C I-A
Hcy 71.47 μmol/L
MTHFR T/T
ABCD4 G/G
II-B II-C
Hcy 21.08 μmol/L
MTHFR T/T
ABCD4 C/G
Hcy 51.02 μmol/L
MTHFR C/T
ABCD4 C/G
Hcy 29.22 μmol/L
MTHFR C/T
ABCD4 C/G
Hcy 7.24 μmol/L
MTHFR C/T
ABCD4 C/G
B.
Homozygous
wild type
Exon 4 Intron4 Exon 4 Intron4 Exon 4 Intron4
Heterozygous
carrier
Homozygous
mutant
Figure 7. (A) Pedigree of the family of WG3630 showing plasma homocysteine
levels and genotypes. For the MTHFR c.677C>T polymorphism, C is the major
allele and T is the minor allele. For the ABCD4 c.423C>G mutation, C is the wild
type allele, and G is the mutant allele. I-A, aunt; I-B, father; I-C, mother; II-A, elder
sister; II-B, proband; and II-C, younger brother. (B) DNA sequencing
chromatograms of the ABCD4 c.423C>G (p.N141K) mutation. For each
chromatogram, the black box indicates the affected codon, the black arrow indicates
the mutant base, and the red line indicates the exon-intron boundary. Left column:
homozygous wild type (MCH23 control); middle column: heterozygous carrier; and
right column: homozygous mutant.
![Page 97: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/97.jpg)
97
3.4 Transfections and Assessments of Biochemical Phenotypes
Eight cell lines in Table 1 were immortalized and transfected with wild
type ABCD4 and LMBRD1 constructs. The transfection with ABCD4 was
performed to see correction of biochemical phenotypes in WG4066 and WG4140
patient cell lines and confirm ABCD4 as the gene responsible for the new defect.
The other six cell lines were selected as various controls as described in Section 2.3.
The transfection with LMBRD1 was performed to see correction of biochemical
phenotypes in the WG3365 and WG3377 cblF cell lines and assess whether
WG4066 and WG4140 cells were biochemically affected or not. MethylTHF
incorporation, propionate incorporation, cobalamin derivative distribution assay,
and Superose 12 analysis of TC-bound, free, and enzyme-bound cobalamin were
assayed.
3.4.1 Labelled MethylTHF and Propionate Incorporation Assays
A total of 24 immortalized cell lines were assayed; MCH64, MCH46,
WG4066, WG4140, WG3365, WG3377, WG3646, and WG4095 were either not
transfected, transfected with wild type ABCD4, or transfected with wild type
LMBRD1 (Tables 7, 8). For both assays, non-transfected MCH64 and MCH46
showed incorporation levels within the reference range for controls as expected.
Six patient cell lines, including WG4066 and WG4140, showed incorporation
levels within the reference range for cblF patients; WG3646 and WG4095 do not
![Page 98: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/98.jpg)
98
have the cblF defect but they showed low incorporation levels expected of cblD-
combined and cblC defects, respectively.
Transfection with ABCD4 or LMBRD1 did not affect incorporation levels
of positive controls, MCH64 and MCH46, and negative controls, WG3646 and
WG4095. Slight increases or decreases in incorporation levels were within our
expectation of variability in incorporation assay results. As a result, expression of
wild type ABCD4 and LMBRD1 were shown to have no effects on WG3646 and
WG4095 since the two cell lines carried defects in metabolic steps downstream to
lysosomal cobalamin export.
Transfection of WG4066 and WG4140, which carry compound
heterozygous mutations in ABCD4, with wild type ABCD4 resulted in the
correction of incorporation levels to within the control reference range. Similarly,
transfection of WG3365 and WG3377, which carry compound heterozygous
mutations in LMBRD1, with wild type LMBRD1 resulted in the correction of
incorporation levels. Unexpectedly, when cblF cell lines were transfected with
ABCD4, a similar restoration was observed. However, when WG4066 and
WG4140 cell lines were transfected with LMBRD1 in a reciprocal experiment, no
restoration of incorporation levels was observed.
![Page 99: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/99.jpg)
99
[14
C]methylTHF incorporation
(pmoles/mg protein/18h)
Not transfected Transfected with
ABCD4
Transfected with
LMBRD1
MCH64
170.7 (12.5) 145.5 (3.8) 154.3 (8.3)
166.3 170.3 198.1 146.2 143.0 144.7 165.7 151.0 146.3
162.3 163.1 164.2 146.8 152.4 140.0
MCH46
94.3 (7.4) 95.4 (7.5) 142.6 (2.1)
92.2 103.1 105.5 97.8 92.1 80.5 140.6 141.8 145.5
90.3 85.1 89.4 103.1 98.4 100.8
WG4066
46.4 (8.2) 105.7 (3.3) 64.3 (0.8)
49.6 57.9 54.9 101.3 106.5 109.3 65.4 64.3 63.3
36.5 39.3 39.9
WG4140
29.4 (2.2) 80.2 (4.1) 44.8 (0.9)
29.9 34.0 27.9 85.4 75.3 80.0 46.2 44.0 44.4
27.9 27.5 29.0
WG3365
(cblF)
37.1 (0.8) 95.6 (2.8) 121.8 (19.3)
37.5 35.9 37.9 91.7 98.4 96.8 109.7 106.5 149.1
WG3377
(cblF)
46.1 (1.4) 95.0 (15.7) 180.1 (12.2)
44.4 46.2 47.8 87.1 116.9 81.0 165.6 179.2 195.4
WG3646
(cblD)
40.8 (2.2) 38.7 (2.3) 21.2 (2.0)
43.8 38.7 39.9 35.5 41.0 39.6 21.7 18.6 23.4
WG4095
(cblC)
48.0 (4.2) 45.0 (1.8) 40.5 (7.7)
42.6 53.0 48.5 43.9 43.5 47.6 34.3 51.4 35.9
Table 7. Labelled methylTHF incorporations of 24 cell lines. [14
C]methylTHF
incorporation experiments were performed in triplicate and were repeated for a
few cell lines. Averages are written in bold numbers and standard deviations are
written beside them in brackets. Reference range for the cblF patients is 43 ± 11,
and for controls is 191 ± 112.
![Page 100: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/100.jpg)
100
[14
C]propionate incorporation
(nmoles/mg protein/18h)
Not transfected Transfected with
ABCD4
Transfected with
LMBRD1
MCH64 8.3 (0.1) 7.6 (0.2) 8.4 (0.6)
8.4 8.2 8.4 7.4 7.5 7.9 7.6 9.0 8.7
MCH46
9.4 (0.9) 9.5 (0.2) 9.9 (0.6)
8.4 8.7 9.0 9.4 9.8 9.4 9.5 9.5 10.8
11.2 9.5 9.8
WG4066 1.2 (0.0) 13.1 (0.3) 1.1 (0.0)
1.2 1.2 1.2 13.0 13.4 12.8 1.0 1.1 1.1
WG4140
1.6 (0.0) 11.9 (0.3) 2.7 (0.7)
1.5 1.6 1.6 12.1 12.2 11.5 2.5 2.3 2.2
4.2 2.7 2.0
WG3365
(cblF)
2.2 (0.2) 14.7 (0.7) 15.0 (0.4)
2.0 2.2 2.4 15.7 14.2 14.1 15.1 14.5 15.3
WG3377
(cblF)
1.1 (0.0) 10.3 (0.1) 15.0 (1.1)
1.1 1.1 1.1 10.4 10.2 10.4 14.6 14.0 16.5
WG3646
(cblD)
1.6 (0.0) 1.1 (0.1) 2.0 (0.8)
1.6 1.6 1.5 1.1 1.0 1.2 3.2 1.5 1.4
WG4095
(cblC)
1.5 (0.1) 1.1 (0.0) 2.0 (0.2)
1.5 1.6 1.4 1.2 1.1 1.2 1.7 2.0 2.0
2.0 2.3 1.8
Table 8. Labelled propionate incorporations of 24 cell lines. [14
C]propionate
incorporation experiments were performed in triplicate and were repeated for a
few cell lines. Averages are written in bold numbers and standard deviations are
written beside them in brackets. Reference range for cblF patients is 1.9 ± 1.7, and
for controls is 13.1 ± 4.1.
![Page 101: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/101.jpg)
101
3.4.2 Cobalamin Derivative Distribution Assay
A total of 18 immortalized cell lines were assayed; MCH64, MCH46,
WG4066, WG4140, WG3365, and WG3377 were either not transfected,
transfected with wild type ABCD4, or transfected with wild type LMBRD1
(Figure 8). Non-transfected MCH64 and MCH46 showed normal syntheses of
AdoCbl and MeCbl with percentages within reference ranges. Control cell lines
were not affected by transfection with ABCD4 or LMBRD1, and AdoCbl and
MeCbl levels remained within reference ranges. WG4066, WG4140, WG3365,
and WG3377 cell lines showed nearly absent synthesis of AdoCbl and MeCbl,
which is commonly observed in the cblF fibroblasts; percentages of AdoCbl were
1.7 - 3.1% while percentages of MeCbl were 0.4 - 1.4%. Importantly, they showed
very high percentages of unmetabolized CNCbl ranging from 76.1 to 82.1%.
Transfection of WG4066 and WG4140 with wild type ABCD4 resulted in
the increases in AdoCbl and MeCbl syntheses; AdoCbl levels were not as high as
normal values but MeCbl levels were within the accepted normal range. This
change was accompanied by corresponding decreases in CNCbl levels.
Interestingly, when WG3365 and WG3377 were transfected with ABCD4, slightly
greater increases in AdoCbl synthesis and slightly lower increases in MeCbl
synthesis were observed when compared to WG4066 and WG4140. They also
displayed corresponding decreases in CNCbl levels.
