&o wvf ef m pcufoujpo ev - paul sabatier...
TRANSCRIPT
et discipline ou spécialité
Jury :
le
Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier)
Cheat Sophal
mercredi 8 juillet 2015
Individual and combined effects of the trichothecenes deoxynivalenol and
nivalenol ex vivo and in vivo on pig intestinal mucosa
ED SEVAB : Pathologie, Toxicologie, Génétique et Nutrition
UMR 1331 TOXALIM, Research Centre in Food Toxicology, INRA-INP-ENV-UPS de Toulouse
Couderc Bettina, Professeur
Desfontis Jean-Claude, Professeur, Rapporteur
Feidt Cyril, Professeur, Rapporteur
Oswald Isabelle, Directeur de Recherches
Raymond-Letron Isabelle, Maître de Conférences HDR
Kolf-ClauwMartine
1
Acknowledgements
First of all, I would like to express my sincere thanks to all the members of the thesis
committee who had taken their busiest time to be present at my thesis defense, Prof.
Bettina Couderc; the reporters, Prof. Jean-Claude Desfontis and Prof. Cyril Feidt; Dr.
Isabelle Oswald and Dr. Isabelle Raymond-Letron.
I wish to extend my deepest appreciation and thanks to Prof. Martine Kolf-Clauw for her
gentle, kind and generous, yet robust supervision on the thesis works. She has always given
me the constructive critical ideas alongwith during the three years aiming at improving
knowledge, ability and inspiration for toxicological assessment. Being as similar as mother and
son, she introduced a well-equipped apartment with a good surrounding environment and
provided extra household stuffs for being used during the stay.
I wish to extend my deepest appreciation to Dr. Isabelle Oswald for accepting to take part in
her research team, team 5, and her very strong recommendation letter for obtaining the
scholarship, resulting in today’s thesis. She often provides me a global point of view in the
research field in mycotoxins and technical methods that are appropriable and applicable for
being used in home country. Besides, she welcomes for any further collaborations in the
research field between home country, Cambodia and host country, France; thank you for your
glance at our country with high consideration in improving higher education in such a
developing country.
I also wish to extend my deepest appreciation and thanks to Dr. Isabelle Raymond-Letron for
her suggestion in the field of histopathology. In spite of the fact that there had been plenty
piles of working microscopic slides of her own on her desk; still she was able to share her
time to explain me the principal concepts by illustrating my own treated slides under a
microscope.
I also extend my deepest appreciation to Prof. Sovan Lek, an initiator who has brought the
TECHNO1 scholarship project and the others from ERASMUS MUNDUS programme, for
opening a way to this world of research. Through these projects, mutual enrichment and
2
better understanding between the EU and South-East Asia should be fostered at higher
education level. Although this works may not be immediately applied in my home country due
to the research facilities, I have a broader vision for long term development in this field as
well as the collaboration. Prof. Bernard Salles, director of Toxalim is acknowledged for his
informative e-mail to reach the acceptance from Dr. Isabelle Oswald. Prof. Claude Maranges,
head of the doctoral school, SEVAB, is grateful for his authorization to the doctoral
program. Dominique Pantalacci, secretary of the SEVAB, is appreciated for her well
management and coordination in the doctoral course works. Amelie Sigaudo, European project
manager and her colleagues are appreciated for their well coordination.
I wish to extend my deepest appreciation and thanks to my colleagues and friends throughout
the team, the Toxalim, the ENVT, the UPS and the Alliance Française de Toulouse, who have
so generously provided their constructive critical suggestions and encouragement for this
work and also for the French language study.
I also wish to acknowledge the physical, mental and time contributions of the team and the
others: Philippe Pinton for his qRT-PCR technical and experimental animal support Anne-Marie
Cossalter for animal care and experimental animal support, Joëlle Laffitte and Soraya
Tadrist for their helpful assistance, Olivier Lafaix and Juliette Cognie for helping in the
loops experiments, Celine Bleuart and Isabelle Pardo for training in tissue staining and
technical assistance for immunohistochemistry, Faouzi Lyazhri for statistical advice, Jean-
Denis Bailly for his constructive idea and opinion on the thesis oral presentation and on the
researches in the future.
I also appreciate the kind suggestions and helpful manner from Imourana Alassane-Kpembi, a
closed friend. An unforgettable first lunch from Selma Snini at the cantine, a kindness in
accommodation installation from Anwar EL Mahgubi, kindly regards from Patricia Cano, Alix
Pierron, Julie Seeboth, Yann Biggy, Stela Desto, Brankica Aleksic, Sylviane Bailly, Olivier Puel,
Arlette Querin, Marie-Rose Trumel, Pascal Gourbeyre, Delphine Payros, Joanna Tannous,
Sabria Mimoun, Rhoda El Khoury, Joya Makhlouf, Amaranta Aliciacus, Laura Costes, Leticia
Murate, Viviane Maruo, Huong Le Thanh and everyone from the team are appreciated and
3
acknowledged. This works successfully achieved depend on a very warm and comfortable
working environment. Thank you for allowing me in this best condition!
I am grateful to Cambodian brothers, sisters in France for their welcome and encouragement
and those in Cambodia for their informative communication, especially those from Royal
University of Agriculture.
Finally, I wish to thank my daughter Arunvatei Phal, my son Duongpisedth Phal, my wife
Sereirumny Huot and my parents for their patience, support and encouragement during this
process. Without them, this thesis might not be completed; thank you for being with me!
Grâce au Cambodge, Merci la France!!
Toulouse, July 08, 2015
Sincerely yours,
Sophal CHEAT
4
List of documents
- Book chapter: Mycotoxin outbreak in animal feed, 15
- Paper 1: Nivalenol has a greater impact than deoxynivalenol on pig jejunum mucosa in vitro on
explants and in vivo on intestinal loops, 68
- Paper 2: Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and nivalenol
show synergism on jejunal enterocytes, 86
5
Acknowledgements, 1
List of documents, 4
List of publications and communications, 6
List of abbreviations, 8
Introduction, 9
Chapter I: General background and objective of the work, 9
1.1. Context of the study, 9
1.1.1. Mycotoxins, 9
1.1.2. Pig intestine as a target for DON and NIV, 10
1.1.3. Sensitive biomarkers of mycotoxins in small intestine, 12
1.2. Mycotoxin outbreak in animal feed (book chapter) , 15
1.3. Objective of the PhD thesis, 59
1.4. The PhD thesis structure, 59
Chapter II: Materials and Methods, 60
2.1. Biological models, 60
2.1.1. Explant model, 60
2.1.2. Loops model, 62
2.1.3. Animal experiments, 64
2.2. Histological assessments, 65
2.2.1. Morphometry, 65
2.2.2. Immunohistochemistry, 65
2.3. Gene expression (qRT-PCR) , 66
Chapter III: Results and discussion, 68
3.1. Paper 1: Nivalenol has a greater impact than deoxynivalenol on pig jejunum mucosa in
vitro on explants and in vivo on intestinal loops, 68
3.2. Paper 2: Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and
nivalenol show synergism on jejunal enterocytes, 86
3.3. General discussion, 112
3.4. General conclusion, 116
3.5. Perspectives, 116
References, 118
Appendix, 140
6
List of publications and communications
Publications
1). Cheat S, Oswald IP, Kolf-Clauw M. Mycotoxin outbreak in animal feed. In: Carol A. Wallace
and Louise J. Manning, editors. Foodborne diseases: Case studies of outbreaks in agri-food
industries. The CRC Press, UK; 2015?. Accepted.
2). Cheat, S.; