Vol. 175, No. 9

Nucleotide Sequence Analysis of the Termini andChromosomal Locus Involved in Site-Specific Integration

of the Streptococcal Conjugative Transposon Tn5252MOSES N. VIJAYAKUMAR* AND SAHLU AYALEW

Department ofMicrobiology and Molecular Genetics, Oklahoma State University,Stillwater, Oklahoma 74078

Received 6 November 1992/Accepted 4 March 1993

The 47-kb, broad-host-range, streptococcal conjugative transposon Tn5252 is capable of site-specificintegration into the pneumococcal chromosome. We present the nucleotide sequence of the terminal regions ofthe transposon and its target site in the pneumococcal genome. No inverted repeats were found at the terminiof the transposon. A 72-bp region of the target was present on either side following the insertion of Tn5252 andappeared to serve as a signal for its integration and excision. The data suggest that the left copy of the 72-bpsegment was a part of the conjugative element, the crossover point of integration was nonrandom within thisregion, and the mechanism of insertion could resemble that of the site-specific temperate phages.

Sudden emergence of multiple-antibiotic resistance inclinical streptococci in the 1970s (6, 8, 15, 16, 21) has beenchiefly due to a highly promiscuous class of mobile elementstermed conjugative transposons (4, 12, 17, 22, 29, 31). Thesemediate self-transfer by a DNase-resistant process requiringcell-to-cell contact (8, 16, 30). Several streptococcal conju-gative transposons have been identified so far, and these canbe loosely classified into two groups based on size, onetypified by elements such as the 16-kb Tn916 (16) and 25-kbTnJS45 (12) and the other having elements exceeding 50 kb,such as Tn3701 (4), Tn3951 (22), and TnS253 [formerly calledthe fl(cat tet) element] (34). TnS253, originally identified as aheterologous insertion in the chromosome of Streptococcuspneumoniae BM6001 (8, 26), is a 65.5-kb self-transmissibleelement that encodes resistances to chloramphenicol andtetracycline (29).We had previously cloned the entire element in fragments

in Escherichia coli and generated its restriction endonucle-ase map (34, 35). The transposition behavior of a DNAsegment carrying Tetracycline resistance when separatedfrom the context of surrounding DNA led to the identifica-tion of TnS253 as a composite structure of two independentconjugative transposons with an 18-kb element, TnS251(Tcr), inserted in the central region of another, TnS252 (47kb, Cmr) (2). Similarly, Bouguenec et al., found that Tn3701in Streptococcus pyogenes was also a composite structurecontaining a transposon, Tn3703 (Tcr), in its central region(5). TnS251, which is homologous to Tn3703, has beenshown to be structurally and functionally very similar toTn916 and TnlS45 (2, 5). The structure and mechanism oftransposition of Tn916 (9, 17, 18, 27, 28) and TnJS45 (13, 25)have been the subject of investigation by several laborato-ries.On the other hand, our knowledge of the mechanistic and

molecular details of the larger conjugative transposons isvery limited. In spite of apparent functional similaritiesbetween the two classes of conjugative transposons, crucialdifferences were also observed, in particular with referenceto their target specificity (34). While the smaller elements

* Corresponding author.

insert at more than one genomic site (2, 11, 13), the largerelements such as TnS252 seemed to prefer to insert at aunique site in pneumococci (2, 34). Our previous studies ledto the identification of the junction regions of the transposonand cloning of its preferred target site in the pneumococcalchromosome (34). To gain insight into the nature of theintegration of TnS252, we performed DNA sequence analy-sis of the target and terminal regions of the transposon andpresent the results in this report. The data support the notionthat the larger conjugative transposons are very differentfrom the smaller Tn916 class of elements and probablybelong to a distinct class of mobile elements that carrysite-specific integration-excision functions.

MATERIALS AND METHODS

Bacterial strains, media, transformation, and conjugation.DP1322 (TnS253) was derived (29) from the Rxl wild-typestrain of pneumococcus by transformation to Cmr Tcr withchromosomal DNA from the clinical isolate S. pneumoniaeBM6001 (8). DP1324 is DP1322 carrying the str-1 chromo-somal mutation conferring resistance to streptomycin.SP1000 (TnS252) was created from DP1324 by deleting theTnS251 from the middle of TnS253 (2). The remainingsequences of the transposon constitute TnS252. Streptococ-cus gordonii (formerly Streptococcus sanguis V685, a Chal-lis derivative), Enterococcusfaecalis UV202, Streptococcusagalactiae ATCC 12386, and S. pyogenes ATCC 21547 wereused in conjugation experiments. Growth of streptococcalcultures, conjugation, the competence regimen, and platingtechniques have been described elsewhere (29, 30). Recom-binant plasmids were generated in recombination-deficientE. coli JM109 by transformation by the method of Hanahan(20).DNA procedures. DeepVent DNA polymerase used in

polymerase chain reactions (PCRs) was purchased fromNew England Biolabs. DNA restriction and modificationenzymes were used according to the recommendations of thesuppliers. Chromosomal DNAs from streptococci were iso-lated as described previously (23). Plasmid DNA from E. coliwas prepared by standard methods. DNA hybridizationswere done by the method of Southern (32) with a Gene-

