novel oral poliomyelitis type 2 vaccine - nopv2 gmo deliberate … · 2018-05-09 · university of...

University of Antwerp Technical and Scientific Information on the GMO

nOPV2 Phase 2 Version 1.0

Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Novel Oral Poliomyelitis Type 2 Vaccine - nOPV2

GMO Deliberate Release Notification

Part 1A – Technical dossier

April 2018

“A Phase 2, double-blind, randomized, placebo-controlled, multicenter study

to evaluate the safety and immunogenicity of two novel live attenuated

serotype 2 oral poliovirus vaccines candidates, in healthy adults and

adolescents previously vaccinated with oral polio vaccine (OPV) or inactivated

polio vaccine (IPV), compared with historical controls given Sabin OPV2 or

placebo.”

Sponsor University of Antwerp (with grant support from the Bill and

Melinda Gates Foundation)

Sponsor Representative Prof Dr Pierre Van Damme, PhD

University of Antwerp

Campus Drie Eiken, Universiteitsplein 1

2610 Antwerpen (Wilrijk) Belgium

Tel + 32-3-2652538, Fax +32-3-2652404

CONFIDENTIALITY STATEMENT

The information in this document contains trade secrets and commercial information that are privileged

or confidential and may not be disclosed unless such disclosure is required by applicable law or

regulations. In any event, persons to whom the information is disclosed must be informed that the

information is privileged or confidential and may not be further disclosed

without written authorization of University of Antwerp.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

TABLE OF CONTENTS

List of Abbreviations ................................................................................................................................................... 6

Introduction ................................................................................................................................................................. 7

I. GENERAL INFORMATION .......................................................................................................................... 8

A. NAME AND ADDRESS OF THE NOTIFIER ............................................................................................................. 8

B. NAME, QUALIFICATIONS AND EXPERIENCE OF THE RESPONSIBLE SCIENTIST(S) ................................................ 8

C. TITLE OF THE PROJECT ..................................................................................................................................... 9

II. INFORMATION RELATING TO THE GMO ............................................................................................. 9

A. CHARACTERISTICS OF THE RECIPIENT ORGANISM ........................................................................................ 9

1. Scientific name ................................................................................................................................................... 9

2. Taxonomy........................................................................................................................................................... 9

3. Other names ...................................................................................................................................................... 10

4. Phenotypic and genetic markers ....................................................................................................................... 10

5. Degree of relatedness between donor and recipient or between parental organisms ........................................ 10

6. Description of identification and detection techniques..................................................................................... 10

7. Sensitivity, reliability (in quantitative terms) and specificity of detection and identification techniques ........ 11

8. Description of the geographic distribution and of the natural habitat of the organism including information on

natural predators, preys, parasites and competitors, symbionts and hosts ........................................................ 11

9. Organisms with which transfer of genetic material is known to occur under natural conditions ..................... 12

10. Verification of the genetic stability of the organisms and factors affecting it .................................................. 13

11. Pathological, ecological and physiological traits .............................................................................................. 13

12. Nature of indigenous vectors ............................................................................................................................ 16

13. History of previous genetic modifications. ....................................................................................................... 16

B. CHARACTERISTICS OF THE VECTOR ................................................................................................................ 17

1. Nature and source of the vector ........................................................................................................................ 17

2. Sequence of transposons, vectors and other non-coding genetic segments used to construct .......................... 21

3. Frequency of mobilisation of inserted vector and/or genetic transfer capabilities and methods of

determination .................................................................................................................................................... 21

4. Information on the degree to which the vector is limited to the DNA required to perform the intended

function. ........................................................................................................................................................... 21

C. CHARACTERISTICS OF THE MODIFIED ORGANISM ........................................................................................... 21

1. Information Relating to the Genetic Modification ........................................................................................... 21

2. Information on the final GMO ......................................................................................................................... 22

III. INFORMATION RELATING TO THE CONDITIONS OF RELEASE AND THE RECEIVING

ENVIRONMENT ........................................................................................................................................... 31

A. INFORMATION ON THE RELEASE ..................................................................................................................... 31

1. Description of the proposed deliberate release, including the purpose(s) and foreseen products..................... 31



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

2. Foreseen dates of the release and time planning of the experiment including frequency and duration of

releases ............................................................................................................................................................. 32

3. Preparation of the site previous to the release .................................................................................................. 33

4. Size of the site .................................................................................................................................................. 33

5. Method(s) to be used for the release ................................................................................................................. 33

6. Quantities of GMOs to be released................................................................................................................... 33

7. Disturbance on the site (type and method of cultivation, mining, irrigation, or other activities) ..................... 34

8. Worker protection measures taken during the release ...................................................................................... 34

9. Post-release treatment of the site ...................................................................................................................... 34

10. Techniques foreseen for elimination or inactivation of the GMOs at the end of the experiment ..................... 35

11. Information on, and results of, previous releases of the GMOs, especially at different scales and in different

ecosystems ........................................................................................................................................................ 35

B. INFORMATION ON THE ENVIRONMENT (BOTH ON THE SITE AND IN THE WIDER ENVIRONMENT): ..................... 35

1. Geographical location and grid reference of the site(s) (in case of notifications under part C the site(s) of

release will be the foreseen areas of use of the product) .................................................................................. 35

2. Physical or biological proximity to humans and other significant biota .......................................................... 35

3. Proximity to significant biotopes, protected areas, or drinking water supplies ................................................ 36

4. Climatic characteristics of the region(s) likely to be affected .......................................................................... 36

5. Geographical, geological and pedological characteristics ................................................................................ 36

6. Flora and fauna, including crops, livestock and migratory species .................................................................. 36

7. Description of target and non-target ecosystems likely to be affected ............................................................. 36

8. Comparison of the natural habitat of the recipient organism with the proposed site(s) of release ................... 36

9. Any known planned developments or changes in land use in the region which could influence the

environmental impact of the release ................................................................................................................. 37

IV. INFORMATION RELATING TO THE INTERACTIONS BETWEEN THE GMOs AND THE

ENVIRONMENT ........................................................................................................................................... 37

A. CHARACTERISTICS AFFECTING SURVIVAL, MULTIPLICATION AND DISSEMINATION ........................................ 37

1. Biological features which affect survival, multiplication and dispersal ........................................................... 37

2. Known or predicted environmental conditions which may affect survival, multiplication and dissemination

(wind, water, soil, temperature, pH, etc.) ......................................................................................................... 37

3. Sensitivity to specific agents ............................................................................................................................ 38

B. INTERACTIONS WITH THE ENVIRONMENT ....................................................................................................... 38

1. Predicted Habitat of the GMOs ........................................................................................................................ 38

2. Studies of the behaviour and characteristics of the GMOs and their ecological impact carried out in simulated

natural environments, such as microcosms, growth rooms, greenhouses ......................................................... 39

3. Genetic transfer capability ................................................................................................................................ 39

4. Likelihood of post-release selection leading to the expression of unexpected and/or undesirable traits in the

modified organism ............................................................................................................................................ 40



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

5. Measures employed to ensure and to verify genetic stability. Description of genetic traits which may prevent

or minimise dispersal of genetic material. Methods to verify genetic stability. ............................................... 41

6. Routes of biological dispersal, known or potential modes of interaction with the disseminating agent,

including inhalation, ingestion, surface contact, burrowing, etc ...................................................................... 42

7. Description of ecosystems to which the GMOs could be disseminated ........................................................... 42

8. Potential for excessive population increase in the environment ....................................................................... 42

9. Competitive advantage of the GMOs in relation to the unmodified recipient or parental organism(s) ............ 43

10. Identification and description of the target organisms if applicable ................................................................. 43

11. Anticipated mechanism and result of interaction between the released GMOs and the target organism(s) if

applicable ......................................................................................................................................................... 43

12. Identification and description of non-target organisms which may be adversely affected by the release of the

GMO, and the anticipated mechanisms of any identified adverse interaction .................................................. 44

13. Likelihood of post-release shifts in biological interactions or in host range .................................................... 44

14. Known or predicted interactions with non-target organisms in the environment, including competitors, preys,

hosts, symbionts, predators, parasites and pathogens ....................................................................................... 44

15. Known or predicted involvement in biogeochemical processes ....................................................................... 44

16. Other potential interactions with the environment ........................................................................................... 44

V. INFORMATION ON MONITORING, CONTROL, WASTE TREATMENT AND EMERGENCY

RESPONSE PLANS ....................................................................................................................................... 45

A. MONITORING TECHNIQUES ............................................................................................................................. 45

1. Methods for tracing the GMOs, and for monitoring their effects ..................................................................... 45

2. Specificity (to identity the GMOs, and to distinguish them from the donor, recipient or, where appropriate,

the parental organism(s), sensitivity and reliability of the monitoring techniques ........................................... 45

3. Techniques for detecting transfer of the donated genetic material to other organisms..................................... 45

4. Duration and frequency of the monitoring ....................................................................................................... 45

B. CONTROL OF THE RELEASE ............................................................................................................................. 46

1. Methods and procedures to avoid and/or minimise the spread of the GMOs beyond the site of release or the

designated area for use ..................................................................................................................................... 46

2. Methods and procedures to protect the site from intrusion by unauthorised individuals ................................. 46

3. Methods and procedures to prevent other organisms from entering the site. ................................................... 47

C. WASTE TREATMENT ....................................................................................................................................... 47

1. Type of waste generated ................................................................................................................................... 47

2. Expected amount of waste ................................................................................................................................ 47

3. Description of treatment envisaged. ................................................................................................................. 47

D. EMERGENCY RESPONSE PLANS ....................................................................................................................... 47

1. Methods and procedures for controlling the GMOs in case of unexpected spread .......................................... 47

2. Methods for decontamination of the areas affected, for example eradication of the GMOs ............................ 48

3. Methods for disposal or sanitation of plants, animals, soils, etc., that were exposed during or after the spread

48



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

4. Methods for the isolation of the area affected by the spread ............................................................................ 48

5. Plans for protecting human health and the environment in case of the occurrence of an undesirable effect. ... 48

VI. References ....................................................................................................................................................... 49

List of Annexes ........................................................................................................................................................... 53



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

List of Abbreviations

5’ UTR 5’ untranslated region

bOPV bivalent oral polio vaccine

CCID50 Cell Culture Infectious Dose 50 (i.e. dose that leads to infection in 50% of the

cells)

CDC Centers for Disease Control and Prevention (USA)

cVDPV circulating vaccine-derived polio virus

ECDC European Centre of Disease Control and Prevention

E.coli Escherichia coli

EES Exploratory Endpoint Sample

GAPIII third edition of the Global Action Plan of the WHO

IMP Investigational Medicinal Product

IPV inactivated poliovirus vaccine

IRES internal ribosome entry site

iVDPV Immunodeficiency-related vaccine-derived poliovirus

LB Lysogeny broth

MOI multiplicity of infection

mOPV1 monovalent oral polio vaccine type 1

mOPV2 monovalent oral polio vaccine type 2

nOPV2 new oral polio vaccine type 2

nt nucleotide

OPV oral polio vaccine (also: Sabin oral polio vaccine)

OPV2 oral polio vaccine type 2

PCR polymerase chain reaction

RT-rtPCR real-time reverse transcriptase polymerase chain reaction

SAE serious adverse effect

SAGE Strategic Advisory Group of Experts on Immunization (WHO)

TgPVR mice transgenic mice carrying the human poliovirus receptor

tOPV trivalent oral polio vaccine

VAPP vaccine associated paralytic polio

VDPV vaccine derived polioviruses

WHO World Health Organization



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Introduction

Tremendous progress has been made in the eradication of poliovirus disease globally, with

incidence of disease reduced by more than 99% since 1988. As the incidence of wild-type disease

has declined, there has been a relative increase in the proportion of poliomyelitis associated with

use of the Sabin oral polio vaccine (OPV).

In 2012, the Strategic Advisory Group of Experts on Immunization (SAGE) recommended the

withdrawal of the type 2 component (OPV2) of tOPV from routine use. While withdrawal of OPV2

use will reduce risk of vaccine associated paralytic polio (VAPP) cases and introduction of new

type 2 vaccine derived polioviruses (VDPVs) into the community, type 2 VDPV events or

outbreaks may continue for some time from prior circulation, or from chronic shedders (e.g. among

immunocompromised individuals) or from containment failure. To mitigate against this risk, a

500-million-dose stockpile of monovalent OPV2 (mOPV2) vaccine will be maintained for use

during type 2 outbreaks. In the context of waning type 2 intestinal protection following OPV2

cessation and high transmissibility of OPV2, each use of mOPV2 during such outbreak response

risks generating new VDPV2 viruses and continued transmission in areas of low population

immunity posing a significant risk to the eradication program.

While Sabin 2 has a long history of use throughout the world, current circumstances support the

development of a novel OPV2 with an improved benefit/risk profile. Specifically, it is highly

desirable to have a new vaccine which confers the humoral and mucosal immunity provided by

the oral vaccine, but with better genetic stability and therefore reduced risk of reversion to a

neurovirulent phenotype. Reduced reversion in turn will reduce risk of (1) causing vaccine-

associated paralytic polio (VAPP) and (2) mutating into circulating vaccine-derived polio virus

(cVDPV) strains that can potentially seed new outbreaks.

In 2017, a first-in-human Phase 1 clinical study was performed in Belgium, evaluating the general

safety, immunogenicity, viral shedding and genetic stability of two candidate nOPV2 vaccines in

IPV-only vaccinated adults (>18 years old) (Eudra CT number 2017-000908-21). In general, the

immune responses to both candidates were clearly evident; there were no serious adverse effects;

none of the solicited adverse events (pre-specified parameters during the 7 days following

vaccination) were severe, and most were mild; immune responses to both candidates were clearly

evident and participants of both cohorts were seroprotected at day 28. With respect to shedding,

the duration of fecal shedding was generally comparable to expectations for individuals with an

IPV-only vaccination history who are given Sabin OPV, with median durations of shedding of

about 2 and 4 weeks for the two candidate vaccines. Nasopharyngeal swabs taken at day 0, 3, 7

and end-of-containment (day 28-36) were all negative for all participants. This proposal covers the

subsequent Phase 2 multicentre study to further evaluate the safety, immunogenicity and viral

shedding.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

I. GENERAL INFORMATION

A. NAME AND ADDRESS OF THE NOTIFIER Prof Dr Pierre Van Damme, PhD

University of Antwerp

Campus Drie Eiken, Universiteitsplein 1

2610 Antwerpen (Wilrijk) Belgium

Tel + 32-3-2652538, Fax +32-3-2652404

B. NAME, QUALIFICATIONS AND EXPERIENCE OF THE

RESPONSIBLE SCIENTIST(S) Prof Dr Pierre Van Damme, PhD

Centre for the Evaluation of Vaccination,

Vaccine & Infectious Disease Institute,

Faculty of Medicine & Health Sciences,

University of Antwerp, Belgium

Professor Van Damme obtained his MD from the University of Antwerp, Belgium, and has

post-graduate degrees in health and economics, the evaluation of human corporal damage,

and a master degree in occupational health. He obtained his PhD in epidemiology and social

medicine from the University of Antwerp, and is currently a full professor at the University

of Antwerp in the Faculty of Medicine and Health Sciences where he chairs the Vaccine &

Infectious Disease Institute (VAXINFECTIO, University of Antwerp). VAXINFECTIO is

a consortium of three research units within the university: the Laboratory of Medical

Microbiology (LMM), the Laboratory of Experimental Hematology (LEH), and the Centre

for the Evaluation of Vaccination (CEV). It is recognized as ‘Centre of Excellence’ of the

University of Antwerp and functions as WHO Collaborating Centre for the WHO European

Region for the control and prevention of infectious diseases.