In parallel, transfection of WG3365 and WG3377 with wild type
![Page 102: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/102.jpg)
102
LMBRD1 resulted in the increases of AdoCbl and MeCbl syntheses with both
levels reaching reference ranges. As a result, CNCbl levels were drastically
decreased. However, when WG4066 and WG4140 were transfected with
LMBRD1 in a reciprocal experiment, no increases in AdoCbl and MeCbl
syntheses were observed and CNCbl levels remained high.
![Page 103: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/103.jpg)
103
Not transfected
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
OHCbl CNCbl
AdoCbl MeCbl
Transfected with ABCD4
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
Transfected with LMBRD1
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
Figure 8. Cobalamin derivative distributions of 18 cell lines. Six cell lines
were assayed before transfection and after transfection with ABCD4 and LMBRD1.
Each bar represents a value obtained by combining gamma radioactivity counts at
the elution peak of each cobalamin derivative. A legend is located at the top left
corner.
![Page 104: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/104.jpg)
104
3.4.3 Superose 12 Analysis
Identities of three peaks in elution patterns were confirmed by comparing
three samples; MCH64, a control cell line, was expected to produce mostly
enzyme-Cbl; WG3630, a patient cell line, was predicted to produce mostly free
Cbl; and human serum-Cbl control, a mixture of 1.6 µL of [57
Co]-CNCbl, 160 µL
of human serum, and 840 µL of potassium phosphate buffer, was expected to
produce mostly TC-Cbl (Figure 9). After comparing the patterns, the first peak
(fractions 13-17) was confirmed to be enzyme-Cbl, the second peak (fractions 19-
22) was confirmed to be TC-Cbl, and the third peak (fractions 27-34) was
confirmed to be free Cbl. MUT and MTR enzymes had been reported to migrate
in a single peak at ~150 kDa,74
and the identity of this peak in the human serum-
Cbl control was in fact haptocorrin-bound cobalamin which migrates at ~150 kDa
due to heavy glycosylation.163
The MW of TC is 43 kDa and cobalamin is ~1.3
kDa.20
A total of 18 immortalized cell lines were assayed; MCH64, MCH46,
WG4066, WG4140, WG3365, and WG3377 were either not transfected,
transfected with wild type ABCD4, or transfected with wild type LMBRD1
(Figure 10). Non-transfected MCH64 and MCH46 showed normal levels of
enzyme-Cbl at 73.6 - 78.7% and free Cbl at 1.9 - 6.0% because cobalamins were
properly delivered to target compartments and associated with MTR and MUT.
Control cell lines were not affected by transfection with ABCD4 or LMBRD1, and
![Page 105: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/105.jpg)
105
enzyme-Cbl levels remained between 76.4 - 82.0%. WG4066, WG4140, WG3365,
and WG3377 cell lines showed very low levels of enzyme-Cbl at 2.3 - 3.8% and
high levels of free Cbl at 62.4 - 82.6% because unbound cobalamins were trapped
in the lysosomes. This finding corresponded to the high levels of unmetabolized
CNCbl in the cblF and two patient cell lines assessed by cobalamin derivative
distribution assay.
Transfection of WG4066 and WG4140 with wild type ABCD4 resulted in
the increases in enzyme-Cbl levels to 79.1 and 70.5%, respectively. This change
was accompanied by corresponding decreases in free Cbl levels to 2.8 and 4.1%.
Interestingly, when WG3365 and WG3377 were transfected with ABCD4,
moderate increases in enzyme-Cbl levels to 42.7 and 56.1%, respectively, were
observed. They also displayed corresponding decreases in free Cbl levels to 43.1
and 20.8%.
Similarly, transfection of WG3365 and WG3377 with wild type LMBRD1
resulted in the increases in enzyme-Cbl levels to 78.1 and 80.3%, respectively.
Consequently, free Cbl levels dropped to 9.2 and 3.4%. However, when WG4066
and WG4140 were transfected with LMBRD1 in a reciprocal experiment, no
increases in enzyme-Cbl levels were observed as they remained at 4.8 and 2.6%,
respectively. Free Cbl levels also remained high at 74.5 and 83.8%.
![Page 106: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/106.jpg)
106
A. MCH64
0
1000
2000
3000
4000
5000
1 2 3 4 5 6 7 8 9 10111213141516171819202122232425262728293031323334353637383940
B. WG3630
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
1 2 3 4 5 6 7 8 9 10111213141516171819202122232425262728293031323334353637383940
C. Human serum-Cbl control
0
500
1000
1500
2000
2500
1 2 3 4 5 6 7 8 9 10111213141516171819202122232425262728293031323334353637383940
Figure 9. Elution patterns of Superose 12 analyses. Three elution patterns of
(A) MCH64, (B) WG3630, and (C) Human serum-Cbl control are shown as
examples. For each sample, 40 fractions of decreasing MW were collected.
Identity of each peak is shown below a dashed line. Percentage of each peak in
total cobalamin radioactivity is shown above the peak.
78.7%
9.1% 6.0%
8.8% 6.5%
76.2%
25.9%
56.0%
5.7%
Enzyme-Cbl TC-Cbl Free Cbl
![Page 107: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/107.jpg)
107
Not transfected
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
TC-Cbl Free Cbl Enzyme-Cbl
Transfected with ABCD4
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
Transfected with LMBRD1
0
20
40
60
80
MCH64 MCH46 WG4066 WG4140 WG3365 WG3377
% o
f to
tal
cob
ala
min
Figure 10. Superose 12 analyses of 18 cell lines. Six cell lines were assayed
before transfection and after transfection with ABCD4 and LMBRD1. Each bar
represents a value obtained by combining gamma radioactivity counts at the
elution peak corresponding to the size of the cobalamin form. A legend is located
at the top right corner.
![Page 108: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/108.jpg)
108
CHAPTER 4: DISCUSSION
4.1 Novel Inborn Error of Vitamin B12 Metabolism
This thesis reports the description of patients with a novel inborn error of
cobalamin metabolism, the designation of a new complementation group, the
identification of the responsible gene, and the correction of biochemical
phenotypes by expression of wild type ABCD4 cDNA in patient cells.
Three patients with MMA and HC were referred to our laboratory for
suspected inborn errors of cobalamin metabolism. Based on biochemical findings
from cultured fibroblasts, WG4066 and WG4140 were identified as cblF-
phenocopies with failure of lysosomal cobalamin transport but without mutations
in the LMBRD1 gene. Cells clearly showed accumulation of non-protein bound,
unmodified cyano form of cobalamin and decreased synthesis of MeCbl and
AdoCbl associated with MTR and MUT, respectively. WG3630 was a very
unusual case because methylTHF and propionate incorporations were assessed to
be normal but moderate decreases in MeCbl and AdoCbl syntheses and
accumulation of CNCbl were observed (Table 3).
Somatic cell complementation revealed that WG4066 and WG4140 did
not belong to any of the known eight complementation groups. Based on the
absence of complementation when cells from the two patients were fused together,
it was confirmed that WG4066 and WG4140 suffer from the same defect in
![Page 109: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/109.jpg)
109
cobalamin metabolism (Tables 4, 5). The designation of cblJ has been proposed
for this novel complementation group.
To identify the genetic defect in WG4066 and WG4140, exome capture
and massively-parallel sequencing were independently employed by our
laboratory and the laboratories of Dr. Brian Fowler and Dr. Matthias Baumgartner,
respectively. Exome sequencing of WG3630 was performed after the other two
patients without the expectation that this patient carried the same defect.
Comparing genetic variants in patients to dbSNP and 1000 Genomes databases
was beneficial in finding private mutations and narrowing down to a small
number of candidate genes with compound heterozygous or homozygous
mutations. In patients WG4066, WG4140, and WG3630, three, eight, and six
candidate genes, respectively, were discovered after the filtering process.
Therefore, the current report demonstrated the efficacy of exome sequencing in
identifying a disease-causing gene from unrelated patients.
Combining the exome variants data of WG4066 and WG4140, it was
discovered that both patients carried compound heterozygous mutations in the
ABCD4 gene, which was selected as the top candidate gene by each laboratory
even before merging the independent exome sequencing efforts (Table 6).
Subsequently, the exome of WG3630 was sequenced and a homozygous mutation
in ABCD4 immediately stood out as the best candidate. To further confirm the
causality of ABCD4 mutations in the patients, I transfected the fibroblasts of
![Page 110: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/110.jpg)
110
WG4066 and WG4140, along with other control cell lines, with a wild type
ABCD4 cDNA. A retroviral expression vector system, previously established to be
highly effective, was utilized.84, 161
It is worthwhile noting that the success of this
project owes much to the development of next-generation sequencing techniques.
Exome sequencing of a single proband, identification of a candidate gene, and
confirmation by transfection with a wild type copy of the gene were similarly
accomplished before with complex I deficiency.164
The transfection experiment was successful in demonstrating that ABCD4
is a new player in vitamin B12 metabolism and is defective in the three patients
(Tables 7, 8 & Figures 8, 10). Transfections with ABCD4 and LMBRD1 did not
have any unexpected effects on cellular cobalamin metabolism as assessed by four
biochemical assays on the control cell lines. MethylTHF and propionate
incorporations were assayed for transfected WG3646 and WG4095 cell lines and
they did not show increases in incorporations since defects in MMADHC and
MMACHC could not be restored. Expression of wild type ABCD4 could correct
cobalamin metabolism in both WG4066 and WG4140 patient cells, meaning that
ABCD4 was the gene causing the cblJ defect. In the meantime, expression of wild
type LMBRD1 could correct cobalamin metabolism in the two cblF cells,
WG3365 and WG3377.