2713

JOURNAL OF BACTERIOLOGY, May 1993, P. 2713-27190021-9193/93/092713-07$02.00/0Copyright © 1993, American Society for Microbiology

2714 VIJAYAKUMAR AND AYALEW

Screen Plus membrane (DuPont, New England Nuclear) assupport.DNA sequencing and computer analysis of DNA sequences.

Denatured double-stranded plasmid DNA templates wereprepared according to the method of Chen and Seeburg (10).After the template (1 pug) was dissolved in water and an-nealed with primer (0.5 pmol), labeling with [ot-35S]ATP(New England Nuclear) and chain termination with dide-oxynucleotides were carried out with Sequenase version 2.0as recommended by the supplier (U.S. Biochemical Corp.).Separation of the DNA fragments was done by electrophore-sis through vertical 5% polyacrylamide gels (40 cm tall, 20 cmwide, and 0.04 cm thick) containing 8 M urea. The gels werefixed in 10% acetic acid and dried on the plates at 650Covernight. The bands were visualized by autoradiography atambient temperature on Kodak X-Omat AR film. After man-ual collection of primary sequence data, sequence assem-bly and analysis were performed by using HIBIO DNASIS(Hitachi Software Engineering Co.).The plasmid subclones used for sequencing are shown in

Fig. 2. Sequence readings from both strands were obtainedexcept at the left side of Sall site that flanked the target andleft terminus of the transposon. Apart from the universallacZ primers, synthetic oligonucleotide primers internal toDNA segments under investigation were used, and thesewere made at the University of Oklahoma Health SciencesCenter.PCR. PCR was performed in a Coy Tempcycler model 60

with genomic DNAs from the streptococcal species understudy as templates. A 100-ptl PCR mixture contained 10 to100 ng of template DNA in a lx concentration of Ventreaction buffer supplied by the manufacturer, each primer at0.2 riM, each nucleotide at 0.2 mM, and 0.5 U of DeepVentDNA polymerase. The reaction mixture was covered with100 pul of sterile mineral oil to avoid evaporation. A total of30 cycles of amplification consisting of a 2.0-min denatur-ation period at 940C, a 1.0-min annealing at 350C, and a 50-sextension at 720C were performed. The primers specific forthe ends of the transposon used in the PCR experimentswere TGTL (5' CATTGAATAGTAGCCAT 3'), TGTR (5' TAGTAAAATAAAATAGG 3'), L2R (5' TGACAAATTGTITAAGC 3'), and R1F (5' TCAATAAATAAAGAATC 3').

Nucleotide sequence accession number. The nucleotidesequences of the left and right junction regions of Tn5252and its target region in pneumococcus presented here havebeen deposited with GenBank under accession numbersL07750, L07751, and L07752, respectively.

RESULTS

Site-specific integration of TnS252. As mentioned earlier,Tn5252 was originally found as a part of Tn5253 in thechromosome of S. pneumoniae BM6001 and was transferredto the laboratory strain Rxl by transformation (29). Analysisof the chromosomal DNAs of transconjugants followingsuccessive transfers of the element via conjugation betweenpneumococcal strains showed that the conjugative transpo-son nearly always inserted at a unique site in the chromo-some (34). Hence, it was assumed that a specific region inthe pneumococcal chromosome served as an att site for thiselement. However, a recent report (33) based on the transferproperties of another conjugative transposon, Tn925, raisedthe possibility that the conjugal mating involves some type ofcell fusion between the donors and recipients, with theimplication that transfer of the element, at least within thesame species, could result from homologous recombination.

