nuclear accumulation of cytosolic glyceraldehyde-3-phosphate … · in this manner, glutathione,...

Nuclear Accumulation of CytosolicGlyceraldehyde-3-Phosphate Dehydrogenase inCadmium-Stressed Arabidopsis Roots1[C][W]

Marco Vescovi, Mirko Zaffagnini, Margherita Festa, Paolo Trost, Fiorella Lo Schiavo, and Alex Costa*

Department of Biology, University of Padua, 35131 Padua, Italy (M.V., F.L.S.); Department of Pharmacy andBiotechnology, University of Bologna, 40126 Bologna, Italy (M.Z., M.F., P.T.); and Department of Bioscience,University of Milan, 20133 Milan, Italy (A.C.)

NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a ubiquitous enzyme involved in the glycolyticpathway. It has been widely demonstrated that mammalian GAPDH, in addition to its role in glycolysis, fulfills alternativefunctions mainly linked to its susceptibility to oxidative posttranslational modifications. Here, we investigated the responses ofArabidopsis (Arabidopsis thaliana) cytosolic GAPDH isoenzymes GAPC1 and GAPC2 to cadmium-induced stress in seedlingsroots. GAPC1 was more responsive to cadmium than GAPC2 at the transcriptional level. In vivo, cadmium treatments induceddifferent concomitant effects, including (1) nitric oxide accumulation, (2) cytosolic oxidation (e.g. oxidation of the redox-sensitiveGreen fluorescent protein2 probe), (3) activation of the GAPC1 promoter, (4) GAPC1 protein accumulation in enzymaticallyinactive form, and (5) strong relocalization of GAPC1 to the nucleus. All these effects were detected in the same zone of the roottip. In vitro, GAPC1 was inactivated by either nitric oxide donors or hydrogen peroxide, but no inhibition was directly providedby cadmium. Interestingly, nuclear relocalization of GAPC1 under cadmium-induced oxidative stress was stimulated, rather thaninhibited, by mutating into serine the catalytic cysteine of GAPC1 (C155S), excluding an essential role of GAPC1 nitrosylation in themechanism of nuclear relocalization, as found in mammalian cells. Although the function of GAPC1 in the nucleus is unknown, ourresults suggest that glycolytic GAPC1, through its high sensitivity to the cellular redox state, may play a role in oxidative stresssignaling or protection in plants.

Plants are exposed to several biotic and abioticstresses. Among the latter, drought, salinity, extremetemperatures, anoxia, excess light, xenobiotics, andheavy metals dramatically affect plant growth and de-velopment as well as crop yield (Jaspers and Kangasjärvi,2010; Urano et al., 2010; Kosová et al., 2011). Plantshave developed sophisticated signaling mechanismsthat link the perception of the stress signals to specificresponses, such as up- or down-regulation of stress-responsive genes (Yamaguchi-Shinozaki and Shinozaki,2006). Reactive oxygen and nitrogen species (ROS andRNS, respectively) and phosphorylation cascades ofmitogen-activated protein kinases (MAPKs) play a

prominent role in these processes (Rodriguez et al.,2010).

ROS and RNS are also produced under physiologi-cal conditions and their levels held in check by low-Mrreductants (e.g. glutathione and ascorbate; Foyer andNoctor, 2011) and enzymatic antioxidant systems (e.g.catalases, peroxidases, thioredoxins, and glutaredoxins;Meyer et al., 1999; Apel and Hirt, 2004; Foyer andNoctor, 2005). Various physiological processes areregulated by ROS and RNS, particularly in roots (e.g.transition from cell proliferation to cell differentiation[Tsukagoshi et al., 2010], apical growth of root hairs[Foreman et al., 2003], and lateral root formation [Correa-Aragunde et al., 2004]), but also in leaves (e.g. stomatamovements [Kwak et al., 2003]).

However, when plants are exposed to differenttypes of stress, the production of ROS and RNS canoverwhelm the scavenging capacity of the cell, therebyleading to accumulation of these reactive moleculeswith the establishment of oxidative stress conditions(Apel and Hirt, 2004; Møller et al., 2007; Valderramaet al., 2007; Corpas et al., 2008). Interestingly, multipleMAPK modules that mediate oxidative stress re-sponses are not only induced by ROS, but can alsoregulate ROS levels by stimulating catalase activities(Rodriguez et al., 2010). Moreover, ROS and RNS dointeract in vivo. For instance, programmed cell deathwas induced by a combination of hydrogen peroxide(H2O2) and nitric oxide (NO; Delledonne et al., 2001),

1 This work was supported by the Ministry of Education, Univer-sity, and Research (Progetti di Ricerca di Interesse Nazionale [PRIN]2008 to F.L.S., PRIN 2008 to P.T., PRIN 2009 to M.F. and M.Z., andFondo per gli Investimenti della Ricerca di Base 2010 to A.C.).

* Corresponding author; e-mail [email protected] authors responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) are:Alex Costa ([email protected]) and Fiorella Lo Schiavo ([email protected]).

[C] Some figures in this article are displayed in color online but inblack and white in the print edition.

[W] The online version of this article contains Web-only data.www.plantphysiol.org/cgi/doi/10.1104/pp.113.215194

Plant Physiology�, May 2013, Vol. 162, pp. 333–346, www.plantphysiol.org � 2013 American Society of Plant Biologists. All Rights Reserved. 333

https://plantphysiol.orgDownloaded on November 13, 2020. - Published by Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

mailto:[email protected]

http://www.plantphysiol.org




http://www.plantphysiol.org/cgi/doi/10.1104/pp.113.215194

https://plantphysiol.org

and MAPKs were shown to regulate NO levels uponH2O2 induction (Wang et al., 2010).

Implication of ROS and RNS (chiefly H2O2 and NO)in redox signaling probably stems from their capabilityto induce posttranslational modifications of targetproteins (Foyer and Noctor, 2005; Foyer and Noctor,2009; Yu et al., 2012). Cysteines that are made reactiveby their particular protein environment can be pri-marily oxidized to sulfenic acids (-SOH) by H2O2 andfurther oxidized to sulfinic or sulfonic forms (-SO2Hand -SO3H, respectively) over prolonged oxidative stress(Poole et al., 2004). Alternatively, sulfenic cysteines canform disulfide bonds with other protein cysteines (-SS-)or with glutathione (-SSG, glutathionylation; Zaffagniniet al., 2012a, 2012b). NO can also modify reactive cys-teines, giving rise to nitrosothiol groups (-SNO; Besson-Bard et al., 2008; Yu et al., 2012). While sulfinic andsulfonic modifications are irreversible, all other types ofredox modifications (-SOH, -SSG, -SS-, and -SNO) canbe recovered by physiological redox active systems in-volving glutaredoxins, thioredoxins, and low-Mr reduc-tants such as reduced glutathione (GSH) and NADPH.In this manner, glutathione, the major thiol-based redoxbuffer of plant cells (Noctor et al., 2011), may regulateredox signaling pathways (Zaffagnini et al., 2012b). Forexample, protein Tyr phosphatase, known to regulate theintensity and duration of signals involving MAPKmodules (Gupta and Luan, 2003; Rodriguez et al., 2010),is itself regulated by redox modification of active sitecysteines (Dixon et al., 2005).

Not surprisingly, several proteomic studies haverecently reported that H2O2, NO-donors, and bioticand abiotic stresses applied to plants may affect theredox state of reactive protein cysteines, in addition toaffecting their transcriptomic and proteomic profiles(Chen et al., 2003; Polverari et al., 2003; Parani et al.,2004; Lindermayr et al., 2005; Herbette et al., 2006;Roth et al., 2006; Sarry et al., 2006; Besson-Bard et al.,2008; Romero-Puertas et al., 2008; Astier et al., 2011).Because of the high reactivity of its catalytic Cys, cy-tosolic glyceraldehyde 3-P dehydrogenase (GAPDH)has been identified as a target of different typesof redox modifications (Hancock et al., 2005, 2006;Lindermayr et al., 2005; Holtgrefe et al., 2008; Bedhommeet al., 2012).

Plant GAPDHs are abundant and ubiquitous en-zymes playing essential metabolic roles in glycolysisand photosynthetic carbon assimilation. However, apea (Pisum sativum) chloroplast GAPDH isoform hasbeen shown to have uracil DNA glycosylase activity(Wang et al., 1999), and in mammals, GAPDH wasshown to fulfill additional nonmetabolic functions,including posttranscriptional regulation, maintenanceof DNA integrity, and apoptosis (Sirover, 2011; Tristanet al., 2011). In rat cells, stress conditions may causenitrosylation of GAPDH catalytic Cys and interactionwith Seven in absentia homolog1 (Siah1; an E3 ubiq-uitin ligase), whose nuclear localization signal drivesthe GAPDH-Siah1 complex into the nucleus, where theubiquitinating activity of Siah1 promotes apoptosis

(Hara et al., 2005). On the other hand, nitrosylatedGAPDH was found to mediate transnitrosylation ofnuclear proteins, an activity that could further propa-gate the redox signal (Kornberg et al., 2010). However,alternative mechanisms have been proposed in whichGAPDH translocation to the nucleus is independent onboth nitrosylation and Siah1 (Sirover, 2011).

Here, we studied the behavior of the two Arabi-dopsis (Arabidopsis thaliana) cytosolic GAPDH isoformsGAPC1 (At3g04120) and GAPC2 (At1g13440) underoxidative stress conditions imposed by the common soilpollutant cadmium (Sanità di Toppi and Gabbrielli,1999). The expression of both genes was stimulated bycadmium, but GAPC1 was the more responsive one.Through the generation of transgenic plants expressingeither a transcriptional or a translational GAPC1 re-porter, we demonstrated that the oxidative stress in-duced by cadmium treatment stimulated a transientincrease of GAPC1 promoter activity and a steady ac-cumulation of the GAPC1 protein in an inactive state. Invitro studies underlined the sensitivity of ArabidopsisGAPC1 activity to treatment with H2O2 and NO do-nors, whereas no inhibitory effect was observed in thepresence of cadmium under conditions tested. Inter-estingly, in Arabidopsis roots, the cadmium-dependentoxidative stress induced a massive accumulation ofGAPC1 in the nucleus. This process could be mimickedand amplified by mutation of GAPC1 catalytic Cys,thus demonstrating that nitrosylation of GAPC1 is not arequisite for nuclear relocalization, as previously ob-served in mammalian cells (Hara et al., 2005). To ourbest knowledge, this is the first demonstration thatGAPDH can be translocated to the nucleus of plantcells under oxidative stress conditions.