A serendipitous finding was that cblF cells with ABCD4-transfection, still
lacking a functioning copy of the LMBRD1 gene, were capable of lysosomal
![Page 111: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/111.jpg)
111
cobalamin export resulting in roughly 50% correction of cobalamin cofactor
synthesis. On the other hand, cblJ cells with LMBRD1-transfection, still lacking a
functioning copy of the ABCD4 gene, were incapable of lysosomal cobalamin
export resulting in no enhancement of cobalamin cofactor synthesis. Given the
observation that overexpression of ABCD4 could correct the cblF defect while
overexpression of LMBD1 could not correct the cblJ defect, I speculate that
ABCD4 may be the actual transporter of cobalamin while LMBD1 has a
regulatory or accessory role.
In retrospect, the phenotypes of three patients were not outwardly
different from those of cblF patients. Clinical findings overlapping with those
seen in more than one third of cblF patients were hypotonia and feeding
difficulties seen in WG4066, cardiac defects, hypotonia, feeding difficulties,
developmental delay, failure to thrive, and small for gestational age seen in
WG4140, and low serum cobalamin level seen in WG3630. Some of the rare
findings seen in a few cases of cblF were lethargy, neutropenia, and
thrombocytopenia seen in WG4066, facial dysmorphism, mild cerebral atrophy,
and neutropenia seen in WG4140, and hyperpigmentation and mild microcytic
anemia seen in WG3630. Most cblF patients were diagnosed in the first year of
age, some following positive newborn screening, although one was not diagnosed
until age of 11 years. Similarly, WG4066, WG4140, and WG3630 were diagnosed
at one month, 16 months, and eight years of age, respectively.
![Page 112: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/112.jpg)
112
In the unusual WG3630 patient, Superose 12 analysis of fibroblasts was
helpful in unveiling an accumulation of free, non-protein bound cobalamin and
validate that this patient was suffering from a mild case of failure of lysosomal
cobalamin export (Figure 9B). Increased homocysteine levels in four members of
the WG3630 family were also peculiar (Figure 7A). Segregation analysis of the
MTHFR c.677C>T polymorphism suggested that the hyperhomocysteinemia in
the sister may be attributed to a homozygous MTHFR polymorphism which is
known to result in ~65% decrease in the enzyme activity.114
However, the
homocysteine levels could not be exclusively explained by the MTHFR
polymorphism and the ABCD4 mutation because the mother had identical
genotypes with the father and the aunt but showed normal plasma homocysteine
and cobalamin levels. Therefore, their homocysteine levels may be affected by
combinations of the MTHFR polymorphism, the ABCD4 mutation, and other
genetic/environmental/dietary factors.
Based on our current knowledge, it would be hard to distinguish cblF and
cblJ patients on clinical and laboratory grounds alone. The cblF defect itself
causes highly variable phenotypes in 15 reported patients. If a patient presented
with a phenotype suggestive of cblF or cblJ defects, a definitive diagnosis would
require somatic cell complementation analysis and/or sequencing of the LMBRD1
and ABCD4 genes. By identifying more cblF and cblJ patients, we may be able to
catalogue the spectrum of phenotypes and discover differences between the two.
![Page 113: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/113.jpg)
113
4.2 Role of ABCD4 in Vitamin B12 Metabolism
There has been little effort to investigate the ABCD4 protein compared to
the other three proteins of the ABC transporter subfamily D, so the function and
structure of it remains unexplored. While initially reported as a peroxisomal
membrane protein, a later investigation reported ABCD4 as an ER membrane
protein. However, our collaborating research team led by Dr. Frank Rutsch and Dr.
Matthias Baumgartner disputed the previous findings and observed a strong co-
localization of ABCD4 with lysosomal markers, including LMBD1, using the
fluorescence microscopy technology (data not shown). It could be argued that,
through evolution, ABCD4 acquired a role in cobalamin metabolism and localized
to the lysosomes unlike its peroxisomal homologues.
Another example of a heterodimer formed by two ABC half-transporters
is the antigen peptide transporter formed by dimerization of TAP1/ABCB2 and
TAP2/ABCD3 which is responsible for transporting antigens from cytoplasm to
ER lumen for association with MHC class I molecules.142, 165
Given that ABCD4
is the only member of its subfamily localized to the lysosomes, it perhaps forms a
homodimer for its function as the transporter of cobalamin.
In cobalamin synthesizing bacteria and archaea, cobalamin is synthesized
in a biosynthetic pathway partly shared by heme, chlorophyll, and siroheme
syntheses. It is predicted that the pathway first evolved to produce cobalamin.13
Knowing such ancient origin of cobalamin in life forms, we continue to discover
![Page 114: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/114.jpg)
114
intricate steps involved in the metabolism of cobalamin in humans. To date, ABC
importers have not been reported in eukaryotes but have been limited to
prokaryotes.142, 148
With further studies, ABCD4 may be proven to be the first
ABC importer reported in the empire eukaryota because ABCD4 transports
cobalamin into the cytoplasm, not out of it. In bacteria, the ABC transporter
BtuCD specifically transports cobalamin across the inner membrane and into the
cytoplasm.166
In WG4066, the c.956A>G mutation resulted in a tyrosine to cysteine
substitution (p.Y319C) predicted to be “probably damaging” by the PolyPhen-2
program (http://genetics.bwh.harvard.edu/pph2). On the other hand, the
c.1746_1747insCT mutation resulted in a frameshifting mutation (p.E583LfsX9)
affecting 8 downstream residues and then creating a premature stop codon (UGA).
By RT-PCR, the c.542+1G>T and c.1456G>T mutations in WG4140 were found
to result in in-frame skipping of exon 5 (p.D143_S181del) and of exons 13 and 14
(p.G443_S485del) (data not shown). In WG3630, the homozygous c.423C>G
mutation caused a asparagine to lysine substitution (p.N141K) also predicted to be
“probably damaging” by the PolyPhen-2. Moreover, both p.Y319C and p.N141K
missense mutations occurred at residues evolutionarily conserved all the way
down to zebra fish (http://genome.ucsc.edu). Therefore, all five mutations could
severely damage the ABCD4 protein.
ABCD4 has been broadly divided into the N-terminal TMD (residues 39-
![Page 115: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/115.jpg)
115
332) and the C-terminal NBD (residues 389-603), which are two fundamental
domains of an ABC transporter (Figure 4). Collectively, three mutations, p.N141K,
p.D143_S181del, and p.Y319C, occurred in the TMD while the other two
mutations, p.G486C and p.E583LfsX9, occurred in the NBD. Based on these five
mutations, no preference was observed for the location of mutations. It is possible
that they affect domains or regions essential for cobalamin binding and
transporting or protein-protein interaction.
In conclusion, the novel disorder, named cblJ, is an autosomal recessive
disorder caused by mutations in the ABCD4 gene. Patients present with
methylmalonic aciduria, hyperhomocysteinemia, and other symptoms also found
in patients with the cblF defect. I suggest that ABCD4, an ABC transporter, is an
essential component of intracellular cobalamin metabolism and interacts with
LMBD1 to allow transport of vitamin B12 out of the lysosome.
![Page 116: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/116.jpg)
116
ORIGINAL CONTRIBUTIONS TO SCIENCE
Identification and biochemical characterization of the cblJ disease, a novel
inborn error of vitamin B12 metabolism
Identification of ABCD4 as the causative gene in the cblJ disease
Discovery of overexpression of ABCD4 mildly correcting the cblF defect and
overexpression of LMBD1 not correcting the cblJ defect
![Page 117: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/117.jpg)
117
BIBLIOGRAPHY
1. Voet D and Voet JG (2004) Biochemistry, 3rd ed. John Wiley & Sons, Inc,
Hoboken, NJ
2. Banerjee R (2006) B12 trafficking in mammals: A case for coenzyme escort
service. ACS Chem Biol 1 (3):149-159
3. Annibale B, Lahner E, and Fave GD (2011) Diagnosis and management of
pernicious anemia. Curr Gastroenterol Rep 13 (6):518-524
4. Minot GR and Murphy WP (1926) Treatment of pernicious anemia by a
special diet. J Am Med Assoc 87 (7):470-476
5. Smith EL (1948) Purification of anti-pernicious anaemia factors from liver.
Nature 161 (4095):638
6. Rickes EL, Brink NG, Koniuszy FR, Wood TR, and Folkers K (1948)
Crystalline Vitamin B12. Science 107 (2781):396-397
7. Shorb MS (1948) Activity of Vitamin B12 for the Growth of Lactobacillus
lactis. Science 107 (2781):397-398
8. Banerjee R and Ragsdale SW (2003) The many faces of vitamin B12:
catalysis by cobalamin-dependent enzymes. Annu Rev Biochem 72:209-247
9. Hodgkin DC, Kamper J, Mackay M, Pickworth J, Trueblood KN, and White
JG (1956) Structure of vitamin B12. Nature 178 (4524):64-66
10. Motwani HV, Qiu S, Golding BT, Kylin H, and Tornqvist M (2011)
Cob(I)alamin reacts with sucralose to afford an alkylcobalamin: relevance to
in vivo cobalamin and sucralose interaction. Food Chem Toxicol 49 (4):750-
757
11. Krautler B (2005) Vitamin B12: chemistry and biochemistry. Biochem Soc
Trans 33 (Pt:4):4-10
12. Watanabe F (2007) Vitamin B12 sources and bioavailability. Exp Biol Med
(Maywood ) 232 (10):1266-1274
13. Roth JR, Lawrence JG, and Bobik TA (1996) Cobalamin (coenzyme B12):
synthesis and biological significance. Annu Rev Microbiol 50:137-181
14. Randaccio L, Geremia S, Demitri N, and Wuerges J (2010) Vitamin B12:
unique metalorganic compounds and the most complex vitamins. Molecules
15 (5):3228-3259
15. Barker HA, Rooze V, Suzuki F, and Iodice AA (1964) The Glutamate
Mutase System. Assays And Properties. J Biol Chem 239:3260-3266
16. Krasotkina J, Walters T, Maruya KA, and Ragsdale SW (2001)
Characterization of the B12- and iron-sulfur-containing reductive
dehalogenase from Desulfitobacterium chlororespirans. J Biol Chem 276
(44):40991-40997
17. Kräutler B, Fieber W, Ostermann S, Fasching M, Ongania KH, Gruber K,
Kratky C, Mikl C, Siebert A, and Diekert G (2003) The Cofactor of
![Page 118: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/118.jpg)
118
Tetrachloroethene Reductive Dehalogenase of Dehalospirillum multivorans
Is Norpseudo-B12, a New Type of a Natural Corrinoid. HCA 86 (11):3698-
3716
18. Watkins D and Rosenblatt DS (2011) Inborn errors of cobalamin absorption
and metabolism. Am J Med Genet C Semin Med Genet 157 (1):33-44
19. Leclerc D, Campeau E, Goyette P, Adjalla CE, Christensen B, Ross M,
Eydoux P, Rosenblatt DS, Rozen R, and Gravel RA (1996) Human
methionine synthase: cDNA cloning and identification of mutations in
patients of the cblG complementation group of folate/cobalamin disorders.