The CEV was founded in 1994 by Professor Van Damme, and conducts research in 5 main

areas: (1) (sero-) epidemiology of infectious diseases; (2) economic evaluation of public

health interventions and mathematical modelling of infectious diseases; (3) vaccine trial

studies including assessment of safety, protective efficacy and immunogenicity of vaccines;

(4) injection and diagnostic device research; (5) kinetics of vaccine-induced antibodies,

including passive transfer of maternal antibodies and maternal immunization. Since 1985 he

has conducted more than 325 vaccine trials within the trial unit of the Centre for the

Evaluation of Vaccination.

Professor Van Damme has authored more than 370 peer-reviewed papers and is on the

editorial board of several scientific journals that focus on the study of vaccines and vaccine-

preventable infectious diseases. He was awarded with the Research Award of the University

of Antwerp, and in 2000 with the Belgian Social Medicine Award ‘Jean Van Beneden’ for

his work on the introduction of universal hepatitis B immunization programs. In May 2014,

he was awarded with the prestigious Bill Marshall award of the ESPID society. In addition,

for more than 10 years Professor Van Damme has served as a regular advisor for national



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

and international organizations including the Flemish Vaccination platform, the National

Immunization Technical Advisory Group, and the World Health Organization (European

Regional Office and Headquarters). He has been appointed as chairman of the European

Technical Advisory Group of Experts on communicable diseases and vaccines for the WHO

European Region (ETAGE) (2004-2014) and is a member of the Belgian Royal Academy of

Medicine.

C. TITLE OF THE PROJECT “A Phase 2, double-blind, randomized, placebo-controlled, multicenter study to evaluate the

safety and immunogenicity of two novel live attenuated serotype 2 oral poliovirus vaccines

candidates, in healthy adults and adolescents previously vaccinated with oral polio vaccine

(OPV) or inactivated polio vaccine (IPV), compared with historical controls given Sabin

OPV2 or placebo.”

II. INFORMATION RELATING TO THE GMO

Both nOPV2 candidate 1 and nOPV2 candidate 2 are derived from the Sabin 2 live attenuated

oral polio vaccine. Sabin 2 is considered the “recipient organism”.

Sabin 2 virus RNA genome was cloned using the RNA-cDNA hybrid cloning method. The

cDNA version of the genome was cloned into a plasmid backbone and further modified

based on standard molecular techniques using E.coli strains. The modification to the

plasmids and E.coli work are described in the section on “vector”.

Finally, the modified Sabin 2 sequences are transfected in Vero cells, which respectively

produce the nOPV2 candidate 1 and nOPV2 candidate 2. The two nOPV2 candidate vaccines

are described as the “GMO”.

A. CHARACTERISTICS OF THE RECIPIENT ORGANISM

1. Scientific name

Attenuated poliomyelitis vaccine (oral) Type 2 (Sabin 2)

2. Taxonomy

This is the taxonomy of poliovirus, from which the vaccine was derived

Group Group IV ((+)ssRNA)

Order Picornavirales

Family Picornaviridae

Genus Enterovirus

Species Enterovirus C

Subtype Poliovirus



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

3. Other names

Sabin 2, Sabin OPV2

4. Phenotypic and genetic markers

Polioviruses are small, non-enveloped viruses with a single positive strand RNA genome of

approximately 7400 nucleotides. The genome contains a relatively long non-coding region

in the 5’ end (5’ untranslated region, or 5’ UTR) which is highly structured and contains the

internal ribosome entry site (IRES) that is required for translation. The genome is translated

as a single polyprotein, which is cleaved during translation by genome-encoded proteases

into three regions referred to as P1, P2, and P3. The P1 region is further processed into viral

structural (capsid) proteins, while P2 and P3 encode the non-structural proteins that are

involved in protein processing and viral replication.

A type 2 strain (P2/712) isolated from the stools of a healthy child from New Orleans, and

therefore naturally attenuated, was the basis of the Sabin 2 strain (Minor, 2015). Experiments

using recombinants between the attenuated P2/172 strain and a virulent mouse-adapted strain

(P2/Lansing) have demonstrated that two regions of the P2/172 genome are primarily

responsible for the attenuation, and mutations at these regions result in reversion to a more

virulent form of the virus. These two regions are nt 481 in the 5’UTR and nt 143 of the capsid

protein VP1 (Moss et al., 1989). Comparison of neurovirulent strains of type 2 polio and

Sabin OPV2 revealed that attenuation is linked with two nucleotide substitutions: G481A in

the 5'UTR (the stem loop region V of the internal ribosome entry site (IRES)) and C2909U,

resulting in a threonine for isoleucine at position 143 in the capsid protein VP1 (Ren et al.,

1991; Macadam et al., 1993).

5. Degree of relatedness between donor and recipient or between parental organisms

The modifications that lead to the two nOPV2 candidate vaccines are based on

insertion/substitution of modified OPV2 sequences or on mutagenesis. The modified OPV2

sequences were synthesized on demand. No sequences from other -unrelated- donor

organisms have been used.

6. Description of identification and detection techniques

Polioviruses isolated through environmental or Acute Flaccid Paralysis surveillance can be

readily identified by any Global Poliovirus Laboratory Network lab.

The gold standard assay for detection of poliovirus in stool specimens is a cell culture

isolation algorithm using both rhabdomyosarcoma (RD) cells and L20b cells. This algorithm

was modified for use with IPV clinical studies using a challenge with OPV, by eliminating

the RD cell arms of the algorithm and adding an automated 50% cell culture infectious dose

(CCID50) assay to quantitate the infectious virus in the stool specimen. Polio vaccine virus

isolated in cell culture are identified using a real time PCR assay which detects all

enteroviruses (pan-EV) as well as Sabin 1, 2, and 3. This PCR assay is the same PCR assay

used in the intratypic differentiation kits distributed to the Global Polio Laboratory Network

(GPLN) for polio surveillance.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

New methods of poliovirus detection are required to increase testing throughput, minimize

wait times, and maintain a high level of assay sensitivity compared to the gold-standard of

isolating poliovirus on cell cultures. The direct detection assay was developed to identify

polio vaccine virus in nucleic acid extracts from stool suspensions, eliminating the need to

isolate virus on cell culture. To compare this method to the gold standard, a panel of stool

suspensions (n=186; power = 90%, non-inferiority difference = 7.5%, α = 0.05) from a

monovalent Sabin 2 challenge clinical trial conducted in Latin America. Stool suspensions

used for validation of the direct detection method were selected from three categories of

virus shedding based on virus concentrations:

1) High (4.75 – 8.25 CCID50/g of stool)

2) Medium (3.25 – 4.74 CCID50/g of stool)

3) Low (2.75 – 3.24 CCID50/g of stool)

The real time PCR assay used to identify virus in the direct detection method is the same

assay used in the gold standard method. Overall, the direct detection method has a true

positive rate (sensitivity) of 97% and a true negative rate (specificity) of 71% compared to

the gold standard method. For each of the shedding categories, the true positive rate was 100

(high), 100 (medium), and 92% (low) indicating that method sensitivity decreases slightly

at virus concentrations at or below the limits of what can be cultured using the gold standard

method. The low true negative rate can be attributed to the low number of negative stools

tested (n=18).

The real time PCR method has been successfully applied to detecting shed Sabin 2 in a

number of recent trials, including “A Phase 4 study to evaluate the safety and

immunogenicity of monovalent oral polio vaccine type 2 in healthy OPV-vaccinated adults”

(EudraCT 2015-003325-33) conducted in Belgium in late 2015.

7. Sensitivity, reliability (in quantitative terms) and specificity of detection and

identification techniques

See previous point.

8. Description of the geographic distribution and of the natural habitat of the organism

including information on natural predators, preys, parasites and competitors,

symbionts and hosts

Poliovirus, from which Sabin 2 is derived has a highly-restricted host range. Non-primates

and their cell cultures lack the human poliovirus receptors and are refractory to natural

infection. There is no evidence that non-primates are infected by poliovirus in nature or could

serve as reservoirs. While filter-feeding shellfish can concentrate poliovirus from polluted

waters, poliovirus does not replicate in these organisms and is purged when the source of

contamination is removed (Dowdle & Birmingham, 1997).

Some lower primates are susceptible to poliovirus infection. However, even in the

cynomolgus monkey, considered to be one of the species more susceptible to oral infection,

poliovirus excretion is low and of short duration with very limited transmission. There are

reports that suggest that chimpanzee, and possibly other higher non-human primates, may

acquire poliovirus in nature. However, they are less susceptible than humans and it is



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

unlikely that populations are sufficient to sustain poliovirus transmission in the absence of

human infection (Dowdle & Birmingham, 1997).

Polio transmission is primarily the result of person-to-person contact (fecal-oral or oral-oral)

(Dowdle & Birmingham, 1997).

The recipient strain, Sabin 2, does not occur naturally. Sabin 2 for vaccine production is

typically cultured in cells, such as Vero cells derived from African green monkey epithelial

cells.

Once administrated to a human subject, the vaccine virus can replicate and during the first

4-6 weeks following vaccination; the majority of non-immune vaccine recipients shed OPV

in nasopharyngeal secretions and feces (WHO, 2016). Data from non-immune subjects given

mOPV1, mOPV2, or tOPV demonstrate oropharyngeal virus shedding for up to 20 days

(median of 6-10 days), and more than 75% of primary OPV recipients shed virus in the feces

for a period that is highly variable (mean 20-28 days, range of up to 8-10 weeks in less than

10% of subjects at low and intermittently detectable levels) (Gelfand et al., 1959; Ghendon

& Sanakoyeva, 1961; Ginter et al., 1961; Henry et al., 1966; Asturias et al., 2016).

Shedding is reduced when the vaccine is administered to individuals who have previously

received OPV or IPV (Fine & Carneiro, 1999). Fewer than 5% of children who have received

3 or more doses of OPV shed virus from the oropharynx following a challenge OPV dose.

Fecal shedding is also reduced to 22-37% of recipients who shed the challenge virus for a

mean of 5-7 days at titers that are approximately 3 log10 lower than non-immune OPV

recipients (Horstmann et al., 1959; Ghendon & Sanakoyeva, 1961; Henry et al., 1966;

Onorato et al., 1991). These reports are consistent with preliminary results of a trial recently

conducted in Belgium by the University of Antwerp -“A Phase 4 study to evaluate the safety

and immunogenicity of monovalent oral polio vaccine type 2 in healthy OPV-vaccinated

adults” (EudraCT 2015-003325-33)- where 13% of OPV-vaccinated adults had detectable

Sabin-2 viral RNA in stools collected day 7 post-administration.

Prior vaccination with at least 2 IPV doses reduces oropharyngeal excretion of the OPV

challenge virus to less than 5% and also reduces the rate of fecal excretion compared with

non-immune subjects, but magnitude of the effect is less than among naturally immune and

OPV immune subjects. Across studies, 63-100% of IPV vaccinated children demonstrate

fecal excretion at 7-10 days after the OPV challenge (Horstmann et al., 1959; Ghendon &

Sanakoyeva, 1961; Henry et al., 1966; Onorato et al., 1991; Mohammed et al., 2008). The

effect of IPV vaccination on duration and titer of virus shed is greater (mean 12 days, 50%

shorter and 104,1 tcid50/gram, 1 log10 lower than non-immune OPV recipients, respectively).

(Ghendon & Sanakoyeva, 1961; Hird &Grassly, 2012).

There are no natural predators, preys, parasites or competitors.

9. Organisms with which transfer of genetic material is known to occur under natural

conditions

Group C enteroviruses, including polioviruses and the derived Sabin 2, can recombine in

humans if co-infection occurs. Such recombination is one of the mechanisms that can lead

to the reversion of the attenuated vaccine strain to a neurovirulent phenotype (e.g. Rakoto-

Andrianarivelo et al., 2007; Holmblat et al., 2014)



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

There is no evidence for circulation of type C enteroviruses in the Belgian population in

recent years (Personal communication from Prof. M. Van Ranst, Rega Institute, KULeuven,

national reference laboratory on enterovirus typing for the period 2011-2016/2017).

10. Verification of the genetic stability of the organisms and factors affecting it

Sabin 2 has inherent genetic instability at the attenuating positions which leads to reversion

to virulence. The proposed clinical study is part of a development program investigating

genetic modifications to improve the genetic stability and thereby produce a more stable

vaccine, i.e. less likely to revert to virulence.

Sabin 2 is highly attenuated in both monkeys and transgenic mice carrying the human

poliovirus receptor (TgPVR mice). Two mutations are understood to account for the majority

of the attenuation as compared to wild-type type 2 virus. The mutation in Sabin 2 which is

primarily responsible for attenuation resides in the 5’ UTR (Macadam et al., 1993). This

mutation (nucleotide 481A) acts to thermodynamically destabilize an RNA stem-loop

structure known as domain V which forms part of the internal ribosome entry site. It is

believed that this mutation results in attenuation by reducing the efficiency of the initiation

of translation of the viral polyprotein in neural cells, thereby reducing neurovirulence.

After oral administration of the Sabin 2 vaccine, reversion at the 481 site occurs quickly in

the human gut, leading to shedding of virus with increased neurovirulence. For example,

virus shed only one week after trivalent OPV (tOPV) vaccination in children was shown to

contain 33-96% reverted (481G) type 2 virus (Laasri et al., 2005). This reversion results in

a domain V structure which is more thermodynamically stable than the attenuated sequence,

and rare but serious cases of vaccine-associated disease are caused by strains that have

reverted at this attenuation determinant.

The other mutation which accounts for some attenuation of the Sabin 2 vaccine is in amino

acid 143 in VP1, resulting in a threonine to isoleucine substitution. Selective pressure in the

human gut against this mutation appears to be lower than for nucleotide 481, with about half

of the VP1-143 codons exhibiting changes in samples isolated 3 weeks after vaccination

(Macadam et al., 1993).

Other than these modifications, we are not aware of other factors making the Sabin 2 strain

different in genetic stability than other polioviruses or, more broadly, than other group C

enteroviruses i.e. modification by recombination and by infidelity during viral replication

are both possible.

11. Pathological, ecological and physiological traits

a) classification of hazard according to existing Community rules concerning the protection of

human health and/or the environment

The effective use of Sabin OPV2 has been essential for the eradication of type 2 polio. As

such, and in spite of the rare risk for VAPP, it was not classified as a pathogen or raising any

other concern for human health and/or the environment: it can only cause disease upon

reversion, it poses minimal risk to human health and the environment in regions with well-

vaccinated populations, it is unlikely to spread or to establish itself; there is effective

prophylaxis.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

In 2015, the WHO issued the third edition of the Global Action Plan (GAPIII) intended to

minimize poliovirus facility-associated risk after type-specific eradication of wild

polioviruses and sequential cessation of OPV use. With the implementation of GAPIII, the

use of OPV2 has been or is planned to be restricted to control of VDPV2 outbreaks, and

handling of the viruses is intended to be limited to Polio Essential Facilities that meet

stringent containment criteria.

Formally, no hazard classification has yet been determined (WHO, 2015). As a consequence

of GAP III, the Dutch COGEM has advised to increase the pathogenicity classification of

poliovirus type 2 to class 3 (COGEM, 2017a). In a specific advice for 2 chimeric GM

poliovirus strains (derived from Sabin OPV3 with capsid proteins of OPV2), COGEM

indicated that the activities could be conducted at BSL-2 containment (COGEM, 2017b).

b) generation time in natural ecosystems, sexual and asexual reproductive cycle

Sabin OPV2 relies on a primate host for replication. When Sabin OPV 2 is administered

orally, the attenuated poliovirus attaches to the poliovirus receptor (CD155) on the

cytoplasmic membrane of the cells within the host’s gastrointestinal system. Individual

replication cycles occur over about 10 hours, but can continue until the infection is controlled

by the host immune response. Replication and shedding in humans generally lasts for an

average of 5-7 days in OPV vaccinated individuals and 20-28 days in non-immune subjects

(See also Section II.A.8).

c) information on survival, including seasonability and the ability to form survival structures

Polioviruses are resistant to inactivation by many common detergents and disinfectants,

including soaps, but are rapidly inactivated by exposure to ultraviolet light (WHO, 2016).

