null alleles in genetic genealogy 0 - dna-fingerprint · definition of null allele original...

41
Null Alleles in Genetic Genealogy 0 Thomas Krahn FTDNA Conference 2009

Upload: phungtram

Post on 17-Sep-2018

237 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Null Alleles in Genetic Genealogy

0Thomas Krahn FTDNA Conference 2009

Page 2: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)DNA

Promotor

Gene

RNA Polymerase

Splicing

mRNA

Transcription

ProteinTranslation

Ribosomes

Not a sharp definition.

Many things can go wrongin the complex geneexpression process.

Page 3: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.

Note: This is my own definition. Other definitions I found in the literature and on the internet usually focus on a very narrow subtype of a DNA segment. E.g. STR markers.

Page 4: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.

For a PCR reaction we need a solution of intact DNA. Degraded (sheared) DNA cannot be amplified because the TAQ polymerase needs to extend one DNA strand down until the reverse primer. If the TAQ drops off from the DNA segment before it reaches the reverse primer we will not get an exponential amplification. Since degraded DNA doesn't represent a species who can have descendants, we exclude degraded DNA from being a Null Allele for genealogical purpose.

Page 5: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.

All our known STR markers (e.g. DYS391, DYF385S1, vWA etc.) are DNA segments that are defined by flanking PCR primer sequences. DYS stands for “DNA Y-chromosome Segment”. The famous database GDB that recorded all primerpairs is unfortunately off-line since summer 2007. So it is sometimes difficult to lookup the exact primers for D markers from older publications. Genbank still keeps recordof a partial subset of the GDB markers. There they are also called STS markers (=Sequence Tagged Sites). An STS may also contain one or more SNP markers.

Page 6: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.

The actual characteristic of a Null Allele is that we can't detect a signal from a PCR product. We'll go into detail later what “detection” means, but this makes already clear that we need to precisely define a detection limit above the background noise ofthe detection instrument. Some mutations in the primer binding region don't completelyinhibit the formation of a PCR product so that a small signal persists despite the mutation. With alternative assays such a small signal may be still identified as a Null Allele.

Page 7: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.

Here comes the population genetic aspect of Null Alleles as a usable phylogeneticmarker. It is however important to understand the molecular genetic background of the mutation mechanism. Some of these genetic changes may occur independently on completely different branches of the phylogenetic tree, some of them may even berevertible. Depending on the stability of the marker we may need to select independent assays to restrict or confirm the phylogenetic position of a Null Allele marker.

Page 8: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Definition of Null Allele

● Concerning DNA markers:A DNA segment of good quality, limited to the two primer pairs of a PCR reaction that doesn't yield a PCR product in some biological samples while all other samples of that kind show a clearly detectable signal with the same PCR reaction.This makes clear that every Null Allele requires a positive control. This is usually easywith routine STR markers. However, if “other samples” is restricted to a narrow population the samples with Null Alleles may become the majority.Alternatively a competitive primer may sometimes be designed that inverts the definitionof a Null Allele marker to the contrary. This primer matches only the samples who carry the mutation and doesn't yield a PCR product for the “normal” samples.In our lab we have designed assays that combine both primers so that we are able toproperly distinguish the alleles and always get at least one positive result.

Page 9: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Basics

Page 10: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Basics

Page 11: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Basics

● Capillary electrophoresis to detect the PCR products

AAAATTGGTTCCTTGGGGTTTTGGAAGGGGCC

- +

Page 12: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

What can go wrong at PCR?

● Bad DNA template● Assay doesn't work● Detection method fails

If we can exclude the above, but still get nosignal from a PCR product

=> then a NULL allele is very likely

(...but not proven).

Page 13: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS439 Null mutation (L1)

Not observedwhen STR testing was performed inthe GRC lab because weuse a differentforward primer.

Page 14: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS437 Null

Page 15: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS391 Null

Page 16: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS463 Null

Page 17: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS565 Null

Page 18: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 Null

Page 19: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 NullPCR with more distant primers did NOT yield any PCR products.