Hum Mol Genet 5 (12):1867-1874
20. Moras E, Hosack A, Watkins D, and Rosenblatt DS (2007) Mitochondrial
vitamin B12-binding proteins in patients with inborn errors of cobalamin
metabolism. Mol Genet Metab 90 (2):140-147
21. Qureshi AA, Rosenblatt DS, and Cooper BA (1994) Inherited disorders of
cobalamin metabolism. Crit Rev Oncol Hematol 17 (2):133-151
22. Li N, Seetharam S, and Seetharam B (1995) Genomic structure of human
transcobalamin II: comparison to human intrinsic factor and transcobalamin
I. Biochem Biophys Res Commun 208 (2):756-764
23. Froese DS and Gravel RA (2010) Genetic disorders of vitamin B12
metabolism: eight complementation groups - eight genes. Expert Rev Mol
Med 12:e37
24. Morkbak AL, Poulsen SS, and Nexo E (2007) Haptocorrin in humans. Clin
Chem Lab Med 45 (12):1751-1759
25. Quadros EV, Nakayama Y, and Sequeira JM (2009) The protein and the
gene encoding the receptor for the cellular uptake of transcobalamin-bound
cobalamin. Blood 113 (1):186-192
26. Johnston J, Bollekens J, Allen RH, and Berliner N (1989) Structure of the
cDNA encoding transcobalamin I, a neutrophil granule protein. J Biol Chem
264 (27):15754-15757
27. Johnston J, Yang-Feng T, and Berliner N (1992) Genomic structure and
mapping of the chromosomal gene for transcobalamin I (TCN1):
comparison to human intrinsic factor. Genomics 12 (3):459-464
28. Carmel R (2003) Mild transcobalamin I (haptocorrin) deficiency and low
serum cobalamin concentrations. Clin Chem 49 (8):1367-1374
29. Carmel R, Parker J, and Kelman Z (2009) Genomic mutations associated
with mild and severe deficiencies of transcobalamin I (haptocorrin) that
cause mildly and severely low serum cobalamin levels. Br J Haematol 147
(3):386-391
30. Hewitt JE, Gordon MM, Taggart RT, Mohandas TK, and Alpers DH (1991)
Human gastric intrinsic factor: characterization of cDNA and genomic
clones and localization to human chromosome 11. Genomics 10 (2):432-440
![Page 119: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/119.jpg)
119
31. Yassin F, Rothenberg SP, Rao S, Gordon MM, Alpers DH, and Quadros EV
(2004) Identification of a 4-base deletion in the gene in inherited intrinsic
factor deficiency. Blood 103 (4):1515-1517
32. Yang YM, Ducos R, Rosenberg AJ, Catrou PG, Levine JS, Podell ER, and
Allen RH (1985) Cobalamin malabsorption in three siblings due to an
abnormal intrinsic factor that is markedly susceptible to acid and proteolysis.
J Clin Invest 76 (6):2057-2065
33. Tanner SM, Li Z, Perko JD, Oner C, Cetin M, Altay C, Yurtsever Z, David
KL, Faivre L, Ismail EA, Grasbeck R, and de la Chapelle A (2005)
Hereditary juvenile cobalamin deficiency caused by mutations in the
intrinsic factor gene. Proc Natl Acad Sci U S A 102 (11):4130-4133
34. Aminoff M, Carter JE, Chadwick RB, Johnson C, Grasbeck R, Abdelaal
MA, Broch H, Jenner LB, Verroust PJ, Moestrup SK, de la Chapelle A, and
Krahe R (1999) Mutations in CUBN, encoding the intrinsic factor-vitamin
B12 receptor, cubilin, cause hereditary megaloblastic anaemia 1. Nat Genet
21 (3):309-313
35. Tanner SM, Aminoff M, Wright FA, Liyanarachchi S, Kuronen M, Saarinen
A, Massika O, Mandel H, Broch H, and de la Chapelle A (2003) Amnionless,
essential for mouse gastrulation, is mutated in recessive hereditary
megaloblastic anemia. Nat Genet 33 (3):426-429
36. Fyfe JC, Madsen M, Hojrup P, Christensen EI, Tanner SM, de la Chapelle A,
He Q, and Moestrup SK (2004) The functional cobalamin (vitamin B12)-
intrinsic factor receptor is a novel complex of cubilin and amnionless. Blood
103 (5):1573-1579
37. Broch H, Imerslund O, Monn E, Hovig T, and Seip M (1984) Imerslund-
Grasbeck anemia. A long-term follow-up study. Acta Paediatr Scand 73
(2):248-253
38. Tanner SM, Li Z, Bisson R, Acar C, Oner C, Oner R, Cetin M, Abdelaal
MA, Ismail EA, Lissens W, Krahe R, Broch H, Grasbeck R, and de la
Chapelle A (2004) Genetically heterogeneous selective intestinal
malabsorption of vitamin B12: founder effects, consanguinity, and high
clinical awareness explain aggregations in Scandinavia and the Middle East.
Hum Mutat 23 (4):327-333
39. Carmel R (2007) The disappearance of cobalamin absorption testing: a
critical diagnostic loss. J Nutr 137 (11):2481-2484
40. Ament AE, Li Z, Sturm AC, Perko JD, Lawson S, Masterson M, Quadros
EV, and Tanner SM (2009) Juvenile cobalamin deficiency in individuals of
African ancestry is caused by a founder mutation in the intrinsic factor gene
GIF. Br J Haematol 144 (4):622-624
41. Regec A, Quadros EV, Platica O, and Rothenberg SP (1995) The cloning
and characterization of the human transcobalamin II gene. Blood 85
![Page 120: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/120.jpg)
120
(10):2711-2719
42. Seligman PA, Steiner LL, and Allen RH (1980) Studies of a patient with
megaloblastic anemia and an abnormal transcobalamin II. N Engl J Med
303 (21):1209-1212
43. Schiff M, Ogier de BH, Bard G, Barlogis V, Hamel C, Moat SJ, Odent S,
Shortland G, Touati G, and Giraudier S (2010) Should transcobalamin
deficiency be treated aggressively? J Inherit Metab Dis 33 (3):223-229
44. Anastasio, N., Watkins, D., Vezina, L., Dempsey-Nunez, L., Reichman, L.,
Quadros, E. V., and Rosenblatt, D. S. Mutations in TCblR, the gene for the
transcobalamin receptor, result in decreased cellular uptake of vitamin B12
and methylmalonic aciduria; Program #615. Presented at the 11th
International Congress of Inborn Errors of Metabolism, August 29-
September 3, 2009, San Diego, California.
45. Quadros EV, Lai SC, Nakayama Y, Sequeira JM, Hannibal L, Wang S,
Jacobsen DW, Fedosov S, Wright E, Gallagher RC, Anastasio N, Watkins D,
and Rosenblatt DS (2010) Positive newborn screen for methylmalonic
aciduria identifies the first mutation in TCblR/CD320, the gene for cellular
uptake of transcobalamin-bound vitamin B(12). Hum Mutat 31 (8):924-929
46. Moestrup SK and Verroust PJ (2001) Megalin- and cubilin-mediated
endocytosis of protein-bound vitamins, lipids, and hormones in polarized
epithelia. Annu Rev Nutr 21:407-428
47. Beedholm-Ebsen R, van de Wetering K, Hardlei T, Nexo E, Borst P, and
Moestrup SK (2010) Identification of multidrug resistance protein 1
(MRP1/ABCC1) as a molecular gate for cellular export of cobalamin. Blood
115 (8):1632-1639
48. Kantarci S, Al-Gazali L, Hill RS, Donnai D, Black GC, Bieth E, Chassaing
N, Lacombe D, Devriendt K, Teebi A, Loscertales M, Robson C, Liu T,
MacLaughlin DT, Noonan KM, Russell MK, Walsh CA, Donahoe PK, and
Pober BR (2007) Mutations in LRP2, which encodes the multiligand
receptor megalin, cause Donnai-Barrow and facio-oculo-acoustico-renal
syndromes. Nat Genet 39 (8):957-959
49. Pober BR, Longoni M, and Noonan KM (2009) A review of Donnai-Barrow
and facio-oculo-acoustico-renal (DB/FOAR) syndrome: clinical features
and differential diagnosis. Birth Defects Res A Clin Mol Teratol 85 (1):76-
81
50. Beedholm-Ebsen R, van de Wetering K, Hardlei T, Nexo E, Borst P, and
Moestrup SK (2009) Identification of multidrug resistance protein 1
(MRP1/ABCC1) as a molecular gate for cellular export of cobalamin. Blood
51. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC,
Stewart AJ, Kurz EU, Duncan AM, and Deeley RG (1992) Overexpression
of a transporter gene in a multidrug-resistant human lung cancer cell line.