Also dilute solutions of formaldehyde or free residual chlorine can inactivate polioviruses

(Dowdle & Birmingham, 1997).

Poliovirus from infected stool has been reported to have survived in fresh water for 188 days

at 4°C under laboratory conditions. However, in nature survival will depend on physical,

chemical and biological factors in the environment. The estimation as used by WHO is that

at ambient temperatures a 90% decrease in infectivity is expected every 5.5 days in fresh

water and every 2.5 days in seawater (Dowdle & Birmingham, 1997). Duizer et al. (2016)

use a more conservative estimate of 90% decrease in infectivity every 17.5 days in fresh

water and every 7 days in seawater at 18.5°C.

Sewage treatment as commonly practiced will substantially reduce virus concentrations. A

reduction by 0.7-2 log10 (5 to 100 times) is assumed (Duizer et al., 2016).

Poliovirus may survive in soil for weeks or months, often longer than in water. In temperate

climates, poliovirus infectivity in soil was found to decrease by 90% every 20 days in winter

and every 1.5 days in summer (Dowdle & Birmingham, 1997). At ambient temperatures, a

90% decrease in infectivity occurs in sewage every 26 days, in freshwater every 5.5 days,

and in seawater every 2.5 days (WHO, 2003).

Polioviruses do not form biological survival structures. There is no indication that the

survival and the ability to form survival structures would be different for Sabin OPV2.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

d) pathogenicity: infectivity, toxigenicity, virulence, allergenicity, carrier (vector) of pathogen,

possible vectors, host range including non-target organism. Possible activation of latent

viruses (proviruses). Ability to colonise other organisms

Vaccination with Sabin OPV 2 is generally well tolerated; however, fever, vomiting,

diarrhea and allergic/anaphylactic reactions (latter presumably due to hypersensitivity to

vaccine components or manufacturing process residues, e.g. neomycin, polymyxin) have

been described after vaccination with GSK’s oral trivalent poliomyelitis vaccine (Polio

Sabin mono two SmPC).

On rare occasions, particularly in immunodeficient infants, aseptic meningitis and

encephalitis have been reported after OPV (WHO, 2014).

The main reasons for discontinuation of Sabin 2 in tOPV are the risks for vaccine-associated

paralytic polio (VAPP) in vaccinees or their close contacts and the emergence of circulating

vaccine-derived polioviruses (cVDPVs) that have acquired transmissibility and

neurovirulence. As Sabin strains can replicate in the gut of vaccine recipients, there is a

possibility that the attenuating mutations in the vaccine strains revert and that virulence of

the vaccine strain is restored. This reversion of attenuating mutations during OPV replication

in humans is the underlying cause of VAPP and VDPVs. Both are discussed further below.

In extremely rare cases, OPV vaccination has led to paralysis in vaccinees or in their

unimmunized or immunodeficient close contacts. Onset of VAPP usually occurs 4-30 days

following receipt of OPV or within 4-75 days after contact with a recipient of OPV.

In industrialized countries, VAPP occurs mainly in early infancy associated with the first

dose of OPV and decreases sharply with subsequent OPV doses. A review of VAPP cases

in the United States from 1990-1999 was performed by Alexander et al. (2004). The rate of

VAPP for vaccine recipients is estimated as 1 case per 6.4 million doses (1 case per 1.4

million first doses and 1 case per 35.4 million subsequent doses). For contacts of vaccine

recipients, the rate is estimated at 1 case per 13.3 million doses OPV given (1 case per 4.5

million first doses and 1 case per 23.6 million subsequent doses). A review of VAPP cases

in Hungary, which used monovalent OPVs almost exclusively from 1961-1981, estimates

the VAPP risk for Sabin 2 at 0.56 per million doses given (Estívariz et al., 2011).

Persons with primary immunodeficiency disorders are at much higher risk of VAPP

(approximately 3000-fold) than the general population, but VAPP is rare even in this group.

The Sabin 2 strain was found to be the cause of 30% of cases of VAPP following OPV

vaccination (Platt et al., 2014).

Through prolonged replication in either individuals with primary immunodeficiency

disorders or in a community with low OPV coverage, VDPVs can emerge. These are

characterized by a VP1 sequence divergence of greater than 1% from the parental strain for

type 1 and 3 and greater than 0.6% for type 2, indicating prolonged replication (or

transmission) of the vaccine virus. Though the definition of VDPVs is based on the estimated

duration of replication, it is likely that many of these have re-acquired the neurovirulence

and transmissibility characteristics of wild-type poliovirus. Especially among isolates of type



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

2 VDPVs, the mutations controlling neurovirulence are frequently found to have reverted

(Macadam et al., 1991; Macadam et al., 1993; Minor, 2009).

In regions with low vaccination coverage rates, where competing wild-type poliovirus has

been eliminated and where epidemiologic conditions (e.g. low socioeconomic status, poor

hygiene/sanitation and crowding) favor poliovirus transmission, VDPVs have the potential

for sustained circulation and when there is evidence of person-to-person transmission in the

community these are called circulating VDPVs (cVDPVs). Strikingly, the majority of

reported cases following cVDPV outbreaks that have occurred since 2000 have been

associated with type 2 (Burns et al., 2014). While wild-type poliovirus type 2 has been

eradicated since 1999, type 2 Sabin virus accounts for more than 95% of cVDPV outbreaks

detected in recent years (Bandyopadhyay et al., 2015).

In a small number of individuals with primary immunodeficiency, OPV immunization can

lead to infections which persist for prolonged periods, resulting in chronic shedding of

VDPVs that show increased neurovirulence, the iVDPVs. No iVDPV is known to have

generated secondary cases with paralysis (WHO, 2016). The occurrence of iVDPVs is very

rare. Since the introduction of OPV in 1961 to March 2015, approximately 100 persons with

primary immunodeficiencies worldwide have been found to be excreting iVDPVs. Like

cVDPVs, type 2 iVDPVs are the most prevalent (65%) (Diop et al., 2015).

There are no latent proviruses within the Sabin 2 genome.

The hypothetical potential to colonize species other than humans was described in Section

II.A.8.

e) antibiotic resistance, and potential use of these antibiotics in humans and domestic

organisms for prophylaxis and therapy

Sabin OPV 2 is not susceptible to antibiotics and does not contain antibiotic resistance genes.

f) involvement in environmental processes: primary production, nutrient turnover,

decomposition of organic matter, respiration, etc.

Sabin OPV 2 is not involved in any environmental process.

12. Nature of indigenous vectors

There are no indigenous vectors in Sabin OPV2.

13. History of previous genetic modifications.

There have been no previous genetic modifications of Sabin OPV2. As noted above, Sabin

OPV2 was derived from an attenuated strain of wild poliovirus shed by a healthy child.

Comparison of neurovirulent strains of type 2 polio and Sabin OPV2 reveal that attenuation

is the result of two nucleotide substitutions: G481A in the 5'UTR (the stem loop region V of

the IRES) and C2909U, resulting in a threonine for isoleucine at position 143 in the capsid

protein VP1 (Macadam et al., 1993; Ren et al., 1991).



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

B. CHARACTERISTICS OF THE VECTOR

1. Nature and source of the vector

For nOPV2 candidate 1

Plasmid construction began with the plasmid backbone pBR322 (NEB).

Production of the parental Sabin 2 clone from a Sabin SO+3/II vaccine has been described

previously (Pollard et al., 1989). Sabin 2 virus RNA genome was purified using phenol-

chloroform. The RNA was then cloned using the RNA-cDNA hybrid cloning method. The

cDNA version of the genome was cloned into the PstI site of the plasmid backbone (nt 3607).

A T7 RNA polymerase promoter was engineered adjacent to the 5' end of the viral genome

to produce the plasmid pT7/S2. Subsequently, different modifications were introduced:

• Domain V modification

cDNA sequence corresponding to positions 277 to 757 in the polio genome and including

the Macadam S15 domain V sequence for domain V (further described in Section C.2)

was ordered from LifeTech. This sequence was inserted into the plasmid pT7/S2 by

cutting the plasmid with MluI and SacI, trimming the S15 DNA insert with MluI and SacI

and ligating fragments. The combined fragment was transformed into E.coli DH5α cells.

Then colonies of pT7/S2/S15domV were picked and grown up in LB medium containing

tetracycline.

• cre knockout modification

cDNA sequence corresponding to positions 3888 to 5524 in polio genome and including

the novel cre knockout sequence was ordered from LifeTech. This sequence was inserted

into the plasmid pT7/S2/S15domV by cutting the plasmid with BseRI and NcoI, trimming

the cre knockout DNA insert with BseRI and NcoI and ligating fragments. The combined

fragment was transformed into E.coli DH5α cells. Colonies of pT7/S2/S15domV/SL3

were picked and grown up in LB medium containing tetracycline.

• cre5 insertion modification

cDNA sequence corresponding to positions -74 to 277 in the polio genome clone, with an

insertion of the 61 nucleotides (cre5) between positions 120 and 121 in the polio genome

was ordered from LifeTech. This sequence was inserted into the plasmid

pT7S2/S15domV/SL3 by cutting the plasmid with NotI & MluI, trimming the cre5 DNA

insert with NotI & MluI and ligating fragments. The combined fragment was transformed

into E.coli DH5α cells. Colonies of pT7/S2/cre5/S15domV were picked and grown up in

LB medium containing tetracycline.

• hifi and rec modifications

cDNA sequence corresponding to positions 5898 to 7366 in the polio genome and

including the novel hifi and rec mutations was ordered from LifeTech. This sequence was

inserted into the plasmid pT7/S2/cre5/S15domV by cutting the plasmid with BsiWI and

MfeI, trimming the S15 DNA insert with BsiWI and MfeI and ligating fragments. The

combined fragment was transformed into E.coli DH5α cells. Colonies of

pT7/S2/cre5/S15domV/rec1/hifi3 were picked and grown up in LB medium containing

tetracycline.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Figure 1. Map of the plasmid constructed for the production of nOPV2 candidate 1

The final plasmid was amplified in E. coli DH5α cells (NEB) and purified using a Qiagen

maxi prep kit. Aliquots of plasmid were used for re-derivation of GMP-quality seed and

were also used for generation of research stocks.

For the preparations for clinical trials, the plasmid was transcribed using T7 polymerase and

RNA transcripts purified using a commercial kit. The poliovirus RNA transcripts were then

transfected into Vero cells to rescue infectious virus. Rescued virus was subsequently cloned

and deep sequenced, further assuring the removal of any plasmid DNA sequences.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2


Plasmid construction of the recipient Sabin 2 clone has previously been described (Burns et

al, 2006). The poliovirus sequence and T7 phage polymerase promoter were inserted in the

SalI/HindIII restriction endonuclease sites of plasmid vector pUC19. The plasmid contained

19 nucleotide bases of the T7 promoter (TAATACGACTCACTATAGG) immediately

upstream of the first base of poliovirus. The plasmid is linearized with HindIII before RNA

transcripts are made so no vector pUC sequence is transcribed or transfected. There is a 29

nt polyA tail after the poliovirus sequence immediately upstream of the HindIII site. As

described, an XhoI site was formed for cloning purposes using QuikChange Site-directed

Mutagenesis (Stratagene) at nucleotide 3303 A→T near the 3’ end of VP1.

nOPV2 candidate 2 has the same amino acid composition as Sabin 2 GenBank AY184220.

The P2, P3, and 3’ UTR nucleotide sequence are identical to AY184220. Modifications to

other regions of the genome are as follows:

• 40% CpG2-3 modification in P1/capsid

CpG2-3 modification impacts four amino acids changes: Ser AGY and Ser TCN to TCG;

Pro CCN to CCG; Ala GCN to GCG; and, Thr ACN to ACG. A P1/capsid region

containing a 40% CpG2-3 saturation rate was designed, reflecting 40% of all possible

CpG2-3 synonymous codon changes to the Sabin 2 AY184220 sequence. The synonymous

codon changes are evenly distributed across the P1/capsid region. There are 28 capsid

codons that reside outside of the P1/capsid region past the XhoI cloning site. This includes

8 Ser, Thr, Ala, or Pro, one of which has a native CpG2-3.

The design of nOPV2 candidate 2 results in an increase of 94 CpG2-3 with a loss of 7

CpG3-1, for a net increase of 87 CpG over that present in Sabin 2 GenBank AY184220.

In total, 95 codons are changed in candidate 2; 94 codon changes to add CpG2-3 and one

to add an XhoI site at the 3’ end of the capsid cassette. There are 109 nucleotide

substitutions in the P1/capsid region.

A gene cassette containing the 40% CpG2-3 modified P1/capsid sequence was

manufactured by GenScript. To insert the cassette into the Sabin 2 clone, both the cassette

and the Sabin 2 plasmid were cut at the native Sabin 2 BstZ17I (nt 656) site and the XhoI

(nt 3302) cloning site. The Sabin 2 cut plasmid was treated with Antarctic Phosphatase

(New England Biolabs, NEB). Cut plasmid fragments were gel purified (Qiagen Gel

Purification Kit) and ligated with T4 DNA ligase (NEB).

The parent Sabin 2 clone has an A at nucleotide 5640 in the 3C region. This was changed

by site-directed mutagenesis A→T to match GenBank AY184220 in the 40% CpG clone.

• Macadam S15 Domain V insertion within the 5’ UTR

The Macadam S15 domain V modification within the 5’ UTR results in 18 nucleotide

substitutions across nucleotides 469-534 of the Sabin 2 AY184220 clone. A cassette

containing the 5’ UTR Macadam S15 domain V insert was manufactured by GenScript.

The Macadam S15 domain V 5’ UTR cassette was inserted into the nOPV2 candidate 2

clone by cutting the cassette and the 40% CpG2-3 Sabin 2 plasmid generated above in step

1 at the native Sabin 2 BstZ17I (nt 656) site and SalI vector site. Cloning was completed

as described in step 1.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Figure 2 Map of the plasmid constructed for the production of nOPV2 candidate 2

The final nOPV2 candidate 2 plasmid was transformed into Agilent Technologies SoloPack

Gold Supercompetent Cells. Transformed bacteria were cultured in LB media with 100

mg/ml ampicillin. Plasmid DNA was extracted and purified from the culture using Qiagen

Plasmid Plus Maxi Kit and the sequence was confirmed. Lyophilized plasmid DNA was

used for re-derivation of GMP seeds and used for generation of research stocks.

For the preparations for clinical trials, the plasmid was transcribed using T7 polymerase and

RNA transcripts purified using a commercial kit. The poliovirus RNA transcripts were then

transfected into Vero cells to rescue infectious virus. Rescued virus was subsequently cloned

and deep sequenced, further assuring the removal of any plasmid DNA sequences.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

2. Sequence of transposons, vectors and other non-coding genetic segments used to

construct

See Section II.B.1.

3. Frequency of mobilisation of inserted vector and/or genetic transfer capabilities and

methods of determination

The vector is only required for the modification of the vaccine viral genome. Vector (plasmid

DNA) sequences do not remain in the GMO.

4. Information on the degree to which the vector is limited to the DNA required to

perform the intended function.

The vector has been designed for the modification of the vaccine viral cDNA genome and

the stable transfer of transcribed RNA sequences to Vero cells. The plasmids have been

completely characterized, no unknown functions are present and they have been used

routinely in research. Vector (plasmid DNA) sequences do not remain in the GMO.