D Y S 4 4 8

Regular primer pair

Outer primers

4000

2000

1250800500300200100

GR

C00

5356

->

DY

S44

8 N

ull

GR

C0

0343

6 ->

DY

S4

48 1

9

GR

C00

000

1 ->

DY

S4

48 1

8

GR

C0

0002

7 -

> f

emal

e

Siz

e S

tand

ard

DYS448 Null PCR product on agarose gel

The DYS448 Y-STR marker has been amplified with alternative primers DYS448_f: GAGGAGGATATGTCAAAGGATTCDYS448_r: CAGTTTCACTTCATGTTTGGGand PCR products have been sized on an agarose gel (FlashGel 1.2% agarose Lonza 200V/5min).The positive controls (19 and 18 repeats) show a band ant the expected size of ca. 800 bp.The female negative control and the DYS448 Null allele sample don't have a PCR product and their lanes on the gel are empty. Amplification assays with alternative primer sets practically eliminate the hypothesis of an inhibited PCR due to a mutation on the primer binding site.

Page 20: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 Null

Palindromic Pack results are generally inconspicuous...

Except DYF397has possiblyonly 2 alleles

Page 21: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 Null

DYS448 is located on the unique loopof the P3 palindrome

DYS464 G-type

DYS464 C-type

DYS725

DYS725

DYS725

DYS725

DYF399 T-type

DYF399 C-type

DYF408

DYF408

DYS724

DYS724

DYS459

DYS459 DYF385

DYF385DYF401

DYF401

DYF399 ins G, T-type

P1

P2

DYF397

DYF397

DYF387

DYF387

DYF371 C-type

DYF371 C-type

DYF397

DYF397

P3

N.N.

N.N.

188 bp

188 bp

DYS448

DYS392

DYS485

DYS461

DYS464 C-type

DYS464 C-type

DYS452

DYS392 is NOT missing

DYF397 only 2 alleles DYS464 and DYS725 only 2 allelesDYF399 only 2 allelesand no .1 allele

DYS448 = NullDYS464 = 14-15DYS459 = 9-10DYS401 = 14-17DYF408 = 188-188-8-13DYF399 = 21t-25c (no .1 allele!)DYF397 = 14-15DYS725 = 31-31DYS392 = 11

Page 22: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 Null

DYS464 G-type

DYS464 C-type

DYS725

DYS725

DYS725

DYF399 T-type

DYF399 C-type

DYF408

DYS724

DYS459

DYF385

DYF401

DYF399 ins G, T-type

P1

DYF397

DYF397

DYF387

DYF371 C-type

DYF371 C-type

DYF397

DYS448

DYS392

DYS485

DYS461

DYS464 C-type

DYS464 C-type

DYS452 DYF397

Loop Constellation!

Recombination

DYS448 = NullDYS464 = 14-15DYS459 = 9-10DYS401 = 14-17DYF408 = 188-188-8-13DYF399 = 21t-25c (no .1 allele!)DYF397 = 14-15DYS725 = 31-31DYS392 = 11

Page 23: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS448 Null

DYS464 G-type

DYS464 C-type

DYS725

DYS725

DYS725

DYF399 T-type

DYF399 C-type

DYF408

DYS724

DYS459

DYF385

DYF401

DYF399 ins G, T-type

P1

DYF397

DYF397

DYF387

DYF371 C-type

DYF371 C-type

DYF397

DYS448

DYS392

DYS485

DYS461

DYS464 C-type

DYS464 C-type

DYS452

DYS448 = NullDYS464 = 14-15DYS459 = 9-10DYS401 = 14-17DYF408 = 188-188-8-13DYF399 = 21t-25c (no .1 allele!)DYF397 = 14-15DYS725 = 31-31DYS392 = 11

DYF397

Loop Constellation!

Page 24: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 Null

Page 25: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 NullYfiler

Singleplex

Page 26: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 Null

1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 2 3 1 2 3 4 5 6 7 8 9 1011

Deletion of the middle fragment in between DYS389I and DYS389B

DYS389I

DYS389II

The nomenclature of DYS389 is defined asDYS389I: [TCTG]q [TCTA]r = GenBank top strandDYS389II: [TCTG]n[TCTA]p[TCTG]q [TCTA]r = GenBank top strandSee: http://www.cstl.nist.gov/biotech/strbase/str_y389.htm

The deleted sample matches the first 5 repeats [TCTG] from the related samples in R1b1c.It shows 10 repeats of TCTA which we can align to the left or to the right side.