Also, it has been shown that the transfer of Tn916 inLactococcus lactis was due to a fertility factor present in thedonors and that the apparent site specificity for insertion ofthe conjugative transposon was the result of homologousrecombination between the genomes (7). Any of these pos-sibilities could explain our observations regarding the site-specific insertion of Tn52S2.However, we expected that such transfer of the conjuga-

tive transposon solely based on homology could not takeplace between distantly related species. Also, on retransferof the element into pneumococci from a heterologous sourcevia conjugation, the transposon cannot be expected to insertat the same chromosomal site in all transconjugants. Tosettle this question, Tn5252 in the pneumococcal strainSP1000 was mobilized by filter mating into four streptococ-cal species. In previous experiments, using a 2-kb EcoRIfragment carrying the target region of Tn5252 in pneumo-cocci (34) as a probe, we did not detect any hybridization tothe chromosomes of streptococci such as S. gordonii, S.agalactiae, and E. faecalis. Under these hybridization con-ditions of high stringency, the genomic DNA of S. pyogeneshybridized only weakly whereas the probe strongly reactedwith the pneumococcal DNA (1). However, the elementtransferred to all four species with efficiencies ranging from10-5 to 10-7 per donor. Genomic DNAs from four Cmrtransconjugants of S. gordonii were used in blot hybridiza-tion experiments to check whether both ends of the elementwere present in the transconjugants. To avoid the possibilityof isolating siblings, each of the four transconjugants testedwas chosen from independent mating experiments. Apartfrom the presence of genetic markers used in the initialselection process, each transconjugant also displayed hemo-lytic and biochemical characteristics of S. gordonii.

Total genomic DNAs were isolated from the transcon-jugants, digested with EcoRI, and probed with the plasmidspVJ414 and pVJ407, carrying the left and right junctionregions of TnS252 from SP1000, respectively (Fig. 1). Asexpected (34), both of the probes reacted with a 2.1-kbEcoRI fragment representing the target region in Rxl (Fig.1A, lanes b; Fig. 1B, lane o). Among the two additionalbands seen in Fig. 1B, lane o, the 3.8-kb fragment was due tothe presence of an EcoRI site within the right junction probe(see Fig. 2). The other was due to a region in the pneumo-coccal chromosome that is homologous to the transposonpart of the probe (34). The 3.57-kb EcoRI fragment repre-senting the left junction region and the 3.3-kb EcoRI frag-ment carrying the right junction site in SP1000 also hybrid-ized with their corresponding probes. Both probes alsoreacted with the chromosomal DNAs from all of thetransconjugants of S. gordonii, indicating the transfer of theentire element. Curiously, each probe was seen to hybridizeto a common fragment of identical size among all thetransconjugants, suggesting that even in S. gordonii thetransposon preferred to insert at a unique spot.One of the Cmr transconjugants of S. gordonii was used as

a donor in reverse matings with the pneumococcal wild-typestrain, Rxl. The chromosomal DNAs from the pneumococ-cal back transconjugants were isolated and analyzed by blothybridization using the left and right junctions as probes. Asthe results in Fig. 1 show, in all cases the probes reacted withfragments of sizes similar to those of the parental strain,SP1000, indicating that TnS252 inserted at the same site asbefore. This seemed to suggest site-specific recombinationas the targeting mechanism.

Nucleotide sequence analysis of the junction and targetregions of TnS252. In a previous paper (34), we reported that

J. BACTERIOL.

SITE-SPECIFIC INTEGRATION OF TRANSPOSON Tn5252 2715

a b c d e f gh i jk I m bAkb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~I

A. Rxl target

Pst I EcoR II I

pVJ421

-a pVJ425

B. Left JunctIon of TnS252

.Stl.

Hi i

pi) Aq'0 00 ant57 0 0 0 0008 S3- -_ :; A;f:l slA,-.XtS Aid,4 U

2.1- * FRESHas bAt>;)7

..:0000

t Slid; d:>

SSS

;:E of^+ C:g w f And i-04 in

::

D a bed e f a |

40-pVJ433-

.-pVJ428

C. Right junctionof Tn5252

r i i k If mt n

kbEl

-3.943-

3w3-

FIG. 1. Autoradiograms showing site-specific insertion ofTnS252. S. pneumoniae SP1000 carrying TnS252 was mated on

filters with S. gordondi recipients. Cmr transconjugants were se-

lected on agar plates contaning optochin and chloramphenicol. Oneof the S. gordonii (TnS252) transconjugants was used as a donor inthe reverse conjugal matings with Rx1 recipients. The chromosomalDNAs from the donors, recipients, and transconjugants resultingfrom several matings were isolated, digested with EcoRI, separatedon a 0.8% agarose gel, blotted to a nylon membrane, and probedwith 32P-labeled pVJ414 carrying the 3.57-kb EcoRI left junctionfragment (carrying approximately 1.7 kb of pneumococcal chromo-somal DNA and 1.9 kb of transposon DNA) (A) and pVJ407 carryingthe 2.75-kb KpnI right junction fragment (carrying 1 kb of host DNAand 1.75 kb of transposon DNA) (B) from SP1000 (see Fig. 2 for therestriction maps of these regions). Lanes: a, SP1000; c, S. gordonii;d to g, Cmr transconjugants of S. gordonii; h to m, S. pneumoniaeCmr transconjugants resulting from mating with S. gordonii(TnS252). (A) Lanes b, Rx1. (B) Lanes b and n, molecular weightstandards; lane o, Rx1. Representative sizes are indicated.