![Page 121: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/121.jpg)
121
Science 258 (5088):1650-1654
52. Deeley RG, Westlake C, and Cole SP (2006) Transmembrane transport of
endo- and xenobiotics by mammalian ATP-binding cassette multidrug
resistance proteins. Physiol Rev 86 (3):849-899
53. Shah NP, Beech CM, Sturm AC, and Tanner SM (2011) Investigation of the
ABC transporter MRP1 in selected patients with presumed defects in
vitamin B12 absorption. Blood 117 (16):4397-4398
54. Hogenkamp HP (1968) Enzymatic reactions involving corrinoids. Annu Rev
Biochem 37:225-245
55. Oberholzer VG, Levin B, Burgess EA, and Young WF (1967)
Methylmalonic aciduria. An inborn error of metabolism leading to chronic
metabolic acidosis. Arch Dis Child 42 (225):492-504
56. Rosenberg LE, Lilljeqvist A, and Hsia YE (1968) Methylmalonic aciduria:
metabolic block localization and vitamin B12 dependency. Science 162
(3855):805-807
57. Rosenberg LE, Lilljeqvist AC, and Hsia YE (1968) Methylmalonic aciduria.
An inborn error leading to metabolic acidosis, long-chain ketonuria and
intermittent hyperglycinemia. N Engl J Med 278 (24):1319-1322
58. Rosenberg LE, Lilljeqvist AC, Hsia YE, and Rosenbloom FM (1969)
Vitamin B12 dependent methylmalonicaciduria: defective B12 metabolism
in cultured fibroblasts. Biochem Biophys Res Commun 37 (4):607-614
59. Morrow G, III, Barness LA, Cardinale GJ, Abeles RH, and Flaks JG (1969)
Congenital methylmalonic acidemia: enzymatic evidence for two forms of
the disease. Proc Natl Acad Sci U S A 63 (1):191-197
60. Watkins D, Matiaszuk N, and Rosenblatt DS (2000) Complementation
studies in the cblA class of inborn error of cobalamin metabolism: evidence
for interallelic complementation and for a new complementation class
(cblH). J Med Genet 37 (7):510-513
61. Gravel RA, Mahoney MJ, Ruddle FH, and Rosenberg LE (1975) Genetic
complementation in heterokaryons of human fibroblasts defective in
cobalamin metabolism. Proc Natl Acad Sci U S A 72 (8):3181-3185
62. Mudd SH, Levy HL, Abeles RH, and Jennedy JP, Jr. (1969) A derangement
in B12 metabolism leading to homocystinemia, cystathioninemia and
methylmalonic aciduria. Biochem Biophys Res Commun 35 (1):121-126
63. Mahoney MJ, Rosenberg LE, Mudd SH, and Uhlendorf BW (1971)
Defective metabolism of vitamin B12 in fibroblasts from children with
methylmalonicaciduria. Biochem Biophys Res Commun 44 (2):375-381
64. Mahoney MJ, Hart AC, Steen VD, and Rosenberg LE (1975)
Methylmalonicacidemia: biochemical heterogeneity in defects of 5'-
deoxyadenosylcobalamin synthesis. Proc Natl Acad Sci U S A 72 (7):2799-
2803
![Page 122: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/122.jpg)
122
65. Willard HF and Rosenberg LE (1977) Inherited deficiencies of human
methylmalonyl CoA mutase activity: reduced affinity of mutant apoenzyme
for adenosylcobalamin. Biochem Biophys Res Commun 78 (3):927-934
66. Willard HF and Rosenberg LE (1980) Inherited methylmalonyl CoA mutase
apoenzyme deficiency in human fibroblasts: evidence for allelic
heterogeneity, genetic compounds, and codominant expression. J Clin Invest
65 (3):690-698
67. Goodman SI, Moe PG, Hammond KB, Mudd SH, and Uhlendorf BW (1970)
Homocystinuria with methylmalonic aciduria: two cases in a sibship.
Biochem Med 4 (5):500-515
68. Willard HF, Mellman IS, and Rosenberg LE (1978) Genetic
complementation among inherited deficiencies of methylmalonyl-CoA
mutase activity: evidence for a new class of human cobalamin mutant. Am J
Hum Genet 30 (1):1-13
69. Cooper BA, Rosenblatt DS, and Watkins D (1990) Methylmalonic aciduria
due to a new defect in adenosylcobalamin accumulation by cells. Am J
Hematol 34 (2):115-120
70. Suormala T, Baumgartner MR, Coelho D, Zavadakova P, Kozich V, Koch
HG, Berghauser M, Wraith JE, Burlina A, Sewell A, Herwig J, and Fowler B
(2004) The cblD defect causes either isolated or combined deficiency of
methylcobalamin and adenosylcobalamin synthesis. J Biol Chem 279
(41):42742-42749
71. Levy HL, Mudd SH, Schulman JD, Dreyfus PM, and Abeles RH (1970) A
derangement in B12 metabolism associated with homocystinemia,
cystathioninemia, hypomethioninemia and methylmalonic aciduria. Am J
Med 48 (3):390-397
72. Schuh S, Rosenblatt DS, Cooper BA, Schroeder ML, Bishop AJ, Seargeant
LE, and Haworth JC (1984) Homocystinuria and megaloblastic anemia
responsive to vitamin B12 therapy. An inborn error of metabolism due to a
defect in cobalamin metabolism. N Engl J Med 310 (11):686-690
73. Rosenblatt DS, Cooper BA, Pottier A, Lue-Shing H, Matiaszuk N, and
Grauer K (1984) Altered vitamin B12 metabolism in fibroblasts from a
patient with megaloblastic anemia and homocystinuria due to a new defect
in methionine biosynthesis. J Clin Invest 74 (6):2149-2156
74. Rosenblatt DS, Hosack A, Matiaszuk NV, Cooper BA, and Laframboise R
(1985) Defect in vitamin B12 release from lysosomes: newly described
inborn error of vitamin B12 metabolism. Science 228 (4705):1319-1321
75. Watkins D and Rosenblatt DS (1986) Failure of lysosomal release of
vitamin B12: a new complementation group causing methylmalonic aciduria
(cblF). Am J Hum Genet 39 (3):404-408
76. Rosenblatt DS, Thomas IT, Watkins D, Cooper BA, and Erbe RW (1987)
![Page 123: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/123.jpg)
123
Vitamin B12 responsive homocystinuria and megaloblastic anemia:
heterogeneity in methylcobalamin deficiency. Am J Med Genet 26 (2):377-
383
77. Hallam LJ, Sawyer M, Clark AC, and Van der Weyden MB (1987) Vitamin
B12-responsive neonatal megaloblastic anemia and homocystinuria with
associated reduced methionine synthase activity. Blood 69 (4):1128-1133
78. Watkins D and Rosenblatt DS (1988) Genetic heterogeneity among patients
with methylcobalamin deficiency. Definition of two complementation
groups, cblE and cblG. J Clin Invest 81 (6):1690-1694
79. Youngdahl-Turner P, Rosenberg LE, and Allen RH (1978) Binding and
uptake of transcobalamin II by human fibroblasts. J Clin Invest 61 (1):133-
141
80. Rutsch F, Gailus S, Miousse IR, Suormala T, Sagne C, Toliat MR, Nurnberg
G, Wittkampf T, Buers I, Sharifi A, Stucki M, Becker C, Baumgartner M,
Robenek H, Marquardt T, Hohne W, Gasnier B, Rosenblatt DS, Fowler B,
and Nurnberg P (2009) Identification of a putative lysosomal cobalamin
exporter altered in the cblF defect of vitamin B12 metabolism. Nat Genet 41
(2):234-239
81. Gailus S, Suormala T, Malerczyk-Aktas AG, Toliat MR, Wittkampf T, Stucki
M, Nurnberg P, Fowler B, Hennermann JB, and Rutsch F (2010) A novel
mutation in LMBRD1 causes the cblF defect of vitamin B12 metabolism in
a Turkish patient. J Inherit Metab Dis 33 (1):17-24
82. Miousse IR, Watkins D, and Rosenblatt DS (2011) Novel splice site
mutations and a large deletion in three patients with the cblF inborn error of
vitamin B12 metabolism. Mol Genet Metab 102 (4):505-507
83. Vassiliadis A, Rosenblatt DS, Cooper BA, and Bergeron JJ (1991)
Lysosomal cobalamin accumulation in fibroblasts from a patient with an
inborn error of cobalamin metabolism (cblF complementation group):
visualization by electron microscope radioautography. Exp Cell Res 195
(2):295-302
84. Lerner-Ellis JP, Tirone JC, Pawelek PD, Dore C, Atkinson JL, Watkins D,
Morel CF, Fujiwara TM, Moras E, Hosack AR, Dunbar GV, Antonicka H,
Forgetta V, Dobson CM, Leclerc D, Gravel RA, Shoubridge EA, Coulton
JW, Lepage P, Rommens JM, Morgan K, and Rosenblatt DS (2006)
Identification of the gene responsible for methylmalonic aciduria and
homocystinuria, cblC type. Nat Genet 38 (1):93-100
85. Mellman I, Willard HF, and Rosenberg LE (1978) Cobalamin binding and
cobalamin-dependent enzyme activity in normal and mutant human
fibroblasts. J Clin Invest 62 (5):952-960
86. Mellman I, Willard HF, Youngdahl-Turner P, and Rosenberg LE (1979)
Cobalamin coenzyme synthesis in normal and mutant human fibroblasts.
