o-linkedglycosylationatthreonine27protectsthecopper ... · 067166, project 1 (to j.h.k.). the costs...

O-Linked Glycosylation at Threonine 27 Protects the CopperTransporter hCTR1 from Proteolytic Cleavage inMammalian Cells*

Received for publication, March 1, 2007, and in revised form, May 7, 2007 Published, JBC Papers in Press, May 24, 2007, DOI 10.1074/jbc.M701806200

Edward B. Maryon, Shannon A. Molloy, and Jack H. Kaplan1

From the Department of Biochemistry and Molecular Genetics, University of Illinois, Chicago, Illinois 60607

The major human copper uptake protein, hCTR1, has 190amino acids and a predicted mass of 21 kDa. hCTR1 antibodiesrecognizemultiple bands in SDS-PAGEcentered at 35 kDa. Partof this increasedmass is due toN-linkedglycosylation atAsn-15.We show that in mammalian cells the N15Q mutant proteintrafficked to the plasmamembrane andmediated copper uptakeat 75% of the rate of wild-type hCTR1.We demonstrate that theextracellular amino terminus of hCTR1 also contains O-linkedpolysaccharides. Glycosidase treatment that removed O-linkedsugars reduced the apparent mass of hCTR1 or N15Q mutantprotein by 1–2 kDa. Expression of amino-terminal truncationsand alanine substitution mutants of hCTR1 in HEK293 andMDCK cells localized the site of O-linked glycosylation to Thr-27. Expression of alanine substitutions at Thr-27 resulted inproteolytic cleavage of hCTR1 on the carboxyl side of the T27Amutations. This cleavage produced a 17-kDa polypeptide miss-ing approximately the first 30 amino acids of hCTR1. Expressionof wild-type hCTR1 in mutant Chinese hamster ovary cells thatwere unable to initiate O-glycosylation also resulted in hCTR1cleavage to produce the 17-kDa polypeptide. The 17-kDahCTR1 polypeptide was located in the plasma membrane andmediated copper uptake at about 50% that of the rate of wild-type hCTR1. Thus, O-linked glycosylation at Thr-27 is neces-sary to prevent proteolytic cleavage that removes half of theextracellular amino terminus of hCTR1 and significantlyimpairs transport activity of the remaining polypeptide.

Copper is an essential trace element, acting as a catalyticcofactor for proteins involved in functions such as oxidativephosphorylation, detoxification of free radicals, iron uptake,neuropeptide synthesis, and connective tissue formation (1).Free Cu1� or Cu2� ions are not present in cells or in the serumin mammals, presumably because copper ions can participatein the formation of toxic reactive oxygen species (2, 3). Theregulation of cellular copper levels involves uptake transport-ers, Cu-activated ATPases that mediate copper efflux, and sev-eral protein-specific chaperones that deliver copper to its intra-cellular target proteins (4–8).

CTR2 transport proteins constitute a major pathway of cop-per entry into eukaryotic cells. CTR homologs are foundthroughout eukaryotes, but they were first identified and stud-ied in Saccharomyces cerevisiae (9). Yeast strains with deletionsin the two high affinity copper uptake genes (ctr1�ctr3�) have agrowth defect due to copper deficiency (9). Functional comple-mentation of this growth defect was used to clone hCTR1, thehuman homolog of yeast CTR1 (10). hCTR1 is expressed inmost if not all cell types (10). In mammals, CTR1 is an essentialhigh affinity copper transporter, since mCTR1 homozygousknock-out animals die early in embryogenesis (11, 12).CTR proteins contain three membrane-spanning segments,

an extracellular amino terminus, a cytoplasmic loop betweenthe first and second membrane spanning helices, and a cyto-plasmic carboxyl-terminal tail (Fig. 1). A two-dimensional crys-tal structure of lipid-embedded hCTR1was recently solved to 6Å of resolution using electron crystallography (13), revealing ahomotrimeric complex having a central pore. The coppertransport activity of hCTR1 has been studied using 64Cu uptakein cultured cells. 64Cu uptake assays have been widely used tomeasure kinetic parameters of copper transport by hCTR1 andin structure-function studies of the protein (14, 15).The extracellular amino terminus of hCTR1 may play a role

in delivering copper ions from copper-binding proteins or cop-per complexes such as Cu�-histidine to the transport pathway(7). The amino terminus has also been shown to self-associate,which may contribute to the stability of the trimeric complex(16). The amino termini of all CTR proteins contain conservedmethionine- and histidine-richmotifs thatmight serve to focusthe ions into the transport pathway (14). hCTR1 contains histi-dine- and methionine-rich motifs in the first 45 amino acids (Fig.1A, H-1, H-2, and M-1, M-2, respectively). Mutagenesis studiesshowed that alanine substitutions and deletions affecting M-2have thegreatest effecton64Cuuptake.Specifically, substitutionofM43 and M45 (Fig. 1A, stars) dramatically reduced 64Cu uptake(15). Among hCTR1mutants stably expressed in insect cells, ami-no-terminal truncations of the first 53 and 69 amino acids havesubstantially reduced 64Cu uptake, whereas a truncation of thefirst 34 amino acids had little effect (14).It has repeatedly been observed that hCTR1 forms multi-

meric hCTR1 species, particularly dimeric forms, that are sta-* The work was supported by National Institutes of Health Grant P01 GM067166, Project 1 (to J. H. K.). The costs of publication of this article weredefrayed in part by the payment of page charges. This article must there-fore be hereby marked “advertisement” in accordance with 18 U.S.C. Sec-tion 1734 solely to indicate this fact.

1 To whom correspondence should be addressed: Dept. of Biochemistry andMolecular Genetics, University of Illinois, 900 S. Ashland Ave., Chicago, IL60607. Tel.: 312-355-2732; Fax: 312-355-1765; E-mail: [email protected].

2 The abbreviations used are: CTR1, copper transport protein; HEK293, humanembryonic kidney 293; DMEM, Dulbecco’s modified Eagle’s Medium; PBS,phosphate-buffered saline; CHO, Chinese hamster ovary; tet, tetracycline;PNGase, glycosidase; MDCK, Madin-Darby canine kidney; IP, immunopre-cipitation; CAPS, 3-(cyclohexylamino)propanesulfonic acid.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 28, pp. 20376 –20387, July 13, 2007© 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

20376 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282 • NUMBER 28 • JULY 13, 2007

ble in denaturing polyacrylamide gels (15, 17, 18). Themobilityof hCTR1 in gels is further complicated by the presence of gly-cosylation(s) in the amino terminus. The predicted molecularmass of hCTR1 is 21 kDa (10), but hCTR1migrates with amass

of 33–35 kDa, often appearing as a closely spaced smear ofbands (17, 19). Treatment of (mammalian) cells with tunicamy-cin or digestion with theN-linked polysaccharide-specific pep-tide glycosidase PNGase F reduces the apparentmass of hCTR1to about 24–26 kDa (17, 20).Two studies identified the site of N-linked glycosylation in

hCTR1 at N15, confirming that the amino terminus is extracel-lular (17, 20). In human H441 cells, overexpressed N15DhCTR1 protein had a similar half-life and exhibited a similarimmunofluorescence staining pattern in the plasmamembraneas did overexpressed wild-type hCTR1 (16). When wild-typeand N15Q hCTR1 proteins were overexpressed in insect cells,both proteins were abundant in plasma membrane fractions,and insect cells expressingN15Qhad similar 64Cu uptake activ-ity as cells expressing wild-type hCTR1 (14). Equivalent traf-ficking or 64Cu uptake experiments using N15Q hCTR1expressed in mammalian cells have not been reported.In the present work we have examined the consequences of

removing N-linked polysaccharides from hCTR1 in mamma-lian cells and shown that removal of N15-linked glycosylationby mutation (N15Q) does not affect trafficking of the trans-porter to the cell surface. Copper transport activity of N15Qmutant protein was diminished by about 25% in comparison tothe wild-type protein.Previous work suggested that hCTR1 might also contain

O-linked polysaccharides. In pulse-chase studies, endogenoushCTR1 in HeLa cells matured from a 28-kDa polypeptide to a35-kDa form (17). In the presence of theN-glycosylation inhib-itor tunicamycin, hCTR1 was synthesized as a 23-kDa precur-sor that chased into a species estimated as 30 kDa (17). Pulse-chase studies using N15D mutant hCTR1 also showed that aprecursor 23-kDa protein chased into a 30-kDa species (16).The authors speculated that this 30-kDa species could be theresult of O-linked glycosylation. Furthermore, endogenoushCTR1 protein fromHEK293 cells treatedwith PNGase F and amixture of glycosidases that remove O-linked sugars exhibiteda greater increase inmobility than hCTR1 treated with PNGaseF alone.3

In this report we establish that hCTR1 is O-glycosylated inmammalian cells, and we demonstrate that glycosylation takesplace at Thr-27 in the extracellular amino terminus. Strikingly,we found that eliminating theO-linked glycosylation of hCTR1results in essentially complete proteolytic cleavage of hCTR1on the carboxyl side of Thr-27. The resulting 17-kDa polypep-tide lacks approximately 30 amino acids from the amino termi-nus. The truncated hCTR1 protein is localized in the plasmamembrane and has copper transport activity that is 50–60%that observed for wild-type hCTR1. It, thus, appears thatO-linked glycosylation at Thr-27 of hCTR1 is necessary to pro-tect the extracellular amino terminus from proteolytic removalfrom the transporter.