RESULTS

Cadmium Induces Accumulation of NO and CytosolicOxidation in Arabidopsis Root Tips

Cadmium, a common soil pollutant (Sanità di Toppiand Gabbrielli, 1999), has been reported to induce ac-cumulation of NO and ROS in plant cells (Cho andSeo, 2005; Besson-Bard et al., 2009; De Michele et al.,2009; Cuypers et al., 2011). In our hands, 1-week-oldArabidopsis seedlings exposed to different concentra-tions of cadmium (0.1–0.4 mM) for 24 h displayed abrowning region in the root tip, particularly apparentin differentiation and transition zones (SupplementalFig. S1). However, treatment with 0.1 mM cadmiumcould be prolonged for up to 72 h without affecting cellviability, although root tip morphology was clearly al-tered and root hair formation was induced (SupplementalFig. S1). Treatments with 0.1 mM cadmium for up to 72 hwere therefore adopted in the following experimentsaimed at testing the capability of cadmium to induceoxidative stress conditions in Arabidopsis seedlings.

In vivo analysis of NO levels was performed with 4-amino-5-methylamino-29,79-difluorofluorescein (DAF-

334 Plant Physiol. Vol. 162, 2013

Vescovi et al.


http://www.plantphysiol.org/cgi/content/full/pp.113.215194/DC1





FM) diacetate as a membrane-permeable NO-sensitiveindicator (Kojima et al., 1998; Zottini et al., 2007).Cadmium treatment induced NO accumulation at 24 hand was still detected at 72 h (Fig. 1A). The effect ofcadmium on the cellular redox state was assessed byusing Arabidopsis transgenic seedlings expressing freeredox-sensitive (ro)GFP2 (localized in the cytosol andnucleus [Meyer et al., 2007]). The roGFP2 is a redox-sensitive fluorescent probe that can exist in either re-duced (dithiol, -SH HS-) or oxidized (disulfide, -SS-)forms, each with a different excitation spectrum. Invivo, the redox state of roGFP2 depends on the redoxpotential of glutathione (itself a function of the [GSH]2/[GSSG] ratio; Meyer et al., 2007), but possibly also byother molecules (e.g. ROS and RNS) that might reactwith roGFP2 redox-sensitive cysteines. After 24 h ofcadmium treatment, a slight increase in the 405/488nm probe ratio reflected an increased oxidation ofthe roGFP2 probe. After 72-h cadmium treatment, thisincrease was dramatic (Fig. 1B). A similar effect wasobserved by treating the roGFP2-seedlings with thecatalase inhibitor 3-amino-1,2,4-triazole (3-AT; Fig. 1C;

Gechev et al., 2005) or with exogenous H2O2 (data notshown). In spite of the clear effect, it is difficult to as-sess whether the oxidation of the roGFP2 probe upontreatments with cadmium, 3-AT, or H2O2 might bemediated by a partial oxidation of the glutathione poolor alternatively achieved by other means (e.g. directoxidation by H2O2). In any case, the results of Figure1 clearly showed that cadmium treatments poise thecellular redox state to more oxidizing conditions. Inaddition to causing the oxidation of the redox proberoGFP2, these conditions are likely to cause oxidationof several reactive cysteines present in the cell.

In Root Tips, Cadmium Induced Transient Activation ofGAPC1 Promoter and Steady Accumulation of GAPC1Protein in Inactive State

Arabidopsis contains two genes coding for cytosolicGAPDHs, namely GAPC1 (At3g04120) and GAPC2(At1g13440; http://www.arabidopsis.org). Our quan-titative real-time reverse-transcription (RT)-PCR anal-ysis of whole seedlings revealed that both genes were

Figure 1. NO production and redox statusin Arabidopsis seedlings exposed to cadmium.A, Seven-day-old Arabidopsis wild-typeseedlings treated with 0.1 mM cadmiumfor 24 and 72 h and stained with DAF-FMdiacetate for NO quantification. The rela-tive fluorescence values are related to thefluorescence level in control roots (set to1). False-colored pictures are representa-tive images of transition and elongationroot tip zones considered for the dataanalyses reported in the graph of A. B,Normalized ratio values (405/488 nm) ofcytosolic roGFP2 probe in 7-d-old Arabi-dopsis roGFP2 transgenic seedlings treatedwith 0.1 mM cadmium for 24 and 72 h. C,Normalized ratio values (405/488 nm) ofcytosolic roGFP2 probe in 7-d-old Arabi-dopsis roGFP2 transgenic seedlings treatedwith 1 mM 3-AT for 24 and 72 h. False-colored pictures are representative ratio-metric images (405/488-nm ratios) oftransition and elongation root tip zonesconsidered for the data analyses reportedin the graphs of B and C. Asterisks indicatefluorescence levels or normalized ratiosthat are significantly different from thosefound in control roots as calculated byStudent’s t test (***P , 0.005 and **P ,0.01).

Plant Physiol. Vol. 162, 2013 335

Cytosolic GAPDH Nuclear Relocalization


http://www.arabidopsis.org


up-regulated after 24-h cadmium treatment, with GAPC1being clearly more responsive to the treatment thanGAPC2 (Fig. 2). Following experiments were thus fo-cused on GAPC1.

To investigate the effect of cadmium on GAPC1expression at the cellular and subcellular level, twodifferent Arabidopsis transgenic lines were generated:(1) a transcriptional reporter line harboring the GUSgene under the control of the GAPC1 promoter sequence(2633 to21 from the ATG start codon; Supplemental Figs.S2A and S3) and (2) a translational reporter line har-boring the chimeric GAPC1-YFP (for yellow fluorescentprotein) gene under the control of the same GAPC1promoter sequence. For each expression cassette, severalindependent transgenic lines were isolated (SupplementalFig. S2, A and B). The lines showing a similar expressionpattern were used for further analyses, and these selectedlines did not show changes in growth and morphologywhen compared with wild-type plants (data not shown).The western blot performed with total proteins extractedfrom the three selected translational reporter lines showedthe presence of a band at the expected size recognized bythe GFP antibody (Supplemental Fig. S2B). The GAPC1promoter activity was detected throughout plant devel-opment, from seedlings (Supplemental Fig. S3A) to ma-ture plants (Supplemental Fig. S3B), and was found to beexpressed in root, rosette and cauline leaves, flowers, andsilique abscission zone (Supplemental Fig. S3B).

Transgenic Arabidopsis seedlings transformed withthe transcriptional reporter pGAPC1::GUS treated with0.1 mM cadmium showed an increased promoter ac-tivity in root tips at 24 h (Fig. 3, A and B), in agreementwith quantitative real-time RT-PCR analysis of wholeseedlings (Fig. 2). Quantitative determination of GUSactivity showed a progressive decrease after 24-htreatment and reached control levels at 72 h (Fig. 3B),although GAPC1 promoter activation at this time point

was still revealed by histochemical staining (Fig. 3A).At the cellular level, cadmium induced GAPC1 pro-moter activity both in elongating and differentiatingcells, whereas the activity of the promoter appearedrestricted to elongating cells in control roots (Fig. 3A).

Same experiments were performed on seedlingsexpressing the translational reporter GAPC1-YFP un-der the control of the GAPC1 promoter. Confocal mi-croscope analyses (Fig. 3C) revealed the accumulationof GAPC1-YFP in elongating and differentiating cells,starting from 24-h cadmium treatments. After 48 and72 h, GAPC1-YFP was accumulated also in the apicalmeristem and in differentiated root cells (Fig. 3C),pairing with the spread of the GUS histochemical sig-nal of Figure 3A. Western-blot analyses of total proteinsextracted from roots of control and 72-h-cadmium-treated seedlings confirmed that the increased fluores-cence of Figure 3C was reflecting the accumulation ofthe GAPC1-YFP chimeric protein (Fig. 3D).

In spite of the induction of GAPC1 protein accu-mulation, 72-h cadmium treatments had no stimulat-ing effects on the extractable NADH-specific GAPDHactivity of whole seedlings (Fig. 4D). However, theinterpretation of this result was complicated by the factthat the Arabidopsis genome codes for four different

Figure 2. Quantitative real-time RT-PCR expression analysis of GAPC1and GAPC2 genes in 7-d-old Arabidopsis wild-type seedlings treatedwith 0.1 mM cadmium for 24 h. The relative expression values ofGAPC genes are related to the expression levels in control roots (set to1). Values represent mean6 SD of relative quantification value of threeexperiments performed by using templates from three independentbiological samples. Asterisks indicate expression levels that are sig-nificantly different from those found in control seedlings as calculatedby Student’s t test (*P , 0.001 and **P , 0.01).

Figure 3. Effects of cadmium treatment on GAPC1 promoter activityand GAPC1-YFP level. A and B, GUS histochemical and quantitativeenzymatic activity analyses performed on 7-d-old Arabidopsis pGAPC1::GUS transgenic seedlings treated with 0.1 mM cadmium for 24, 48,and 72 h. The GUS activity assay was performed using total proteinextracts from 600 roots in three independent experiments. The relativeactivity values of GUS are related to the activity in control roots (set to1). Asterisks indicate GUS activity levels that are significantly differentfrom those found in control roots as calculated by Student’s t test(*P , 0.001). C, Confocal images of 7-d-old Arabidopsis pGAPC1::GAPC1-YFP transgenic seedlings treated with 0.1 mM cadmium for24, 48, and 72 h. D, Two and one-half micrograms of total proteinextracts from roots of 7-d-old Arabidopsis pGAPC1::GAPC1-YFPtransgenic seedlings in control conditions or treated with 0.1 mM

cadmium for 72 h were assayed by immunoblot analysis using a GFPantibody. Coomassie Blue was used as loading control. The blot wasrepeated twice.


Vescovi et al.