C. CHARACTERISTICS OF THE MODIFIED ORGANISM

1. Information Relating to the Genetic Modification

a) methods used for the modification

The modifications of the plasmids described in the previous section were made by standard

cloning methods and site-directed mutagenesis.

b) methods used to construct and introduce the insert(s) into the recipient or to delete a

sequence

The modifications of the plasmids are described in the previous section, in particular Section

II.B.1.

c) description of the insert and/or vector construction

The modifications of the plasmids are described in the previous section, in particular Section

II.B.1.

d) purity of the insert from any unknown sequence and information on the degree to which the

inserted sequence is limited to the DNA required to perform the intended function

The cDNA inserts used for construction of both nOPV2 candidates were designed and

obtained from LifeTech or GenScript. The modifications in the nOPV2 candidate 2 are

achieved using a site-directed mutagenesis. No sequence of unknown source has been used.

e) methods and criteria used for selection

The modifications of the plasmids are described in the previous section. E.coli strains

harbouring the modified plasmids have been selected using antibiotic resistance gene.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

f) sequence, functional identity and location of the altered/inserted/deleted nucleic acid

segment(s) in question with particular reference to any known harmful sequence.

The sequence changes introduced, their location, and their intended purposes are described

in Sections II.C.2.a). No known harmful sequences have been introduced. A full sequence

comparison between nOPV2 candidate 1 and Sabin 2 as well as nOPV2 candidate 2 and

Sabin 2 virus has been conducted (see Annex 1 and 2).

2. Information on the final GMO

a) description of genetic trait(s) or phenotypic characteristics and in particular any new traits

and characteristics which may be expressed or no longer expressed

The nOPV2 candidates are expected to induce the same immunization reaction as Sabin

OPV2.

Nevertheless, the GMOs are intended to be more genetically stable than the parental Sabin

OPV2 strain, resulting in a much lower -if any- reversion to a neurovirulent phenotype.

Whereas attenuation of Sabin OPV2 is based on two single nucleotide mutations, the nOPV2

candidate strains include different combinations of 5 distinct modifications of the Sabin 2

genome (Figure 3), including changes to the RNA sequence in the 5’ UTR, the capsid protein

coding region (P1), the non-structural protein 2C, and the polymerase 3D. Of these

modifications, only the changes to polymerase 3D result in a change in the amino acid

sequence. The rest of the modifications aim to stabilize the genetic sequence against

reversion in either the 5’ UTR or capsid regions.

Figure 3 Schematic presentation of the different modifications in nOPV2 candidates. The Sabin

2 genome is depicted showing the 5’ UTR in grey shading, polyproteins (P1-3), 3’ UTR and

polyA; locations of modifications within the genome are shown. Nucleotide differences

between Sabin 2 and Macadam S15 domain V are shown in red.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2


Table 1 lists the five modifications that were introduced in Sabin 2 cDNA clone to establish

nOPV2 candidate 1 (S2/cre5/S15domV/rec1/hifi3).

Table 1 Overview of the modifications made in nOPV2 candidate 1 (To) in comparison

with the recipient Sabin OPV2 strain (From). Nucleotide position is based on

mOPV2 numbering

Name of

modification

Type of

modification

Nucleotide

Position

Sequence changes

cre5 Insertion Between 120

and 121

CAUUAACAAUUAGGUACAGCUCUAGAGCAAA

CACCGUAUAGAGCCAGUACCUUUGUUAGUA

Macadam S15

domain V

Substitution 468-535 From

UCCUAACCACGGAACAGGCGGUCGCGAACCA

GUGACUGGCUUGUCGUAACGCGCAAGUCUGU

GGCGGA

To

UUCUAACCAUUGAGCAGGCAGCUGCAACCCA

GCAGCCAGCCUGUCGUAAC

GCGCAAGUCAAUGGCGAA

cre knock-out

SL3


AAUAAUUACGUACAGUUCAAAUCCAAGCACC

GUAUUGAGCCAGUAUGUUUGUU

To

AAUAAUUAUGUCCAAUUUAAAUCCAAGCACC

GUAUCGAGCCAGUAUGUUUGUU

Rec 1 Substitution 6097-6099;

3Dpol - 38

From AAG; K (lysine)

To AGA; R (arginine)

HiFi 3 Substitution 6142-6144;

3Dpol - 53

From GAC; D (aspartate)

To AAU; N (asparagine)

The modifications are:

• A new 61 nucleotide sequence was inserted into the 5’ UTR to generate a new cre

element. The sequence inserted originated from the Sabin 2 cre (located in protein 2C)

but includes changes to increase thermodynamic stability of the secondary structure and

to introduce STOP codons if the new cre somehow was returned to its position in protein

2C (for example by recombination) (See Figure 3).

• Modifications were made to the domain V to eliminate the potential for further

stabilization of the structure by a single nucleotide change. While the modifications are

shown in comparison to Sabin 2 domain V, this new sequence actually came from making

a smaller number of modifications to the Sabin-3 domain V sequence. More specifically,

the sequence of RNA structural domain V in the 5’UTR (nucleotides 468-535) has been

replaced with the equivalent region of the virus S15 (nucleotides 471-538) (Macadam et

al., 2006).

• Substitutions were made to the sequence of the original cre element in the protein 2C

gene in order to eliminate its function. These substitutions all involve synonymous codon

usage and therefore do not impact protein 2C amino acid sequence.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

• Two codons were modified to result in two amino acid changes in the polymerase which

improve fidelity (hifi3) and reduce recombination (rec1).

Apart from the modifications in the polymerase gene (3D) there were no amino acid changes

deliberately introduced into the Sabin 2 polyprotein.


Table 2 lists the two modifications that were introduced in Sabin 2 cDNA clone to establish

nOPV2 candidate 2 (S2/S15domV/CpG40).

Table 2 Overview of the modifications made in nOPV2 candidate 2 (To) in comparison

with the recipient Sabin OPV2 strain (From). Nucleotide position is based on

mOPV2 numbering

Name of

modification

Type of

modification

Nucleotide

Position

Sequence changes

Macadam S15

domain V


UCCUAACCACGGAACAGGCGGUCGCGAACCA

GUGACUGGCUUGUCGUAACGCGCAAGUCUGU

GGCGGA

To

UUCUAACCAUUGAGCAGGCAGCUGCAACCCA

GCAGCCAGCCUGUCGUAACGCGCAAGUCAAU

GGCGAA

CpG40 Substitution 748-3384; P1 87 N-G mutations at 3rd base of codons;

7 AGY–UCG codon substitutions;

All substitutions are synonymous

The modifications are:

• Modifications to the S15 domain V (identical to candidate 1 above).

• The proportion of CpG dinucleotides in the P1 (capsid) region of the genome was

increased to 40%. 95 codons were changed resulting in an increase of 94 CpG2-3 and a

loss of 7 CpG3-1, yielding a net increase of 87 CpG over Sabin 2. All substitutions are

synonymous (i.e., not resulting in an amino acid change) so that surface antigens remain

unaltered.

The nOPV2 candidate vaccines are designed to combine the immunogenic capacity of the

live attenuated OPV2 vaccine with a much reduced -if any- reversion to a neurovirulent

phenotype. The genetic stability and likelihood of reversion are further addressed in Section

II.C.2.c. Annex 3 provides a summary of the results of the Phase 1 study conducted with the

nOPV2 candidate vaccines.

b) structure and amount of any vector and/or donor nucleic acid remaining in the final

construction of the modified organism

There is no donor or vector nucleic acid in the final organisms. Most of the modifications

result in the substitution of the Sabin OPV2 sequence with a modified sequence. The only



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

inserted sequence (cre) consists of 61 nucleotides originating from the Sabin 2 cre located in

protein 2C.

c) stability of the organism in terms of genetic traits

The absence of a relevant animal model that includes replication and shedding of

polioviruses following oral dosing makes a definitive assessment of genetic stability in vivo

difficult prior to human clinical trials. However, culture of Sabin 2 in animal cells at

physiological temperatures has been shown to result in reversion in a manner similar to that

seen in human shedding samples (Macadam et al., 2006). As discussed earlier, most notable

among these changes is the reversion of the domain V attenuating mutation (481A) to the

wild-type nucleotide (481G). Because of the temperature sensitive phenotype, selective

pressure towards reversion is high at physiological temperatures.

Therefore, the candidate nOPV2 viruses were passaged ten times in Vero cells at 37°C using

a multiplicity of infection (MOI) of 0.1 pfu/cell and a single cycle of replication per passage.

Preliminary experiments (not shown) established that a 10-h incubation was suitable to

achieve the goal of a single replication cycle. The passaging experiments for the two

candidates were conducted separately in two labs with different Vero cell banks; however,

in both cases the same Sabin 2 reference strain (WHO SO+2/2) was passaged concurrently

with candidate nOPV2 strain.

In brief, for the initial passage, 1x107 Vero cells were seeded on 10-cm cell culture dishes or

T75 flasks and cultured at 37°C the day before infection. After washing the cells, 106 pfu of

Sabin 2 or nOPV2 was added and incubated for 1 hour to allow virus adsorption. The cells

were washed again, fresh medium was added, and the infected cells incubated at 37°C until

10 hours post infection. The infected cultures were then lysed using three freeze-thaw cycles

to release the viruses. The virus suspension was clarified and stored frozen. For subsequent

passages, infection occurred based on dilution, with confirmation that the actual MOI was

within 3-fold of the target MOI of 0.1.

Passage 10 viruses were tested for neurovirulence in TgPVR mice. Transgenic mice

expressing the human poliovirus receptor (Tg66-CBA) were inoculated by the intraspinal

(i.s.) route. The dose TCID50 required to paralyse 50% of the mice (PD50) was calculated

using the Spearman-Karber method. Additionally, deep sequencing was used to monitor the

genetic stability across the passages. These results are described below.

TgPVR mice

Both nOPV2 candidates are much more phenotypically stable than Sabin 2 following the ten

passages in Vero cells. Specifically, Sabin 2 increased in virulence more than 1000-fold, as

shown by the greater than 3 log10 reduction in PD50 (Table 3). Candidate 2 showed a marginal

(less than 10-fold) loss of attenuation. Candidate 1 showed no apparent loss of attenuation.

These results suggest that reversion of the candidate strains in the human gut should be

significantly reduced relative to the Sabin 2 vaccine.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Table 3 Neurovirulence following passaging in cell culture.

PD50, log10 TCID50 (Tg66-CBA, i.s.)

Passage 0 (start) Passage 10 Change

Sabin 2 5.6 2.1 -3.5 log10

nOPV2 candidate 1 >8.35 >8.7 Not measurable

nOPV2 candidate 2 6.3 5.4 -0.9 log10

Deep sequencing

For both nOPV2 candidates, results from the deep sequencing confirmed the observation of

improved phenotypic stability seen in the mouse neurovirulence model relative to Sabin 2.

Specifically, all of the modifications deliberately introduced into the genomes of the two

nOPV2 candidates were retained with no evidence of reversion and no changes known to be

associated with increased neurovirulence were observed.

Reversion in domain V is the main determinant for restoration of virulence following Sabin

2 administration in humans. For the nOPV2 candidate strains, no changes were detected in

domain V following passaging; no singular nucleotide polymorphisms were detected in this

region above 0.1%. In contrast, for Sabin 2, reversion of the major attenuating mutation at

481 in domain V was selected to the level of 19.7% following passaging concurrent with

nOPV2 candidate 1 (Table 4), and to the level of 18.6% following passaging concurrent with

nOPV2 candidate 2 (Table 5). These results again affirm the significantly improved genetic

stability of these strains. In addition, the Sabin 2 results observed here are analogous to what

is seen in vivo: for these experiments revertants accumulated to approximately 20% in

approximately 4 days of passaging while, in vivo, reversion ranged from 33% to 97% 7 days

after immunization (Laasri et al., 2005).

In both passaging experiments, variants in the protease 2A gene were selected in Sabin 2 and

the nOPV2 candidate strains. The results do not appear in the summary table for nOPV2

candidate 2 and the Sabin control since in this experiment none of the 2A variants

accumulated to more than 5%. This is due to a well-known Vero cell adaptation mechanism

and does not affect attenuation (Rowe et al., 2000). It is likely that variation in 3C selected

in one of the passage series (Table 5) is a similar phenomenon.

Viruses Sabin 2 (WHO SO+2), nOPV2 candidate 1, and nOPV2 candidate 1 mutants with

single mutations in 3Dpol, were passaged 10x in Vero cells at 37°C using an MOI of 0.1

then deep-sequenced. Variation of at least 10% in any of the co-passaged strain are

summarized. In Sabin 2, reversion of the major attenuating mutation at 481 in domain V was

selected to the level of 19.7%. All of the modifications deliberately introduced into the

genome of candidate 1 were retained with no evidence of reversion. Variation in the protease

2A gene was selected in Sabin 2 and the candidate strain.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Table 4 Deep sequencing of Sabin 2 andnOPV2 candidate 1 following passaging in Vero

cells.

Position(1) Protein Variant Coding

impact

Variant Percentage

Sabin 2 candidate 1 481 None (5’ UTR) A to G None 19.7 N/A

3400 2A A to G N6D 12.6(2) 0.9

3403 2A A to C K7Q 0.6 10.5

2A A to G K7E 0.7

3404 2A A to C K7T 1.8 5.9

2A A to G K7R 13.4 11.0

3413 2A A to G Y10C 12.3 17.0

3571 2A T to C Y63H 2.3 14.0

3750 2A A to G I122M 4.3(3) 5.0(3)

Table Notes:

1. Position designation based on Sabin 2.

2. Variants greater than 10% shown. Other variants at same position shown for completeness.

3. Greater than 10% variation at this position observed for at least one co-passaged strain (data not shown).

Similarly, Sabin 2 (WHO SO+2) and candidate 2 were passaged 10x in Vero cells at 37°C

using an MOI of 0.1, and then deep-sequenced. In Sabin 2, reversion of the major attenuating

mutation at 481 in domain V was selected to the level of 18.6%. All of the modifications

deliberately introduced into the genome of candidate 2 were retained with no evidence of

reversion. Variation in the protease 2A gene was selected in Sabin 2 and the candidate strain

at several positions at levels of 1-4%. Variation in 3C was seen for both strains, to a greater

extent in Sabin 2 than candidate 2.

Table 5 Deep sequencing of Sabin 2 and candidate 2 following passaging in Vero cells.

Position(1) Protein Variant Coding

impact

Variant Percentage

Sabin 2 candidate 2 156 None (5’ UTR) T to C None 7.5

481 None (5’ UTR) A to G None 18.6 N/A

2797 VP1 T to A S106T 13.3

5774 3C A to T Y113F 77.1 11.3

Table Notes:

1. Position designation based on Sabin 2.

In the first-in-human Phase 1 clinical study performed in Belgium (Eudra CT number 2017-

000908-21), 15 participants each were administered nOPV2 candidate 1 and 2. Annex 3

provides a summary of the results. Virus shed in stools collected from the participants of this

study was assessed for genetic stability by the modified transgenic mouse neurovirulence

test (mTgmNVT) to assess the potential neurovirulence of virus and by deep sequencing to

provide supportive information for genetic stability of the candidates, primarily by

demonstration of retention of key genetic modifications.

A predetermined procedure was used to identify the latest sample per participant suitable for

analysis by these methods, in order to maximize the possibility of detecting changes; this

sample was termed the exploratory endpoint sample (EES). The EES is defined as the last

polio type 2-positive stool sample with a CCID50 above a cutoff of 4.00 log10 CCID50 per



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

gram of stool. In order to have sufficient virus titer to perform the intraspinal injection in the

TgmNVT, the shed virus was amplified in cell culture. Deep sequencing was performed on

both cell culture amplified virus and virus directly isolated from stool. For nOPV2 candidate

1, a sample was available from each study participant (15 total, ranging from day 2 to 56

post-vaccination). For nOPV2 candidate 2, six samples met the EES criteria and were tested

by deep sequencing (ranging from day 2 to day 28 post-vaccination), but only two were

evaluable by the TgmNVT (day 2 and 3 post-vaccination).