the insertion site of the transposon in the pneumococcalchromosome was within a 5-kb PstI fragment. Further, theprecise insertion site was narrowed down to a 0.44-kb regionflanked by Sall and EcoRI sites. The 5-kb PstI fragment iscarried on the plasmid pVJ183 (34). The 0.44-kb SalI-EcoRIfragment containing the actual insertion site was isolatedfrom pVJ183 and subcloned into SalI-EcoRI-digested pBlue-

I kb I I I I I

FIG. 2. Maps of the target and terminal regions of Tn5252 in S.pneumoniae SP1000 and sequencing strategy. Relevant restrictionendonuclease sites are indicated. In the upper diagram in eachpanel, thin lines indicate the chromosomal DNA and thick linesindicate transposon DNA. The 5-kb target region flanked by PstIsites (A), the 3.57-kb left junction region flanked by EcoRI sites (B),and the 2.75-kb right junction region flanked by KinI sites (C) werecloned to form recombinant plasmids, pVJ183, pVJ414, and pVJ407,respectively. The lower part of each panel shows passenger DNAscarried by the further plasmid subclones created for sequencing. Foreach primer used, the extent of the sequence obtained is indicatedby an arrow. Initially, a nested set of deletion derivatives of pVJ428and pVJ419 obtained following exonuclease III and S1 treatmentswas used to generate the primary sequence data. With this informa-tion, sequence-specific primers were designed for further sequenc-ing reactions to check and fill gaps in the primary data.

Script vectors KS+ and SK+ to create the plasmids pVJ425and pVJ426, respectively. To obtain the DNA sequence ofthe termini of the transposon as it is in SP1000 (Rxl carryingTnS252), several DNA fragments covering both the left andright regions were recovered from our collection of recom-binant plasmids (34) carrying the transposon DNA andsubcloned into pBlueScript or pUC plasmids. The sequenc-ing strategy is presented in Fig. 2.The termini of the transposon were localized by compar-

ison with the sequence of the target region. DNA sequenceanalysis of the passenger segments in the plasmids carryingthe junction regions showed that a 72-bp segment of thetarget region, attB, was present at both ends of the transpo-son (Fig. 3). The copies flanking the element, attL and attR,were 73 and 74 bp long, respectively. Alignment of the three