![Page 124: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/124.jpg)
124
Evidence for a processing enzyme activity deficient in cblC cells. J Biol
Chem 254 (23):11847-11853
87. Kim J, Gherasim C, and Banerjee R (2008) Decyanation of vitamin B12 by
a trafficking chaperone. Proc Natl Acad Sci U S A 105 (38):14551-14554
88. Hannibal L, Kim J, Brasch NE, Wang S, Rosenblatt DS, Banerjee R, and
Jacobsen DW (2009) Processing of alkylcobalamins in mammalian cells: A
role for the MMACHC (cblC) gene product. Mol Genet Metab 97 (4):260-
266
89. Plesa M, Kim J, Paquette SG, Gagnon H, Ng-Thow-Hing C, Gibbs BF,
Hancock MA, Rosenblatt DS, and Coulton JW (2011) Interaction between
MMACHC and MMADHC, two human proteins participating in
intracellular vitamin B(1)(2) metabolism. Mol Genet Metab 102 (2):139-
148
90. Koutmos M, Gherasim C, Smith JL, and Banerjee R (2011) Structural basis
of multifunctionality in a vitamin B12-processing enzyme. J Biol Chem 286
(34):29780-29787
91. Froese DS, Krojer T, Wu X, Shrestha R, Kiyani W, von DF, Gravel RA,
Oppermann UC, and Yue WW (2012) Structure of MMACHC reveals an
arginine-rich pocket and a domain-swapped dimer for its B12 processing
function. Biochemistry
92. Coelho D, Suormala T, Stucki M, Lerner-Ellis JP, Rosenblatt DS, Newbold
RF, Baumgartner MR, and Fowler B (2008) Gene identification for the cblD
defect of vitamin B12 metabolism. N Engl J Med 358 (14):1454-1464
93. Miousse IR, Watkins D, Coelho D, Rupar T, Crombez EA, Vilain E,
Bernstein JA, Cowan T, Lee-Messer C, Enns GM, Fowler B, and Rosenblatt
DS (2009) Clinical and molecular heterogeneity in patients with the cblD
inborn error of cobalamin metabolism. J Pediatr 154 (4):551-556
94. Stucki M, Coelho D, Suormala T, Burda P, Fowler B, and Baumgartner MR
(2012) Molecular mechanisms leading to three different phenotypes in the
cblD defect of intracellular cobalamin metabolism. Hum Mol Genet 21
(6):1410-1418
95. Dobson CM, Wai T, Leclerc D, Kadir H, Narang M, Lerner-Ellis JP, Hudson
TJ, Rosenblatt DS, and Gravel RA (2002) Identification of the gene
responsible for the cblB complementation group of vitamin B12-dependent
methylmalonic aciduria. Hum Mol Genet 11 (26):3361-3369
96. Schubert HL and Hill CP (2006) Structure of ATP-bound human
ATP:cobalamin adenosyltransferase. Biochemistry 45 (51):15188-15196
97. Lerner-Ellis JP, Gradinger AB, Watkins D, Tirone JC, Villeneuve A, Dobson
CM, Montpetit A, Lepage P, Gravel RA, and Rosenblatt DS (2006)
Mutation and biochemical analysis of patients belonging to the cblB
complementation class of vitamin B12-dependent methylmalonic aciduria.
![Page 125: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/125.jpg)
125
Mol Genet Metab 87 (3):219-225
98. Jorge-Finnigan A, Aguado C, Sanchez-Alcudia R, Abia D, Richard E,
Merinero B, Gamez A, Banerjee R, Desviat LR, Ugarte M, and Perez B
(2010) Functional and structural analysis of five mutations identified in
methylmalonic aciduria cblB type. Hum Mutat 31 (9):1033-1042
99. Dobson CM, Wai T, Leclerc D, Wilson A, Wu X, Dore C, Hudson T,
Rosenblatt DS, and Gravel RA (2002) Identification of the gene responsible
for the cblA complementation group of vitamin B12-responsive
methylmalonic acidemia based on analysis of prokaryotic gene
arrangements. Proc Natl Acad Sci U S A 99 (24):15554-15559
100. Merinero B, Perez B, Perez-Cerda C, Rincon A, Desviat LR, Martinez MA,
Sala PR, Garcia MJ, Aldamiz-Echevarria L, Campos J, Cornejo V, Del TM,
Mahfoud A, Martinez-Pardo M, Parini R, Pedron C, Pena-Quintana L, Perez
M, Pourfarzam M, and Ugarte M (2008) Methylmalonic acidaemia:
examination of genotype and biochemical data in 32 patients belonging to
mut, cblA or cblB complementation group. J Inherit Metab Dis 31 (1):55-66
101. Martinez MA, Rincon A, Desviat LR, Merinero B, Ugarte M, and Perez B
(2005) Genetic analysis of three genes causing isolated methylmalonic
acidemia: identification of 21 novel allelic variants. Mol Genet Metab 84
(4):317-325
102. Lerner-Ellis JP, Dobson CM, Wai T, Watkins D, Tirone JC, Leclerc D, Dore
C, Lepage P, Gravel RA, and Rosenblatt DS (2004) Mutations in the
MMAA gene in patients with the cblA disorder of vitamin B12 metabolism.
Hum Mutat 24 (6):509-516
103. Hubbard PA, Padovani D, Labunska T, Mahlstedt SA, Banerjee R, and
Drennan CL (2007) Crystal structure and mutagenesis of the
metallochaperone MeaB: insight into the causes of methylmalonic aciduria.
J Biol Chem 282 (43):31308-31316
104. Froese DS, Kochan G, Muniz JR, Wu X, Gileadi C, Ugochukwu E,
Krysztofinska E, Gravel RA, Oppermann U, and Yue WW (2010) Structures
of the human GTPase MMAA and vitamin B12-dependent methylmalonyl-
CoA mutase and insight into their complex formation. J Biol Chem 285
(49):38204-38213
105. Padovani D and Banerjee R (2009) A G-protein editor gates coenzyme B12
loading and is corrupted in methylmalonic aciduria. Proc Natl Acad Sci U S
A 106 (51):21567-21572
106. Jansen R, Kalousek F, Fenton WA, Rosenberg LE, and Ledley FD (1989)
Cloning of full-length methylmalonyl-CoA mutase from a cDNA library
using the polymerase chain reaction. Genomics 4 (2):198-205
107. Ledley FD, Lumetta M, Nguyen PN, Kolhouse JF, and Allen RH (1988)
Molecular cloning of L-methylmalonyl-CoA mutase: gene transfer and
![Page 126: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/126.jpg)
126
analysis of mut cell lines. Proc Natl Acad Sci U S A 85 (10):3518-3521
108. Worgan LC, Niles K, Tirone JC, Hofmann A, Verner A, Sammak A, Kucic T,
Lepage P, and Rosenblatt DS (2006) Spectrum of mutations in mut
methylmalonic acidemia and identification of a common Hispanic mutation
and haplotype. Hum Mutat 27 (1):31-43
109. Leclerc D, Wilson A, Dumas R, Gafuik C, Song D, Watkins D, Heng HH,
Rommens JM, Scherer SW, Rosenblatt DS, and Gravel RA (1998) Cloning
and mapping of a cDNA for methionine synthase reductase, a flavoprotein
defective in patients with homocystinuria. Proc Natl Acad Sci U S A 95
(6):3059-3064
110. Wilson A, Leclerc D, Rosenblatt DS, and Gravel RA (1999) Molecular basis
for methionine synthase reductase deficiency in patients belonging to the
cblE complementation group of disorders in folate/cobalamin metabolism.
Hum Mol Genet 8 (11):2009-2016
111. Zavadakova P, Fowler B, Suormala T, Novotna Z, Mueller P, Hennermann
JB, Zeman J, Vilaseca MA, Vilarinho L, Gutsche S, Wilichowski E, Horneff
G, and Kozich V (2005) cblE type of homocystinuria due to methionine
synthase reductase deficiency: functional correction by minigene expression.