EXPERIMENTAL PROCEDURES

Cell Lines and Culture Conditions—HEK293 FLp-InTMT-RexTM cells and Madin-Darby canine kidney (MDCK) FLp-InTM T-RexTM cells were cultured in Dulbecco’s minimal

3 J. Eisses and J. Kaplan, unpublished information.

FIGURE 1. hCTR1 protein. A, topology and domains of hCTR1. Shaded boxes inthe extracellular amino-terminal domain represent histidine- and methio-nine-rich sequences common to CTR1 homologs. Starred methionines in M2are essential for copper transport. The single site of N-linked polysaccharideaddition is shown at N15 (N-GLY). B, detection of hCTR1 by Western analysisusing antibodies (ab) against the cytoplasmic loop and (cytoplasmic) COOH-tail. Plasma membrane protein from Caco-2 cells (lanes 1 and 2, 30 �g),HEK293 cells (lane 3, 40 �g), and HEK293 cells overexpressing hCTR1 (lane 4,10 �g) were detected with antibodies indicated below the panels. The 38-kDaband in lanes 2– 4 detected by the anti-COOH tail antibodies is a cross-react-ing protein unrelated to hCTR1. C, reciprocal immunoprecipitation usingaffinity purified anti-loop and anti-COOH tail antibodies. Endogenous hCTR1was precipitated from solubilized Caco-2 membranes with anti-COOH tailantibodies and protein G-Sepharose (middle panel) or anti-cytoplasmic loopantibody coupled to beads (right panel). Light chain (L.C.) IgG from precipitat-ing antibody is indicated.

Glycosylation of hCTR1

JULY 13, 2007 • VOLUME 282 • NUMBER 28 JOURNAL OF BIOLOGICAL CHEMISTRY 20377

essential media (DMEM (Invitrogen catalog #11995), 25 mMHepes buffer, and 10% fetal calf serum (Atlanta Biologicals,Lawrenceville, GA). Caco-2 colorectal adenocarcinoma cellswere cultured in DMEM/Hepes supplemented with 20% fetalcalf serum. Chinese hamster ovary (CHO) cells, LDLD (CHO)cells, and LDLD cell lines stably expressing hCTR1 were cul-tured in Ham’s F-12 media (Invitrogen catalog #11765) with10% fetal calf serum and 100 �g/ml zeomycin (Invitrogen) orsupplemented as described. All cells were grown at 37 °C in 5%CO2. Cells were passaged every 3–7 days. HEK293 FLp-InTMT-RexTM cells were purchased from Invitrogen and maintainedwith selective antibiotics as suggested by the manufacturer.MDCK FLp-InTM cells were a generous gift of the late Dr. Rob-ert B. Gunn (Emory University), and were converted toT-RexTM cells using the FLp-InTMT-RexTM core kit purchasedfrom Invitrogen. LDLDCHOcells were generously provided byDr. Monty Krieger (MIT) via the American Type Culture Col-lection (ATCC, Manassas, Va). Caco-2 cells and CHO cellswere obtained from ATCC (catalog # HTB-37 and CCL-61,respectively).Cell lines containing tetracycline-regulated hCTR1 genes

were created in HEK293 FLp-InTMT-RexTM cells and MDCKFLp-InTMT-RexTM cells described above using the FLp-InTMT-RexTM core kit (Invitrogen). Briefly, the cells weretransfected with various hCTR1 constructs (see below) usingLipofectamine 2000 (Invitrogen). Transfected cells wereselected in 12 �g/ml blastocidin S (RPI Corp.) and 400 �g/mlhygromycin (Invitrogen). Resistant colonies were pooled andtested for tetracycline-regulated expression. Cells were cul-tured in media containing 1 �g/ml tetracycline for 48 h beforeharvesting.hCTR1 Expression Constructs and Mutants—The wild-type

hCTR1 cDNA clone used here was obtained from Dr. J.Gitschier, UCSF (GenBankTM accession number U83460). AnAgeI site was added 5� of the initiating methionine codon byligation of annealed oligos (AgeI adaptor, Table 1) between the5�BamHI site and theNdeI site at nucleotide�16 in the hCTR1coding sequence. A FLAG epitope tag was added to the aminoterminus by ligation of annealed oligos between BamHI andAgeI (NT-FLAG, Table 1) to produce the clone pEM79. Thisamino-terminal FLAG tagged hCTR1 cDNA was ligated intothe FLp-InTM vector pcDNA5/FRT/TO© (Invitrogen) as a

BamHI-ApaI fragment to produce pEM83. The same BamHI-ApaI fragmentwas ligated into pcDNA3.1/Zeo (�) (Invitrogen)to produce pEM89 for creation of stable hCTR1-expressingLDLD cell lines.The NT-FLAG-tagged H22 and A29 truncation mutants

were created from wild-type hCTR1 cDNA using PCR primerpairs listed inTable 1. hCTR1 genes lacking the first 21 (H22) or28 (A29) amino acids were amplified with PCR, cut with AgeIandClaI, and ligated into pEM83, replacing the full-length cod-ing sequence with the truncated genes. Two truncationmutants (not FLAG-tagged) lacking the first 33 (MG34) or 52(MN53) amino acids were amplified using oligos previouslydescribed (14) and ligated as AflII-EcoRI fragments intopcDNA5/FRT/TO©.The NT-FLAG-tagged wild-type hCTR1 was transferred

from pEM83 to the pBSIIKS vector (Stratagene, La Jolla, CA) asa BamHI-ApaI fragment to produce pEM94. The N15Q muta-tion was introduced into pEM94 to produce pEM95 using theQuikChange�II site-directedmutagenesis kit (Stratagene) withthe N15Q oligos in Table 1. pEM94 and pEM95 were used astemplates to produce a set of alanine substitution mutants inamino acids Thr-26, Thr-27, and Ser-28 of hCTR1 (nucleotides�809–817 in the hCTR1 cDNA). The wild-type TTS sequencewas changed toATS, TAS, TTA,AAS, andAAA in both pEM94and pEM95 using the site-directed mutagenesis kit with muta-genic oligos listed in Table 1. The mutant hCTR1 genes weretransferred as BamHI-XhoI fragments to pcDNA5/FRT/TO©.All clones were sequenced before use in experiments.Restriction enzymes and T4DNA ligase was purchased from

New England Biolabs (Beverly, MA). PfuTurbo� polymerasefor PCR was purchased from Stratagene. Oligos were pur-chased from Invitrogen, and DNA sequencing was performedby the Research Resources Center at the University of Illinois atChicago.Antibodies and Affinity Purification—The affinity-purified

rabbit anti-hCTR1 antibody raised against the carboxyl-termi-nal peptide (SWKKAVVVDITEHCH) was described previ-ously (20) and used at 1/10,000 dilution. The anti-hCTR1 anti-bodies described in this work were raised against a 46-aminoacid peptide corresponding to the cytoplasmic loop (KIARES-LLRKSQVSIRYNSMPVPGPNGTILMETHKTVGQQMLS-FPH) purchased from Biopeptide Co., LLC (San Diego, CA).

TABLE 1Oligonucleotides used to create epitope-tagged and mutant hCTR1 expression constructs

Oligonucleotide Sequence, 5�–3�

AgeI adaptor-sense GATCCCACCACACCGGTATGGATCATTCCCACCAAgeI adaptor-anti-sense TATGGTGGGAATGATCCATACCGGTGTGGTGGFLAG-sense GATCCACCATGGACTACAAGGACGATGACGATAAAGGAAFLAG-anti-sense CCGGTTCCTTTATCGTCATCGTCCTTGTAGTCCATGGTGH22-sense ATAACCGGTCACCATCACCCAACCACTTCAGCCA29-sense ATAACCGGTGCCTCACACTCCCATGGTGH22 and A29-anti-sense ACTGCAATCGATAAGGCCACGCATS-sense CTCACCATCACCCAGCCACTTCAGCCTCACACTCCCATGATS-antisense CATGGGAGTGTGAGGCTGAAGTGGCTGGGTGATGGTGAGTAS-sense CTCACCATCACCCAACCGCTTCAGCCTCACACTCCCATGTAS-antisense CATGGGAGTGTGAGGCTGAAGCGGTTGGGTGATGGTGAGTTA-sense CTCACCATCACCCAACCACTGCAGCCTCACACTCCCATGTTA-antisense CATGGGAGTGTGAGGCTGCAGTGGTTGGGTGATGGTGAGAAS-sense CTCACCATCACCCAGCCGCTTCAGCCTCACACTCCCATGAAS-anti-sense CATGGGAGTGTGAGGCTGAAGCGGCTGGGTGATGGTGAGAAA-sense CTCACCATCACCCAGCCGCTGCAGCCTCACACTCCCATGAAA-anti-sense CATGGGAGTGTGAGGCTGCAGCGGCTGGGTGATGGTGAG