5 x [TCTG] + 10 x [TCTA] = 5 x [TCTG] + 10 x [TCTA] = 15 repeat units15 repeat units

Page 27: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 Null

Peak shows up at “16” - But really has 1515 repeats!

Page 28: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 Null

13 24 14 10 11 15 12 12 12 15 13 0 18 9 10 11 11 25 15 19 30 15 15 17 1813 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 15 16 16 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 31 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 16 1713 24 14 10 11 15 12 12 12 14 13 30 18 9 10 11 11 25 15 19 30 13 15 16 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 16 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 16 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 13 15 1513 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 16 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 15 15 15 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 13 15 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 12 15 16 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 16 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 1713 24 14 10 11 15 12 12 12 13 13 30 18 9 10 11 11 25 15 19 30 15 15 17 1713 24 14 10 11 15 12 12 12 13 13 29 18 9 10 11 11 25 15 19 30 13 15 17 17

393

390

19

391

385a

385b

426

388

439

389|1

392

389|2

458

459a

459b

455

454

447

437

448

449

464a

464b

464c

464d

DYS389 Null

Page 29: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS389 Null

1 2 3 4 5 1 2 3 4 5 6 7 8 9 10 1 2 3 1 2 3 4 5 6 7 8 9 1011

DYS389I

DYS389II

Looping constellation

Recombination Deletion

5? 10? 3? 10?

13?

28?

5 10

Page 30: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS425 Null

Page 31: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS425 NullDYS413

DYS413

YCAII

YCAII

DYF408

DYF408

DYS385b*

DYS385a*

DYS464 G-type

DYS464 C-type

DYS725

DYS725

DYS725

DYS725

DYF399 T-type

DYF399 C-type

DYF408

DYF408

DYS724

DYS724

DYS459

DYS459 DYF385

DYF385DYF401

DYF401

DYF399 ins G, T-type

P1

P2

P4

P5

P8

DYF411

DYF411

DYF395

DYF395

DYF397

DYF397

DYF387

DYF387

DYF371 C-type

DYF371 C-type

DYF397

DYF397

P3

N.N.

N.N.

188 bp

188 bp

DYS448

DYS392

DYS485

DYS452

DYS461

DYS390DYF371 T-type

DYF371 C-type

DYS464 C-type

DYS464 C-type

DYS425 = DYF371 T-type allele

The T-type SNP can get lost by a recLOH

This is seen as a “NULL-Allele” if only DYS425 is tested

Page 32: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS425 Null / DYF371X

DYS425 12 DYS425 Null

Page 33: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

DYS425 Null

The HUGO sequence has also a Null allele at DYS425

10c-10c-13c-14c

Normally in R1b (and most other haplogroups):

10c-12t-13c-14c

Page 34: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Multi Marker Deletion

Page 35: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

Multi Marker DeletionMarker Allele Region Start StopDYS393 13 3191128 3191246DYS19 16 10131934 10132128DYS391 10 12612758 12613044DYS437 14 12976972 12977163DYS439 11 13025167 13025418DYS389I 14 13122100 13122515DYS389II 32 13122100 13122515DYS388 13 13256856 13257013DYS438 10 13447189 13447409DYS390 0 15784268 15784613DYS426 0 17644207 17644303DYS385b 0 19260844 19261212DYS385a 0 19301724 19302104DYS392 0 21043146 21043399

ChrYChrYChrYChrYChrYChrYChrYChrYChrYChrYChrYChrYChrYChrY

Possible P1/P5 deletion in the palindromic region

Page 36: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

Astrid Krahn (mt hg J)

Page 37: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

Dr. Connie Bormans (mt hg I)

Page 38: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

Jory Clark (Y hg T)

Page 39: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

Brent Maning (Y hg R-U106*)

Page 40: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

Dr. Arjan Bormans (Y hg R-L2*)

Page 41: Null Alleles in Genetic Genealogy 0 - DNA-Fingerprint · Definition of Null Allele Original meaning: A mutant copy of a gene that completely lacks that gene's normal function. (Wikipedia)

GRC Lab Pics

...and our other lab coworkers

Thanks for listening!