A summary of the neurovirulence results is shown in Table 6 below, which compares the

neurovirulence of the EES with the nOPV2 candidate vaccine administered. No meaningful

increases in neurovirulence were detected in any samples compared to the administered

candidate. While there were no concurrent Sabin OPV2 control vaccinees in this trial, a

Sabin 2 reference virus was included as assay controls at two dose levels in order to monitor

assay performance and assess validity. To note, a reverted mOPV2 virus isolate (90% of

virus has mutation at nucleotide 481, known to be associated with neurovirulence phenotype)

from day 7 post-vaccination from a previous trial, showed over 70% paralysis during

qualification of this method at the same inoculum level (4 log10 CCID50).

Table 6 Summary of transgenic mouse neurovirulence testing for candidate vaccines and virus

shed from trial participants. Results represent 20-30* mice inoculated per EES.

Candidate vaccine Paralysis rate for

administered candidate

Virus shed from participants

Number of EES evaluated Paralysis rate, Mean (range)

Candidate 1 0.0% 15 0.8% (0.0%, 5.3%) #

Candidate 2 13.3% 2 6.9% (0.0%, 14.3%) * Data pending from retest of one replicate for 5 EES (all EES from the Phase 1 M4a trial were tested in triplicate). Data are not expected

to substantially change results.

Deep sequencing analyses generally support the neurovirulence observations. For both

candidates, no variants consistent with increased virulence were detected in domain V of the

5’ untranslated region, the site of the primary determinant of attenuation for Sabin OPV2

(nucleotide 481).

For both candidates 1 and 2, the unprotected secondary attenuation site, VP1-143, reverted

in a manner consistent with expectations for Sabin OPV2. Reversion at this site was reported

for samples collected on or after day 7. Modifications which strengthen the RNA structure

of the relocated cre (U123C or G179A, where nucleotides 123 and 179 form a pair in the

stem) and domain IV of the 5’untranslated region (U459C, or U398C in Sabin-2 frame) were

noted with candidate 1 shed virus. Mouse neurovirulence testing with strains created using

site-directed mutagenesis at these positions (VP1-143 and 123/179) suggest they may

increase virulence, albeit at a low level as compared to the A481G reversion alone in Sabin-

2. Reassuringly, the changes observed in the shed virus were not sufficient to cause

meaningful observable paralysis in the mTgmNVT. For example, the day 56 sample from a

candidate 1 recipient—which had fixed mutations at all three sites (U123C, U459C, and

A2969G leading to Ile to Val substitution at VP1-143)—had no measured paralysis (0/20

mice). A day 38 sample from a candidate 1 recipient, which had fixed mutations at two of



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

the sites (G179A and U2970C leading to an Ile to Thr substitution and VP1-143)—had

minimal measured paralysis (1/19 mice). These results suggest that substantial further

increases in virulence from evolution at these three sites is unlikely.

In summary, the results from the mTgmNVT and deep sequencing of sampes from the Phase

1 study are generally consistent with expectations and provide support for the improved

genetic and phenotypic stability of the nOPV2 candidates.

d) rate and level of expression of the new genetic material/ method and sensitivity of

measurement

There are no heterologous or new proteins expressed by these candidates as a result of the

modifications. The modified sequences do not translate into modified protein sequences,

except for the two amino acid substitutions in the polymerase protein (nOPV2 candidate 1

only).

e) activity of the expressed protein(s)

There are no heterologous proteins expressed in these GMOs. While the polymerase protein

of candidate 1 does have two amino acid substitutions, the overall activity does not seem to

have been significantly changed since the replication in cell culture is similar to the parental

Sabin 2 strain.

f) description of identification and detection techniques including techniques for the

identification and detection of the inserted sequence and vector

The identity of either of these candidates can be readily identified by the unique sequence

elements introduced, which were described above. Since all type 2 poliovirus samples

identified during surveillance must now be sequenced, the identity of either of these nOPV2

candidates can be readily identified by the unique sequence elements introduced.

On the same basis, the Polio and Picornavirus Laboratory in CDC’s Division of Viral

Diseases has developed a real-time reverse transcriptase polymerase chain reaction (RT-

rtPCR) method to detect and differentiate between, Sabin 2, and the two nOPV2 candidate

vaccines.

The nOPV2 Multiplex RT-rtPCR assay is conducted according to a SOP developed and

evaluated by the CDC Population Immunity team. All samples are run using nOPV2

Multiplex RT-rtPCR kit containing six primers and three probes. Extracted viral RNA will

be used as a positive control for Sabin 2 and nOPV2 candidate 1 and candidate 2 RNA, while

nuclease-free water is used as a negative control. The PCR reaction is achieved using AB

7500 equipment and software. After the completion of the run, the data are analyzed using a

manual threshold setting following as per the SOP developed by the CDC.

g) sensitivity, reliability (in quantitative terms) and specificity of detection and identification

techniques

Identification of the nOPV2 candidate 1 and candidate 2 strains is done using a real time

PCR assay designed to differentiate between Sabin 2 and each candidate. PCR reactions

specific for each polio vaccine virus was validated against each strain to demonstrate



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

specificity to the target vaccine virus. The limit of detection for each polio vaccine virus

specific PCR assay is approximately 100 CCID50 for Sabin 2, candidate 1 and candidate 2.

See also Section II.A.6

h) history of previous releases or uses of the GMO

So far, all activities with the 2 nOPV2 candidate vaccines, including the first-in-human Phase

1 study have been performed under contained use conditions.

In the Phase 1 study (Eudra CT number 2017-000908-21), containment of each cohort lasted

until the last participants in each had been in containment for 28 days following

administration of study product. Participants, for which shedding exceeded the 28 days

containment period, were further monitored and special provisions were made to contain

feces.

i) considerations for human health and animal health, as well as plant health

(i) toxic or allergenic effects of the GMOs and/or their metabolic products

There is no indication that the GMO is toxic or allergenic. The modifications aim to obtain

a vaccine which is at least as immunogenic as the widely-used Sabin OPV2, combined with

a strong reduction -if not elimination- of the risk of reversion to neurovirulence. The results

of the Phase 1 clinical trial (Annex 3) confirm that the candidate vaccines were immunogenic

and generally well-tolerated.

(ii) comparison of the modified organism to the donor, recipient or (where appropriate)

parental organism regarding pathogenicity

The recipient Sabin OPV2 is a live attenuated vaccine derived from polio virus. In Section

II.A.11.d) the occasional findings of reversion resulting in VAPP and cVDPV have been

indicated as the main reason for restricting the use of OPV2 to exceptional outbreak cases.

In case of reversion of Sabin OPV2, the pathogenicity approaches that of wild type

poliovirus with prolonged circulation.

In comparison, both nOPV2 candidates combine multiple genetic strategies to reduce the

risk of reversion. To date the higher genetic stability of the candidates has been shown in in

vitro cell culture experiments described above and in the results of the Phase-1 study

summarized in Annex 3.

(iii) capacity for colonisation

As noted in Section II.A.8, there is a limited host range for polioviruses and this would also

apply to the candidate poliovirus vaccines. The nOPV2 candidate vaccines are expected to

replicate in humans in a manner similar to the parental Sabin 2.

In the Phase 1 clinical trial, the PCR detection method was used as an indication for possible

shedding in nasopharyngal and fecal samples (Annex 3). Fecal shedding was observed for

both candidate vaccines, while nasopharyngeal was not.

(iv) if the organism is pathogenic to humans who are immunocompetent:

- diseases caused and mechanism of pathogenicity including invasiveness and virulence,



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

- communicability,

- infective dose,

- host range, possibility of alteration,

- possibility of survival outside of human host,

- presence of vectors or means of dissemination,

- biological stability,

- antibiotic resistance patterns,

- allergenicity,

- availability of appropriate therapies.

Pathogenicity is anticipated to be similar or lower than Sabin OPV2, which has been

administered globally for decades. Section II.A.11.d) summarizes the data on the recipient

organism.

The initial clinical trial data in a limited number of subjects does not indicate that the

organisms are pathogenic.

(v) other product hazards

No additional product hazards are known or anticipated.

III. INFORMATION RELATING TO THE CONDITIONS OF

RELEASE AND THE RECEIVING ENVIRONMENT

A. INFORMATION ON THE RELEASE The information on the intended release is based on the planning of the notifier and might

be subject to possible modifications arising from indications during the clinical trial.

Whenever such modification would arise, the GMO competent authorities will be informed,

in particular if the modification might affect the GMO risk assessment.

1. Description of the proposed deliberate release, including the purpose(s) and foreseen

products

The deliberate release covers the Phase 2 multicentre, double-blinded, placebo-controlled,

randomized study in 200 healthy OPV-primed adults (age range 18 to 50 years) and in 132

healthy IPV- only-primed adults and adolescents (15 to 50 years), as follows:

Group Participants nOPV candidate

vaccine

Number of

doses

Number of

participants

1 OPV-vaccinated adults 1 1 dose 50

2 OPV-vaccinated adults 1 2 doses* 50

3 OPV-vaccinated adults 2 1 dose 50

4 OPV-vaccinated adults 2 2 doses* 50

5 IPV-only vaccinated subjects 1 2 doses* 44**

6 IPV-only vaccinated subjects 2 2 doses* 44**

7 IPV-only vaccinated subjects placebo 2 doses* 44**

* administered 28 days apart / ** approximately 24 adults & 20 adolescent



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

The primary objectives of the study are to assess:

• the safety (serious adverse events [SAEs] and severe1 adverse events [AEs]) and

immunogenicity (seroprotection rate) of novel monovalent live attenuated oral serotype

2 poliovirus vaccine (nOPV2) candidate 1 and novel monovalent live attenuated oral

serotype 2 poliovirus vaccine (nOPV2) candidate 2 in healthy OPV-vaccinated subjects,

compared with historical controls given Sabin OPV2

• the safety (serious adverse events [SAEs] and severe adverse events [AEs]) of nOPV2

candidate 1 and nOPV2 candidate 2 in healthy IPV-only vaccinated older adolescents and

adults, compared with placebo.

Secondary objectives are to assess:

• the safety (any solicited and unsolicited AEs, laboratory assessments) of nOPV2

candidate 1 and nOPV2 candidate 2 in healthy OPV-vaccinated adults, compared with

historical controls given Sabin OPV2;

• the safety (any solicited and unsolicited AEs, laboratory assessments) of nOPV2

candidate 1 and nOPV2 candidate 2 in healthy IPV-only vaccinated adolescents and

adults, compared with placebo;

• the immunogenicity (seroconversion rate, median antibody titer (post-vaccination)) of

nOPV2 candidate 1 and nOPV2 candidate 2 in healthy OPV-vaccinated adults, compared

with historical control of Sabin OPV2;

• the immunogenicity (seroprotection rate, seroconversion rate, median post-vaccination

antibody titer) of nOPV2 candidate 1 and nOPV2 candidate 2 in healthy IPV-only

vaccinated adolescents and adults.

The only products will be samples for further analysis and scientific data.

2. Foreseen dates of the release and time planning of the experiment including frequency

and duration of releases

Recruitment of the first participants is expected to start in the second half of 2018 (Q3/Q4).

Completion will depend on availability of participants fulfilling all selection criteria and

could take up to 3 to 5 months.

Study duration is expected to be 6 weeks for subjects receiving 1 dose of vaccine and

approximately 10 weeks for subjects receiving 2 doses of vaccine, including a 6-week safety

follow-up period after last vaccine administration.

A subject will be considered to have completed the study when:

• he or she has completed all study related procedures 42 days after the last study

vaccination,

• shedding is PCR negative on 3 consecutive stool samples (with a maximum of one sample

per day), and

• no AE or SAE, including clinically significant abnormalities in laboratory safety testing

are observed.

1 List of severe AEs as mentioned in the diary cards: fever > 39°C, headache, fatigue, myalgia, arthralgia, paresthesia, anesthesia,

paralysis, or gastrointestinal symptoms (nausea, vomiting diarrhea and/or abdominal pain) that prevent normal activity or any

other severe AE that prevents normal activity.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Further details on follow up of participants and evaluation of shedding is provided in Section

V.A.4.

3. Preparation of the site previous to the release

No specific preparation of the investigational site (clinical trial centre) is foreseen. Care will

be taken to avoid any loss or deterioration of the doses that are provided. According to the

protocol, the material will be logged upon arrival and stored separately.

The primary release is the moment where the vaccine is administered to the participant. Since

this is done via an oral application, the involved clinical staff can apply the dose with a spoon

without much manipulation. All waste related to the application, including any recipients

that have been used for the nOPV2 candidate vaccines, will be collected on the site and will

be treated as hazardous medical waste.

While the location of the clinical trial centres will be known, the identity and coordinates of

the participants will not be known to the notifier. In addition, shedding may occur during the

evacuation of stool. This is not necessarily limited to the home of the participant. In

consequence, the national territory is considered as the wider potential release area covered

under this application. No preparation of the wider potential release area is foreseen.

4. Size of the site

Not relevant.

5. Method(s) to be used for the release

The nOPV2 candidates are administered orally as a single dose administered at a single

timepoint (Day 0) or administered twice (Days 0 and 28). Participants will remain at the

clinical trial site for at least 30 min following the administration of vaccine.

During the period following the administration, fecal shedding is likely to occur. The first

two weeks are the major shedding period, but based on literature and results from the Phase

1 clinical study it can be foreseen that over a prolonged period (longest period in Phase 1

was 89 days) a low level of fecal shedding might be detected with PCR. Although it is known

that under ideal conditions, poliovirus can survive several weeks outside of the host, shedded

vaccine viruses will eventually die.

6. Quantities of GMOs to be released

The nOPV2 candidate vaccines are provided to the sites in vials filled in 1.1 ml aliquots,

sufficient for 3 doses per vial, and presented as an aqueous yellow-red solution for oral use.

Both vaccines will be administered orally (6 drops of study vaccine). One dose of vaccine

(0.3 ml) is contained in six drops which are delivered via a spoon from the dropper. Each

dose of the nOPV2 vaccine candidate 1 and nOPV2 vaccine candidate 2 contains

approximately 106 CCID50.

Following administration, the nOPV2 candidate vaccine will multiply for a limited period in

the host and then the viruses will be shed.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

7. Disturbance on the site (type and method of cultivation, mining, irrigation, or other

activities)

Not relevant.

8. Worker protection measures taken during the release

There are 4 steps during which the involved clinical staff may be exposed to the nOPV2

candidates:

1) handling the prepared doses of experimental vaccine from reception to administration (no

direct contact given packaging)

2) administration of the experimental vaccine

3) contact with participant during follow-up visit

4) handling of samples collected by the participant and preparing for shipment

The most important exposure is in step 2) given that the vaccine is viable and present in high

concentration.

Staff will wear a lab coat and disposable gloves. Disposable wipes will be used when

handling samples. All waste material will be handled as hazardous medical waste.

9. Post-release treatment of the site

Three types of sites are identified where the released nOPV2 candidate vaccines may be

present:

Type of sites Treatment

Clinical trial centres

Preparation & administration • Standard handling of all clinical material.

• Collection of recipients as hazardous medical

waste

• After the last visit of the last subject in the study,

any used and unused study vaccine will be

returned to the Sponsor, or destroyed at the

clinical trial site with the Sponsor’s written

permission

Direct (e.g. toilet) and indirect (e.g.

sewage system) environment of the

participant

Release after shedding

• Commitment to good hygienic practices:

o flushing toilet with toilet lid closed,

o hand washing after toilet use,

o hand washing before handling food,

o no sharing of cutlery.

• No additional post-release treatment foreseen.

Clinical trial centres

Follow-up participants, handling of

samples

• Standard handling of all clinical material.

• Collection of recipients as hazardous medical

waste



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

10. Techniques foreseen for elimination or inactivation of the GMOs at the end of the

experiment

For any handling in the clinical trial centres during preparation, administration or follow-up,

either chemical inactivation (e.g. Umonium38® spray, 5 min. exposure, see also Section

IV.A.3) or collection as hazardous medical waste for heat inactivation/incineration will be

used.

