nucleic acids genetic material. nucleic acids are macromolecules there are two main types: dnarna

Nucleic AcidsNucleic Acids

Genetic MaterialGenetic Material

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.



Nucleic Acids are macromoleculesNucleic Acids are macromolecules

There are two main types:There are two main types:DNA DNA RNARNA

A Nucleotide is the building A Nucleotide is the building blockblock

It is made up of three partsIt is made up of three parts One part is a 5-carbon sugarOne part is a 5-carbon sugar

This sugar is also called ribose (in RNA)This sugar is also called ribose (in RNA)

Or Deoxy-ribose (In DNA) – Deoxyribose nucleic Or Deoxy-ribose (In DNA) – Deoxyribose nucleic acidacid

What is the difference between What is the difference between Ribose and Deoxy ribose?Ribose and Deoxy ribose?



Second part of a NucleotideSecond part of a Nucleotide

Nitrogen containing baseNitrogen containing base

There are four different bases:There are four different bases:

Adenine, Cytosine, Guanine, ThymineAdenine, Cytosine, Guanine, Thymine

3 D3 D



The Third Component of a The Third Component of a Nucleotide is a Phosphate Nucleotide is a Phosphate

GroupGroup



Put it all together now…Put it all together now…



DNA is supercoiledDNA is supercoiled

Think of a Twisted LadderThink of a Twisted Ladder





In HUMANs and most animals, DNA is In HUMANs and most animals, DNA is always double strandedalways double stranded

RNA is always Single strandedRNA is always Single stranded There are three kinds of RNA…which we will There are three kinds of RNA…which we will

talk about later.talk about later.

The Double HelixThe Double Helix

In 1953 James Watson and Francis Crick In 1953 James Watson and Francis Crick proposed a model for DNA that is still proposed a model for DNA that is still accepted todayaccepted today

Two ExperimentsTwo Experiments

This is an x ray of crystallized DNA taken This is an x ray of crystallized DNA taken by Rosalind Franklin - The Dark Lady of by Rosalind Franklin - The Dark Lady of DNADNA



Rosalind the CrystallographerRosalind the Crystallographer



It was Rosalind’s image that led It was Rosalind’s image that led Watson and Crick to the double Watson and Crick to the double

helix model of DNAhelix model of DNA

DNA is made up of two long chains.DNA is made up of two long chains.

Each with a sugar phosphate backboneEach with a sugar phosphate backbone

BUT: The two back-bone’s run in opposite BUT: The two back-bone’s run in opposite direction!direction!

Watson and Crick determined Watson and Crick determined that the four bases pair up very that the four bases pair up very

specificallyspecificallyDiscovered in 1953, won Nobel Prize in Discovered in 1953, won Nobel Prize in 19621962



Watson and Crick used discoveries Watson and Crick used discoveries of other researchers to build their of other researchers to build their

modelmodelExperiments done by Rosalind Franklin and Experiments done by Rosalind Franklin and

Maurice Wilkins suggested to Watson and Maurice Wilkins suggested to Watson and Crick, that DNA molecules had a Crick, that DNA molecules had a double double helix structurehelix structure

Watson and Crick came up with the Watson and Crick came up with the idea of Base Pairingidea of Base Pairing

Cytosine only pairs with Guanine and vice Cytosine only pairs with Guanine and vice versaversa

Thymine only pairs with Adenine and vice Thymine only pairs with Adenine and vice versaversa

The Genetic CodeThe Genetic Code

DNA forms the genes – units of genetic DNA forms the genes – units of genetic information that pass from parent to information that pass from parent to offspringoffspring

The human genome is ~ 3 billion base The human genome is ~ 3 billion base pairs long and has been completely pairs long and has been completely mapped mapped

DNA taken with a Scanning DNA taken with a Scanning Tunneling MicroscopeTunneling Microscope



A single DNA molecule - this is A single DNA molecule - this is a chromosomea chromosome



Unravelled vs condensedUnravelled vs condensed



DNA use as evidenceDNA use as evidence

Like a fingerprint DNA is unique to an Like a fingerprint DNA is unique to an individualindividual

Look your right or leftLook your right or left

The person sitting next to you is 99.9% The person sitting next to you is 99.9% similar to you similar to you

How can Forensic Scientists How can Forensic Scientists use DNA?use DNA?

In the human genome there are certain In the human genome there are certain places where there are known sequencesplaces where there are known sequences

We can use these parts as markers and We can use these parts as markers and we can use specific enzymes to cut the we can use specific enzymes to cut the DNA strand at this spotDNA strand at this spot

Restriction Enzymes are used Restriction Enzymes are used to cut DNAto cut DNA

These enzymes are produced by certain These enzymes are produced by certain types of virusestypes of viruses

What these enzymes do is recognize What these enzymes do is recognize specific patterns in a DNA sequence and specific patterns in a DNA sequence and cut the DNA like a pair of scissorscut the DNA like a pair of scissors

Viruses are an enemy of bacteria and people, Viruses are an enemy of bacteria and people, and they can infect us by cutting our DNA, and and they can infect us by cutting our DNA, and inserting THEIR DNA!!inserting THEIR DNA!!