This peptide was used to immunize rabbits (Cocalico Biologi-cals, Reamstown PA). Pre-immune and immune sera weretested for reactivity against hCTR1. The antibody was used at1/1000 dilution.hCTR1 cytoplasmic loop peptide was coupled to Actigel

ALD resinmatrix using themanufacturer’s instructions (Stero-gene, Carlsbad CA). Post-coupled resin was packed into col-umns and used to purify anti-hCTR1 antibody fromwhole rab-bit sera. Bound antibody was eluted with Actisep elutionmedium (Sterogene), which was subsequently removed bydesalting into PBS. The antibody was concentrated in spin con-centrators (Vivascience AG, Hanover, Germany). Anti-hCTR1loop IgG or normal rabbit IgG (Jackson ImmunoResearch Lab-oratories) was coupled to Actigel ALD resin for pull down reac-tions. IgG was purified from anti-hCTR1 loop whole serumusing the Melon GelTM system (Pierce) as suggested. PurifiedIgGs were coupled to Actigel as above.Membrane Preparation—Cultured cells were washed twice

in PBS and harvested from 10- or 15-cm plates by scraping.Cells were homogenized in the presence of a mixture of prote-ase inhibitors (Roche Applied Science). Homogenization wasdone in a tight-fittingDounce homogenizer followedby passingthe lysate 3 times through a 27-gauge needle. Large debris wascleared by centrifugation at 1200� g. The resultingmicrosomalsupernatant was spun at �90,000 � g to pellet “total” mem-branes or layered in 5-step gradients to recover fractionsenriched for plasma membranes, Golgi complex membranes,or membranes from the endoplasmic reticulum as described(21). Membrane protein concentration was determined usingthe method of Bradford (22).Immunoprecipitation (IP)—IP and pulldown experiments in

Fig. 1 were performed using membranes solubilized in n-dode-cyl-�-D-maltoside (RPI Corp.). Membranes were resuspendedin 0.1 M phosphate, pH 7.2, 150 mM NaCl, 5 mM dithiothreitol,and 1% n-dodecyl-�-D-maltoside for 45–60 min at room tem-perature. Samples were spun at �90,000 � g for 25 min at 4 °C,then the supernatant was removed. Supernatants were dilutedinto IP/pulldown buffer (50 mM phosphate, pH 7.2, 200 mMNaCl, 2.5 mM dithiothreitol, and 0.5% n-dodecyl-�-D-malto-side). IP reactions were precleared with protein G-agarosebeads (Pierce). Precleared supernatant was collected by centrif-ugation at 1200� g for 5min. For IPs, antibodies were added toprecleared supernatant at 1/100 and rotated at 4 °C for 30–60min, after which 10 �l of protein G-agarose beads were added,and themixture was rotated overnight at 4 °C. Pulldown super-natants were precleared with normal rabbit IgG resin, and thesupernatantswere collected as for IPs. 50�l of anti-hCTR1 loopIgG resin was then added to the supernatant, and the mixturewas rotated overnight at 4 °C. IP beads or IgG resin was washed5 times in IP/pulldown buffer, and bound proteins were elutedat 37 °C with 2� SDS electrophoresis sample buffer (125 mMTris, pH 6.8, 2 mM EDTA, 6% SDS, 20% glycerol, 0.25% brom-phenol blue, and 1% �-mercaptoethanol).Cell Surface Biotinylation—HEK293 cells were surface-bio-

tinylated with a reversible (thiol-cleavable) reagent (Sulfo-NHS-SS-Biotin, Pierce catalog #21331) as described (23). Thecells were washed from 10-cm plates with DMEMmedia with-out fetal calf serum and spun 10 min at 800 � g at 4 °C. Pellets

were washed twice in PBS, and the cells were biotinylated whilerotating for 25min at 4 °C and quenched in buffers as described(23).Washed cells were then solubilized in 1%Triton-X-100 for60 min, and insoluble material was removed by centrifugationat 12,000� g. Supernatants were divided in equal portions, andhalf was incubated overnight at 4 °C with 100 �l of streptavidinbeads (Pierce) that were equilibrated in solubilization buffer.The beads were collected and washed as described (23), afterwhich the proteins bound to the beadswere cleavedwith 50mMdithiothreitol in 2� SDS electrophoresis sample buffer at 30 °Cbefore SDS-PAGE. The remaining half of the solubilized, bio-tinylated proteins were incubated with 200�l anti-hCTR1 loopantibody-coupled beads in pulldown reactions as describedabove. The supernatants from streptavidin bead pulldownassays were subsequently incubatedwith the anti-hCTR1 beadsin a second pulldown reaction. A control pulldown experimentusing solubilized hCTR1 proteins from cells that were not bio-tinylated was performed using the same streptavidin and anti-hCTR1 beads. Preincubation with the streptavidin beads didnot reduce the yield of unbiotinylated hCTR1 using anti-hCTR1 loop antibody beads (not shown).PAGE and Western Blots—12 or 15% SDS-PAGE was per-

formed using the method of Laemmli (24). Gels were trans-ferred to Immobilon-Pmembranes (Millipore, BedfordMA) in0.1 M CAPS buffer, pH 11, dried, and blocked with PBScontaining 5% powdered milk and 0.1% Tween 20 (Fisher)Membranes were incubated with primary and secondaryantibodies in the same solution and washed after incubationsin PBS, 0.1% Tween. Western blot signals were obtained usingSuperSignal�West reagents (Pierce) and collected by exposingto film or with a Chemi-Doc XRS system (Bio-Rad). Relativeband intensity was determined using Quantity One� Software(Bio-Rad).Glycosidase Treatment—Membranes were prepared for

digestionwith various glycosidases by partial denaturationwithsolutions provided by suppliers. Denaturation of hCTR1 sam-ples was done for 10 min at 37 °C (higher temperatures aggre-gated the protein). Detergent and glycosidases were subse-quently added to the reactions, and digestions were done at37 °C for 2–3 days. Reactions were stopped with the addition ofSDS sample buffer (above) before PAGE analysis. Asparagine-linked polysaccharides were removed frommembrane sampleswith PNGase F (New England Biolabs). Threonine/serine-linked polysaccharides were removed with 1) a mixture of gly-cosidases included in the PRO-Link ExtenderTM kit (Prozyme,San Leandro, CA) or 2) using individual enzymes in the kit orpurchased separately, including �-2-fucosidase, �-N-acetyl-hexosaminidase, and Neuraminidase (New England Biolabs),and �-1–4-galactosidase (Prozyme).

64Cu Uptake Assays—64Cu uptake assays were similar tothose described previously in insect cells (20), except thatDMEM media containing 10% fetal bovine serum was used(DMEM 10%), which was previously shown to have a muchlower level of hCTR1-independent copper uptake in mamma-lian cells compared with the buffer used in insect cells (18).LDLD cells for 64Cu uptake were grown in Ham’s F-12 mediacontaining 3% dialyzed calf serum supplemented with or with-out galactose and or N-acetyl-galactosamine (Sigma) 72 h



before the assay. HEK293 cells expressing wild-type or mutanthCTR1 were induced with tetracycline in 10% DMEM 48 hbefore the assay.One day before the assays 12-well tissue culture plates were

seededwith 6–8� 105 cells/well in 10%DMEM.The followingday the cells were washed once with 10%DMEM (without anti-biotics), then incubated in 10% DMEM containing 2.5 �MCuCl2 and trace amounts of 64Cu (0.5–2.0 � 106 cpm/well) for5 min at room temperature or 45 min at 37 °C. Copper uptakewas stopped by removing 64Cu and adding ice-cold buffer (150mM NaCl, 5 mM KCl, 2,5 mM MgCl2, 10 mM EDTA, 25 mMHepes, pH 7.4), after which the cells were washed twice withcold buffer, then dissolved in 1ml 0.1 NNaOH. Lysed cells werecollected, and half the volume was counted in a Beckman LS6500 scintillation counter. A portion of the remaining lysedcells was used for protein determination. Each condition wasdone in triplicate wells and averaged. 64Cu uptakes from 5-minincubations were subtracted from 45-min incubations to cor-rect for nonspecific binding.To normalize expression between tet-induced cell lines, 30

�g of total membrane protein or 10 �g of plasma membraneprotein from each line was analyzed on Western blots usinganti-hCTR1 and anti-Na,K-ATPase antibodies as described(20). For loading controls, signals from either the �-subunit oftheNa,K-ATPase pump (for plasmamembranes) or the 38-kDacross-reacting protein described in the following paragraph (fortotal membranes) were quantitated. hCTR1 wild-type andmutant signals were also quantitated, and copper uptake rateswere normalized for differences in expression of hCTR1. The64Cu uptake rate shown for the tet-induced cell-line expressingwild-type hCTR1 was consistently 6–8 pM/mg of protein/min,and other rates were normalized with respect to this. Theexpression of N15Q mutant protein averaged 59% of the wild-type level, so uptake values forN15Q in Fig. 2 were increased bya factor of 1.7. Expression of the AAA/N15Q mutant proteinaveraged 110% of the wild-type level; therefore, the averageuptake value for the AAA/N15Q mutant (see Fig. 7) wasreduced by 9%. 64Cu-uptake experiments in LDLD cells weredone in stably transformed cell lines and were, therefore, notadjusted for expression.