Sal I EcoR I Kpn II

Pst

EcoR I Sail XbI Xbal EcoRII aI I I

KpnlI Xba I Xba EcoR Kpn

lw pVJ407-

pVJ419

-~pVJ432

VOL. 175, 1993

I

2716 VIJAYAKUMAR AND AYALEW

A0 -40 . -20 . 1 10AATTTTAAATTTCCTGCACCTGTCGACGCGCTTTAGACATGTGACCAGGAAACCATTGAA

Sail ------>20 . 40 . 60 0

TAGTAGCCATTGAGTTTTTTCCTTTCGTAGCAAGGATTTAGATCCCCTATTTTATTTTAC

so . 100 . 110 0

ThTAGTTTGAACATAGAGAGTTTTCAAATGAATGATGTCAAACAGTTCTTGTTTTATGAC

B0 -40 . -20 . 1AATT!TTAAATTCTCCTGCACTTGTCGACGCGCTTTAGACATGTGACCAGGAACCATTGAA

SalT ------->

20 . 40 . 60 0

TAGTAGCCATTGAGTTTTTTTCCTTTCGTAGCAAGGGTTTAGAGCCCCTATTTTATTTTA<-------

80 . 100 1120CTATTGTCTAAACACCAAGCGAACACCAAAACTACCATGCAATGG1AAAAACCTCTGATTT

140 . 160 . 2.80GATTCTCACTTGATTTCACAATCTTTATATCAAACTGTGGGTGGTATTTGACkATATCTT

200 . 220 . 240 0

TTTTGATTTTTAATAGTAAATTCGAAATAATATTTTAGGTGAGTAACGTGGACTAAGATG

260TAACAAGTCTTTGAACTCATCGA

C* -.190 . -170 . -150TTCTCAGAATAAAACGAAGAATGTGAATCTTCGACATATAATATTGACACAAACTCAACA

* -.130 * - 110 . -90CCAAAAAGTTTTATTGATGATTATTGCACATATAACAATGTGAATAATTAAAATCTAAAC

* -70 . -50 . -30CAATAAAAGTCCTTGAATTTCAAGGAATTTAAGTATTTATTCTACTTCACAATGTTTTAT

0 -10 2. 20 40TATTTTAAATCTTCTAGACCAACCATTGAATAGTAGCCATTGAGTTTTTTTCCTTCTCGT

XbaI ------- >60 . 80 . 100

AGCAAGGATTTAGATCCCCTATTTTATTTTACTATAGTTTGAACATAGAGAGTTTTCAAA110 1220

TGAATGATGTCCAAATAGTTCTTGTTTTTATGACFIG. 3. Nucleotide sequences of the junction and target regions of TnS252 in pneumococci. (A) The target region in Rx1; (B) left junction

region; (C) right junction region. The nucleotide sequences begin on the 5' end. The region common to all three is underlined. The numberingof sequences is based on the first nucleotide of the att sites common to all three regions, designated as position 1. An 8-bp imperfect invertedrepeat found within each att site is indicated by arrows drawn below the nucleotides in the repeat.

sites showed that, besides being slightly larger, the flankingsites also contained minor sequence differences, particularlyin the middle (Fig. 4). The overall GC content of the attsegments was about 35%. The left and right junction regionsshowed little homology with the target region outside the attsegments.The GC contents of the first 200 bases of the left and right

termini of the transposon were 32 and 25%, respectively.Directly repeated sequences, 8 to 9 bases long, were presentin both of the regions. Interestingly, no inverted repeatswere detectable within the 200 nucleotides of the termini of

TnS252. Also, no significant homology between the terminiof TnS252 and Tn916 was detected.The 72-bp left repeat is a part of the transposon. The

presence of 72-bp direct repeats flanking TnS252 in SP1000seemed to suggest the duplication of this target DNA as aresult of transposon integration. If this is the case, nucle-otide sequences of attL and attR regions flanking the trans-poson in pneumococci would be expected to be differentfrom the ones flanking the element when present in aheterologous recipient such as S. gordonii, as there was nodetectable homology between the target sites of the two

* *ant I AACCATTGMTAGTAGCCATTGAGTTTTTT-CCTT-TCGTAGCAAGGGTTTAGAGCCCCTATTTTATTTTACTAalt B AACCATTGAATAGTAGCCATTGAGTTTTTTMCCTTCTCGTAGCAAGGATTTAGATCCCCTATTTTATTTTACTAantR MCCATTGAATAGTAGCCATTGAGTTerisksTnCCTTCTCGTAGCs.GGATTTAGATCCCCTATTTTATTTTACTA

FIG. 4. Comparison of attL and attR sites to attB. Asterisks denote base differences. Dots within the sequence show missing bases.

J. BACTERIOL.

SITE-SPECIFIC INTEGRATION OF TRANSPOSON TnS252 2717

1 2 3 4 5 6 7 8

n nnnnnnna b a ba ba bha ba ba ba bm

kb

4.3-

0.8-

FIG. 5. Agarose gel electrophoresis of PCR amplification prod-ucts. Ten microliters of each mixture after the completion of thereaction was mixed with sample buffer, loaded onto a 0.8% agarose

gel, and electrophoresed. Lanes: 1, Rx1; 2, SP1000; 3, S.gordonii::TnS252; 4, S. gordonii; 5 to 8, various pneumococcal Cmrtransconjugants using S. gordonii donors; m, molecular weightmarkers; a, primers L2R and TGTL, specific for the left end; b,primers R1F and TGTR, specific for the right end (see Materials andMethods). Nominal sizes are indicated.

organisms. On the other hand, the element should be flankedby whatever sequences that serve as the integration signal inthe new host. It also seemed possible that a copy of theobserved direct repeats formed one end of the element. If so,

this copy should be conserved at one end of the transposonin any host and the attB of that organism would be expectedto be present at the other terminus.To distinguish between these possibilities, genomic DNAs

from SP1000 donors and S. gordonii transconjugants were

subjected to PCRs to amplify the end segments of theelement. DNA sequence data extending approximately 2 kbfrom either end of the transposon (not shown) facilitateddesigning appropriate primers to extend the sequences to-