NADH-specific GAPDH isoforms (i.e. two cytosolicGAPC and two plastidial GAPCp; Rius et al., 2008;Muñoz-Bertomeu et al., 2010; Guo et al., 2012). Tosimplify the picture, knockout homozygous mutantsfor either GAPC1 or GAPC2 genes were thus isolated(see “Materials and Methods”; Fig. 4, A and B), andreal-time PCR analysis revealed the complete absenceof either GAPC1 or GAPC2 transcripts in their re-spective insertional mutant lines (Fig. 4C). Inter-estingly, no compensatory effects were observed, asneither GAPC2 nor GAPC1 transcript abundance wassignificantly affected in gapc1 and gapc2 mutants, re-spectively. Real-time PCR analysis also revealed ahigher level of GAPC2 than GAPC1 transcripts in wild-type seedlings (Supplemental Fig. S4), consistent withpublished microarray data (Winter et al., 2007). Inseedlings of each mutant line, the catalytic activity as-sociated to NADH-specific cytosolic GAPDH isoforms(see “Materials and Methods”) was reduced to about50% of the wild-type level (Fig. 4D), suggesting thatboth GAPC isoforms may similarly contribute to gly-colysis in wild-type plants, with little or no contributionby GAPCp isoforms. Given the different expression ofGAPC2 and GAPC1 transcripts (Supplemental Fig. S4),this result also suggests that regulatory mechanismsacting downstream of transcription would reequi-librate the GAPC1/GAPC2 ratio in terms of catalyticactivity.Cadmium treatments of gapc1 and gapc2 mutant

seedlings induced a moderate increase of NADH-specificGAPDH activity in gapc2 but no effects in gapc1 mutant,implying specific activation of GAPC1. The effect, how-ever, was small (+20%), undetectable in wild-type seed-lings (Fig. 4D) and hard to compare with the increase ofGAPC1-YFP protein observed under identical experi-mental conditions (Fig. 3, C and D). These results seemthus to suggest that cadmium induced GAPC1 accumu-lation in an inactive form.The reducing agent dithiothreitol (DTT) could not

restore the activity of cadmium-overexpressed GAPC1(Fig. 4D), indicating that reversible redox modifica-tions of GAPC1 catalytic Cys (i.e. sulfonation, nitro-sylation, or glutathionylation; Bedhomme et al., 2012)were not the cause of the apparent inactivation. In-terestingly, Fourrat et al. (2007) showed that treat-ments of the protozoan Tetrahymena pyriformis witheither sodium nitroprusside (NO donor) or H2O2 led toa dramatic increase of GAPDH protein level withoutaffecting total enzymatic activity.

Catalytic Activity of Recombinant GAPC1 Is Sensitive toNO and H2O2, But Not to Cadmium

The direct effect of NO, H2O2, and cadmium onGAPC1 catalytic activity was investigated with therecombinant enzyme. Recombinant GAPC1 was inhibitedby both NO (delivered by diethylamine [DEA]-NONOate)and H2O2 in a time- and concentration-dependent manner(Fig. 5, A and B). The reducing agent DTT could restore

Figure 4. Isolation and characterization of Arabidopsis gapc1 andgapc2 mutants. A, Schemes of GAPC1 and GAPC2 gene structures ofgapc1 (SALK_010839) and gapc2 (SALK_016539) insertional mutants.Arrowheads indicate the position of the primers used to screen homo-zygous mutants. B, PCR analysis of GAPC1 and GAPC2 genes per-formed on genomic DNA from the wild type and homozygous gapc1and gapc2 mutants. The upper bands correspond to the amplification ofwild-type alleles, and the lower bands correspond to mutated alleles. C,Quantitative real-time RT-PCR expression analysis of GAPC1 andGAPC2 genes in Arabidopsis wild-type and homozygous gapc1 andgapc2 mutant seedlings. The relative expression values are related to theexpression levels of the same genes in the wild-type background, whichwere set to 1. Note that in control conditions the GAPC2 is expressed100 times more than GAPC1 (Supplemental Fig. S4). Values representmean 6 SD of relative quantification value of three experiments per-formed by using templates from three independent biological samples.ND, Not detected. D, NADH-specific cytosolic GAPDH catalytic ac-tivity analyses performed with total protein extracts from 7-d-old Arabi-dopsis wild-type, gapc1, and gapc2 mutant seedlings treated with0.1 mM cadmium for 72 h. Protein extracts were also treated with 10mM DTT for 15 min and reported in the same graph. The relative ac-tivity values of control mutant seedlings and wild-type treated seed-lings are related to the activity in control wild-type seedlings, whichwas set to 100 (corresponding to 4186 42 nmol min–1 mg–1). Asterisksindicate activity levels that are significantly different from those foundin control seedlings as calculated by Student’s t test (**P , 0.01). [Seeonline article for color version of this figure.]







the activity of the NO-treated enzyme (Fig. 5C). Invitro inactivation by H2O2 was instead irreversible(Fig. 5D), although GSH was previously demonstratedto protect GAPC1 from H2O2 inactivation via gluta-thionylation of transiently oxidized GAPC1 sulfonateand recovery by glutaredoxins or thioredoxins (Bedhommeet al., 2012). It is thus concluded that both NO and H2O2treatments of GAPC1 might result in a reversible inhi-bition of the enzyme in vivo, provided that GSH isavailable for recovery. On the other side, the activity ofrecombinant GAPC1 proved to be insensitive to cad-mium treatment (0.1 mM; Fig. 5E).

Evidence That GAPC1 Expression Is Affected byGlutathione Status

In further investigations, cytosolic oxidation wasalternatively obtained by treating seedlings with L-buthionine-sulfoximine (BSO), an inhibitor of glutathionebiosynthesis (Griffith, 1982), for 24 h (Fig. 6A). The oxi-dizing effect of BSO (1 mM), monitored by analyzingroGFP2 seedlings’ response, was comparable to that ofcadmium (0.1 mM), and oxidation of the roGFP2 probewas severe when the seedlings were cotreated with bothcompounds. Same treatments applied to pGAPC1::GUSand pGAPC1::GAPC1-YFP seedlings showed that BSOitself induced both GAPC1 promoter activity and pro-tein accumulation in the seedling root tips, as comparedwith control condition (Fig. 6, B and C). The effect wasagain amplified in seedlings treated with both BSO andcadmium together (Fig. 6, B and C). By contrast, 24-htreatment with GSH (1 mM) had opposite effects on bothGAPC1 promoter activity and protein accumulation in

root tips (data not shown). The BSO effect stronglysuggests a link between the increased GAPC1-YFP ac-cumulation and the cellular redox status, independentlyfrom the presence of cadmium. This observation wasalso strengthened by the fact that treatments with thecatalase inhibitor 3-AT did also induce GAPC1-YFPaccumulation (data not shown). Taking together thedata shown in Figure 6, it can be observed that BSOaffects the roGFP2 signal more than cadmium, butcadmium affects GAPC1 expression more than BSO,and that BSO and cadmium act synergistically or ad-ditively on both factors. This could reflect the fact thatcadmium depletes the glutathione pool (for phytoche-latin synthesis; De Michele et al., 2009) and generatesROS or other oxidants, whereas the effect of BSO islargely confined to depletion of the glutathione pool.

Cadmium Induces Nuclear Relocalization of InactiveGAPC1-YFP Chimeric Protein

A subcellular localization analysis of root tips ofpGAPC1::GAPC1-YFP seedlings treated for 72 h withcadmium showed a nuclear accumulation of GAPC1-YFPchimeric proteins in cells of the transition/elongationzone (Fig. 7B). Interestingly, green fluorescent nucleiwere observed also in root epidermal cells induced todifferentiate into root hairs under the effect of cad-mium (Fig. 7B).

Hara et al. (2005) described the nuclear relocaliza-tion of GAPDH in rat cells under oxidative stressconditions and showed it to be a consequence of (1)nitrosylation of its catalytic Cys-150 (C150) and (2)interaction with the nuclear carrier Siah1, with Lys-225

Figure 5. Oxidant treatments of recombinantGAPC1. A, Time- and concentration-dependent in-activation of recombinant GAPC1 by the NOdonor DEA-NONOate. B, Time- and concentration-dependent inactivation of recombinant GAPC1 byH2O2. C, Reversibility of DEA-NONOate treatment.Recombinant GAPC1 was incubated for 10 minwith 0.5 mM DEA-NONOate, and the reversibilityof GAPC1 inactivation was then assessed by incu-bation for 10 min in the presence of 20 mM DTT. D,Reversibility of H2O2 treatment. RecombinantGAPC1 was incubated for 10 min with 0.1 mM

H2O2, and the reversibility of GAPC1 inactivationwas then assessed by incubation for 10 min in thepresence of 20 mM DTT. E, Effect of cadmiumtreatment on GAPC1 activity. Recombinant GAPC1was incubated with 0.1 mM cadmium for 10 min.The reversibility of the treatment was assessed byincubating the protein with 20 mM DTT after ex-posure to 0.1 mM cadmium for 10 min. Aliquots ofthe incubation mixtures were withdrawn at theindicated time points, and the NADH-dependentactivity was determined. Data are represented asthe mean percentage of maximal control acti-vity 6 SD. [See online article for color version ofthis figure.]


Vescovi et al.



(K225) of GAPDH being required for such binary com-plex formation. Based on these findings, the followingpoint mutations were introduced in the pGAPC1::GAPC1-YFP expression cassette: C155S (catalytic Cys, also knownas Cys-149, based on the numbering of crystallizedGAPDH from Bacillus stearothermophilus; Biesecker et al.,1977; Bedhomme et al., 2012), C159S, C155/C159S, andK230A (K230 is homologous to the Lys involved inGAPDH-Siah1 binding in animal GAPDH). Arabidopsisprotoplasts were transiently transformed, and subcel-lular localization analyses demonstrated that all mutatedGAPC1 forms were localized mainly in the cytosol, be-cause we failed to detect any signal in the nucleus(Supplemental Fig. S5). Generation of stable transgeniclines by transforming wild-type plants with the fourdifferent constructs allowed testing nuclear relocalizationupon cadmium treatments. Accumulation of GAPC1-YFP in cadmium-treated plants was confirmed, butalso nuclear relocalization was maintained in each mu-tant, at a similar extent to that observed in the originalpGAPC1::GAPC1-YFP plants (Supplemental Fig. S6).

However, because GAPC1 is a tetrameric protein,we speculated that wild-type GAPC1 subunits mightbuild spurious GAPDH tetramers with mutated GAPC1-YFP subunits in transgenic plants, thus preventing aclear-cut interpretation of the relocalization experiments.To overcome this problem, plants expressing the chi-meric proteins (GAPC1-YFP and GAPC1-C155S-YFP)were crossed with gapc1 plants. F2 lines with no wild-type GAPC1 alleles were then selected (GAPC1::GAPC1-YFP-gapc1–/– and GAPC1::GAPC1-C155S-YFP-gapc1–/–).Reevaluation of the effect of cadmium treatments onthese plants revealed that nuclear accumulation ofGAPC1-YFP was higher in gapc1 than in the wild-typebackground (Fig. 7C). Interestingly, the absence of wild-type GAPC1 (gapc1 background) allowed to detect aclear positive effect of C155S mutation on the extent ofnuclear accumulation (Fig. 7C), i.e. exactly the oppositeof what previously suggested by works on differentsystems (Hara et al., 2005; Kornberg et al., 2010), and thiseffect was observed both in the absence or in the pres-ence of cadmium.