RESULTS

Identification of hCTR1 on Western Blots—Initial studies ofhCTR1 proteins using Western blots showed that hCTR1migratedwith higher than expectedmass in SDS-PAGE (15, 17,18, 20). Although the predicted molecular mass of hCTR1 is 21kDa, the size of the protein on Western blots using variousanti-hCTR1 antibodies or epitope tags has been reported as 24,28, and 35 kDa andmultimeric forms of higher molecular mass(17, 18, 25, 26). The presence of higher mass bands that corre-spond to dimer, trimer, and higher mass species further com-plicates the identification of hCTR1 in gels. We previouslyraised a polyclonal antibody against the intracellular carboxyl-terminal tail of hCTR1 that recognized membrane proteins of34–35 and 38 kDa in mammalian cells (Ref. 20, Fig. 1B, lanes2–4). For the present work, we raised polyclonal antibodiesagainst the intracellular loop that recognized the 34–35-kDabands (loop, Fig. 1B, lane 1). Reciprocal immunoprecipitation

and detection with anti-loop antibodies and anti-carboxyl-ter-minal antibodies showed that both antibodies recognize thesame 34–35-kDa protein(s) (Fig. 1C). These results confirmedthat the 38-kDa protein identified by the carboxyl-terminalantibody was a cross-reacting protein unrelated to hCTR1 andshowed that the 34–35-kDa protein bands corresponded to thenative hCTR1 protein.N-Linked Glycosylation of hCTR1—A substantial part of the

extramass of hCTR1 is accounted for byN-linked glycosylationat asparagine 15 (16, 17, 20). Treatment of endogenous hCTR1in Caco-2 cells with PNGase F reduced themass of the smear ofbands to about 26 kDa (Fig. 2A, lane 5). Mutation of asparagine15 to glutamine (N15Q) reduced the mass of hCTR1 to thesame size as PNGase F treatment (Fig. 2A, lanes 2 and 3).Migration of the N15Q mutant protein was not altered bytreatment with PNGase F (not shown), confirming previousconclusions that N15 is the only site of N-linked glycosyla-tion in hCTR1 (16, 20).N15Q mutant hCTR1 exhibited normal trafficking and

somewhat reduced copper transport in cultured mammaliancells. Total membranes from tet-regulated HEK293 cell linesthat overexpressed wild-type or N15Q mutant hCTR1 wereseparated on five-step sucrose gradients to isolate fractions

FIGURE 2. Analysis of N15Q mutant hCTR1. A, plasma membranes fromHEK293 tet-regulated cells expressing wild-type (WT; lane 1) or N15Q mutant(lanes 2 and 3) hCTR1. Shown are plasma membranes (30 �g/lane) fromCaco-2 cells containing endogenous hCTR1 either untreated (lane 4) ortreated with PNGase F (PF; lane 5). B, left panels, membrane fractions enrichedfor plasma membrane (P), Golgi (G), or endoplasmic reticulum (E) fromHEK293 cells expressing wild-type or N15Q mutant proteins (20 �g of mem-brane protein/lane). Right panel, N15Q membrane fractions (as in middlepanel) probed with antibody against the Na,K-ATPase �-subunit, a plasmamembrane protein. C, shown are pulldown assays of hCTR1 proteins fromcells labeled with impermeant biotin. Solubilized proteins from biotinylatedcells expressing wild-type hCTR1 (left panel) or N15Q hCTR1 (right panel) wereincubated with anti-hCTR1-loop beads (ab), streptavidin beads (str), or anti-hCTR1 beads after pull down with streptavidin beads (str-ab). The two hCTR1species pulled down from cells expressing N15Q represent FLAG-tagged pro-tein and protein that has lost the FLAG-tag by proteolysis (see Fig. 4). D, 64Cuuptake in tet-regulated HEK293 cells expressing wild-type hCTR1or N15Qmutant hCTR1 after 48 h of induction with tetracycline. Uptake in uninducedcells (HEK) is shown at the right. Rates shown are the average of threeexperiments.



enriched for plasma membrane, Golgi, and endoplasmic retic-ulum (Fig. 2B, see Ref. 21). Both wild-type and N15Q mutanthCTR1 proteins were found predominantly in the plasmamembrane fraction, as was the �-subunit of the Na,K-ATPase,a plasmamembranemarker (Fig. 2B). The cross-contaminating38-kDa protein described above was most abundant in theGolgi and ER-enriched fraction (Fig. 2B), with smaller amountssometimes co-fractionating with the plasma membrane (e.g.Fig. 2A, compare lanes 3–5).In addition to fractionating with surfacemembrane proteins,

N15Q protein was efficiently labeled at the cell surface with animpermeant biotin reagent (Fig. 2C). Biotinylated cells weresolubilized as described under “Experimental Procedures.”One-half of the solubilized proteinswas incubatedwith strepta-vidin beads and the other half with anti-hCTR1-loop beads.Both beads pulled down wild-type or N15Q mutant proteins,although the streptavidin beads did somore efficiently (Fig. 2C,compare lanes ab and str in each panel). The supernatants fromthe streptavidin pulldown reactions were then subjected to asecond pulldown experiment using the anti-hCTR1 loop beads.As shown in Fig. 2C, lanesmarked str-ab, only a small fractionof either solubilized hCTR1 protein remained after incubationwith streptavidin beads. We conclude from these experimentsthat most of the solubilized wild-type and N15Q mutanthCTR1 proteins (�95%) were biotinylated and, thus, present inthe cell surface membrane.As seen in Fig. 2C, overexpressed FLAG-tagged N15Q pro-

tein migrated in SDS-PAGE as a pair of bands. The proteinsweremore distinctly separated in 15% polyacrylamide gels (Fig.2C) than in 12% gels (Fig. 2, A and B). This pair of bands corre-sponded to epitope-tagged protein and protein that has lost theFLAG tag, presumably by proteolytic activity in vivo or duringpreparation (shown in Fig. 4).

64Cu uptake activity was somewhat reduced in cell linesexpressing N15Q mutant in comparison to wild-type hCTR1.Induction of amino-terminal FLAG-tagged hCTR1 expressionincreased copper transport activity significantly in HEK293cells (Fig. 2D,WT versus HEK). Cells expressing FLAG-taggedN15Q mutant protein had about 75% of the copper transportactivity of the wild-type expressing cells (Fig. 2D, N15Q versusWT; N15Q values were corrected for expression level asdescribed under “Experimental Procedures”). Thus, in mam-malian cells N-linked glycosylation was not necessary for traf-ficking of hCTR1 to the plasma membrane, and copper trans-port was modestly reduced by the loss of glycosylation.O-Linked Glycosylation of hCTR1—We used glycosidases to

show that hCTR1 containsO-linked polysaccharides.O-Linkedpolysaccharides are removed with amixture of exoglycosidasesthat act sequentially. Deglycosylation is completed byO-glyco-sidase, the enzyme responsible for removing galactose(�1–3)-N-acetylgalactosamine(a) “core 1” disaccharide that is attachedto serine or threonine in most O-linked polysaccharides (27).The number of monosaccharides per O-linked glycan variesfrom 4 or 5 to 100s (28).Treatment of endogenous hCTR1 fromCaco-2 cells or over-

expressed N15Q protein in HEK293 cells with glycosidasecocktails resulted in a reduction in the apparent mass of theprotein in SDS-PAGE. Caco-2 plasma membranes were either

mock-digested or digested with glycosidases, as shown in Fig.3A. As shown above in Fig. 2, treatmentwith PNGase F resultedin a shift from 35 to about 26 kDa (Fig. 3A, lane 2). The additionof the mixture of glycosidases that remove O-linked polysac-charides further reduced the apparent mass by 1–2 kDa (Fig.3A, lane 3). Treatment of overexpressed N15Q hCTR1 fromHEK293 cells with the O-glycosidase mixture also reduced theapparent mass of hCTR1 by 1–2 kDa (Fig. 3B, lane 3). These

FIGURE 3. Glycosidase treatment of wild-type and N15Q mutant hCTR1protein. A, endogenous hCTR1 in Caco-2 plasma membranes (�30 �g ofmembrane protein/lane) were either mock-digested (lane 1), digested withPNGase F (lane 2), PNGase F and O-glycosidase mixture (lane 3), or mixturealone (lane 4). B, overexpressed hCTR1 in plasma membranes from HEK293cells expressing wild-type (lane 1) or N15Q (lanes 2 and 3). The N15Q mem-branes were mock-digested (lane 2) or digested with the O-glycosidase mix-ture (lane 3). C, digestion of plasma membranes containing N15Q protein.Membranes were either mock-digested (Mock) or digested with sialidase(Sial., �-N-acetyl-hexosaminidase (�-hex.), �-(1– 4)-galactosidase (�-gal.), or amixture containing all three enzymes and O-glycanase (mixture). Anti-COOHtail antibodies were used to detect hCTR1 proteins.