Shed material is expected to be eliminated naturally from the environment. When shed via

feces, the nOPV2 viruses will be evacuated. They may remain in septic tanks and/or be

treated in waste water treatment plants. Duizer et al. (2016) modeled different aspects of

waste water treatment for an accidental release of wildtype poliovirus in the Belgian sewage

system. They concluded that the reported release of 1013 infectious poliovirus particles had

not resulted in detectable levels of poliovirus in any of the samples from Belgium and the

Netherlands taken after the incident.

Any shed virus entering the sewage systems will immediately be diluted and eventually

degrade naturally and/or be removed during sewage treatment. This was also observed in a

recent wild type poliovirus type 2 shedding event following an accidental exposure in the

Netherlands. Stools of the infected person were released into the sewage system for 10 days

after the exposure. Sewage monitoring downstream of the residence of the infected operator

showed that virus could be detected up to 20 days after the last discharge of positive stool

into the sewage system, after which no further virus could be detected (Duizer et al., 2017).

11. Information on, and results of, previous releases of the GMOs, especially at different

scales and in different ecosystems

See previous sections, in particular Section II.C.2.

B. INFORMATION ON THE ENVIRONMENT (BOTH ON THE SITE

AND IN THE WIDER ENVIRONMENT):

1. Geographical location and grid reference of the site(s) (in case of notifications under

part C the site(s) of release will be the foreseen areas of use of the product)

The clinical trial centres are:

• Centre for Evaluation of Vaccination, University of Antwerp

• CEVAC - Centre for Vaccinology, Ghent University Hospital

At these locations, exposure and release into the environment will be limited (administration,

follow-up of participants and handling of samples).

The actual release will occur at the moment of the application by the participant and

subsequent shedding. Participants will be recruited in Belgium.

2. Physical or biological proximity to humans and other significant biota

Obviously, the participants will be directly exposed to a nOPV2 candidate vaccine. Family

members and other relations may be exposed if shedding releases candidate vaccine viruses

via nasopharyngeal excretion or stool (Note: in the Phase 1 study, virus was detectable in

stool but not in nasopharyngeal swabs). Standard hygienic practices (see Section III.A.9)



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

should be sufficient to limit or prevent significant exposure via the fecal-oral routes. In

addition, specific participant exclusion criteria are included to limit the residual risk for

exposure of the broader population to shed candidate vaccines, such as:

• Professional handling of food, catering or food production activities during the total

duration of the study;

• Having Crohn’s disease or ulcerative colitis or having had major surgery of the

gastrointestinal tract involving significant loss or resection of the bowel;

• Having any confirmed or suspected immunosuppressive or immunodeficiency condition

(including human immunodeficiency virus [HIV] infection, hepatitis B and C infections

or total serum IgA level below lab lower limit of normal (LNN));

• Having household or professional contact with known immunosuppressed people or

people/children without full polio vaccination (i.e. complete primary infant immunization

series), e.g. babysitting during the total duration of the study;

• Neonatal nurses or others having professional contact with children under 6 months old

during the total duration of the study.

The most likely route of shedding follows the disposal of stool. It is not expected that this

would affect significant biota.

3. Proximity to significant biotopes, protected areas, or drinking water supplies

Administration occurs at the clinical trial centres. As a consequence of release via shedding,

the national territory is considered as the wider potential release area. Therefore, the

proximity of significant biotopes, protected areas or drinking water supplies cannot be

excluded. However, the most likely route for exposure would be via the disposal of stool,

which would in any event not be expected to reach such areas as stools are expected to be

disposed via standard waste water handling (septic tanks, waste water treatment plants).

4. Climatic characteristics of the region(s) likely to be affected

Not relevant. Polio virus and the Sabin 2 have a wide distribution throughout all climatic

zones. It is not expected that the improved nOPV2 candidate vaccines differ in this respect.

5. Geographical, geological and pedological characteristics

Not relevant. Polio virus and the Sabin 2 have a wide distribution throughout regions with

very diverse geographical, geological and pedological characteristic. It is not expected that

the improved nOPV2 candidate vaccines differ in this respect.

6. Flora and fauna, including crops, livestock and migratory species

Not relevant.

7. Description of target and non-target ecosystems likely to be affected

Not relevant.

8. Comparison of the natural habitat of the recipient organism with the proposed site(s)

of release

Not relevant. OPV and IPV vaccination has been conducted routinely. In consequence, Sabin

2 has been released before.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

9. Any known planned developments or changes in land use in the region which could

influence the environmental impact of the release

Not relevant.

IV. INFORMATION RELATING TO THE INTERACTIONS

BETWEEN THE GMOs AND THE ENVIRONMENT

A. CHARACTERISTICS AFFECTING SURVIVAL, MULTIPLICATION

AND DISSEMINATION

1. Biological features which affect survival, multiplication and dispersal

Survival of poliovirus -and by extension the derived vaccines- in the environment is finite

and depends on physical, chemical and biological factors. None of the modifications

integrated in the nOPV2 candidate vaccines is expected to alter the sensitivity to inactivating

agents or the survivability in the environment.

There is no indication that the two amino acid substitutions in the polymerase protein of

nOPV2 candidate 1 have an impact on multiplication as the replication in cell culture at 33°C

and susceptibility to culture at elevated temperatures are similar to the parental Sabin 2

strain. nOPV2 candidate 2 also shows similar growth properties to Sabin 2 in cell culture at

33°C and is at least as sensitive to culture at elevated temperatures as Sabin 2. Therefore,

both candidates are expected to replicate in humans as demonstrated by the shedding data

from the Phase 1 study summarized in Annex 3.

Poliovirus has a highly-restricted host range. Infection occurs when poliovirus attaches to

the poliovirus receptor (CD155) on the cytoplasmic membrane of the cells within the primate

host’s gastrointestinal system. There are no reports of transmission of the parental Sabin 2

vaccine strain to organisms other than humans outside of laboratory settings. The mode of

transmission (dispersal) is primarily through person-to person contact (fecal-oral or oral-

oral) (Dowdle & Birmingham, 1997). None of the modifications in the nOPV2 candidate

vaccine strains is expected to alter this. Results from the Phase 1 study confirm shedding via

stool; yet, there was no indication of nasopharyngal shedding in any of the samples taken

from the participants. This result was expected given that all participants had been vaccinated

against poliovirus in the past.

2. Known or predicted environmental conditions which may affect survival,

multiplication and dissemination (wind, water, soil, temperature, pH, etc.)

Environmental conditions which may affect survival outside of the host are expected to be

the same as for the recipient Sabin 2 organism. Multiplication in and dissemination by the

host are expected to be influenced by the prior vaccination status and immune status of the

host, as for the recipient Sabin 2 organism. (see Section II.A.11).



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

3. Sensitivity to specific agents

None of the modifications made to the nOPV2 candidate vaccine strains are expected to alter

their sensitivity to chemical or physical inactivation methods compared to wild type

polioviruses and the recipient Sabin 2 organism.

Polioviruses are rapidly destroyed by exposure to temperatures of 50°C or more, autoclaving

or incineration (WHO, 2003). Polioviruses are resistant to inactivation by many common

detergents and disinfectants, including soaps, but are rapidly inactivated by exposure to

ultraviolet light (WHO, 2016).

Also dilute solutions of formaldehyde or free residual chlorine (bleach) can inactivate

polioviruses (Dowdle & Birmingham, 1997). Chlorine bleach (0.5%) is the recommended

disinfectant for laboratories working with polioviruses (WHO, 2003). It has been shown that

1 minute of exposure to 0.5 mg/L of free chlorine resulted in loss of cell culture infectivity

and 5 minutes of exposure resulted in destruction of nucleic acids (Ma et al., 1994). Chlorine

dioxide is one of the most effective methods for inactivating poliovirus (Alvarez & O’Brien,

1982), due to its benefit of being 0.124 nm in size which is smaller than any microorganism

and by inactivating the viral genome.

Similar results were obtained when viruses were exposed to 1 N NaOH. Exposure to 1 N

NaOH resulted in loss of cell culture infectivity after 30 seconds and destruction of nucleic

acids after 3 minutes (Ma et al., 1994).

Poliovirus has also been shown to be susceptible to chemical inactivation by Umonium38®

(isopropyl-tricedyl-dimethyl-ammonium). 0.5% and 2.5% Umonium38® solutions inactivate

poliovirusses after 5 minutes of exposure (Umonium38® data sheet).

Sabin 2 and both nOPV2 candidate vaccines are expected not to differ in their sensitivity for

these agents.

B. INTERACTIONS WITH THE ENVIRONMENT

1. Predicted Habitat of the GMOs

Like Sabin 2, nOPV2 candidate vaccines may survive for a limited time in the environment,

but can only multiply in humans, non-human primates, and laboratory mice which carry the

human poliovirus receptor. Their use will be limited to the clinical trial facilities, where

measures are in place to ensure that only the intended clinical trial participants will be

exposed.

Subsequent release via shedding can occur in a broad environment, in which the nOPV2

candidate vaccine can passively spread and from which it eventually will be eliminated.

Unless another person ingests the shed nOPV2 candidate vaccine, no subsequent

multiplication and further shedding is foreseen.

The potential of the nOPV2 candidate vaccine strains for spread beyond the clinical study

participants is considered very low as the high rate of polio vaccination coverage in Belgium

due to mandatory routine vaccination (OPV from 1966-2000, IPV from 2001 on) means that

there are no large groups of susceptible individuals that could support circulation. Similar



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

conclusions can be drawn for nearby countries, with polio immunization coverage for

Belgium and nearby countries in 2016 as follows: Belgium-98%, Netherlands-95%,

Germany-94%, France-97%, Luxembourg-99%, United Kingdom-94% (WHO Global

Health Observatory data repository, consulted December 9, 2017).

ECDC (2014) confirms that the overall polio vaccination uptake is high in the EU, and the

likelihood of a vaccinated person developing poliomyelitis is very low, regardless of whether

the person was vaccinated with OPV or IPV. They highlight specific vulnerable groups that

are under-vaccinated: the groups of highest concern for propagated outbreaks are orthodox

Christian groups in the Netherlands and the large Roma populations in the south-eastern

parts of the EU.

2. Studies of the behaviour and characteristics of the GMOs and their ecological impact

carried out in simulated natural environments, such as microcosms, growth rooms,

greenhouses

Poliovirus has a very narrow host range and there are no reports of transmission of the

recipient Sabin 2 vaccine strain to organisms other than humans outside of laboratory

settings (experimental infection of transgenic mice expressing the human poliovirus

receptor). There is no relevant animal model that includes replication and shedding of

polioviruses following oral dosing that can be used to model human transmission.

No specific studies to investigate transmission of the nOPV2 candidate vaccine strains

between humans have been carried out, yet the introduced modifications do not provide any

indication that the mode of transmission or any other aspect of behaviour has changed in

comparison with the recipient Sabin 2. This is confirmed by the results of Phase 1 study

(Annex 3).

3. Genetic transfer capability

a) postrelease transfer of genetic material from GMOs into organisms in affected ecosystems

b) postrelease transfer of genetic material from indigenous organisms to the GMOs

Humans are the only known host of the recipient Sabin 2 strain. As the lifecycle is entirely

cytoplasmic, poliovirus does not have the ability to integrate into the host cell genome and

even if such an event could occur, the infected cells would be destroyed by the virus. As the

modifications in the nOPV2 candidate vaccine strains do not change these characteristics of

the Sabin 2 poliovirus, integration into the host genome is not considered to be a risk

associated with the nOPV2 candidate vaccine strains.

However, upon administration to human subjects, the nOPV2 candidate vaccines could

possibly exchange genetic material with related type C enteroviruses by recombination if a

subject would be infected with such a virus at the time of vaccination and the nOPV2

candidate strain virus and the related enterovirus were replicating at the same time in the

same cell (Famulare et al., 2016). Recombination between polioviruses and other type C

enteroviruses is commonly found in cVDPVs that arise when Sabin strains circulate in

poorly immunized populations together with other enteroviruses. Most of the cVDPVs

studied to date have recombinant genomes composed of mutated sequences from Sabin

strains and sequences from non-polio enteroviruses; with the non-polio enterovirus

sequences located within the regions P2, P3 or 3′UTR of the genome and in many cases



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

within the 5′UTR. The PV/non-PV breakpoints in the genomes of recombinant cVDPVs are

preferentially located within the P2 region, at the end of the 2A- or 2B-encoding region,

although they may also be found close to the P1-P2 junction in some cases (Bessaud et al.,

2016). Recombination within the P1 region has rarely been observed, and only then between

very closely related viruses or involving the extreme termini of VP1, presumably due to

restrictions imposed on assembly of the icosahedral particle (Lowry et al., 2014).

As there is no evidence for circulation of type C enteroviruses in the Belgian population in

recent years (Personal communication from Prof. M. Van Ranst, Rega Institute, KULeuven,

national reference laboratory on enterovirus typing for the period 2011-2016/2017),

simultaneous infection in a study participant is expected to be a very rare event and therefore

the frequency of genetic variants arising from recombination of nOPV2 candidate strains

with circulating type C enteroviruses is expected to be extremely low.

4. Likelihood of post-release selection leading to the expression of unexpected and/or

undesirable traits in the modified organism

While the parental organism Sabin OPV2 has inherent genetic instability, and it is known

that prolonged replication in a community with low vaccination coverage, can lead to the

emergence of cVDPVs where the mutations controlling neurovirulence in Sabin OPV2 are

frequently found to have reverted (Minor, 2009; Macadam et al., 1991; Macadam et al.,

1993), the goal of this development program is to introduce genetic modifications to improve

the genetic stability of the candidate vaccine strains and prevent this reversion from

occurring.

To this aim, nOPV2 candidate 1 has a specific modification to the polymerase to improve

fidelity and both nOPV2 candidates carry a number of modifications designed to protect the

attenuated phenotype from reversion to neurovirulence by mutations. The nOPV2 candidates

are therefore expected to revert to a neurovirulent phenotype at a slower rate -if at all- than

the recipient Sabin 2, as supported by the in vitro and mice in vivo experiments described in

Section II.C.2.c.

Another mechanism that contributes to the emergence of pathogenic cVDPVs is

recombination whereby genetic exchanges take place between polio Sabin and non-polio

type C enteroviruses. This could occur if the nOPV2 candidate strain virus and the related

enterovirus were replicating at the same time in the same cell (See section above on Genetic

transfer capability).

The 5′ -half of the genome plays a key role in the pathogenicity of type 2 cVDPVs.

Experiments with chimeric polio Sabin 2/non-polio enterovirus type C viruses have shown

that viruses with unmodified Sabin 2 5′ UTR sequence are not neurovirulent, while most of

the 5′ UTRs from cocirculating enterovirus type C could contribute to the reversion of the

attenuated Sabin 2 strain to a neurovirulent phenotype. However, some viruses with identical

5′ UTR sequences displayed different levels of attenuation, indicating a possible effect of

the 3′ half of the genome on pathogenicity. The precise underlying mechanisms remain to

be deciphered but are thought to involve the replication machinery, which mobilizes proteins

encoded by the non-structural regions of the genome and three-dimensional RNA structures

within the 3′ UTR. The moderately neurovirulent phenotype of viruses where the Sabin 2 5′

UTR only or the 5′ UTR together with the corresponding P2 and P3-3′ UTR fragments were



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

experimentally swapped with the corresponding fragments from non-polio enterovirus type

C’s, indicates that likely additional mutations need to accumulate that increase its fitness

and, thus, its neurovirulence, for cVDPVs to emerge as pathogenic strains. This result is

consistent with the finding that most pathogenic cVDPVs circulate for months before

causing poliomyelitis cases (Bessaud et al., 2016).