Figure 6. Effects of inhibition of glutathione bio-synthesis on redox status, GAPC1 promoter activity,and GAPC1-YFP level in control and cadmium-treated roots. A, Ratio values (405/488 nm) of 7-d-old Arabidopsis roGFP2 transgenic seedling roottips in control conditions or treated with 0.1 mM

cadmium, 1 mM BSO, and 0.1 mM cadmium plus1 mM BSO for 24 h. False-colored pictures arerepresentative ratiometric images (405/488-nmratios) of transition and elongation root tip zonesconsidered for the data analyses reported in thegraph. B, Histochemical analysis of GUS activityin 7-d-old Arabidopsis pGAPC-1::GUS transgenicseedling root tips in control conditions or treatedwith 0.1 mM cadmium, 1 mM BSO, and 0.1 mM

cadmium plus 1 mM BSO for 24 h. C, YFP fluo-rescence of 7-d-old Arabidopsis pGAPC-1::GAPC1-YFP transgenic seedling root tips in con-trol conditions or treated with 0.1 mM cadmium,1 mM BSO, and 0.1 mM cadmium plus 1 mM BSOfor 24 h. The graph reports the semiquantitativepixel intensity analysis. The relative fluorescencevalues are related to the fluorescence level incontrol roots (set to 1). Pictures are representativeimages of transition and elongation root tip zonesconsidered for the data analyses reported in thegraph. Asterisks indicate fluorescence levels thatare significantly different from those found incontrol roots as calculated by Student’s t test(*P , 0.005 and **P , 0.05).







DISCUSSION

Increasing attention has been recently paid to the studyof “new roles” played by “old enzymes.” An emergingidea is that certain enzymes, so far only considered as keyplayers in fundamental metabolic pathways, may playdifferent roles in signal transduction or other stress-related responses. To recognize their versatility, thesehave been named moonlighting proteins (Jeffery, 1999;Huberts and van der Klei, 2010; Sirover, 2011) anddifferent mechanisms were proposed for the control oftheir moonlighting activity, chiefly posttranslationalmodifications and protein-protein interactions (Moore,2004). Several reviews, largely inspired by studies onthe animal field, have recently proposed plant GAPDHas an example of a moonlighting protein and S-nitro-sylation of its catalytic Cys as a possible means tocontrol GAPDH moonlighting activities (Astier et al.,2011; Gaupels et al., 2011). However, despite a generalinterest in nonglycolytic roles of plant GAPDHs, fewreports have experimentally addressed the topic.

Cadmium, a well-known inducer of oxidative stress(De Michele et al., 2009), is shown here to induce a pro-duction of NO in root tip cells of Arabidopsis seedlings(DAF-FM diacetate probe) and to cause cytosolic oxida-tion as determined by the redox probe roGFP2. Arabi-dopsis plants express two different cytosolic GAPDHs,GAPC1 and GAPC2, each accounting for nearly 50% oftotal NADH-specific GAPDH activity in whole seedlings.Both GAPC1 and GAPC2 transcripts were up-regulatedby cadmium, but GAPC1 was the more responsive be-tween the two genes. Further studies on GAPC1 geneexpression and protein accumulation were thus con-ducted with the help of Arabidopsis transgenic linesexpressing either the GUS transcriptional reporter orthe GAPC1-YFP translational reporter. With theseplants, we could show that cadmium induced the ac-tivation of the GAPC1 promoter, and the accumulationof the GAPC1-YFP chimeric protein, in the same rootcells where NO and cytosolic oxidation also increased.Cytosolic oxidation could also be induced by the cat-alase inhibitor 3-AT or BSO, an inhibitor of glutathionebiosynthesis, and again this condition was associatedto GAPC1 accumulation in root tips.

However, the relationship between cadmium andGAPC1 in Arabidopsis plants is made complicated bythe fact that cadmium, in vivo, seems to cause GAPC1inactivation, concomitantly with the induction ofGAPC1 protein accumulation. In vitro experimentsshowed that GAPC1 enzyme activity is insensitive tocadmium but rapidly inactivated by oxidants such asNO or H2O2. In principle, GAPC1 oxidative inactiva-tion should be countered in vivo by glutathione, eitherdirectly or through glutaredoxins. However, in roottips of cadmium-treated seedlings, the glutathionepool is probably not reduced enough to keep activethis recovery system, as suggested by the progressiveoxidation of the roGFP2 probe. This conclusion fitswith our observations that cadmium induced in vivoan accumulation over time of chimeric GAPC1-YFP

Figure 7. GAPC1-YFP chimeric protein accumulation in the nucleusof cadmium-treated root cells. A, Cells from the elongation zone of atypical root tip of 7-d-old Arabidopsis showing the cytosolic locali-zation of GAPC1-YFP chimeric protein. Inset, representative cellwhere the YFP signal clearly surrounds the nucleus but is not inside thenucleus. B, Cells from the elongation zone of a typical root tip of 7-d-old Arabidopsis challenged with 0.1 mM cadmium for 72 h showingthe characteristic morphological alteration and the GAPC1-YFP ac-cumulation in the nuclei of the responding cells. Inset, representativecell (same focal plane of the inset shown in A) where the YFP signal isinside the nucleus. Note the presence of ectopic root hairs as typicalfeature of cadmium treatment. C, Effect of mutation of Cys-155 onmovement of the protein into the nucleus. Seven-day-old ArabidopsispGAPC1::GAPC1-YFP, pGAPC1::GAPC1-YFP 3 gapc1, pGAPC1::GAPC1-C155S-YFP, and pGAPC1::GAPC1-C155S-YFP 3 gapc1 trans-genic seedlings were treated with 0.1 mM cadmium for 72 H, and roottips were analyzed by means of confocal microscope. White circlesindicate cells that present GAPC1-YFP nuclear accumulation. In thegraph, values represent mean 6 SD of the percentages of cells pre-senting GAPC1-YFP nuclear accumulation. Asterisks indicate valuesthat are significantly different from those found in control roots ascalculated by Student’s t test (*P , 0.001). Black squares indicatevalues that are significantly different from those found in the pGAPC1::GAPC1-YFP 3 gapc1 transgenic line as calculated by Student’s t test(P , 0.05). Dagger indicates values that are significantly different fromthose found in pGAPC1::GAPC1-C155S-YFP transgenic line as cal-culated by Student’s t test (P , 0.001).


Vescovi et al.



(Fig. 3C), without significantly increasing GAPC1 ac-tivity (Fig. 4D). Perhaps the oxidative stress conditionsimposed by cadmium activate a signaling cascade thatenhances GAPC1 expression to compensate its ongo-ing inactivation. Interestingly, similarly to our resultswith cadmium, salt stress has been shown to induce, inArabidopsis root cells, the accumulation of GAPC1and proteins involved in ROS scavenging (Jiang et al.,2007).Though normally considered cytosolic, GAPC was

proposed to be localized in the nucleus of plant cells,and nuclear localization of a glycolytic enzyme is takenas a hint of moonlighting activity. Anderson et al.(2004) have shown by immunogold localization thepresence of GAPC both in the cytosol and the nucleusof pea leaf cells. Holtgrefe et al. (2008) have proposedthat, in Arabidopsis protoplasts, both GAPC1 andGAPC2 could localize also in the nucleus, in additionto the cytosol, and bind DNA. In the same Arabidopsissystem, tobacco (Nicotiana tabacum) cytosolic GAPDHwas shown to interact, both in the cytosol and in thenucleus, with an osmotic stress-activated protein ki-nase (NtOSAK) from tobacco too (Wawer et al., 2010).Although complex formation in the nucleus was notunaffected by stress conditions or NO donors, the in-teraction was abolished when both active-site cysteinesof GAPDH were mutated into serines (Wawer et al.,2010). These studies were performed with Arabidopsisprotoplasts expressing GAPDH under the control of thep35S promoter (Holtgrefe et al., 2008; Wawer et al.,2010), and in similar experiments, we could nicely con-firm the nuclear localization of GAPC1-YFP expressedunder the control of p35S (data not shown). However,replacing this constitutive strong promoter with theGAPC1 endogenous promoter largely prevented, incontrol conditions, the nuclear accumulation of GAPC1(Supplemental Fig. S5). We therefore suspect that, intransiently transformed protoplasts with a strong pro-moter such as p35S, nuclear GAPDH accumulationcould be a mere consequence of its overexpression. Toovercome this problem, we generated stable transgeniclines expressing GAPC1-YFP under the control of theendogenous GAPC1 promoter. These plants provedinstrumental to investigate GAPDH subcellular locali-zation under both control and stress conditions. Nuclearlocalization of GAPC1-YFP in pGAPC1::GAPC1-YFPArabidopsis plants was monitored in root tips andfound to be very rare in seedlings grown under controlconditions, but strongly stimulated by cadmiumtreatments.Cadmium-induced nuclear relocalization of GAPC1

in Arabidopsis root tips is reminiscent of the nuclearrelocalization of GAPDH described by Hara et al.(2005) in mammalian cells challenged with differenttypes of stimuli. In the mammalian system, GAPDHneeds to be nitrosylated on its catalytic Cys beforeforming a binary complex with Siah1 that can moveinto the nucleus, where the ubiquitinating activity ofSiah1 is exerted. In spite of superficial analogies, ourresults on the Arabidopsis system challenged with

cadmium underpin some crucial differences. In thesearch for unambiguous results, the GAPC1-YFP chi-mera was introduced into a gapc1 background and itwas demonstrated that cadmium-induced nuclear lo-calization of GAPC1 was not inhibited, but ratherstimulated, by the substitution of the catalytic CysC155 with a Ser. Based on this unexpected result, wecould rule out that S-nitrosylation or any other type ofredox modification of the catalytic Cys is an essentialprerequisite for binding with a putative partner pro-tein that allows relocalization of GAPC1 into the nu-cleus. It is possible, however, that inactivation of theenzyme, either by redox modification or by mutagen-esis, may be a sufficient condition to drive GAPDHinto the nucleus. In animal cells, mechanisms inde-pendent on S-nitrosylation of catalytic Cys were alsoproposed for nuclear localization of GAPDH underseveral conditions (Sirover, 2011). Interestingly,Wawer et al. (2010) also found that nuclear localizationof the GAPDH-NtOSAK complex was not stimulatedby NO donors, though complex formation did depend,somehow, on GAPDH catalytic Cys. Interestingly, inmammalian cells, several nonmetabolic functions havebeen reported for GAPDH in the nucleus, includingposttranscriptional regulation and apoptosis (Sirover,2011; Tristan et al., 2011). The demonstration thatmammalian and also chloroplastic GAPDHs haveuracil glycosylase activity (Wang et al., 1999; Mazzolaand Sirover, 2003) opens an interesting scenario on apossible role played by the GAPC1 in the nucleus. Theuracil glycosylase activity of GAPDH is associatedwith its monomeric form present in the nucleus(Mazzola and Sirover, 2003), whereas the glycolyticcytosolic form is tetrameric. Bearing in mind that theuracil glycosylase activity is important for the main-tenance of DNA integrity and is necessary to preventmutagenesis by eliminating uracil from DNA mole-cules, it is possible that the nuclear accumulation weobserved for GAPC1 may fit with the cell requirementof preventing possible DNA damaging due to oxida-tive stress.