results showed that hCTR1 has O-linked polysaccharide(s) inaddition to the glycosylation at N15.To identify terminal residues of theO-linked polysaccharides

on hCTR1,we treated plasmamembranes fromN15Q-express-ing cells with individual exoglycosidases present in themixture.In addition we also tested fucosidase alone and in the mixture(not shown). We found that sialidase was the only individualglycosidase that shifted the mobility of N15Q hCTR1 (Fig. 3C),indicating the presence of terminal sialic acid residues on amodest sized polysaccharide of between 1 and 2 kDa.Localization of O-Linked Polysaccharides to Thr-26–

Thr-27–Ser-28—We expected that the O-linked sugars wouldbe located in the extracellular amino terminus of hCTR1, sincethe rest of the molecule consists of three transmembranedomains, a cytoplasmic loop, a short cytoplasmic carboxyl-ter-minal tail, and a short linker sequence between transmembranedomains two and three (Fig. 1). Because there are 16 serine andthreonine residues distributed across the amino terminus ofhCTR1 (Fig. 4A), we first tested four truncation mutants thatlacked either the amino-terminal 22, 29, 34, or 53 amino acidsto determine whether a shift in mobility occurred after treat-ment with the O-glycosidase mixture. We designed the H22and A29 truncations to specifically test whether the Thr-26–Thr-27–Ser-28 sequence within this interval containedO-linked sugars. When the hCTR1 protein sequence wasscanned using a predictive algorithm (29), Thr-26 and Thr-27had the highest score for residues in hCTR1 likely to be sites ofO-glycosylation (Fig. 4A, starred residues).The various truncations together with wild-type and N15Q

mutant hCTR1 were expressed in tet-regulated HEK293 andMDCK cell lines. The truncated hCTR1 proteins migrated ingels in descending order as more of the amino terminus wasremoved (Fig. 4B, HEK293 lines are shown). The wild-type,N15Q, H22, and A29 proteins included an amino-terminalFLAG tag, whereas theG34 andN53 proteins had only amethi-onine residue added to the amino terminus of the truncation.As seen above, wild-type and N15Q hCTR1 proteins wereshifted to fastermobility after treatmentwith theO-glycosidasemixture. Of the four truncation mutants, only the H22 trunca-tion was shifted by glycosidase treatment, showing that (at leastpart of) theO-linked glycosylation of hCTR1 occurred betweenH22 andA29 (Fig. 4B). The seven amino acids within this inter-val include Thr-26, Thr-27, and Ser-28. The size of the shift inmobility of theH22mutant after glycosidase treatment appearscomparable with that of wild-type or N15Q protein, but wecould not definitively rule out the possibility that other residueson the amino-terminal side of H22might also containO-linkedsugars.Strikingly, themajority of theA29 truncationmutant protein

underwent proteolytic cleavage on the carboxyl side of alanine29. As shown in Fig. 4B the faster migrating protein in the A29sample recognized by the carboxyl-terminal anti-hCTR1 anti-body had an apparent mass of about 17 kDa. The 17-kDa A29protein was recognized by loop and COOH-tail antibodies butwas not recognized by anti-FLAG antibodies, showing that theFLAG-tagged amino terminus was lost on cleavage (Fig. 4C).The less abundant, slowermigrating bandwas full-length, since

it was recognized by both carboxyl-terminal and anti-FLAGantibodies (Fig. 4C).The proteolytic cleavage near G34 was predominant only in

theA29-truncated protein, although theH22 truncated proteincontained variable amounts of the 17-kDa cleavage product(Fig. 4C, left andmiddle panels). A 17-kDa band of similar sizewas also seen at low levels in some hCTR1 preparations with

FIGURE 4. Analysis of hCTR1 amino-terminal truncation mutants forO-linked glycosylation. A, the extracellular amino-terminal 61 amino acidsof hCTR1, showing the location of serine and threonine residues (dark orshaded circles, respectively), the site of N-glycosylation, and the amino terminiof four truncation mutants. The starred (**) threonine residues scored highestusing an algorithm used to predict sites of O-glycosylation. B, plasma mem-branes from HEK293 cells expressing wild-type, N15Q, and the four amino-terminal truncation mutants shown in panel A were mock-digested ordigested with the mixture of glycosidases that remove O-linked polysaccha-rides (20 �g of plasma membrane protein/lane). ab, antibody. C, plasmamembranes from cells expressing the hCTR1 mutants shown above each lanewere detected on Western blots with the antibodies indicated below eachpanel. The star indicates the relative mobility of the G34 truncation mutantprotein and the 17-kDa fragment observed in the adjacent lane. Arrowheadsshow the mobility of the two hCTR1 protein species in membranes from cellsexpressing the amino-terminal FLAG-tagged N15Q mutant. The fastermigrating species is not recognized by anti-FLAG antibody.



antibodies raised against the carboxyl terminus or intracellularloop of hCTR1.4 In any case, the A29 mutant protein was mostsusceptible to cleavage in multiple independent preparationsfrom both HEK293 and MDCK cells. These preparationsincluded other hCTR1 protein variants processed in parallel inthe same buffers that were not cleaved.Substitutions of Thr-26, Thr-27, and Ser-28 Result in Proteo-

lytic Cleavage—Wenext identified the specific residue that wasO-glycosylated by expressingmutants having single ormultiplealanine replacements in the Thr-26–Thr-27–Ser-28 tripeptidesequence (TTS sequence). Themutations in TTS weremade inboth wild-type andN15Qmutant backgrounds. Thesemutantswere in expressed in tet-regulated HEK293 and MDCK cellsand were analyzed with Western blots to determine their stateof glycosylation. We found that in both cell types, replacementof the TTS sequence with alanine residues (AAA) resulted invirtually complete proteolytic cleavage of hCTR1 protein verynear the position cleaved in the A29mutant (Fig. 5A). The AASdouble substitution mutant protein was cleaved to nearly thesame extent as the triple substitution AAA mutant, showingthat one or both threonines are needed to protect against cleav-age.Further analysis showed that threonine 27 was the principle

amino acid required within the TTS sequence to prevent cleav-age. Three single substitutionmutants (ATS, TAS, TTA) in theN15Qbackgroundwere expressed inHEK293 andMDCKcells.Of these, the TASmutant wasmost efficiently cleaved (Fig. 5B).We observed some cleavage of the ATS mutant protein, theextent of which was variable between preparations (Fig. 5B,lanesmarkedATS). Multiple protein species observed between24 and 34 kDa in Fig. 5B include 2 bands from uncleaved N15Q(seen in theN15Q TTS lane in Fig. 5A) and the dimeric form ofthe 17-kDa cleavage product, which migrated between theslowermigrating uncleavedN15Qprotein species and thewild-type hCTR1 smear at 34–35 kDa. This dimeric species wasalways observed to some extent in samples containing the

17-kDa protein but was never observed in samples that did notcontain the 17-kDa species. M34 mutant protein was includedin Fig. 5B to show the migration of the dimer from this protein,which is similar in size to the 17-kDa fragment.It, therefore, appears that Thr-27 is the key site of O-linked

glycosylation in the TTS sequence. Loss of O-glycosylation ofhCTR1 caused by a lack of Thr-27 resulted in efficient proteo-lytic cleavage of hCTR1. This cleavage likely occurred on thecarboxyl side of serine 28, since the FLAG-tagged A29 trunca-tion mutant (Fig. 4) contained the site(s) of cleavage thatresulted in the 17-kDa fragment. Because theMG34 truncationmutant migrated slightly faster than the 17-kDa cleavage prod-uct (Fig. 4C, ab panel, loop, *), the site of cleavage appears tooccur between A29 and H33 in the sequence ASHSH.Loss of O-Linked Glycosylation in Wild-type hCTR1 Also