wards the inside of either end of the element. The oligonu-cleotide primers TGTL and L2R were used to amplify theleft end. TGTL contained the first 17 bases of attL, and L2Rwas a 17-base complementary sequence present about 0.8 kbfrom TGTL at the left end within the transposon. To amplifythe right end, TGTR, the complementary sequence of thelast 17 bases of attR, was used as a primer in combinationwith R1F, a 17-base nucleotide sequence present approxi-mately 1.1 kb from TGTR inside the element. These were

used to prime sequences towards the inside of the transpo-son.As expected, in SP1000, both ends were amplified, yield-

ing a 0.8-kb fragment for the left end and a 1.1-kb fragmentfor the right end (Fig. 5). However, when the chromosomalDNA from the S. gordonii transconjugants was used in PCR,only the left end was amplified. Likewise, TnS252 transcon-jugants of S. pyogenes, S. agalactiae, and E. faecalis were

also tested for the presence of the 72-bp segment by PCR.Again, in all cases, only the left end was amplified, indicatingthat in these streptococcal species the right end was notflanked by, if it was flanked at all, an exact copy of the 72-bpsequence (data not shown). Further, using the chromosomalDNAs from the pneumococcal back transconjugants (which

arose from matings with S. gordonii::TnS252 donors), weobserved the amplification of both ends, confirming onceagain the site-specific insertion of TnS252 in pneumococci.

DISCUSSION

While the work presented here does not address thequestion of cell fusion during conjugal mating, a role forextensive homologous recombination as a potential reasonfor the site-specific integration of TnS252 in pneumococcicould be ruled out. In S. gordonii also, a unique site seemedto be the preferred site of insertion, as all four transcon-jugants tested displayed identical restriction profiles. Theseresults implied a site-specific integration function carried bythe element itself. Further, it appeared that the signal fortarget specificity was provided by the 72 bp in Rx1. Theintroduction of the chromosome-borne transposon into Rx1via transformation using the lysate of the clinical isolateBM6001 might have been the reason for the apparent se-quence differences between attB, attL, and attR sites inpneumococci. Minor differences notwithstanding, the datapresented clearly suggest a role for this or similar sequencesin the site-specific integration and excision of the element.Even though no homology was detectable between Rx1 andS. gordonii target sites by Southern hybridizations, wecannot rule out the possibility of a consensus sequenceserving as a recognition signal. To clarify the situation, oneneeds to obtain the DNA sequence of the preferred targetsite from S. gordonii for comparative purposes. Also, aninvestigation of the fate of the transposon in recipientsdevoid of the normal att site should yield interesting infor-mation. However, for reasons not clear at present, repeatedattempts to delete the attB site in the Rxl strain of pneumo-coccus have not been successful so far.

Amplification of only the left end of Tn5252 in transcon-jugants of S. gordonii and other streptococci in PCR exper-iments using primers specific for each terminus showed thatattR in these was not homologous to the one in pneumo-cocci. Conversely, the left copy of the repeat must be a partof the transposon, as this was carried to all the new hosts.The presence of this copy of the direct repeat at the left endin the new hosts also implied that whatever sequence servedas a signal for insertion in S. gordonii must be at the rightend. If this is the case, the crossover point of recombinationshould be nonrandom and lie at the left side of the last 17bases of the att site. If the crossover point were randomwithin the att site of the new hosts, the right end of thepneumococcal att sequence (represented by the primersequence TGTR) would be expected to be present in at leastsome of the transconjugants. However, in none of the 10transconjugants representing all four streptococcal speciesused in this work was amplification of the right end ob-served, whereas in every case the left end was consistentlyamplified yielding a product of the expected size.The origin of streptococcal conjugative transposons has

been the subject of speculation for some time (11, 19). It hasbecome increasingly evident that at least two classes of theseelements exist (2, 5). In spite of some functional similarities,transposons typified by Tn916, Tn1S45, and TnS251 areclearly structurally and otherwise very different from thelarger elements such as TnS252 and Tn3703 (2, 5). Thesmaller elements carry genes encoding products which arefunctionally and structurally similar to the int and xis pro-teins of lambda phage, even though these transposons insertat several spots in the host chromosome (2, 13, 17). Thetarget specificity of the larger transposons, on the other