Whatever the mechanism, we show in this work thatGAPC1, in addition to its glycolytic function, may wellbehave as a moonlighting protein involved in an oxi-dative stress-signaling pathway. Oxidative stress con-ditions, in our case promoted in vivo by cadmiumtreatments, induce the expression of GAPC1, but theprotein accumulates as inactive form and is relocalizedinto the nucleus. The complex relationships betweenGAPC1 and the cellular redox environment suggestthat it may act as an oxidative stress sensor.

The understanding of the mechanisms involved inGAPC1 nuclear relocalization and the role played byGAPC1 in the nucleus, along with the study of the roleplayed by redox posttranslational modifications, will beimportant topics to investigate in the future. Futureresearch will be also addressed to discovery, by meansof proteomic approaches, which are the proteins thatmight interact with GAPC1 during oxidative stress andare potentially responsible for its nuclear accumulation.






The transgenic lines generated would be helpful in suchanalyses.

MATERIALS AND METHODS

Plant Material and Growth Conditions

All the Arabidopsis (Arabidopsis thaliana) plants used in this study were ofthe Columbia ecotype. Plants were grown on Jiffy-Pot (http://www.jiffypot.com/) under 16-h/8-h cycles of white light (approximately 75 mE) at 22°C.Seedlings were grown in vitro for the selection of transformants and experi-ments. Seeds were surface-sterilized and, after cold treatment for 2 to 3 d, wereexposed to 16-h/8-h cycles of white light approximately 75 mE) in growthchambers. Seeds were grown at 23°C on vertical plates containing one-half-strength Murashige and Skoog medium (Murashige and Skoog, 1962) in-cluding 0.8% (w/v) agar (Duchefa). The medium was enriched with 0.1%(w/v) Suc and 0.05% (w/v) MES. The pH of the media was adjusted to 6.0 60.1 with 0.5 N KOH before autoclaving at 121°C for 20 min. Seeds of thetransgenic roGFP2 Arabidopsis line (Meyer et al., 2007) were provided byMarkus Schwarzländer. Seeds of gapc1 and gapc2 Arabidopsis transfer DNA(T-DNA) insertional mutant lines were from the SALK Institute (SALK_010839and SALK_016539, respectively).

Genotyping of Insertional gapc1 and gapc2 Mutants

T-DNA insertion mutant lines gapc1 (SALK_010839) and gapc2 (SALK_016539) were selected from the Salk collection (Alonso et al., 2003). GAPC1gene (At3g04120) is composed of nine exons, and the gapc1 insertion lineSALK_010839 presents the T-DNA insertion in the ninth exon (Fig. 4A). Thisline is a single T-DNA insertion line and was previously isolated and char-acterized (Rius et al., 2008). The GAPC2 gene (At1g13440) is composed of 11exons, and the T-DNA insertion in the SALK_016539 line is located in the sixthexon (Fig. 4A) and was previously isolated and characterized (Guo et al.,2012).

The wild-type GAPC1, GAPC2, and T-DNA insertion gapc1 and gapc2alleles were identified using PCR with the following primers: LP-GAPC1(59-CCGCACATCTGTTAATGAATTTC-39) and RP-GAPC1 (59-CTCAGAA-GACTGTTGATGGGC-39) to identify GAPC1 wild-type alleles, LP-GAPC2(59-GGTTAGGACTGAGGGTCCTTG-39) and RP-GAPC2 (59-GGCATCAGG-TACATAATCATGG-39) to identify GAPC2 wild-type alleles, and LBa1-SALK(59-TGGTTCACGTAGTGGGCCATCG-39) with RP-GAPC1 (59-CTCAGAA-GACTGTTGATGGGC-39) or RP-GAPC2 (59-GGCATCAGGTACATAATCATGG-39) to identify, respectively, gapc1 and gapc2 mutated alleles.

Enzyme Analyses

For the analyses of GAPDH activities, 400 7-d-old Arabidopsis seedlingswere pooled and homogenized in 50 mM Tris-HCl (pH 7.4) and 0.05% (w/v)Cys at 4°C. After centrifugation at 16,100g for 20 min at 4°C, the proteincontent was quantified according to the method of Bradford (1976). GAPDHactivity was monitored spectrophotometrically at 340 nm and 25°C in a re-action mixture containing 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 3 mM

3-phosphoglycerate, 1 mM EDTA, 5 units mL–1 of 3-phosphoglycerate kinase(from rabbit muscle; Sigma), 2 mM ATP, and 0.2 mM NADH. For calculations,an extinction coefficient of 340 for NADH of 6.23 mM

–1 was used. The NADH-dependent GAPDH activity of crude extracts may depend on both NADH-specific GAPDH (i.e. glycolytic isoforms) and NAD(P)H-GAPDH isoforms ofthe Calvin-Benson cycle. The maximal NADPH-dependent GAPDH activitywas assayed as above, except that 0.2 mM NADPH substituted NADH andthe extracts were incubated with a 1,3-bisphosphoglycerate generatingsystem for 10 min before assaying. Because the NADH activity of fully acti-vated NAD(P)H-GAPDH is approximately one-third of its NADPH activity(Sparla et al., 2005), the activity of glycolytic GAPDH isoforms was estimatedby subtracting one-third of the fully activated NADPH activity from the totalNADH activity of the crude extract.

Detection of NO Production

For detection of NO production, 7-d-old Arabidopsis seedlings were in-cubated with the cell-permeable fluorescent probe DAF-FM diacetate (Alexis

Biochemicals), with a final concentration of 5 mM in the loading buffer solution(0.25 mM KCl, 1 mM CaCl2, and 5 mM MES-KOH, pH 5.7) for 15 min. Seedlingswere then washed three times with fresh buffer and examined by confocalmicroscope as previously reported (Zottini et al., 2007).

RNA Isolation and cDNA Synthesis

Seven-day-old Arabidopsis seedlings were harvested, frozen in liquidnitrogren, and stored at –80°C. The frozen samples were powdered in liquidnitrogen, and RNA was isolated with the TRIzol method. Then, the total RNAwas purified using an RNeasy kit, including DNase digestion (Qiagen).Complementary DNA (cDNA) was synthesized by ImProm-II Reverse Tran-scriptase (Promega) from 1 mg of purified RNA.

Quantitative Real-Time RT-PCR Primer

The quantitative real-time RT-PCR expression analysis of GAPC1 and GAPC2genes was performed using the following primers: GAPC1-F (GAGGT-GATGGGAGTTTGTAGAC) and GAPC1-R (TACGTCATCATCAACGGG) forthe expression analysis of the GAPC1 gene, GAPC2-F (TGCGCAGTCATGA-GAGTT) and GAPC2-R (AGTTGCCAGTTGGGTTTG) for the expression anal-ysis of the GAPC2 gene, and EF-1a-F (TGAGCACGCTCTTCTTGCTTTCA) andEF1a-R (GGTGGTGGCATCCATCTTGTTACA) for the expression analysis ofthe elongation factor1a (EF1a) gene.

RNA Analysis

Quantitative real-time RT-PCR using FAST SYBR Green I technology wasperformed on an ABI PRISM 7500 sequence detection system (Applied Bio-systems) using the following cycling conditions: initial denaturation at 95°Cfor 10 min, 40 cycles of 15 s at 95°C, and 1 min at 60°C, followed by melt-curvestage analysis to check for specificity of the amplification.

The reactions contained Power SYBR Green PCR Master Mix (AppliedBiosystems), 300 nM of gene-specific forward and reverse primers, and 1 mL ofthe diluted cDNA in a 20-mL reaction. The negative controls contained 1 mLRNase-free water instead of the cDNA. The primer efficiencies were calculatedas E = 10–1/slope on a standard curve generated using a 4- or 2-fold dilutionseries over at least five dilution points of cDNA. The expression analysis ofGAPC genes was performed by the Pfaffl method, using EF1a as the referencegene (Pfaffl, 2001; Remans et al., 2008).

Genetic Materials

The Arabidopsis GAPC1 coding sequence was amplified by PCR fromArabidopsis cDNA using the following primers where the NcoI sites wereintroduced: forward 59-CATGCCATGGCTGACAAGAAGATTAGG-39 andreverse 59-CATGCCATGGCGGAGGCCTTTGACATGTGGACGATCAA-39.The Arabidopsis GAPC1 promoter sequence (–633 bp to –1 bp) was amplified byPCR from Arabidopsis genomic DNA using the following primers where the EcoRIsite was introduced: forward 59-CATGGAATTCCGAGTTTTTGATAGGGACTTTT-GCT-39 and reverse 59-CATGGAATTCTGTAGAATCGAAAACGAGAGTTAGA-39.

DNA Constructs

For the expression of the GUS transcriptional reporter and the GAPC1-YFPtranslational reporter genes, the pGreen0029 (Hellens et al., 2000) binaryvector was used.

To isolate the GAPC1 promoter, we amplified by PCR 633 bp upstream ofthe GAPC1 ATG start codon. The amplicon was digested with EcoRI and li-gated into a modified pGreen0029 binary vector upstream of the GUS codingsequence fused with the nopaline synthase terminator (Valerio et al., 2011). Theobtained vector was named pGAPC1-GUS.