Results in Proteolytic Cleavage—Weobserved efficient proteol-ysis of hCTR1 when Thr-27 was substituted with alanine, andwe inferred that the loss of O-linked glycosylation resulted inthe cleavage of the hCTR1 amino terminus. It was also possiblethat alanine substitution mutations might affect the structureof hCTR1, rendering it susceptible to proteolysis due to mis-folding (for example) and that the observed cleavage was notsimply due to the loss of O-linked polysaccharides. We there-fore expressed hCTR1 having wild-type sequence in CHOLDLD cells, which are conditional for O-glycosylation. LDLDcells are among a group of cell lines defective for the expressionof lowdensity lipoprotein receptors on their surface (30). LDLDcells lack epimerase activity needed for the synthesis of galac-tose and N-acetylgalactosamine. Under restrictive conditionsin which N-acetylgalactosamine was not available, we foundthat cleavage of the N terminus of hCTR1 also occurred.The expression level of CTR1 is very low in CHO cells and

the LDLD-CHOcell line.4We therefore transfected LDLD cellswith amino-terminal FLAG-tagged wild-type hCTR1. Stablelines were selected in normal growth media and checked forhCTR1 expression with anti-FLAG and anti-hCTR1 antibodies(not shown). The level of hCTR1 overexpression was consider-ably less than hCTR1 expression in the tet-regulated HEK293or MDCK cells, but hCTR1 was easily detected in purifiedplasma membrane fractions. To observe the effect of eliminat-ing O-linked glycosylation on hCTR1, cells were grown withdifferent sugars supplemented in a glycosylation-restrictivemedium. The restrictive medium contained 3% dialyzed serumto eliminate contaminating galactose and N-acetylgalac-tosamine found in normal fetal calf serum. The four growthconditions tested had restrictive media supplemented withgalactose and N-acetylgalactosamine, with galactose alone,with N-acetylgalactosamine alone, or with no added sugar.Plasma membrane fractions were prepared and examined onWestern blots.Western blot analysis revealed that hCTR1 was proteolyti-

cally cleavedwhen the LDLD cells were grown in the absence ofN-acetyl-galactosamine. As shown in Fig. 6, cells grown in thepresence of galactose and N-acetylgalactosamine or N-acetyl-galactosamine alone contained primarily full-length (34–35kDa) hCTR1, whereas cells grown in galactose alone or noadded sugar contained primarily the 17-kDa polypeptide. Somefully glycosylated 35-kDa protein synthesized before the 48-h4 E. B. Maryon and J. H. Kaplan, unpublished observation.

FIGURE 5. Expression of hCTR1 mutants with alanine substitutions in Thr-26, Thr-27, and Ser-28 (TTS). Plasma membranes from cells expressing var-ious hCTR1 substitution mutants were analyzed on Western blots using anti-COOH tail antibody (15 �g of plasma membrane protein/lane). The substitutionswere made in wild-type or N15Q mutant backgrounds as shown above the pan-els. The amino acid sequence of each hCTR1 variant is shown above the lanes.The cell type in which each mutant was expressed is shown below the lanes.A, triple or double alanine substitutions in wild-type or N15Q mutant back-grounds from the indicated cell types. B, single substitution mutants (N15Qbackground) expressed HEK293 and MDCK cells. The far right lane in panel Bshows the relative mobility of the monomer and dimer forms of G34 hCTR1truncation mutant (* and **, respectively).



treatment in restrictive media was probably still present, sincethe half-life of the 35-kDa hCTR1 protein was reported to be atleast 2 days (16). In any case, hCTR1 is very efficiently cleaved incells deprived of N-acetylgalactosamine, which are unable toinitiate O-linked glycosylation (30). Perhaps surprisingly, theabsence of galactose supplementation did not affect the migra-tion of hCTR1 (Fig. 6, third lane), suggesting that galactose isnot required for the maturation of either N- or O-linkedpolysaccharides on hCTR1. We conclude from these data andfrom the experiments above that in the absence of O-glycosy-lation atThr-27, hCTR1undergoes proteolytic cleavage to yielda 17-kDa polypeptide lacking �30 amino acids from the aminoterminus.Proteolytically Cleaved hCTR1 Is Found in the Plasma

Membrane—To determine the subcellular location of the17-kDa hCTR1 fragment, we fractionated membranes fromHEK293 and LDLD cells overexpressing wild-type or cleavedhCTR1. The HEK293 cell line used to examine the fraction-ation of the 17-kDa fragment contained the tet-inducible AAA/N15Q mutant hCTR1 (i.e. the triple substitution of alanine forThr-26–Thr-27–Ser-28 that also included the N15Q muta-tion). As seen in Fig. 5A, most (greater than 95%) of the AAA/N15Qmutant protein is cleaved. Fractions enriched for plasmamembrane, Golgi, and endoplasmic reticulum from HEK293and LDLDCHOcells are shown in Fig. 7A. Both full-length and17-kDa hCTR1 proteins were found greatly enriched in plasmamembrane fractions. The �-subunit of the Na,K-ATPase, (aplasma membrane marker) co-fractionated with hCTR1 pro-teins (Fig. 7A).To determine whether the 17-kDa hCTR1 fragment is in the

plasmamembrane and not simply co-fractionatingwith plasmamembranes, we performed surface labeling in HEK293 cellsexpressing either wild-type or AAA/N15Q substitutionmutanthCTR1 proteins. The cells were solubilized, divided in twoequal portions, and incubated with either streptavidin-coatedbeads or beads linked to anti-hCTR1 loop antibodies. Proteinswere eluted as described under “Experimental Procedures” andanalyzed on Western blots.

As seen in Fig. 7B, both anti-hCTR1 (lanes ab) and strepta-vidin beads (lanes str) efficiently pulled down the wild-type and17-kDa hCTR1 protein species. The location of the dimericform of the 17-kDa polypeptides is noted (*). This speciesmigrated slightly faster than did wild-type hCTR1 and wasabundant in proteins solubilized with Triton-X-100. A smallamount (less than 5%) of uncleaved protein (N15Q) is also vis-ible in Fig. 7B, right panel (**). The supernatants from thestreptavidin pulldown reactions were then subjected to a sec-ond pulldown experiment using the anti-hCTR1 loop beads. Ifwild-type or mutant proteins were not biotinylated (i.e. werenot in the plasmamembrane), they should be recovered by thissecond pulldown. Very little wild-type or 17-kDa protein waspulled down in this second reaction (Fig. 7B, lanesmarked str-ab). Surface labeling of the AAS and TAS mutants gave similarresults (not shown). We concluded from these experimentsthat the great majority (more than 95%) of wild-type and17-kDa hCTR1 proteins were available for biotinylation andthus at the cell surface.Proteolytically Cleaved hCTR1Has Reduced Levels of Copper

Transport—Having confirmed that the 17-kDa hCTR1 waslocated in the plasma membrane, we measured the capacity ofthis cleaved protein to transport copper. First, wemeasured the

FIGURE 6. Plasma membranes from an LDLD cell line stably expressingwild-type (amino-terminal FLAG-tagged) hCTR1. Membranes were iso-lated from cells grown in four different media having sugar supplementationshown above each lane. 30 �g of plasma membrane protein was run in eachlane. GalNac is N-acetylgalactosamine.

FIGURE 7. Cellular location and copper transport mediated by the 17-kDahCTR1 polypeptide. A, fractionated membranes from cells expressing wild-type or 17-kDa hCTR1 proteins. Membrane fractions enriched for plasmamembrane (P), Golgi (G), or endoplasmic reticulum (E) from HEK293 or LDLDcells were analyzed on Western blots. Left panels, wild-type (WT) orAAA(N15Q) mutant hCTR1 in HEK293 cells (10 �g membrane protein/lane).Right panels, stably expressed wild-type hCTR1 in LDLD cells grown in mediawith or without sugar supplementation (30 �g of membrane protein/lane).The membranes were cut, and Western blots were done using either Na,K-ATPase antibody (above) or anti- COOH-tail antibody (below). B, pulldownassays of hCTR1 proteins from cells labeled with impermeant biotin. Equalvolumes solubilized proteins from biotinylated cells expressing wild-typehCTR1 (left panel) or AAA(N15Q) hCTR1 (right panel) were incubated withanti-hCTR1-loop beads (ab), streptavidin beads (str), or anti-hCTR1 beadsafter pull down with streptavidin beads (str-ab). One-quarter of the totalmaterial eluted from the beads was run in each lane. Anti-hCTR1 carboxyl-terminal antibodies were used for the Western blot. C, 64Cu uptake inLDLD or CHO cells grown in media with or without sugar supplementationas in Fig. 6, first and fourth lanes. Rates shown are the average from threeexperiments. D, 64Cu uptake in tet-regulated HEK293 cells expressingwild-type hCTR1or AAA(N15Q) mutant hCTR1 after 48 h of tetracyclineinduction. Uptake in uninduced cells (HEK) is shown at the right. Ratesshown are the average of three experiments.



level of copper transport in CHO cells and in LDLD-CHO celllines stably expressing hCTR1. 64Cu uptake in the presence of2.5 �M total copper was measured in cells grown in permissiveor restrictivemedia for at least 72 h. Under these conditions themajority of hCTR1 in restrictive media underwent cleavage inLDLD cells (Fig. 7A). In LDLD cells overexpressing hCTR1grown in the absence of galactose and N-acetylgalactosamine,64Cu uptake was about 55% that of the level observed in cellsgrownwith sugar supplementation (Fig. 7C). Sugar supplemen-tation had no effect on 64Cu uptake in the parental CHO cellline, which has relatively low 64Cu uptake activity (Fig. 7C).We then measured 64Cu uptake in HEK293 cells overex-

pressing wild-type or AAA/N15Qmutant hCTR1. The two celllines were inducedwith tetracycline for 2 days and then assayedfor 64Cu uptake in the presence of 2.5 �M copper. Uninducedcontrol cells were also assayed under the same conditions. Theresults of this experiment are shown in Fig. 7D. Cells expressingthe truncated 17-kDa hCTR1 protein (theAAA/N15Qmutant)mediated 64Cuuptake at�50% that of the level observed in cellsexpressing full-length hCTR1. Because endogenous wild-typeand uncleaved full-length proteinmay have contributed a smallfraction of the copper transport observed, the 17-kDa cleavedprotein may have exhibited slightly less than 50% of the activityof 64Cu uptake observed for full-length hCTR1. We concludethat the truncated 17-kDa hCTR1 protein is competent totransport copper but at a reduced level compared with full-length hCTR1.