In addition to the protective features built into the candidate vaccine strains, the likelihood

that release of the candidate vaccine strains could lead to the post-release selection of more

neurovirulent strains is deemed negligible due to the combination of:

• the high rate of polio vaccination coverage in Belgium and EU following mandatory

routine vaccination (see reference to ECDC 2014 above), meaning that there are no large

groups of susceptible individuals that could support circulation of vaccine strains, and

making it extremely unlikely that any vaccine strain would be able to circulate for a

sufficient amount of time to accumulate the mutations that could lead to a more

neurovirulent phenotype, and

• the lack of evidence for circulation of type C enteroviruses in the Belgian population in

recent years, meaning that there are no circulating viruses available in the environment

that could become a recombination partner for the candidate vaccine strains, so that the

likelihood that the vaccine strain would be present in the same cell at the same time as a

possible recombination partner is negligible.

5. Measures employed to ensure and to verify genetic stability. Description of genetic

traits which may prevent or minimise dispersal of genetic material. Methods to verify

genetic stability.

All modifications are intended to make the nOPV2 candidate vaccines more genetically

stable.

• nOPV2 candidate 1 (S2/cre5/S15domV/rec1/hifi3) has several modifications specifically

designed to protect the attenuated phenotype against reversion by recombination events.

2 modifications made to in the polymerase (3D) gene improve fidelity (hifi3) and reduce

recombination (rec1). In addition, the 5’UTR S15 dom V modification is protected

against loss by recombination with a related virus by a second modification that consists

of the relocation of the essential cre cis-acting element from its normal position in the 2C

gene to a position in the 5’UTR between dom I and dom II. Since a single recombination

event would also remove the essential cre, resulting in loss of viability, restoration of

domain V would require either two simultaneous recombination events on either side of

domain V or a sequential process where first the Cre in the 2C gene would be restored

(note that restoration by relocation of the Cre in the nOPV2 candidate 1 itself is not

possible as it has been modified to encode 2 stop codons if it were re-inserted in the 2C

gene) followed by a recombination event to replace the domain V.

• In nOPV2 candidate 2 (S2/S15domV/CpG40) genetically-stable determinants of

attenuation were incorporated into the capsid protein region by deoptimization of codon

usage, increasing the frequencies of CpG dinucleotides within synonymous codons (i.e.

without resulting in any changes in the capsid protein sequence) (Burns et al., 2006; Burns

et al., 2009). This CpG40 modification results in improved attenuation of the virus and

the phenotype is expected to be genetically stable since it would require multiple

mutations to produce significant reversion. Possible variants resulting from



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

recombination between nOPV2 candidate 2 and related type C enteroviruses could swap

the 5’UTR of the S15 strain with the corresponding domain of the related enterovirus.

However, the attenuating mutations in the capsid region would be retained, which by

themselves have a modest effect on attenuation.

Genetic stability can be tested via deep sequencing and/or by in vivo testing of

neurovirulence as described above. This has been demonstrated by the tests performed on

samples of participants that shed the candidate vaccines in stools in the Phase-1 trial.

No traits have been affected that influence dispersal of the nOPV2 candidate vaccines or

dispersal of the genetic material. The Phase 1 study (Annex 3) confirmed that the nOPV2

candidate vaccines are shed following application. No traces were found in nasopharyngeal

swabs, yet shedding continued over a longer period in fecal samples (median duration of

approximately 4 and 2 weeks for candidate 1 and 2 respectively; max. approx. 3 months of

a positive PCR result).

6. Routes of biological dispersal, known or potential modes of interaction with the

disseminating agent, including inhalation, ingestion, surface contact, burrowing, etc

Poliovirus is transmitted by infected humans directly or indirectly by droplets or aerosols

from the oropharynx and by fecal contamination of hands, eating utensils, food and water.

Epidemiologically, at least 80% of poliovirus transmission appears to be person-to-person

(fecal-oral or oral-oral)(Dowdle & Birmingham, 1997). None of the modifications made to

the nOPV2 candidate vaccine strains would be expected to alter this. However, the

vaccination status of the trial volunteers should limit nasopharyngeal shedding (as shown in

the Phase 1 study) and therefore minimize the likelihood of oral-oral transmission of the

GMO.

7. Description of ecosystems to which the GMOs could be disseminated

Given the potentially wide release area, shed nOPV2 candidate vaccines can be disseminated

in a large diversity of ecosystems. Nevertheless, the main route for shedding is excretion via

stool which will be treated as any other stool (collection in septic tanks, waste water

treatment systems) and it is therefore unlikely that valuable and/or vulnerable ecosystems

would be exposed.

While viable virus can persist for a limited amount of time in the environment outside of a

human host, replication can only take place in a human host.

Poliovirus has a very narrow host range as only primates are susceptible to natural infection

and there are no reports of transmission of the parental Sabin 2 vaccine strain to organisms

other than humans outside of laboratory settings (experimental infection of transgenic mice

expressing the human poliovirus receptor). The genetic modifications made to the nOPV2

candidate vaccine strains do not affect host range.

8. Potential for excessive population increase in the environment

The potential for excessive population increase of nOPV2 candidate vaccine strains in the

environment is low considering that:



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

• The only natural hosts that are present in the environment of the release are humans. As

the rate of polio vaccination coverage in Belgium (OPV from 1966-2000, IPV from 2001

on) and in the EU is high due to mandatory routine vaccination (ECDC 2014), there are

no large groups of susceptible individuals that could support circulation.

• The use will be limited to the clinical trial facilities, where measures are in place to ensure

that only the intended clinical trial subjects will be exposed. As clinical trial subjects will

be previously vaccinated with OPV or IPV, they are expected to experience limited

shedding.

• Both candidate vaccine strains are at least as attenuated as the parental strain and designed

to be more resistant to reversion to neurovirulence, which is associated with the ability to

replicate in the human gut for longer. Therefore, it is likely that the extent and/or duration

of shedding may be reduced relative to the recipient organism, but this is not currently

known.

9. Competitive advantage of the GMOs in relation to the unmodified recipient or parental

organism(s)

The nOPV2 candidate vaccines have no competitive advantage in comparison with the

unmodified recipient organism, Sabin 2 vaccine. On the contrary, both candidate vaccines

are at least as attenuated as the recipient strain. The modifications designed to make them

more resistant to reversion to neurovirulence, which is associated with the ability to replicate

in the human gut for longer.

10. Identification and description of the target organisms if applicable

There is no target organism in the strict sense. The nOPV2 candidate vaccines are expected

to induce an immunogenic reaction in the vaccinated human participants. The candidate

vaccines are designed to be safer alternatives for vaccinating humans against poliovirus

outbreaks. This is part of the preparedness programme that strengthens the global polio

eradication effort.

11. Anticipated mechanism and result of interaction between the released GMOs and the

target organism(s) if applicable

If humans are considered target organisms, then the goal of this development program is to

develop a novel OPV2 vaccine with an improved benefit/risk profile by introducing genetic

modifications to improve the genetic stability and therefore reduced risk of reversion to a

neurovirulent phenotype compared to the parental strain Sabin 2.

Upon oral administration, the nOPV2 viral particles are expected to attach to the poliovirus

receptor (CD155) on the cytoplasmic membrane of the cells within the host’s gastrointestinal

system. Replication will occur and the host will produce a local immune response resulting

in both humoral and mucosal immunity. Once the infection is controlled by the host immune

response, replication and shedding of nOPV2 vaccine strain will cease.

Upon subsequent infection with poliovirus, the induced humoral immunity prevents

infection of the nervous system while the induced mucosal immunity reduces the amount of

virus excreted leading to decreased transmission.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

12. Identification and description of non-target organisms which may be adversely affected

by the release of the GMO, and the anticipated mechanisms of any identified adverse

interaction

As humans are the only natural host for Sabin 2 vaccine strains and this is not changed by

the modifications to the candidate nOPV2 strains, the only non-target organisms that may be

affected are unintended human recipients (such as study site personnel or close contacts of

the study participants).

As the non-clinical safety profile shows that the candidate nOPV2 strains are at least as

attenuated as the parental Sabin 2 strain, consequences of transmission of a nOPV2 vaccine

strain to an unintended human recipient are expected to be at worst similar to those of

exposure to the parental Sabin 2 strain (described in section II.A.11.d)).

13. Likelihood of post-release shifts in biological interactions or in host range

Susceptibility to poliovirus infection is determined mainly by the interaction between the

surface capsid proteins (VP1, VP2, and VP3) encoded by the P1 region of poliovirus and the

poliovirus receptor protein (CD155) on the host cell surface (Suzuki, 2006).

In nearly all cVDPV outbreaks, not only does the virus accumulate VP1 mutations and other

mutations associated with phenotypic reversion, it also undergoes recombination with co-

circulating non-polio enterovirus C strains. These recombinant viruses are typically

composed of vaccine-derived P1 sequences with some or all of the genes encoding the

nonstructural proteins derived from an NPEV-C strain (Sahoo et al., 2017). Recombination

within the P1 region encoding the capsid proteins has rarely been observed, and only then

between very closely related viruses or involving the extreme termini of VP1, presumably

due to restrictions imposed on assembly of the icosahedral particle (Lowry et al., 2014).

So even though there is evidence that the P1 region of poliovirus that encodes the host range

determinants is subject to mutation and (rarely) recombination, in nature poliovirus infection

has only ever been found in primates. Therefore, the likelihood of post-release shifts in

biological interactions or host range of the candidate nOPV2 vaccine strains is negligible.

14. Known or predicted interactions with non-target organisms in the environment,

including competitors, preys, hosts, symbionts, predators, parasites and pathogens

No specific interactions with non-target organisms have been identified.

15. Known or predicted involvement in biogeochemical processes

None known or predicted.

16. Other potential interactions with the environment

No other potential interactions with the environment have been identified.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

V. INFORMATION ON MONITORING, CONTROL, WASTE

TREATMENT AND EMERGENCY RESPONSE PLANS

A. MONITORING TECHNIQUES

1. Methods for tracing the GMOs, and for monitoring their effects

A quantitative PCR method has been developed which uniquely identifies both nOPV2

candidate vaccines. In principle, the PCR method can be used on material extracted from

any type of sample, provided the sample matrix is not hindering the extraction or interfering

with detection. Since it is based on the presence of specific sequences, it is possible that

fragments of the vaccines also are detected and thereby providing an overestimation of the

presence of viable GMOs.

The method will be used to evaluate and monitor shedding of type 2 poliovirus as well as

the nOPV2 candidate vaccines in stool samples of study participants.

The primary effect is the immunization of the exposed person. Neutralizing antibodies

against type 2 poliovirus can be determined using a sero-neutralization assay. The clinical

study protocol schedules specific time points when blood samples will be taken from the

participants. Similarly, blood samples can be taken –if necessary- from other persons that

might be exposed.

2. Specificity (to identity the GMOs, and to distinguish them from the donor, recipient or,

where appropriate, the parental organism(s), sensitivity and reliability of the

monitoring techniques

This has been addressed in Section V.A.1.

3. Techniques for detecting transfer of the donated genetic material to other organisms

In earlier sections, the potential for recombination with other C enteroviruses has been

indicated. The likelihood has been deemed to be very low, given the absence of C

enteroviruses in the potentially exposed population (Personal communication from Prof. M.

Van Ranst, Rega Institute, KULeuven, national reference laboratory on enterovirus typing

for the period 2011-2016/2017).

The main concern would be that the nOPV2 candidate vaccines revert to neurovirulence by

recombination of specific sequences with a C enteroviruses that is present at the same time

in the same cell. In case such an event is suspected to have occurred, it is possible to

investigate the exact nature by using molecular tools.

4. Duration and frequency of the monitoring

The participants will visit the clinical trial centre at regular times for monitoring.

Participants are expected to visit the clinical trial centres 5 times for groups 1 and 3 (Day 0,

Day 7, Day 14, Day 28 and Day 42) and 8 times for all other groups (Day 0, Day 7, Day 14,

Day 28, Day 35, Day 42, Day 56 and Day 70). All visits are ambulatory. At specific times,

blood samples will be taken for the determination of neutralizing type 2 poliovirus antibodies

using a sero-neutralization assay.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Similarly, stool samples will be collected and shedding of type 2 poliovirus in the stools will

be evaluated using:

• RT-PCR (viral identity).

• CCID50 determination (titer).

• Viral sequencing methods (e.g. deep sequencing) will be performed on selected stool

samples taken at one or more of the time points to explore the heterogeneity of shed virus.

Sequence information on shed virus may be compared with the results of neurovirulence

testing, if available.

A participant will be considered to have completed the study if he or she has completed all

study related procedures 42 days after the last study vaccination and shedding is PCR

negative on 3 consecutive stool samples (with a maximum of one sample per day). However,

if any AE or SAE, including clinically significant abnormalities in laboratory safety testing

are observed subjects will continue to be followed until these are resolved or determined to

be chronic and stable or until the event is otherwise explained. Also, if type 2 virus shedding

is detected by PCR on the last stool sample (visit 5 minus 1 or 2 days for Groups 1 and 3 and

visit 8 minus 1 or 2 days for Groups 2, 4, 5, 6 and 7), subjects will be asked to further collect

one stool sample at least once per week for four weeks after the last per protocol samples

and then once per month until shedding is PCR negative on 3 consecutive stool samples..

If the last stool sample is missing and shedding was measured on the previous stool sample,

subject will be asked to provide a new sample as soon as possible in order to determine end

of study for this person. Shedding results for last stool sample will be provided to the sites

in a timely manner in order to inform subjects about the need for further stool sampling each

28 days and taking precautions.

B. CONTROL OF THE RELEASE

1. Methods and procedures to avoid and/or minimise the spread of the GMOs beyond the

site of release or the designated area for use

At the clinical trial centres, the material is stored and handled in controlled and contained

conditions. Following administration, shedding will occur. The main instructions for

avoiding exposure are indicated in Section III.A.9. No specific measures are taken to avoid

or minimize the spread of the nOPV2 candidate vaccines.

2. Methods and procedures to protect the site from intrusion by unauthorised individuals

Until administration, the material is stored under controlled conditions and restricted access

at the clinical trial centres. Similarly, any study sample that may contain shed material will

be securely stored. In both cases, unauthorised individuals will not have access to the

material.

Once applied, no further protection is foreseen for shed viruses. Material that enters the

sewage system is no longer protected, except for the general measures that the public at large

usually has no access to the sewage system.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

3. Methods and procedures to prevent other organisms from entering the site.

A similar reasoning as provided under V.B.2 can be developed. At the clinical trial centres

standard precautions are in place to avoid other organisms (pets, insects, rodents, etc.) from

entering the site and the storage equipment.

Once administered to the participant, family members and visitors, pets, insects and rodents

might be present close to the participant and potentially exposed to shed material. As humans

are the only host in which the virus can survive and multiply, the focus is on people directly

or indirectly in contact with the participant.

C. WASTE TREATMENT

1. Type of waste generated

Two types of waste that are expected to carry nOPV2 candidate vaccines are identified:

• Materials at the clinical trial centres that contain or have been exposed to the nOPV2

candidate vaccines (e.g. residual doses, empty containers, equipment used during visits

of and sampling of participants, ..)

• Materials that contain or that may have been exposed to viruses shed via feces (e.g.

tissues, hygienic wipes).

2. Expected amount of waste

The amount of waste generated at the clinical trial centres is not expected to be significant

and will be within the normal handling capacity.

Based on the Phase 1 results, it is not expected that any material will be shed via saliva.

Material shed via feces will be discharged in the sewage system, in which it is immediately

diluted.

3. Description of treatment envisaged.

According to standard practices at the clinical trial centres, all waste is collected and treated

as hazardous medical waste, i.e. collected in dedicated and certified bins, which are

hermetically sealed and transported by a certified shipper to a specialized incineration

facility. Surfaces and non-disposable materials will be chemically decontaminated with

Umonium38®.

No specific treatment is envisaged of shed viruses. Participants will be asked to observe good

hygienic practices (see Section III.A.9).

D. EMERGENCY RESPONSE PLANS

1. Methods and procedures for controlling the GMOs in case of unexpected spread

The proposal takes into consideration a potentially very broad release of the nOPV2

candidate vaccines.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

Unexpected spread would mainly be limited to accidental opening of the packaged doses.