To obtain the pGreen0029-p35S::GAPC1-YFP binary vector, the GAPC1coding sequence was amplified by PCR using as a template the cDNAobtained by the retrotranscription of total RNA extracted by 4-week-oldArabidopsis leaves. The GAPC1 amplicon was digested with the NcoI en-zyme and ligated upstream of the YFP coding sequence in the pGreen-p35S::YFP plasmid (Valerio et al., 2011). The pGreen0029-pGAPC1::GAPC1-YFP bi-nary vector was constructed introducing the GAPC1 promoter sequence up-stream of the GAPC1-YFP coding sequence by replacing the 35S promoterusing the EcoRI restriction sites.


Vescovi et al.


http://www.jiffypot.com/

http://www.jiffypot.com/


To study the role of specific GAPC1 residues, several transgenic Arabidopsislines carrying the pGAPC1::GAPC1-YFP expression cassette mutated in theGAPC1 sequence were produced. The introduction of specific mutations in theGAPC1 sequence was carried out as described by Makarova et al. (2000) withsome modifications. The mutagenesis was performed by PCR reaction using 0.5mg of pGreen0029-pGAPC1::GAPC1-YFP binary vector as template in a reactionvolume of 25 mL containing 0.5 units Phusion High-Fidelity DNA Polymerase(Finnzymes), 0.2 mM deoxynucleotide triphosphates, and 0.2 mM of primer har-boring the specific mutation(s). To introduce the mutations C155S, C159S, andK230A and the double mutation C155S-C159S, the following primers were used:59-CATTGTCTCCAACGCTAGCTCCACCACTAACTGCCTTGCTC-39, 59-CG-CTAGCTGCACCACTAACTCCCTTGCTCCCCTTGCCAAGG-39, 59-CTCCAA-CGCTAGCTCCACCACTAACTCCCTTGCTCCCCTTG-39, and 59-GCTTCCA-GCTCTTAACGGAGCATTGACTGGAATGTCTTTCC-39, respectively. The PCRreaction was performed using the following cycling conditions: initial denaturationat 95°C for 3 min, 18 cycles of 15 s at 95°C, 1 min of annealing at 61°C, 5 min ofextension at 72°C, and a final step of 10 min at 72°C. Then, the PCR product wastreated withDpnI endonuclease for 2 h at 37°C. Finally, 2 mL of digested DNAwastransformed into Escherichia coli XL1 Blue supercompetent cells.

Agrobacterium tumefaciens Strains

For the use of pGreen-derived binary vectors, the A. tumefaciens GV3101-pSoup strain was used (Hellens et al., 2000). Binary vectors were introduced inA. tumefaciens GV3101 strain by freeze-thaw method. One microgram ofplasmid DNA was added to the competent cells, frozen in liquid nitrogen for5 min, and shocked at 37°C for 5 min. The bacterial culture was incubated at28°C for 3 h with gentle shaking in 1 mL yeast extract peptone medium (10 gL–1 bacto-tryptone, 10 g L–1 yeast [Saccharomyces cerevisiae] extract, and 5 g L–1

NaCl, pH 7.0) and then spread out on a yeast extract peptone agar plate con-taining the appropriate antibiotic selection (50 mg L–1 gentamycin, 50 mg L–1

rifampicin, 50 mg L–1 kanamycin, and 5 mg L–1 tetracycline).

Transgenic Plants

Transgenic Arabidopsis plants were generated by floral dip method(Clough and Bent, 1998) using transformed A. tumefaciens strain GV3101.Transformed seedlings were selected on medium supplemented with 50 mgmL–1 kanamycin. For each construct, different Arabidopsis independenttransgenic lines were isolated. None of the transgenic lines selected, with thedifferent constructs, showed phenotypic differences or abnormalities in ourstandard growth conditions.

Among 12 independently isolated lines transformed with the pGAPC1::GUSexpression cassette, 11 of them showed a similar expression pattern (SupplementalFig. S2A). Seventeen independent transgenic lines transformed with the pGAPC1::GAPC1-YFP expression cassette were isolated, and all of them showed a similarexpression pattern based on the YFP fluorescence analyses (data not shown). Ex-pression of GAPC1-YFP chimeric protein was confirmed by immunoblot analysiswith anti-GFP antibodies of protein extracts from three independent lines(Supplemental Fig. S2B). The immune detection was revealed by alkaline phos-phatase reaction.

Detection of GAPC1-YFP by Immunoblot Analysis

For the quantification of GAPC1-YFP induction in root tips, 500 roots of 7-d-oldseedlings for each condition, control or treated for 72 hwith 0.1mM cadmium,wereharvested and homogenized in 250 mL of protein extraction buffer (0.320 M Suc, 50mM Tris, pH 7.4, 1 mM EDTA, 10 mM DTT, 1 mM phenylmethanesulfonylfluoride,and 5% [w/v] polyvinylpyrrolidone). The homogenate was centrifuged at 2,000rpm for 2 min at 4°C to eliminate debris. The supernatant was centrifuged at10,200 rpm for 20 min at 4°C, and the supernatant was collected. Protein con-centration was determined by the Bradford (1976) method, using the Bio-Radprotein assay. Two and one-half micrograms of extracted proteins were sepa-rated by SDS-PAGE with precasted ProGel Tris-Gly Gradient Gels 4% (w/v) to12% (w/v) Tris/Gly Gels (anamed Elektrophorese), transferred to polyvinylidenefluoride 0.2-mmmembrane (Bio-Rad), and analyzed with antibodies raised againstGFP (Invitrogen). Equal loading of proteins was checked by staining an equallyloaded gel with Coomassie Blue.

The chemiluminescence analysis (Fig. 3D) was performed by using ahorseradish peroxidase-conjugated secondary antibody detected with the ECLWestern Blotting Detection System by Pierce (Thermo Fisher Scientific).

GUS Staining and GUS Activity Assay

Histochemical analyses of the transcriptional reporter GUS and measurementof GUS enzymatic activity were performed as described by Jefferson et al. (1987).

Samples for histochemical analysis of GUS activity were fixed by 30-minvacuum infiltration in the fixation solution (50 mM phosphate buffer, pH 7.2,1.5% [v/v] formaldehyde, and 0.5% [w/v] Triton X-100), and then the sampleswere washed three times with 50 mM phosphate buffer (pH 7.2) and vacuuminfiltrated for 15 min in the reaction mixture containing 50 mM phosphatebuffer (pH 7.2), 1 mM 5-bromo-4-chloro-3-indolyl-b-D-glucuronic acid, 0.5 mM

K3Fe(CN)6, 0.5 mM K4Fe(CN)6$3H2O, and 0.5% (w/v) Triton X-100. Then, thesamples were incubated at 37°C overnight or for 20 min for qualitative orsemiquantitative analyses, respectively. Samples were cleared by washingthem in a methanol:acetic acid solution (3:1, v/v).

For GUS enzymatic activity assay, 300 roots of 7-d-old seedlings treated upto 72 h were homogenized in 2 mL of GUS extraction buffer (50 mM NaH2PO4,pH 7.0, 0.1% [w/v] sodium lauryl sarcosine, 20% [v/v] methanol, 10 mM

b-mercaptoethanol, and 10 mM EDTA). The homogenate was centrifuged at400g for 2 min at 4°C to eliminate debris. The supernatant was centrifuged at14,000 rpm for 15 min at 4°C, and the supernatant was collected. Proteinconcentration was determined by the Bradford (1976) method, using the Bio-Rad protein assay.

An appropriate amount of sample was incubated in the reaction solution(GUS extraction buffer and 2 mM 4-methylumbelliferyl-b-D-glucuronide tri-hydrate) for 1 h at 37°C. Aliquots were collected and mixed with stop reactionbuffer (0.2 M Na2CO3) every 15 min starting from time zero. Fluorescence ofthe samples collected was measured with excitation at 365 nm and emission at455 nm on a Luminescence Spectrometer LS 55 (PerkinElmer).

Confocal Microscopy Analyses

Confocal microscopy analyses were performed using a Nikon PCM2000(Bio-Rad) and an inverted SP5II laser scanning confocal imaging system (Leica).For DAF-FM detection, excitation was at 488 nm and emission between 515and 530 nm. To extract quantitative data, pixel values were measured overroot regions, which were located manually on confocal images and calculatedusing ImageJ bundle software (http://rsb.info.nih.gov/ij/). For NO andGAPC1-YFP detection, 15 roots from three independent experiments wereobserved. Then, quantitative fluorescence values of root pictures were deter-mined by analyzing pixel intensity. Data were expressed as (fluorescence in-tensity of treated root)/(fluorescence intensity of control root) ratios.

roGFP2 Microscopy Analyses

For roGFP2 ratiometric analysis, the seedling roots were imaged in vivo by aNikon Ti-E inverted fluorescence microscope with a Nikon CFI Plan Apo VC203 Air 0.75-numerical aperture dry objective. Excitation light was producedby a Prior Lumen 200 PRO fluorescent lamp. The roots were excited at 470/40nm and then at 405/40 nm, and for both excitation wavelengths, roGFP2fluorescence was collected with a band-pass filter of 505 to 530 nm. Filters anddichroic mirrors were purchased from Chroma. The fluorescences emittedwere collected with an Hamamatsu Dual CCD Camera ORCA-D2. Exposuretime was 30 ms with a 232 CCD binning for the 470/40 nm excitation and 300ms with a 232 CCD binning for the 405/40 nm excitation. The images whereacquired every 5 s for a total time of 90 s. NIS-Elements (Nikon) was used asa platform to control microscope, illuminator, camera, and postacquisitionanalyses.

As regards time-course experiments, fluorescence intensity was determinedin the transition/elongation zone of the seedlings’ root tip. The backgroundwas subtracted, and the two emissions of the analyzed roots were used for theratio calculation and eventually normalized to the initial ratio.

Cloning, Expression, and Purification ofRecombinant GAPC1

The recombinant GAPC1 protein was expressed and produced as describedpreviously (Bedhomme et al., 2012).

The molecular mass and purity of the protein were analyzed by SDS-PAGEand Coomassie Blue staining after desalting on PD-10 columns equilibratedwith 50 mM potassium phosphate buffer (pH 7.5). The protein concentrationwas determined spectrophotometrically using a molar extinction coefficient at







http://rsb.info.nih.gov/ij/


280 nm of 40,910 M–1 cm–1 of the monomer. The resulting homogeneous pro-

tein was stored at –20°C.