DISCUSSION

Wehave identified a previously unknownmodification of theamino terminus of the hCTR1 copper transporter, the additionof O-linked polysaccharides at Thr-27 (Fig. 8A). We show thatin the absence of this glycosylation, the amino terminus under-

goes a discrete proteolytic cleavage on the carboxyl side ofThr-27 to leave a truncated transporter that is located at the cellsurface. The truncated hCTR1 protein mediated Cu transportat 50–60% that of the rate observed for full-length hCTR1.Wealso examined the trafficking and 64Cu transport capacity ofhCTR1 that lacks N-linked glycosylation at Asn-15. N15Qmutant protein retained its native size, trafficked normally tothe plasma membrane, and had about 75% copper transportactivity of wild-type hCTR1.Anti-hCTR1 Antibodies—The identification of hCTR1 on

Western blots has been hampered by the tendency of the proteinto migrate in SDS-PAGE as a multiplicity of bands of differingapparentmolecularmass (17, 18, 25, 26). Several factorsgive rise tothese numerous species, including variable post-translationalmodifications, multimeric and/or aggregated forms, proteolyticfragments, and irrelevant cross-reacting proteins. Using two inde-pendent antibodies raised against the carboxyl-terminal tail andthe cytoplasmic loop (Fig. 1), we found that endogenous and over-expressed wild-type hCTR1 migrates in SDS-PAGE as closelyspaced smear of bands at �33–35 kDa (Fig. 1). It is likely that thesmearof full-lengthproteinaround33–35kDa is a consequenceofheterogeneity inN- andO-linked glycosylation.We used three lines of evidence to show that the 33–35-kDa

species corresponds to monomeric hCTR1. First, two antibod-ies raised against different parts of hCTR1 recognize proteins ofthe same size in plasmamembrane fractions from different celltypes (Fig. 1B). Second, immunoprecipitations (or pulldownassays) using either of our two anti-hCTR1 antibodies precipi-tate 33–35-kDa proteins that are recognized by both antibod-ies. Third, both antibodies detect proteins of descending size inthe expected order in plasmamembranes from cells expressinga series of truncation mutants (Fig. 4).

FIGURE 8. Structure and conservation of hCTR1. A, hCTR1 protein showing structural features, such as the site of N-linked glycosylation at Asn-15 (N-GLY) andtwo methionines essential for copper transport (starred residues in M2 methionine-rich sequence). Also shown are the site of O-linked glycosylation (O-GLY)identified in this study and the possible sites of cleavage that resulted in the truncated 17-kDa polypeptide. B, alignment of the extracellular amino termini fromseven mammalian CTR1 orthologs (obtained from NCBI, www.ncbi.nlm.nih.gov.) The consensus site for N-linked glycosylation is shaded as is the TTS sequencecontaining the site of O-linked glycosylation.



N-Linked Glycosylation of hCTR1—We examined the traf-ficking and 64Cu uptake activity of N15Q mutant hCTR1 inmammalian cells. In some cases, for example, the HERG volt-age-gated potassium channel (31), N-linked glycosylation isrequired for trafficking to the surface membrane. We foundthat membranes containing overexpressed N15Q fractionatedin an identical manner as wild-type hCTR1 (Fig. 2B) and thatboth N15Q and wild-type proteins were efficiently surface-la-beled (Fig. 2C). However, the 64Cu uptake activity of N15Qwasreduced by about 25% relative to wild type (Fig. 2D). Thus,although N-glycosylation of the transporter was not necessaryfor normal trafficking of hCTR1 to the surface, copper trans-port was somewhat reduced.N-Linked glycosylationmay play arole in stabilizing ormodifying the structure of hCTR1 in a waythat facilitates copper transport. It is interesting to note that allmammalian CTR1 orthologs examined have a conservedNX(T/S) sequence in the amino terminus (Fig. 8B).O-Glycosylation of hCTR1—We showed that hCTR1 is

O-glycosylated within the amino terminus, primarily if notexclusively at Thr-27. The loss of this glycosylation resulted invirtually complete cleavage of hCTR1 on the carboxyl side ofThr-27. The cleavage produced a 17-kDa polypeptide that wasfound in the plasma membrane and was functional as a coppertransporter. This cleavage was observed in several differentcontexts in which O-linked glycosylation was absent (Figs.4–6), and it occurred in human, canine, and Chinese hamstercell lines. We have not yet examined the glycosylation state ofCTR1 proteins in non-human mammalian cells, but a compar-ison of the amino terminus from six sequenced orthologousCTR1 proteins shows that the TTS sequence and surroundingresidues are largely conserved (Fig. 8B).Based on glycosidase digests, the O-linked polysaccharide is

1–2 kDa, suggesting a single polysaccharide of 4–6 sugar resi-dues that includes terminal sialic acid (Fig. 3C). Typical mucin-type polysaccharides share this general structure (27, 28). Weinfer that Thr-27 is the principle site of glycosylation based onthe extent of cleavage of the Thr-27 alanine substitutionmutant (TAS, Fig. 6). Because we also observe some cleavage intheThr-26mutant (ATS, Fig. 6), it is possible that Thr-26 is alsoglycosylated to some extent. However, it seems equally likelythat the alanine substitution at Thr-26may affect the efficiencyof glycosylation of Thr-27 (32, 33). Further structural analysisof hCTR1 O-linked polysaccharides will be needed to confirmthe identity and linkages of the monosaccharides as well as thespecificity of glycosylation at Thr-27.We could not determine from these experiments whether

any of the 6 serine/threonine residues on the amino-terminalside of Thr-26 are also O-glycosylated because we have not yetisolated the amino-terminal fragment that results from cleav-age. This fragmentmight be released into themediumorwithinthe cell or be degraded, depending on the mechanism andlocation of cleavage. The shift (increase) in mobility of theH22 truncation mutant that contained the O-glycosylation atThr-27 after glycosidase treatment appeared similar to that ofthe intact hCTR1 or N15Q protein (Fig. 4), suggesting thatThr-27 is the single site of O-linked polysaccharide additionin the transporter.

Trafficking of hCTR1 to the Plasma Membrane—In someinstances O-linked glycosylation is necessary for efficient traf-ficking of membrane proteins to the cell surface (34, 35). Wefound that O-linked glycosylation of hCTR1 is apparently notrequired for trafficking of a functional transporter to the plasmamembrane. First, expression of hCTR1 in LDLD cells underconditions in which O-linked glycosylation does not occur didnot prevent the trafficking of hCTR1 to the plasma membrane(Fig. 7,A and B). Second, in addition to variousmutants lackingO-glycosylation, which were found in the plasmamembrane as17-kDa truncated proteins (Figs. 5 and 7), the G34 truncationmutant protein, which lacks both the Thr-27 and Asn-15, wascompetent for copper uptake and was found in plasma mem-brane fractions.5 However, we do not know if intact, unglyco-sylated hCTR1 is delivered to the plasma membrane andcleaved or if cleavage occurs before delivery.It is conceivable that intact hCTR1does not reach the surface

unless it either becomes O-glycosylated or is cleaved, but themechanism by which this would occur (as well as the compart-ment in which it would take place) is unclear. Furthermore, wehave not observed intact un-O-glycosylated protein inGolgi- orER-enriched membrane fractions (see Fig. 7A), so a parsimoni-ous interpretation would be that O-linked glycosylation is notrequired for delivery of hCTR1 to the surfacemembrane. Thus,neither N- nor O-linked glycosylation appears to be requiredfor normal trafficking of the transporter to the plasma mem-brane. It remains possible that hCTR1 glycosylation mightaffect trafficking of hCTR1 to apical or basolateral surfaces inpolarized cells (36).Proteolytic Cleavage—The cleavage of hCTR1 in the absence

of O-glycosylation at Thr-27 produces a discreet 17-kDapolypeptide lacking the first 29–33 amino acids in hCTR1. Wewere able to map the cleavage to a site between A29 and G34because the 17-kDa fragment had a slightly greater mass inSDS-PAGE than did theMG34 protein (Fig. 4C, *) and the A29truncation mutant includes the cleavage site (Fig. 4B). Fig. 8Ashows the deuced location of cleavage in hCTR1. Thissequence, ASHSHG, is unusual because it does not containconventional protease cleavage sites. Thismay indicate that thesequence is unusually exposed or vulnerable to general proteaseactivity or that there is a protease associated with the hCTR1transporter that specifically cleaves within this ASHSHGsequence.We do not yet know the cellular compartment in which pro-

teolytic cleavage of hCTR1 takes place. BecauseO-linked sugarsare added in theGolgi stack at various points duringmaturationof proteins (27), it seems unlikely that cleavage would occurduring transit through the Golgi compartment. The 17-kDacleavage product was found in the plasma membrane fractionandwas surface-labeledwith biotin (Fig. 7). It seemsmost likelythat cleavage occurs either late in the Golgi, during transit fromthe Golgi to the surface, within the plasma membrane, or in anendosome-like compartment that recycles to and from the sur-face. Numerous examples of membrane-associated or integralmembrane proteases in the plasma membrane have been