VOL. 175, 1993

2718 VIJAYAKUMAR AND AYALEW

hand, apparently resembles that of the lambdalike temperatephages. However, the predicted amino acid sequences ofboth ends of Tn5252 (unpublished data) were homologous toDNA modification proteins and site-specific recombinases ofnonlambda origin, reinforcing the idea that the larger andsmaller streptococcal conjugative transposons have possiblydifferent ancestries.There are many examples of transposable elements with

affinity for specific sites for integration (14). Many of thesehave been found in gram-negative bacteria and displayconventional features of transposons. On the other hand, thestructural characteristics of the target and terminal regionsof TnS252 resemble those of other integrated elements inactinomycetes (3, 24). These self-transmissible elements aresite specific, are suspected of carrying genes specifyingsecondary metabolites such as antibiotics, among otherthings, and exist as plasmids under some circumstances (3,24). The larger streptococcal conjugative transposons, how-ever, have not been observed to exist as independent repli-cons, and except for the antibiotic resistance determinants,very little is known about the genes carried by these ele-ments. While dispensable, addition of chromosomally inte-grated mobile elements such as TnS252 may create a varietyof genomic constellations and enhance the survival value ofthe hosts.

ACKNOWLEDGMENTS

We thank Patricia Ayoubi for technical assistance and valuablediscussions.

This work has been supported by grant DMB9018798 from theNational Science Foundation.

REFERENCES1. Ayoubi, P. 1990. Structural and functional characterization of a

composite conjugative transposon in Streptococcus pneumo-niae. M.S. thesis. Oklahoma State University, Stillwater, Okla.

2. Ayoubi, P., A. 0. Kilic, and M. N. Viayakumar. 1991. TnS253,the pneumococcal fi(cat tet) BM6001 element, is a compositestructure of two conjugative transposons, TnS251 and TnS252.J. Bacteriol. 173:1617-1622.

3. Boccard, F., T. Smokvina, J. L. Pernodet, A. Friedman, and M.Guerineau. 1989. Structural analysis of loci involved in pSAM2site-specific integration in Streptomyces. Plasmid 21:59-70.

4. Bouguenec, C., G. Cespedes, and T. Horaud. 1988. Molecularanalysis of a composite chromosomal conjugative element(Tn3701) of Streptococcus pyogenes. J. Bacteriol. 170:3930-3936.

5. Bouguenec, C., G. Cespedes, and T. Horaud. 1990. Presence ofchromosomal elements resembling the composite structureTn3701 in streptococci. J. Bacteriol. 172:727-734.

6. Bouguenec, C., T. Horaud, G. Bieth, R. Colimon, and C.Dauguet. 1984. Translocation of antibiotic resistance markers ofa plasmid-free Streptococcus pyogenes (group A) strain intodifferent streptococcal hemolysin plasmids. Mol. Gen. Genet.194:377-387.

7. Bringel, F., G. L. Van Alstine, and J. R. Scott. 1992. Transfer ofTn916 between Lactococcus lactis subsp. lactis strains is non-transpositional: evidence for a chromosomal fertility function instrain MG1363. J. Bacteriol. 174:5840-5847.

8. Buu-Hoi, A., and T. Horodniceanu. 1980. Conjugative transferof multiple antibiotic resistance markers in Streptococcus pneu-moniae. J. Bacteriol. 143:313-320.

9. Caparon, M. G., and J. R. Scott. 1989. Excision and insertion ofthe conjugative transposon Tn916 involves a novel recombina-tion mechanism. Cell 59:1027-1034.

10. Chen, E. Y., and P. Seeburg. 1985. Laboratory methods: super-coil sequencing: a fast and simple method for sequencingplasmid DNA. DNA 4:165-170.

11. Clewell, D. B., and C. Gawron-Burke. 1986. Conjugative trans-posons and the dissemination of antibiotic resistance in strep-tococci. Annu. Rev. Microbiol. 40:635-659.

12. Courvalin, P., and C. Carlier. 1987. TnlS45: a conjugativeshuttle transposon. Mol. Gen. Genet. 206:259-264.

13. Courvalin, P., C. Carlier, and F. Caillaud. 1987. Functionalanatomy of the conjugative shuttle transposon TnJS45, p. 61-64.In J. J. Ferretti and R. Curtiss III (ed.), Streptococcal genetics.American Society for Microbiology, Washington, D.C.

14. Craig, N. 1988. The mechanism of conservative site-specificrecombination. Annu. Rev. Genet. 22:77-105.

15. Dang-Van, A., G. Tiraby, J. F. Acar, W. V. Shaw, and D. H.Bouanchaud. 1978. Chloramphenicol resistance in Streptococ-cus pneunoniae: enzymatic acetylation and possible plasmidlinkage. Antimicrob. Agents Chemother. 13:577-582.

16. Franke, A., and D. B. Clewell. 1981. Evidence for a chromo-some-borne resistance transposon (Tn916) in Streptococcusfaecalis that is capable of transfer in the absence of a conjuga-tive plasmid. J. Bacteriol. 145:494-502.