Inactivation Treatments of Recombinant GAPC1

Before any treatments, recombinant GAPC1 was incubated with 10mMDTTfor 30 min at room temperature for reduction. Thereafter, DTT was removedby desalting on NAP-5 columns equilibrated with 50 mM BisTris buffer (pH7.0). Reduced GAPC1 (2.5 mM final concentration) was incubated in 50 mM BisTrisbuffer (pH 7.0) supplemented with 0.14 mM NAD+ in the presence of differentconcentrations of DEA-NONOate (diazeniumdiolate) diethylammonium salt orH2O2. At indicated time, an aliquot of the sample was withdrawn for the assay ofenzyme activity as described above. The reversibility of GAPC1 inactivation (10-min incubation with 0.5 mM DEA-NONOate or 0.1 mM H2O2) was assessed bymeasuring GAPC1 activity after incubation for 10 min in the presence of 20 mM

DTT. Reduced GAPC1 was also incubated in 50 mM BisTris buffer (pH 7.0)supplemented with 0.14 mM NAD+ in the presence of 0.1 mM cadmium. After 10-min incubation, an aliquot of the sample was withdrawn for the assay of enzymeactivity as described above. The reversibility of the treatment (10-min incubationwith 0.1 mM cadmium) was assessed by measuring GAPC1 activity after incu-bation for 10 min in the presence of 20 mM DTT.

Generation of Arabidopsis Transgenic Lines ExpressingTransgenes in gapc1 Mutant Background

The transgenic Arabidopsis gapc1 mutant plants stably transformed withpGAPC1::GAPC1-YFP and pGAPC1::GAPC1(C155S)-YFP were obtained bycrossing their mature flowers: ovary of pGAPC1::GAPC1-YFP and pGAPC1::GAPC1-C155S-YFP were pollinated by brushing them with stamens of fullymature flowers from Arabidopsis gapc1 mutant plants. Seeds obtained weresown, and seedlings were selected by using PCR analyses.

Statistical Analysis

Pictures shown in the figures are representative of at least 15 roots from threeindependent experiments, and values reported in the graph represent mean6 SD.The statistical significance of differences was evaluated by Student’s t test.

Supplemental Data

The following materials are available in the online version of this article.

Supplemental Figure S1. Evans blue staining of Arabidopsis roots exposedto cadmium.

Supplemental Figure S2. Validation of the pGAPC1::GUS and pGAPC1::GAPC1-YFP transgenic lines produced.

Supplemental Figure S3. Characterization of GAPC1 promoter activitypattern.

Supplemental Figure S4. Quantitative real-time RT-PCR expression anal-ysis of GAPC genes in Arabidopsis wild-type seedlings.

Supplemental Figure S5. Transient expression of mutated GAPC1-YFPchimeric proteins in Arabidopsis protoplasts.

Supplemental Figure S6. Wild-type and mutant GAPC1-YFP chimericproteins accumulate in the nucleus of cadmium-treated root cells in asimilar way.

ACKNOWLEDGMENTS

We thank Markus Schwarzländer (Institute of Crop Science and ResourceConservation, University of Bonn) for providing the roGFP2 Arabidopsisseeds and Michael Riefler (Institute of Biology/Applied Genetics, DahlemCentre of Plant Sciences, Free University of Berlin) for help with quantitativereal-time RT-PCR expression analysis. M.V., A.C., M.Z., and P.T. designedresearch; M.V., A.C., M.Z., and M.F. performed the experiments; M.V., A.C.,and M.Z. analyzed data; P.T. proposed the study; and P.T., A.C., and F.L.S.supervised the research and wrote the article.

Received January 24, 2013; accepted April 4, 2013; published April 8, 2013.

LITERATURE CITED

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, StevensonDK, Zimmerman J, Barajas P, Cheuk R, et al (2003) Genome-wide inser-tional mutagenesis of Arabidopsis thaliana. Science 301: 653–657

Anderson LE, Ringenberg MR, Carol AA (2004) Cytosolic glyceraldehyde-3-P dehydrogenase and the B subunit of the chloroplast enzyme arepresent in the pea leaf nucleus. Protoplasma 223: 33–43

Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidativestress, and signal transduction. Annu Rev Plant Biol 55: 373–399

Astier J, Rasul S, Koen E, Manzoor H, Besson-Bard A, Lamotte O, Jeandroz S,Durner J, Lindermayr C, Wendehenne D (2011) S-nitrosylation: an emerg-ing post-translational protein modification in plants. Plant Sci 181: 527–533

Bedhomme M, Adamo M, Marchand CH, Couturier J, Rouhier N,Lemaire SD, Zaffagnini M, Trost P (2012) Glutathionylation of cyto-solic glyceraldehyde-3-phosphate dehydrogenase from the model plantArabidopsis thaliana is reversed by both glutaredoxins and thioredoxinsin vitro. Biochem J 445: 337–347

Besson-Bard A, Gravot A, Richaud P, Auroy P, Duc C, Gaymard F,Taconnat L, Renou JP, Pugin A, Wendehenne D (2009) Nitric oxidecontributes to cadmium toxicity in Arabidopsis by promoting cadmiumaccumulation in roots and by up-regulating genes related to iron uptake.Plant Physiol 149: 1302–1315

Besson-Bard A, Pugin A, Wendehenne D (2008) New insights into nitricoxide signaling in plants. Annu Rev Plant Biol 59: 21–39

Biesecker G, Harris JI, Thierry JC, Walker JE, Wonacott AJ (1977) Se-quence and structure of D-glyceraldehyde 3-phosphate dehydrogenasefrom Bacillus stearothermophilus. Nature 266: 328–333

Bradford MM (1976) A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 72: 248–254

Chen IP, Haehnel U, Altschmied L, Schubert I, Puchta H (2003) Thetranscriptional response of Arabidopsis to genotoxic stress - a high-density colony array study (HDCA). Plant J 35: 771–786

Cho UH, Seo NH (2005) Oxidative stress in Arabidopsis thaliana exposed tocadmium is due to hydrogen peroxide accumulation. Plant Sci 168: 113–120

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agro-bacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743

Corpas FJ, Chaki M, Fernández-Ocaña A, Valderrama R, Palma JM,Carreras A, Begara-Morales JC, Airaki M, del Río LA, Barroso JB(2008) Metabolism of reactive nitrogen species in pea plants under abi-otic stress conditions. Plant Cell Physiol 49: 1711–1722

Correa-Aragunde N, Graziano M, Lamattina L (2004) Nitric oxide plays acentral role in determining lateral root development in tomato. Planta218: 900–905

Cuypers A, Smeets K, Ruytinx J, Opdenakker K, Keunen E, Remans T,Horemans N, Vanhoudt N, Van Sanden S, Van Belleghem F, et al(2011) The cellular redox state as a modulator in cadmium and copperresponses in Arabidopsis thaliana seedlings. J Plant Physiol 168: 309–316

De Michele R, Vurro E, Rigo C, Costa A, Elviri L, Di Valentin M, CareriM, Zottini M, Sanità di Toppi L, Lo Schiavo F (2009) Nitric oxide isinvolved in cadmium-induced programmed cell death in Arabidopsissuspension cultures. Plant Physiol 150: 217–228

Delledonne M, Zeier J, Marocco A, Lamb C (2001) Signal interactionsbetween nitric oxide and reactive oxygen intermediates in the planthypersensitive disease resistance response. Proc Natl Acad Sci USA 98:13454–13459

Dixon DP, Fordham-Skelton AP, Edwards R (2005) Redox regulation of asoybean tyrosine-specific protein phosphatase. Biochemistry 44: 7696–7703

Foreman J, Demidchik V, Bothwell JH, Mylona P, Miedema H, TorresMA, Linstead P, Costa S, Brownlee C, Jones JD, et al (2003) Reactiveoxygen species produced by NADPH oxidase regulate plant cell growth.Nature 422: 442–446

Fourrat L, Iddar A, Valverde F, Serrano A, Soukri A (2007) Effects of oxidativeand nitrosative stress on Tetrahymena pyriformis glyceraldehyde-3-phosphatedehydrogenase. J Eukaryot Microbiol 54: 338–346

Foyer CH, Noctor G (2005) Redox homeostasis and antioxidant signaling: ametabolic interface between stress perception and physiological re-sponses. Plant Cell 17: 1866–1875

Foyer CH, Noctor G (2009) Redox regulation in photosynthetic organisms:signaling, acclimation, and practical implications. Antioxid Redox Sig-nal 11: 861–905


Vescovi et al.









Foyer CH, Noctor G (2011) Ascorbate and glutathione: the heart of theredox hub. Plant Physiol 155: 2–18

Gaupels F, Kuruthukulangarakoola GT, Durner J (2011) Upstream anddownstream signals of nitric oxide in pathogen defence. Curr Opin PlantBiol 14: 707–714

Gechev TS, Minkov IN, Hille J (2005) Hydrogen peroxide-induced celldeath in Arabidopsis: transcriptional and mutant analysis reveals a roleof an oxoglutarate-dependent dioxygenase gene in the cell death pro-cess. IUBMB Life 57: 181–188

Griffith OW (1982) Mechanism of action, metabolism, and toxicity of bu-thionine sulfoximine and its higher homologs, potent inhibitors of glu-tathione synthesis. J Biol Chem 257: 13704–13712

Guo L, Devaiah SP, Narasimhan R, Pan X, Zhang Y, Zhang W, Wang X(2012) Cytosolic glyceraldehyde-3-phosphate dehydrogenases interactwith phospholipase Dd to transduce hydrogen peroxide signals in theArabidopsis response to stress. Plant Cell 24: 2200–2212

Gupta R, Luan S (2003) Redox control of protein tyrosine phosphatases andmitogen-activated protein kinases in plants. Plant Physiol 132: 1149–1152

Hancock J, Desikan R, Harrison J, Bright J, Hooley R, Neill S (2006) Doingthe unexpected: proteins involved in hydrogen peroxide perception. JExp Bot 57: 1711–1718

Hancock JT, Henson D, Nyirenda M, Desikan R, Harrison J, Lewis M,Hughes J, Neill SJ (2005) Proteomic identification of glyceraldehyde3-phosphate dehydrogenase as an inhibitory target of hydrogen perox-ide in Arabidopsis. Plant Physiol Biochem 43: 828–835