Even if all the doses are spilled, the quantity remains limited (3ml per doses) and can easily

be handled via a spill procedure.

2. Methods for decontamination of the areas affected, for example eradication of the

GMOs

nOPV2 candidate vaccines are dependent on humans for multiplication. They are expected

to survive in the environment for a limited period. If needed, and depending on the affected

area, chemical disinfection can be used in a liquid or gas form.

3. Methods for disposal or sanitation of plants, animals, soils, etc., that were exposed

during or after the spread

Material that has been exposed to the nOPV2 candidate vaccines will be either disinfected

or inactivated as hazardous medical waste. In other cases, it may suffice to wait until the

viruses have been eliminated naturally and foresee that during this period no contact is made

with humans as they are the only host. No specific sanitation measures are foreseen.

4. Methods for the isolation of the area affected by the spread

Before application and when handling samples, the area where the material is handled and

hence where a spread could occur, will be physically isolated at the clinical trial centres.

Once administered, shed material may end up in very different environments. The main part

will likely be released in the sewage system. No method is proposed for isolation at this

stage.

5. Plans for protecting human health and the environment in case of the occurrence of an

undesirable effect.

The main undesirable effect would be the exposure of participants and the broader public to

viruses that have reverted to neurovirulence. Given the general vaccination status of the

population this is not expected to induce any effect. In any case, in line with the GAPIII, this

would require a broad follow-up in order to ensure that the polio eradication programme can

be maintained.



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

VI. References

• Alexander LN, Seward JF, Santibanez TA, Pallansch MA, Kew OM, Prevots DR, Strebel

PM, Cono J, Wharton M, Orenstein WA and Sutter RW (2004) Vaccine policy changes

and epidemiology of poliomyelitis in the United States. JAMA 292(14):1696-701.

• Alvarez ME and O'Brien RT (1982) Mechanisms of inactivation of poliovirus by chlorine

dioxide and iodine. Appl Environ Microbiol. 44(5):1064-1071.

• Asturias EJ, Bandyopadhyay AS, Self S, Rivera L, Saez-Llorens X, Lopez E, Melgar M,

Gaensbauer JT, Weldon WC, Oberste MS, Borate BR, Gast C, Clemens R, Orenstein W,

O'Ryan G M, Jimeno J, Clemens SA, Ward J, Rüttimann R and Latin American

IPV001BMG Study Group (2016) Humoral and intestinal immunity induced by new

schedules of bivalent oral poliovirus vaccine and one or two doses of inactivated

poliovirus vaccine in Latin American infants: an open-label randomised controlled trial.

Lancet 388(10040):158-69. doi: 10.1016/S0140-6736(16)00703-0.

• Bandyopadhyay AS, Garon J, Seib K and Orenstein WA (2015) Polio vaccination: past,

present and future. Future Microbiol. 2015;10(5):791-808. doi: 10.2217/fmb.15.19. Epub

2015 Mar 31.

• Bessaud M, Pelletier I, Blondel B & Delpeyroux F (2016) A Rapid Method for

Engineering Recombinant Polioviruses or Other Enteroviruses. Methods Mol Biol.

1387:251-62

• Burns CC, Diop OM, Sutter RWand Kew OM (2014) Vaccine-derived polioviruses. J

Infect Dis.210 Suppl 1:S283-93. doi: 10.1093/infdis/jiu295.

• Burns CC, Shaw J, Campagnoli R, Jorba J, Vincent A, Quay J and Kew O (2006)

Modulation of poliovirus replicative fitness in HeLa cells by deoptimization of

synonymous codon usage in the capsid region. J Virol. 80(7):3259-72.

• COGEM (2017a) Advies herziening pathogeniteitsclassificatie poliovirus COGEM

advies CGM/170511-01

https://www.cogem.net/index.cfm/nl/publicaties/publicatie/herziening-

pathogeniteitsclassificatie-poliovirus?q=&category=advies&from=30-09-1998&to=04-

06-2017&order=date_desc

• GOGEM (2017b) Activities with chimeric genetically-modified polioviruses COGEM

advice CGM/171220-01

https://www.cogem.net/index.cfm/nl/publicaties/publicatie/inschaling-van-

werkzaamheden-met-gg-poliovirussen

• Diop OM, Burns CC, Sutter RW, Wassilak SG, Kew OM and the Centers for Disease

Control and Prevention (CDC) (2015) Update on Vaccine-Derived Polioviruses -

Worldwide, January 2014-March 2015. MMWR Morb Mortal Wkly Rep.64(23):640-

646.

• Dowdle WR and Birmingham ME (1997) The biologic principles of poliovirus

eradication. J Infect Dis. 175 Suppl 1:S286-92.

• Duizer E, Rutjes S, Husman A and Schijven J. (2016) Risk assessment, risk management

and risk-based monitoring following a reported accidental release of poliovirus in

Belgium, September to November 2014. Euro Surveill. 21(11):30169. DOI:

http://dx.doi.org/10.2807/1560-7917.ES.2016.21.11.30169

https://www.cogem.net/index.cfm/nl/publicaties/publicatie/inschaling-van-werkzaamheden-met-gg-poliovirussen

https://www.cogem.net/index.cfm/nl/publicaties/publicatie/inschaling-van-werkzaamheden-met-gg-poliovirussen



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

• Duizer E, Ruijs WL, van der Weijden CP, and Timen A (2017) Response to a wild

poliovirus type 2 (WPV2)-shedding event following accidental exposure to WPV2, the

Netherlands, April 2017. Euro Surveill. 25;22(21).

• Dunn G, Begg NT, Cammack N and Minor PD (1990). Virus excretion and mutation by

infants following primary vaccination with live oral poliovaccine from two sources. J

Med Virol. 32(2):92-95

• ECDC - European Centre for Disease Prevention and Control (2014). International

spread of wild-type poliovirus in 2014 declared a Public Health Emergency of

International Concern under the International Health Regulations (IHR) – 28 May 2014.

Stockholm.

https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/Polio-risk-

assessment-may-2014.pdf, last accessed 12 November 2017

• Estívariz CF, Molnár Z, Venczel L, Kapusinszky B, Zingeser JA, Lipskaya GY, Kew

OM, Berencsi G and Csohán A. (2011) Paralytic poliomyelitis associated with Sabin

monovalent and bivalent oral polio vaccines in Hungary. Am J Epidemiol. 174(3):316-

25. doi: 10.1093/aje/kwr070. Epub 2011 Jun 17.

• Famulare M, Chang S, Iber J, Zhao K, Adeniji JA, Bukbuk D, Baba M, Behrend M, Burns

CC, Oberste MS (2016). Sabin vaccine reversion in the field: a comprehensive analysis

of Sabin-like poliovirus isolates in Nigeria. J Virol. 90:317–331.

• Fine PE and Carneiro IA (1999) Transmissibility and persistence of oral polio vaccine

viruses: implications for the global poliomyelitis eradication initiative. Am J Epidemiol.

150(10):1001-21.

• Gelfand HM, Potash L, LeBlanc DR and Fox JP (1959). Intrafamilial and interfamilial

spread of living vaccine strains of polioviruses. J Am Med Assn 170(17):2039-2048.

• Ghendon YZ and Sanakoyeva II (1961) Comparison of the resistance of the intestinal

tract to poliomyelitis virus (Sabin's strains) in person after naturally and experimentally

acquired immunity. Acta Virologica 5(5):265-273.

• Ginter VX, Indulen M, and Kanel IA. (1961) Spread of vaccine virus in boarding

children’s institutions and households during immunization with live poliovirus vaccine.

Pp. 558–590 presented at the IVth Scientific Conference of the Institute of Poliomyelitis

and Virus Encephalitis and the International Symposium on Live Poliovirus Vaccine,

Moscow, 1961.

• Henry, J. L., Jaikaran, E. S., Davies, J. R., Tomlinson, A. J., Mason, P. J., Barnes, J. M.,

and Beale, A. J. (1966). A study of poliovaccination in infancy: excretion following

challenge with live virus by children given killed or living poliovaccine. The Journal of

Hygiene, 64(1), 105–120.

• Hird TR and Grassly NC (2012) Systematic review of mucosal immunity induced by oral

and inactivated poliovirus vaccines against virus shedding following oral poliovirus

challenge. PLoS pathogens 8(4):e1002599.

• Holmblat B, Jégouic S, Muslin C, Blondel B, Joffret M-L and Delpeyroux F. (2014)

Nonhomologous recombination between defective poliovirus and coxsackievirus

genomes suggests a new model of genetic plasticity for picornaviruses. mBio

5(4):e01119-14. doi:10.1128/mBio.01119-14.

https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/Polio-risk-assessment-may-2014.pdf

https://ecdc.europa.eu/sites/portal/files/media/en/publications/Publications/Polio-risk-assessment-may-2014.pdf



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

• Horstmann DM, Niederman JC and Paul JR (1959) Attenuated type 1 poliovirus vaccine.

Its capacity to infect and to spread from “vaccinees” within an institutional population. J

Am Med Assn 170(1):1-8.

• Laassri M, Dragunsky E, Enterline J, Eremeeva T, Ivanova O, Lottenbach K, Belshe R

and Chumakov K (2005). Genetic analysis of vaccine-derived poliovirus strains in stool

specimens by combination of full-length PCR and oligonucleotide microarray

hybridization. J. Clin. Microbiol. 43(6):2886-2894

• Lowry K, Woodman A, Cook J and Evans DJ (2014) Recombination in Enteroviruses Is

a Biphasic Replicative Process Involving the Generation of Greater-than Genome Length

‘Imprecise’ Intermediates PLOS Pathogens 10(6)e1004191

• Ma JF, Straub TM, Pepper IL & Gerba CP (1994) Cell culture and PCR determination of

poliovirus inactivation by disinfectants. Appl Environ Microbiol. 60(11):4203-4206.

• Macadam A. J., Ferguson G., Arnold C. and Minor P. D. (1991). An assembly defect as

a result of an attenuating mutation in the capsid proteins of the poliovirus type 3 vaccine

strain. Journal of Virology, 65(10), 5225–5231.

• Macadam A.J., Pollard S.R., Ferguson G., Skuce R., Wood D., Almond J.W. and Minor

P.D. (1993) Genetic Basis of Attenuation of the Sabin Type 2 Vaccine Strain of Poliovirus

in Primates. Virology 192(1):18-26, https://doi.org/10.1006/viro.1993.1003.

• Macadam AJ, Ferguson G, Stone DM, Meredith J, Knowlson S, Auda G, Almond JW

and Minor PD (2006) Rational design of genetically stable, live-attenuated poliovirus

vaccines of all three serotypes: relevance to poliomyelitis eradication. J Virol.

80(17):8653-8663

• Minor P (2009) Vaccine-derived poliovirus (VDPV): Impact on poliomyelitis

eradication. Vaccine 27(20):2649-52. doi: 10.1016/j.vaccine.2009.02.071. Epub 2009

Mar 3.

• Minor PD. (2015) Live attenuated vaccines: Historical successes and current challenges.

Virology, 479-480:379-392.

• Mohammed AJ, AlAwaidy S, Bawikar S, Kurup PJ, Elamir E, Shaban MMA, Sharif SM,

van der Avoort HGAM, Pallansch MA, Malankar P, Burton A, Sreevatsava M and Sutter

RW (2008) Fractional doses of inactivated poliovirus vaccine in Oman. N Engl J Med

2008; 362:2351-2359.

• Moss EG, O’Neill RE and Racaniello VR. (1989) Mapping of attenuating sequences of

an avirulent polio type 2 strain. J Virol. 63(5):1884-90

• Onorato IM, Modlin JF, McBean AM, Thoms ML, Losonsky GA and Bernier R. (1991)

Mucosal immunity induced by enhanced potency IPV and OPV. J Infect Dis 163(1):1-6.

• Platt LR, Estívariz CF and Sutter RW (2014) Vaccine-associated paralytic poliomyelitis:

a review of the epidemiology and estimation of the global burden. J Infect Dis. 210 Suppl

1:S380-389. doi: 10.1093/infdis/jiu184.

• Pollard SR, Dunn G, Cammack N, Minor PD and Almond JW (1989) Nucleotide

sequence of a neurovirulent variant of the type 2 oral poliovirus vaccine. J Virol.

63(11):4949-4951.

• Rakoto-Andrianarivelo M, Guillot S, Iber J, Balanant J, Blondel B, Riquet F, Martin J,

Kew O, Randriamanalina B, Razafinimpiasa L, Rousset D and Delpeyroux F. (2007) Co-

Circulation and Evolution of Polioviruses and Species C Enteroviruses in a District of

Madagascar. PLoS Pathog 3(12): e191. https://doi.org/10.1371/journal.ppat.0030191

https://doi.org/10.1006/viro.1993.1003

https://www.ncbi.nlm.nih.gov/pubmed/2539491/



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

• Ren R, Moss EG and Racaniello VR (1991) Identification of two determinants that

attenuate vaccine-related type 2 poliovirus. J Virol. 65:1377-1382

• Rowe, A., Ferguson, G. L., Minor, P. D., and Macadam, A. J. (2000). Coding changes in

the poliovirus protease 2A compensate for 5'NCR domain V disruptions in a cell-specific

manner. Virology 269(2): 284-293

• Sahoo, M. K., Holubar, M., Huang, C., Mohamed-Hadley, A., Liu, Y., Waggoner, J. J.,

Troy S.B., Garcia-Garcia L., Ferreyra-Reyes L., Maldonado Y., and Pinsky, B. A. (2017).

Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing. Journal of

Clinical Microbiology, 55(7), 2162–2171

• Suzuki Y (2006) Ancient positive selection on CD155 as a possible cause for

susceptibility to poliovirus infection in simians. Gene 373:16-22

• Umonium data sheet

• WHO (2003) WHO/V&B/03.11 - WHO global action plan for laboratory containment of

wild polioviruses, 2nd Edition

http://apps.who.int/iris/bitstream/10665/68205/1/WHO_V-B_03.11_eng.pdf, last

accessed 1 November 2017

• WHO (2014) Information Sheet - Observed Rate Of Vaccine Reactions Polio Vaccines-

May 2014

http://www.who.int/vaccine_safety/initiative/tools/polio_vaccine_rates_information_she

et.pdf?ua=1, last accessed 1 November 2017

• WHO (2015) WHO Global Action Plan to minimize poliovirus facility-associated risk

after type-specific eradication of wild polioviruses and sequential cessation of oral polio

vaccine use GAP III. WHO/POLIO/15.05 http://polioeradication.org/wp-

content/uploads/2016/12/GAPIII_2014.pdf, last accessed 1 November 2017

• WHO (2016) Polio vaccines: WHO position paper. WHO Weekly Epidemiological

Record 12(91):145-168

http://apps.who.int/iris/bitstream/10665/68205/1/WHO_V-B_03.11_eng.pdf

http://www.who.int/vaccine_safety/initiative/tools/polio_vaccine_rates_information_sheet.pdf?ua=1

http://www.who.int/vaccine_safety/initiative/tools/polio_vaccine_rates_information_sheet.pdf?ua=1

http://polioeradication.org/wp-content/uploads/2016/12/GAPIII_2014.pdf

http://polioeradication.org/wp-content/uploads/2016/12/GAPIII_2014.pdf



Eudra CT: 2018-001684-22 of 53

GMO: B/BE/18/BVW2

List of Annexes

1 Sequence comparison between nOPV2 candidate 1 and Sabin 2

2 Sequence comparison between nOPV2 candidate 2 and Sabin 2

3 Summary of results of Phase 1 clinical study with nOPV2 candidate 1 and candidate 2 CONFIDENTIAL

4 Clinical trial protocol CONFIDENTIAL

5 Investigator’s Brochure CONFIDENTIAL

novel oral poliomyelitis type 2 vaccine - nopv2 gmo deliberate … · 2018-05-09 · university of...

Documents