5 S. Molloy and J. Kaplan, unpublished information.



reported (37–40) as well as examples of internalization andsubsequent cleavage (41). We are currently in the process ofinvestigating these issues.The function of O-linked glycosylation of hCTR1 appears to

be to protect against cleavage of a portion of the extracellularamino terminus. This role has been demonstrated for severalother surface membrane proteins that contain O-linkedpolysaccharides, such as the low density lipoprotein receptor(30), the transferrin receptor (42), and the �-subunit of meprin(43). The need to prevent cleavage and subsequent loss of extra-cellular portions of these proteins may simply be to maintainthe integrity of the protein structure, although in some cases(e.g. the transferrin receptor), cleavage after loss of O-linkedglycosylation mimics a physiologic mechanism in which a sol-uble portion of the receptor is released by regulated cleavage(44).In the case of hCTR1, the 17-kDa polypeptide is only partly

impaired for copper transport in cell-based assays in vitro (Fig.7), perhaps not surprising since the two methionines known tobe essential for copper transport (15) are retained (Fig. 8A,starred residues). The portion of the amino terminus lost fromthe 17-kDa polypeptide is the most variable among CTR1orthologs (Fig. 8B), but it includes the H-1 and H-2 histidine-rich and the M-1 methionine-rich regions (Fig. 1) that mighthave roles in vivo that are not evident in cell-based assays offunction. The proteolysis of hCTR1 might represent an as yetuncharacterized aspect of the regulation of copper homeostasisin which the released glycopeptide binds to a target or that theremaining transporter has altered functions or both.In summary, we have characterized the site of O-linked gly-

cosylation of hCTR1, the major human copper uptake protein.The presence of this newly identified modification protectsagainst a specific, efficient amino-terminal truncation by an asyet unknown protease. Whether or not there are hitherto uni-dentified regulatory or functional consequences of this proteo-lytic cleavage awaits further investigation.

Acknowledgments—We thank John Jellison for excellent technicalassistance and Professor Anant Menon (Weill Cornell Medical Col-lege) and members of the Kaplan laboratory for helpful discussions.

REFERENCES1. Linder,M. C., andHazegh-Azam,M. (1996)Am. J. Clin. Nutr. (Suppl.) 63,

797–8112. Linder, M. C., Wooten, L., Cerveza, P., Cotton, S., Shulze, R., and Lomeli,

N. (1998) Am. J. Clin. Nutr. 67, Suppl. 5, 965–9713. Linder, M. C. (2001)Mutat. Res. 475, 141–1524. Huffman, D. L., and O’Halloran, T. V. (2001) Annu. Rev. Biochem. 70,

677–7015. Prohaska, J. R., and Gybina, A. A. (2004) J. Nutr. 134, 1003–10066. Puig, S., and Thiele, D. J. (2002) Curr. Opin. Chem. Biol. 6, 171–1807. Maryon, E. B., Molloy, S. A., Zimnicka, A. M., and Kaplan, J. H. (2007)

Biometals 20, 355–3648. Lutsenko, S., and Petris, M. J. (2003) J. Membr. Biol. 191, 1–129. Dancis, A., Haile, D., Yuan, D. S., and Klausner, R. D. (1994) J. Biol. Chem.

269, 25660–2566710. Zhou, B., and Gitschier, J. (1997) Proc. Natl. Acad. Sci. U. S. A. 94,

7481–748611. Kuo, Y. M., Zhou, B., Cosco, D., and Gitschier, J. (2001) Proc. Natl. Acad.

Sci. U. S. A. 98, 6836–684112. Lee, J., Prohaska, J. R., and Thiele, D. J. (2001) Proc. Natl. Acad. Sci. U. S. A.

98, 6842–684713. Aller, S. G., and Unger, V. M. (2006) Proc. Natl. Acad. Sci. U. S. A. 103,

3627–363214. Eisses, J. F., and Kaplan, J. H. (2005) J. Biol. Chem. 280, 37159–3716815. Puig, S., Lee, J., Lau, M., and Thiele, D. J. (2002) J. Biol. Chem. 277,

26021–2603016. Klomp, A. E., Juijn, J. A., van der Gun, L. T., van den Berg, I. E., Berger, R.,

and Klomp, L. W. (2003) Biochem. J. 370, 881–88917. Klomp, A. E., Tops, B. B., Van Denberg, I. E., Berger, R., and Klomp, L. W.

(2002) Biochem. J. 364, 497–50518. Lee, J., Pena, M. M., Nose, Y., and Thiele, D. J. (2002) J. Biol. Chem. 277,

4380–438719. Eisses, J. F., and Kaplan, J. H. (2002) J. Biol. Chem. 277, 29162–2917120. Eisses, J. F., Chi, Y., and Kaplan, J. H. (2005) J. Biol. Chem. 280, 9635–963921. Gatto, C., McLoud, S. M., and Kaplan, J. H. (2001) Am. J. Physiol. Cell

Physiol. 281, 982–99222. Bradford, M. M. (1976) Anal. Biochem. 72, 248–25423. Gottardi, C. J., Dunbar, L. A., and Caplan, M. J. (1995) Am. J. Physiol. 268,

F285–F29524. Laemmli, U. K. (1970) Nature 227, 680–68525. Hardman, B., Manuelpillai, U., Wallace, E. M., Monty, J. F., Kramer, D. R.,

Kuo, Y. M., Mercer, J. F., and Ackland, M. L. (2006) Placenta 27, 968–97726. Kuo, Y. M., Gybina, A. A., Pyatskowit, J. W., Gitschier, J., and Prohaska,

J. R. (2006) J. Nutr. 136, 21–2627. Van den Steen, P., Rudd, P. M., Dwek, R. A., and Opdenakker, G. (1998)

Crit. Rev. Biochem. Mol. Biol. 33, 151–20828. Taylor, K. E., and Drickamer, K. (2004) Introduction to Glycobiology, pp.

58–79, Oxford University Press, Oxford29. Hansen, J. E., Lund, O., Engelbrecht, J., Bohr, H., Nielsen, J. O., and Han-

sen, J. E. (1995) Biochem. J. 308, 801–81330. Kozarsky, K., Kingsley, D., and Krieger, M. (1988) Proc. Natl. Acad. Sci.

U. S. A. 85, 4335–433931. Petrecca, K., Atanasiu, R., Akhavan, A., and Shrier, A. (1999) J. Physiol.

(Lond.) 515, 41–4832. Gerken, T. A., Zhang, J., Levine, J., and Elhammer, A. (2002) J. Biol. Chem.

277, 49850–4986233. Gerken, T. A., Gilmore, M., and Zhang, J. (2002) J. Biol. Chem. 277,

7736–775134. Kozarsky, K. F., Call, S. M., Dower, S. K., and Krieger, M. (1988)Mol. Cell.

Biol. 8, 3357–336335. Remaley, A. T., Ugorski, M., Wu, N., Litzky, L., Burger, S. R., Moore, J. S.,

Fukuda, M., and Spitalnik, S. L. (1991) J. Biol. Chem. 266, 24176–2418336. Potter, B. A., Hughey, R. P., and Weisz, O. A. (2006) Am. J. Physiol. Cell

Physiol. 290, 1–1037. Dello Sbarba, P., and Rovida, E. (2002) Biol. Chem. 383, 69–8338. Angeletti, B., Waldron, K. J., Freeman, K. B., Bawagan, H., Hussain, I.,

Miller, C. C., Lau, K. F., Tennant, M. E., Dennison, C., Robinson, N. J., andDingwall, C. (2005) J. Biol. Chem. 280, 17930–17937

39. Chesneau, V., Becherer, J. D., Zheng, Y., Erdjument-Bromage, H., Tempst,P., and Blobel, C. P. (2003) J. Biol. Chem. 278, 22331–22340

40. Zou, Z., Chung, B., Nguyen, T., Mentone, S., Thomson, B., and Biemes-derfer, D. (2004) J. Biol. Chem. 279, 34302–34310

41. Rutledge, E. A., Green, F. A., and Enns, C. A. (1994) J. Biol. Chem. 269,31864–31868

42. Rutledge, E. A., Root, B. J., Lucas, J. J., and Enns, C. A. (1994) Blood 83,580–586

43. Leuenberger, B., Hahn, D., Pischitzis, A., Hansen, M. K., and Sterchi, E. E.(2003) Biochem. J. 369, 659–665

44. Dassler, K., Zydek,M.,Wandzik, K., Kaup,M., and Fuchs, H. (2006) J. Biol.Chem. 281, 3297–3304



o-linkedglycosylationatthreonine27protectsthecopper ... · 067166, project 1 (to j.h.k.). the costs...

Documents