Hara MR, Agrawal N, Kim SF, Cascio MB, Fujimuro M, Ozeki Y,Takahashi M, Cheah JH, Tankou SK, Hester LD, et al (2005) S-Nitro-sylated GAPDH initiates apoptotic cell death by nuclear translocationfollowing Siah1 binding. Nat Cell Biol 7: 665–674

Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000)pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42: 819–832

Herbette S, Taconnat L, Hugouvieux V, Piette L, Magniette ML, Cuine S,Auroy P, Richaud P, Forestier C, Bourguignon J, et al (2006) Genome-wide transcriptome profiling of the early cadmium response of Arabi-dopsis roots and shoots. Biochimie 88: 1751–1765

Holtgrefe S, Gohlke J, Starmann J, Druce S, Klocke S, Altmann B,Wojtera J, Lindermayr C, Scheibe R (2008) Regulation of plant cytosolicglyceraldehyde 3-phosphate dehydrogenase isoforms by thiol modifi-cations. Physiol Plant 133: 211–228

Huberts DH, van der Klei IJ (2010) Moonlighting proteins: an intriguingmode of multitasking. Biochim Biophys Acta 1803: 520–525

Jaspers P, Kangasjärvi J (2010) Reactive oxygen species in abiotic stresssignaling. Physiol Plant 138: 405–413

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker inhigher plants. EMBO J 6: 3901–3907

Jeffery CJ (1999) Moonlighting proteins. Trends Biochem Sci 24: 8–11Jiang Y, Yang B, Harris NS, Deyholos MK (2007) Comparative proteomic

analysis of NaCl stress-responsive proteins in Arabidopsis roots. J ExpBot 58: 3591–3607

Kojima H, Nakatsubo N, Kikuchi K, Kawahara S, Kirino Y, Nagoshi H,Hirata Y, Nagano T (1998) Detection and imaging of nitric oxide withnovel fluorescent indicators: diaminofluoresceins. Anal Chem 70: 2446–2453

Kornberg MD, Sen N, Hara MR, Juluri KR, Nguyen JV, Snowman AM,Law L, Hester LD, Snyder SH (2010) GAPDH mediates nitrosylation ofnuclear proteins. Nat Cell Biol 12: 1094–1100

Kosová K, Vítámvás P, Prášil IT, Renaut J (2011) Plant proteome changesunder abiotic stress—contribution of proteomics studies to under-standing plant stress response. J Proteomics 74: 1301–1322

Kwak JM, Mori IC, Pei ZM, Leonhardt N, Torres MA, Dangl JL, BloomRE, Bodde S, Jones JD, Schroeder JI (2003) NADPH oxidase AtrbohDand AtrbohF genes function in ROS-dependent ABA signaling in Ara-bidopsis. EMBO J 22: 2623–2633

Lindermayr C, Saalbach G, Durner J (2005) Proteomic identification ofS-nitrosylated proteins in Arabidopsis. Plant Physiol 137: 921–930

Makarova O, Kamberov E, Margolis B (2000) Generation of deletion andpoint mutations with one primer in a single cloning step. Biotechniques29: 970–972

Mazzola JL, Sirover MA (2003) Subcellular alteration of glyceraldehyde-3-phosphate dehydrogenase in Alzheimer’s disease fibroblasts. J NeurosciRes 71: 279–285

Meyer AJ, Brach T, Marty L, Kreye S, Rouhier N, Jacquot JP, Hell R (2007)Redox-sensitive GFP in Arabidopsis thaliana is a quantitative biosensorfor the redox potential of the cellular glutathione redox buffer. Plant J 52:973–986

Meyer Y, Verdoucq L, Vignols F (1999) Plant thioredoxins and gluta-redoxins: identity and putative roles. Trends Plant Sci 4: 388–394

Møller IM, Jensen PE, Hansson A (2007) Oxidative modifications to cel-lular components in plants. Annu Rev Plant Biol 58: 459–481

Moore Bd (2004) Bifunctional and moonlighting enzymes: lighting the wayto regulatory control. Trends Plant Sci 9: 221–228

Muñoz-Bertomeu J, Cascales-Miñana B, Irles-Segura A, Mateu I, Nunes-NesiA, Fernie AR, Segura J, Ros R (2010) The plastidial glyceraldehyde-3-phosphate dehydrogenase is critical for viable pollen development in Arabi-dopsis. Plant Physiol 152: 1830–1841

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473–497

Noctor G, Queval G, Mhamdi A, Chaouch S, Foyer CH (2011) Glutathione.The Arabidopsis Book 9: e0142

Parani M, Rudrabhatla S, Myers R, Weirich H, Smith B, Leaman DW,Goldman SL (2004) Microarray analysis of nitric oxide responsivetranscripts in Arabidopsis. Plant Biotechnol J 2: 359–366

Pfaffl MW (2001) A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res 29: e45

Polverari A, Molesini B, Pezzotti M, Buonaurio R, Marte M, DelledonneM (2003) Nitric oxide-mediated transcriptional changes in Arabidopsisthaliana. Mol Plant Microbe Interact 16: 1094–1105

Poole LB, Karplus PA, Claiborne A (2004) Protein sulfenic acids in redoxsignaling. Annu Rev Pharmacol Toxicol 44: 325–347

Remans T, Smeets K, Opdenakker K, Mathijsen D, Vangronsveld J,Cuypers A (2008) Normalisation of real-time RT-PCR gene expressionmeasurements in Arabidopsis thaliana exposed to increased metal con-centrations. Planta 227: 1343–1349

Rius SP, Casati P, Iglesias AA, Gomez-Casati DF (2008) Characterizationof Arabidopsis lines deficient in GAPC-1, a cytosolic NAD-dependentglyceraldehyde-3-phosphate dehydrogenase. Plant Physiol 148: 1655–1667

Rodriguez MC, Petersen M, Mundy J (2010) Mitogen-activated proteinkinase signaling in plants. Annu Rev Plant Biol 61: 621–649

Romero-Puertas MC, Campostrini N, Mattè A, Righetti PG, Perazzolli M,Zolla L, Roepstorff P, Delledonne M (2008) Proteomic analysis ofS-nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitiveresponse. Proteomics 8: 1459–1469

Roth U, von Roepenack-Lahaye E, Clemens S (2006) Proteome changes inArabidopsis thaliana roots upon exposure to Cd2+. J Exp Bot 57: 4003–4013

Sanità di Toppi L, Gabbrielli R (1999) Response to cadmium in higherplants. Environ Exp Bot 41: 105–130

Sarry JE, Kuhn L, Ducruix C, Lafaye A, Junot C, Hugouvieux V, JourdainA, Bastien O, Fievet JB, Vailhen D, et al (2006) The early responses ofArabidopsis thaliana cells to cadmium exposure explored by protein andmetabolite profiling analyses. Proteomics 6: 2180–2198

Sirover MA (2011) On the functional diversity of glyceraldehyde-3-phosphate dehydrogenase: biochemical mechanisms and regulatorycontrol. Biochim Biophys Acta 1810: 741–751

Sparla F, Zaffagnini M, Wedel N, Scheibe R, Pupillo P, Trost P (2005)Regulation of photosynthetic GAPDH dissected by mutants. PlantPhysiol 138: 2210–2219

Tristan C, Shahani N, Sedlak TW, Sawa A (2011) The diverse functions ofGAPDH: views from different subcellular compartments. Cell Signal 23:317–323

Tsukagoshi H, Busch W, Benfey PN (2010) Transcriptional regulation ofROS controls transition from proliferation to differentiation in the root.Cell 143: 606–616

Urano K, Kurihara Y, Seki M, Shinozaki K (2010) ‘Omics’ analyses ofregulatory networks in plant abiotic stress responses. Curr Opin PlantBiol 13: 132–138

Valderrama R, Corpas FJ, Carreras A, Fernández-Ocaña A, Chaki M,Luque F, Gómez-Rodríguez MV, Colmenero-Varea P, Del Río LA,Barroso JB (2007) Nitrosative stress in plants. FEBS Lett 581: 453–461

Valerio C, Costa A, Marri L, Issakidis-Bourguet E, Pupillo P, Trost P,Sparla F (2011) Thioredoxin-regulated beta-amylase (BAM1) triggersdiurnal starch degradation in guard cells, and in mesophyll cells underosmotic stress. J Exp Bot 62: 545–555





Wang P, Du Y, Li Y, Ren D, Song CP (2010) Hydrogen peroxide-mediatedactivation of MAP kinase 6 modulates nitric oxide biosynthesis andsignal transduction in Arabidopsis. Plant Cell 22: 2981–2998

Wang X, Sirover MA, Anderson LE (1999) Pea chloroplast glyceraldehyde-3-phosphate dehydrogenase has uracil glycosylase activity. Arch Bio-chem Biophys 367: 348–353

Wawer I, Bucholc M, Astier J, Anielska-Mazur A, Dahan J, Kulik A,Wysłouch-Cieszynska A, Zareba-Kozioł M, Krzywinska E, Dadlez M,et al (2010) Regulation of Nicotiana tabacum osmotic stress-activatedprotein kinase and its cellular partner GAPDH by nitric oxide in re-sponse to salinity. Biochem J 429: 73–83

Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007)An “Electronic Fluorescent Pictograph” browser for exploring and an-alyzing large-scale biological data sets. PLoS ONE 2: e718

Yamaguchi-Shinozaki K, Shinozaki K (2006) Transcriptional regulatorynetworks in cellular responses and tolerance to dehydration and coldstresses. Annu Rev Plant Biol 57: 781–803

Yu M, Yun BW, Spoel SH, Loake GJ (2012) A sleigh ride through the SNO:regulation of plant immune function by protein S-nitrosylation. CurrOpin Plant Biol 15: 424–430

ZaffagniniM, BedhommeM, Lemaire SD, Trost P (2012a) The emerging roles ofprotein glutathionylation in chloroplasts. Plant Sci 185-186: 86–96

Zaffagnini M, Bedhomme M, Marchand CH, Morisse S, Trost P, LemaireSD (2012b) Redox regulation in photosynthetic organisms: focus onglutathionylation. Antioxid Redox Signal 16: 567–586

Zottini M, Costa A, De Michele R, Ruzzene M, Carimi F, Lo Schiavo F(2007) Salicylic acid activates nitric oxide synthesis in Arabidopsis. J ExpBot 58: 1397–1405


Vescovi et al.



nuclear accumulation of cytosolic glyceraldehyde-3-phosphate … · in this manner, glutathione,...

Documents