Hum Mutat 25 (3):239-247
112. Watkins D, Ru M, Hwang HY, Kim CD, Murray A, Philip NS, Kim W,
Legakis H, Wai T, Hilton JF, Ge B, Dore C, Hosack A, Wilson A, Gravel RA,
Shane B, Hudson TJ, and Rosenblatt DS (2002) Hyperhomocysteinemia due
to methionine synthase deficiency, cblG: structure of the MTR gene,
genotype diversity, and recognition of a common mutation, P1173L. Am J
Hum Genet 71 (1):143-153
113. Wilson A, Leclerc D, Saberi F, Campeau E, Hwang HY, Shane B, Phillips
JA, III, Rosenblatt DS, and Gravel RA (1998) Functionally null mutations in
patients with the cblG-variant form of methionine synthase deficiency. Am J
Hum Genet 63 (2):409-414
114. Carmel R and Jacobsen DW (2001) Homocysteine in Health and Disease.
Cambridge University Press, Cambridge, United Kingdom
115. Gradinger AB, Belair C, Worgan LC, Li CD, Lavallee J, Roquis D, Watkins
D, and Rosenblatt DS (2007) Atypical methylmalonic aciduria: frequency of
mutations in the methylmalonyl CoA epimerase gene (MCEE). Hum Mutat
28 (10):1045
116. Ostergaard E (2008) Disorders caused by deficiency of succinate-CoA
ligase. J Inherit Metab Dis
117. Alfares A, Nunez LD, Al-Thihli K, Mitchell J, Melancon S, Anastasio N, Ha
KCH, Majewski J, Rosenblatt DS, and Braverman N (2011) Combined
malonic and methylmalonic aciduria: exome sequencing reveals mutations
in the ACSF3 gene in patients with a non-classic phenotype. J Med Genet
![Page 127: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/127.jpg)
127
48 (9):602-605
118. Sloan JL, Johnston JJ, Manoli I, Chandler RJ, Krause C, Carrillo-Carrasco
N, Chandrasekaran SD, Sysol JR, O'Brien K, Hauser NS, Sapp JC, Dorward
HM, Huizing M, Barshop BA, Berry SA, James PM, Champaigne NL, de
LP, Valayannopoulos V, Geschwind MD, Gavrilov DK, Nyhan WL,
Biesecker LG, and Venditti CP (2011) Exome sequencing identifies ACSF3
as a cause of combined malonic and methylmalonic aciduria. Nat Genet 43
(9):883-886
119. Salomons GS, Jakobs C, Pope LL, Errami A, Potter M, Nowaczyk M, Olpin
S, Manning N, Raiman JA, Slade T, Champion MP, Peck D, Gavrilov D,
Hillman R, Hoganson GE, Donaldson K, Shield JP, Ketteridge D,
Wasserstein M, and Gibson KM (2007) Clinical, enzymatic and molecular
characterization of nine new patients with malonyl-coenzyme A
decarboxylase deficiency. J Inherit Metab Dis 30 (1):23-28
120. Goyette P, Sumner JS, Milos R, Duncan AM, Rosenblatt DS, Matthews RG,
and Rozen R (1994) Human methylenetetrahydrofolate reductase: isolation
of cDNA, mapping and mutation identification. Nat Genet 7 (2):195-200
121. Kraus JP, Le K, Swaroop M, Ohura T, Tahara T, Rosenberg LE, Roper MD,
and Kozich V (1993) Human cystathionine beta-synthase cDNA: sequence,
alternative splicing and expression in cultured cells. Hum Mol Genet 2
(10):1633-1638
122. Vellodi A (2005) Lysosomal storage disorders. Br J Haematol 128 (4):413-
431
123. Saftig P and Klumperman J (2009) Lysosome biogenesis and lysosomal
membrane proteins: trafficking meets function. Nat Rev Mol Cell Biol 10
(9):623-635
124. Mellquist JL, Kasturi L, Spitalnik SL, and Shakin-Eshleman SH (1998) The
amino acid following an asn-X-Ser/Thr sequon is an important determinant
of N-linked core glycosylation efficiency. Biochemistry 37 (19):6833-6837
125. Braulke T and Bonifacino JS (2009) Sorting of lysosomal proteins. Biochim
Biophys Acta 1793 (4):605-614
126. Futerman AH and van MG (2004) The cell biology of lysosomal storage
disorders. Nat Rev Mol Cell Biol 5 (7):554-565
127. Ruivo R, Anne C, Sagne C, and Gasnier B (2009) Molecular and cellular
basis of lysosomal transmembrane protein dysfunction. Biochim Biophys
Acta 1793 (4):636-649
128. Oladipo O, Rosenblatt DS, Watkins D, Miousse IR, Sprietsma L, Dietzen DJ,
and Shinawi M (2011) Cobalamin F disease detected by newborn screening
and follow-up on a 14-year-old patient. Pediatrics 128 (6):e1636-e1640
129. Gailus S, Hohne W, Gasnier B, Nurnberg P, Fowler B, and Rutsch F (2010)
Insights into lysosomal cobalamin trafficking: lessons learned from cblF
![Page 128: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/128.jpg)
128
disease. J Mol Med (Berl) 88 (5):459-466
130. Gusella JF, Wexler NS, Conneally PM, Naylor SL, Anderson MA, Tanzi RE,
Watkins PC, Ottina K, Wallace MR, and Sakaguchi AY (1983) A
polymorphic DNA marker genetically linked to Huntington's disease.
Nature 306 (5940):234-238
131. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, Henning AK,
SanGiovanni JP, Mane SM, Mayne ST, Bracken MB, Ferris FL, Ott J,
Barnstable C, and Hoh J (2005) Complement factor H polymorphism in
age-related macular degeneration. Science 308 (5720):385-389
132. Altshuler D, Daly MJ, and Lander ES (2008) Genetic mapping in human
disease. Science 322 (5903):881-888
133. Ng PC, Levy S, Huang J, Stockwell TB, Walenz BP, Li K, Axelrod N,
Busam DA, Strausberg RL, and Venter JC (2008) Genetic variation in an
individual human exome. PLoS Genet 4 (8):e1000160
134. Ng SB, Turner EH, Robertson PD, Flygare SD, Bigham AW, Lee C, Shaffer
T, Wong M, Bhattacharjee A, Eichler EE, Bamshad M, Nickerson DA, and
Shendure J (2009) Targeted capture and massively parallel sequencing of 12
human exomes. Nature 461 (7261):272-276
135. Ng SB, Buckingham KJ, Lee C, Bigham AW, Tabor HK, Dent KM, Huff
CD, Shannon PT, Jabs EW, Nickerson DA, Shendure J, and Bamshad MJ
(2010) Exome sequencing identifies the cause of a mendelian disorder. Nat
Genet 42 (1):30-35
136. Bamshad MJ, Ng SB, Bigham AW, Tabor HK, Emond MJ, Nickerson DA,
and Shendure J (2011) Exome sequencing as a tool for Mendelian disease
gene discovery. Nat Rev Genet 12 (11):745-755
137. Campeau PM, Kim JC, Lu JT, Schwartzentruber JA, Abdul-Rahman OA,
Schlaubitz S, Murdock DM, Jiang MM, Lammer EJ, Enns GM, Rhead WJ,
Rowland J, Robertson SP, Cormier-Daire V, Bainbridge MN, Yang XJ,
Gingras MC, Gibbs RA, Rosenblatt DS, Majewski J, and Lee BH (2012)
Mutations in KAT6B, encoding a histone acetyltransferase, cause
Genitopatellar syndrome. Am J Hum Genet 90 (2):282-289
138. Hoischen A, van Bon BW, Rodriguez-Santiago B, Gilissen C, Vissers LE,
de VP, Janssen I, van LB, Hastings R, Smithson SF, Newbury-Ecob R,
Kjaergaard S, Goodship J, McGowan R, Bartholdi D, Rauch A, Peippo M,
Cobben JM, Wieczorek D, Gillessen-Kaesbach G, Veltman JA, Brunner HG,
and de Vries BB (2011) De novo nonsense mutations in ASXL1 cause
Bohring-Opitz syndrome. Nat Genet 43 (8):729-731
139. Gilissen C, Hoischen A, Brunner HG, and Veltman JA (2012) Disease gene
identification strategies for exome sequencing. Eur J Hum Genet 20
(5):490-497
140. Rosenblatt DS (2011) A RaDiCAL approach to gene discovery. J Med Genet
![Page 129: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/129.jpg)
129
48 (9):577-578
141. Watkins D, Schwartzentruber JA, Ganesh J, Orange JS, Kaplan BS, Nunez
LD, Majewski J, and Rosenblatt DS (2011) Novel inborn error of folate
metabolism: identification by exome capture and sequencing of mutations in
the MTHFD1 gene in a single proband. J Med Genet 48 (9):590-592
142. Davidson AL, Dassa E, Orelle C, and Chen J Structure, function, and
evolution of bacterial ATP-binding cassette systems. Microbiol Mol Biol
Rev 72 (2):June
143. Roninson IB, Chin JE, Choi KG, Gros P, Housman DE, Fojo A, Shen DW,
Gottesman MM, and Pastan I (1986) Isolation of human mdr DNA
sequences amplified in multidrug-resistant KB carcinoma cells. Proc Natl
Acad Sci U S A 83 (12):4538-4542
144. Rommens JM, Iannuzzi MC, Kerem B, Drumm ML, Melmer G, Dean M,
Rozmahel R, Cole JL, Kennedy D, Hidaka N, and . (1989) Identification of
the cystic fibrosis gene: chromosome walking and jumping. Science 245
(4922):1059-1065
145. Mosser J, Douar AM, Sarde CO, Kioschis P, Feil R, Moser H, Poustka AM,
Mandel JL, and Aubourg P (1993) Putative X-linked adrenoleukodystrophy
gene shares unexpected homology with ABC transporters. Nature 361
(6414):726-730
146. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van DM, Yu L
et al (1999) Mutations in ABC1 in Tangier disease and familial high-density
lipoprotein deficiency. Nat Genet 22 (4):336-345
147. Theodoulou FL, Holdsworth M, and Baker A (2006) Peroxisomal ABC
transporters. FEBS Lett 580 (4):1139-1155
148. Morita M and Imanaka T (2012) Peroxisomal ABC transporters: Structure,
function and role in disease. Biochim Biophys Acta
149. Holzinger A, Kammerer S, Berger J, and Roscher AA (1997) cDNA cloning
and mRNA expression of the human adrenoleukodystrophy related protein
(ALDRP), a peroxisomal ABC transporter. Biochem Biophys Res Commun
239 (1):261-264
150. Gartner J, Moser H, and Valle D (1992) Mutations in the 70K peroxisomal
membrane protein gene in Zellweger syndrome. Nat Genet 1 (1):16-23
151. Kamijo K, Kamijo T, Ueno I, Osumi T, and Hashimoto T (1992) Nucleotide
sequence of the human 70 kDa peroxisomal membrane protein: a member
of ATP-binding cassette transporters. Biochim Biophys Acta 1129 (3):323-
327
152. Shani N, Jimenez-Sanchez G, Steel G, Dean M, and Valle D (1997)
Identification of a fourth half ABC transporter in the human peroxisomal
membrane. Hum Mol Genet 6 (11):1925-1931
153. Holzinger A, Kammerer S, and Roscher AA (1997) Primary structure of
![Page 130: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/130.jpg)
130
human PMP69, a putative peroxisomal ABC-transporter. Biochem Biophys
Res Commun 237 (1):152-157
154. Liu LX, Janvier K, Berteaux-Lecellier V, Cartier N, Benarous R, and
Aubourg P (1999) Homo- and heterodimerization of peroxisomal ATP-
binding cassette half-transporters. J Biol Chem 274 (46):32738-32743
155. Hillebrand M, Verrier SE, Ohlenbusch A, Schafer A, Soling HD, Wouters
FS, and Gartner J (2007) Live cell FRET microscopy: homo- and
heterodimerization of two human peroxisomal ABC transporters, the
adrenoleukodystrophy protein (ALDP, ABCD1) and PMP70 (ABCD3). J
Biol Chem 282 (37):26997-27005
156. Kashiwayama Y, Seki M, Yasui A, Murasaki Y, Morita M, Yamashita Y,
Sakaguchi M, Tanaka Y, and Imanaka T (2009) 70-kDa peroxisomal
membrane protein related protein (P70R/ABCD4) localizes to endoplasmic
reticulum not peroxisomes, and NH2-terminal hydrophobic property
determines the subcellular localization of ABC subfamily D proteins. Exp
Cell Res 315 (2):190-205
157. Kikuchi M, Hatano N, Yokota S, Shimozawa N, Imanaka T, and Taniguchi
H (2004) Proteomic analysis of rat liver peroxisome: presence of
peroxisome-specific isozyme of Lon protease. J Biol Chem 279 (1):421-428
158. Islinger M, Luers GH, Li KW, Loos M, and Volkl A (2007) Rat liver
peroxisomes after fibrate treatment. A survey using quantitative mass
spectrometry. J Biol Chem 282 (32):23055-23069
159. Wiese S, Gronemeyer T, Ofman R, Kunze M, Grou CP, Almeida JA,
Eisenacher M, Stephan C, Hayen H, Schollenberger L, Korosec T,
Waterham HR, Schliebs W, Erdmann R, Berger J, Meyer HE, Just W,
Azevedo JE, Wanders RJ, and Warscheid B (2007) Proteomics
characterization of mouse kidney peroxisomes by tandem mass
spectrometry and protein correlation profiling. Mol Cell Proteomics 6
(12):2045-2057
160. Gloeckner CJ, Mayerhofer PU, Landgraf P, Muntau AC, Holzinger A,
Gerber JK, Kammerer S, Adamski J, and Roscher AA (2000) Human
adrenoleukodystrophy protein and related peroxisomal ABC transporters
interact with the peroxisomal assembly protein PEX19p. Biochem Biophys
Res Commun 271 (1):144-150
161. Yao J and Shoubridge EA (1999) Expression and functional analysis of
SURF1 in Leigh syndrome patients with cytochrome c oxidase deficiency.