Once their DNA is in we become Virus factoriesOnce their DNA is in we become Virus factories

They have hijacked our cells, and they force us They have hijacked our cells, and they force us to produce more of them…this leads to us being to produce more of them…this leads to us being sick and spreading them.sick and spreading them.

Restriction Enzymes Cut DNA Restriction Enzymes Cut DNA at a palindromeat a palindrome

What is a palindrome ?What is a palindrome ?

A sequence that reads the same A sequence that reads the same backwards as forwards…Do you see the backwards as forwards…Do you see the palindrome in the below sequence?palindrome in the below sequence?

GTAGAATTCATTCACGCAGTAGAATTCATTCACGCA

CATCTTTAAGTAATGCGT CATCTTTAAGTAATGCGT

Now do you see it?Now do you see it?

GTA G-AATTC ATTCACGCAGTA G-AATTC ATTCACGCA

CAT CTTTAA-G TAATGCGTCAT CTTTAA-G TAATGCGT

This is the region where a restriction This is the region where a restriction enzyme would recognize and CUT or enzyme would recognize and CUT or CLEAVE the DNACLEAVE the DNA

The actual name of this enzyme is Eco RIThe actual name of this enzyme is Eco RI

Restriction Fragment Length Restriction Fragment Length PolymorphismPolymorphism

This is the ability to cut DNA at a specific code This is the ability to cut DNA at a specific code using Restriction Enzymesusing Restriction Enzymes

These regions that scientists can cut, will These regions that scientists can cut, will result in varying segment lengths for result in varying segment lengths for different people,different people,

The Digested DNA will then be run using Gel The Digested DNA will then be run using Gel Electrophoresis… This is how we can Electrophoresis… This is how we can visualize the different DNA segment lengthsvisualize the different DNA segment lengths

A molecule of DNA has an A molecule of DNA has an extremely negative chargeextremely negative charge

So we can use this to run an electric So we can use this to run an electric charge through an electophoresis cell--- charge through an electophoresis cell--- see belowsee below

As the electrical charge occurs we have a As the electrical charge occurs we have a current of positive ions flowing through our current of positive ions flowing through our gel.gel.

The DNA will migrate down the gel toward The DNA will migrate down the gel toward the positive end of the cellthe positive end of the cell

The negative DNA is attracted to the The negative DNA is attracted to the Positive end of the electrophoresis cellPositive end of the electrophoresis cell

Do you see the different band Do you see the different band patterns? They are all different patterns? They are all different

size DNA piecessize DNA pieces



After the DNA has been chopped up by After the DNA has been chopped up by enzymes, the shorter pieces will move enzymes, the shorter pieces will move down the gel faster than the longer piecesdown the gel faster than the longer pieces

Is it possible that two different people Is it possible that two different people would have the same lengths strands after would have the same lengths strands after the DNA samples have been cut?the DNA samples have been cut?

Yes!!! - So this method would be a good Yes!!! - So this method would be a good way to eliminate suspects.way to eliminate suspects.This method alone could not incriminate a This method alone could not incriminate a suspectsuspect

In a criminal case where DNA In a criminal case where DNA evidence is available an evidence is available an

electrophoresis would be one of electrophoresis would be one of the first techniques usedthe first techniques used

In actuality Forensic scientists don’t use In actuality Forensic scientists don’t use electroporesis anymore…but it was one of electroporesis anymore…but it was one of the original DNA fingerprinting techniquesthe original DNA fingerprinting techniques

Why do you think this is?Why do you think this is?

Because we the process is relatively Because we the process is relatively inexpensive and quick to do, and suspects inexpensive and quick to do, and suspects whose bands were very different could be whose bands were very different could be immediately eliminatedimmediately eliminated

Suspects who had similar banding Suspects who had similar banding patterns would have to be further analyzed patterns would have to be further analyzed …Their DNA would probably be …Their DNA would probably be sequenced to determine if the sequences sequenced to determine if the sequences matchedmatched

DNA can be sequenced using DNA can be sequenced using PCRPCR

The Polymerase Chain ReactionThe Polymerase Chain Reaction

nucleic acids genetic material. nucleic acids are macromolecules there are two main types: dnarna

Documents

dna sequence

fingerprint dna

dna molecules

dna strand

mapped dna

dna rnaa nucleotide

x ray of crystallized

francis crick