17. Gawron-Burke, C., and D. B. Clewell. 1982. A transposon inStreptococcus faecalis with fertility properties. Nature (Lon-don) 300:281-284.

18. Gawron-Burke, C., and D. B. Clewell. 1984. Regeneration ofinsertionally inactivated streptococcal fragments after excisionof transposon Tn916 in Escherichia coli: strategy for targetingand cloning genes from gram-positive bacteria. J. Bacteriol.159:214-221.

19. Guild, W. R., S. Hazum, and M. D. Smith. 1981. Chromosomallocation of conjugative R determinants in strain BM4200 ofStreptococcus pneumoniae, p. 610. In S. B. Levy, R. C.Clowes, and E. L. Koenig (ed.), Molecular biology, pathogene-city, and ecology of bacterial plasmids. Plenum PublishingCorp., New York.

20. Hanahan, D. 1983. Studies on transformation of Escherichia coliwith plasmids. J. Mol. Biol. 166:557-580.

21. Horodniceanu, T., L. Bougueleret, and G. Beith. 1981. Conjuga-tive transfer of multiple-antibiotic resistance markers in betahemolytic group A, B, F, and G streptococci in the absence ofextrachromosomal deoxyribonucleic acid. Plasmid 5:127-137.

22. Inamine, J. M., and V. Burdett. 1985. Structural organization ofa 67-kilobase streptococcal conjugative element mediating mul-tiple antibiotic resistance. J. Bacteriol. 161:620-626.

23. Marmur, J. 1961. A procedure for the isolation of deoxyribo-nucleic acid from micro-organisms. J. Mol. Biol. 3:208-218.

24. Omer, C. A., and S. N. Cohen. 1986. Structural analysis ofplasmid and chromosomal loci involved in site-specific excisionand integration of the SLP1 element of Streptomyces coelicolor.J. Bacteriol. 166:999-1006.

25. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courva-lin. 1990. The integration-excision system of the conjugativetransposon Tn1545 is structurally and functionally related tothose of lambdoid phages. Mol. Microbiol. 4:1513-1521.

26. Priebe, S. D. 1986. Genetic and physical mapping of antibioticresistance elements in the chromosome of Streptococcus pneu-moniae. Ph.D. thesis. Duke University, Durham, N.C.

27. Scott, J. R., P. A. Kirchman, and M. G. Caparon. 1988. Anintermediate in transposition of the conjugative transposonTn916. Proc. Natl. Acad. Sci. USA 85:4809-4813.

28. Senghas, E., J. M. Jones, M. Tamamoto, C. Gawron-Burke, andD. B. Clewell. 1988. Genetic organization of the bacterialconjugative transposon Tn916. J. Bacteriol. 170:245-249.

29. Shoemaker, N. B., M. D. Smith, and W. R. Guild. 1979.Organization and transfer of heterologous chloramphenicol andtetracycline resistance genes in pneumococcus. J. Bacteriol.139:432-441.

30. Shoemaker, N. B., M. D. Smith, and W. R. Guild. 1980.DNase-resistant transfer of chromosomal cat and tet insertionsby filter mating in pneumococcus. Plasmid 3:80-87.

31. Smith, M. D., and W. R. Guild. 1982. Evidence for transpositionof the conjugative R determinants of Streptococcus agalactiaeB109, p. 109-111. In D. Schlessinger (ed.), Microbiology-1982.American Society for Microbiology, Washington, D.C.

32. Southern, E. 1975. Detection of specific sequences among DNA

J. BACTERIOL.

VOL. 175, 1993 SITE-SPECIFIC INTEGRATION OF TRANSPOSON Tn5252 2719

fragments separated by gel electrophoresis. J. Mol. Biol. 98: 34. Vjayakumar, M. N., S. D. Priebe, and W. R. Guild. 1986.502-517. Structure of a conjugative element in Streptococcus pneumo-

33. Torres, 0. R., R. Z. Korman, S. A. Zahler, and G. M. Dunny. niae. J. Bacteriol. 166:978-984.1991. The conjugative transposon Tn925: enhancement of con- 35. VMayakumar, M. N., S. D. Priebe, G. Pozzi, J. M. Hageman, andjugal transfer by tetracycline in Enterococcus faecalis and W. R. Guild. 1986. Cloning and physical characterization ofmobilization of chromosomal genes in Bacillus subtilis and E. chromosomal conjugative elements in streptococci. J. Bacteriol.faecalis. Mol. Gen. Genet. 225:395-400. 166:972-977.