Hum Mol Genet 8 (13):2541-2549
162. Watkins D (1998) Cobalamin metabolism in methionine-dependent human
tumour and leukemia cell lines. Clin Invest Med 21 (3):151-158
163. Allen RH (1976) The plasma transport of vitamin B12. Br J Haematol 33
(2):161-171
![Page 131: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/131.jpg)
131
164. Haack TB, Danhauser K, Haberberger B, Hoser J, Strecker V, Boehm D,
Uziel G, Lamantea E, Invernizzi F, Poulton J, Rolinski B, Iuso A, Biskup S,
Schmidt T, Mewes HW, Wittig I, Meitinger T, Zeviani M, and Prokisch H
(2010) Exome sequencing identifies ACAD9 mutations as a cause of
complex I deficiency. Nat Genet 42 (12):1131-1134
165. Powis SH, Mockridge I, Kelly A, Kerr LA, Glynne R, Gileadi U, Beck S,
and Trowsdale J (1992) Polymorphism in a second ABC transporter gene
located within the class II region of the human major histocompatibility
complex. Proc Natl Acad Sci U S A 89 (4):1463-1467
166. Locher KP, Lee AT, and Rees DC (2002) The E. coli BtuCD structure: a
framework for ABC transporter architecture and mechanism. Science 296
(5570):1091-1098
![Page 132: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/132.jpg)
132
APPENDIX A: List of Publications and Presentations
Publications
1. Plesa M, Kim J, Paquette SG, Gagnon H, Ng-Thow-Hing C, Gibbs BF,
Hancock MA, Rosenblatt DS, and Coulton JW (2011) Interaction between
MMACHC and MMADHC, two human proteins participating in
intracellular vitamin B12 metabolism. Molecular Genetics and Metabolism
102 (2):139-148
2. Campeau PM*, Kim JC*, Lu JT, Schwartzentruber JA, Abdul-Rahman
OA, Schlaubitz S, Murdock DM, Jiang MM, Lammer EJ, Enns GM,
Rhead WJ, Rowland J, Robertson SP, Cormier-Daire V, Bainbridge MN,
Yang XJ, Gingras MC, Gibbs RA, Rosenblatt DS, Majewski J, and Lee
BH (2012) Mutations in KAT6B, encoding a histone acetyltransferase,
cause Genitopatellar syndrome. American Journal of Human Genetics 90
(2):282-289
* These authors contributed equally to this work
3. Deme JC, Miousse IR, Plesa M, Kim JC, Hancock MA, Mah W,
Rosenblatt DS, Coulton JW (2012) Structural features of recombinant
MMADHC isoforms and their interactions with MMACHC, proteins of
mammalian vitamin B12 metabolism. Molecular Genetics and Metabolism,
doi:10.1016/j.ymgme.2012.07.001 (Article in press)
4. Coelho D*, Kim JC*, Miousse IR, Fung S, du Moulin M, Buers I,
Suormala T, Burda P, Frapolli M, Stucki M, Nürnberg P, Thiele H,
Robenek H, Höhne W, Longo N, Pasquali M, Mengel E, Watkins D,
Shoubridge EA, Majewski J, Rosenblatt DS, Fowler B, Rutsch F, and
Baumgartner MR (2012) Mutations in ABCD4 cause a new inborn error of
vitamin B12 metabolism. Nature Genetics (Article in press)
* These authors contributed equally to this work
Presentations
1. Mutations in ABCD4 Cause a New Inborn Error of Vitamin B12
Metabolism (Poster). Human Genetics Graduate Research Day, McGill
University. June 2011. Montreal, Canada.
![Page 133: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/133.jpg)
133
2. Mutations in ABCD4 Cause a New Inborn Error of Vitamin B12
Metabolism (Oral). 12th
International Congress of Human Genetics.
October 2011. Montreal, Canada. (Abstract published)
3. Novel Inborn Error of Vitamin B12 Metabolism Caused By Mutations in
ABCD4 (Poster). RMGA Journées Génétiques. May 2012. Montreal,
Canada.
4. Novel Inborn Error of Vitamin B12 Metabolism Caused By Mutations in
ABCD4 (Poster). Human Genetics Graduate Research Day, McGill
University. June 2012. Montreal, Canada.
5. Novel Inborn Error of Vitamin B12 Metabolism Caused By Mutations in
ABCD4 (Oral). FASEB: Folic Acid, Vitamin B12, and One-Carbon
Metabolism. July 2012. Crete, Greece.
![Page 134: Novel inborn error of vitamin B12 metabolism caused by mutations](https://reader031.vdocument.in/reader031/viewer/2022030322/587f465d1a28ab73108b8a6d/html5/thumbnails/134.jpg)
134
APPENDIX B: Published Abstract
12th
International Congress of Human Genetics
Mutations in ABCD4 cause a new inborn error of vitamin B12 metabolism
J.C. Kim1, D. Coelho
2,3, I.R. Miousse
1, S. Fung
1, M. du Moulin
4, I. Buers
4, T. Suormala
2,3, M.
Stucki2, P. Nürnberg
5, H. Thiele
5, N. Longo
6, M. Pasquali
6, E. Mengel
7, D. Watkins
1, E.A.
Shoubridge1, F. Rutsch
4, J. Majewski
1,8, M. Baumgartner
2, B. Fowler
2,3, D.S. Rosenblatt
1
1Department of Human Genetics, McGill University, Montreal, Canada,
2Division of Metabolism,
University Children's Hospital, Zurich, Switzerland, 3Metabolic Unit, University Children's
Hospital, Basel, Switzerland, 4University Children's Hospital, Münster, Germany,
5Cologne Center
for Genomics, Cologne, Germany, 6University of Utah and ARUP Laboratories, Salt Lake City,
United States, 7University Children's Hospital, Mainz, Germany,
8McGill University and Genome
Québec Innovation Centre, Montreal, Canada
Two patients presented with methylmalonic aciduria and
hyperhomocysteinemia. Patient 1 presented at birth following an abnormal newborn
screen with hypotonia, lethargy, poor feeding and bone marrow suppression. Patient 2
presented in the newborn period with poor feeding, macrocytic anemia and heart
defects. Studies of cultured fibroblasts from both patients showed decreased function
of the cobalamin (vitamin B12) dependent enzymes methionine synthase and
methylmalonyl-CoA mutase. There was increased uptake of labelled cyanocobalamin
(CNCbl) but decreased synthesis of the cobalamin coenzymes methylcobalamin
(MeCbl) and adenosylcobalamin (AdoCbl), with accumulation of “free” (i.e. non-
protein bound) CNCbl in the cells. The cellular phenotype mimicked that of the cblF
disorder caused by mutations in the LMBRD1 gene encoding the lysosomal
membrane protein LMBD1 that is thought to play a role in transfer of cobalamin
across the lysosomal membrane into the cytoplasm. However, cells from both patients
complemented those from all known complementation classes, including cblF, and no
mutations in LMBRD1 were found. Whole exome capture (patient 1) and microcell-
mediated chromosome transfer and exome capture of chromosome 14 (patient 2), led
to the identification of two mutations in the ABCD4 gene in each patient: c.956A>G
(p.Tyr319Cys) and c.1746_1747insCT (p.Glu583LeufsX9) in patient 1 and
c.542+1G>T and c.1456G>T (p.Gly486Cys) in patient 2. All mutations were
predicted to be deleterious. Transfection of patient fibroblasts with wild type ABCD4
led to rescue of the abnormal cellular phenotype. Transfection with c.1456G>T did
not rescue function confirming the functional significance of this mutation. We
conclude that this novel disorder, tentatively named “cblJ”, is an autosomal recessive
disorder caused by mutations in ABCD4. We suggest that ABCD4, a presumed ABC
transporter, is another essential component of intracellular cobalamin metabolism and
might interact with LMBD1 to allow transport of vitamin B12 out of the lysosome.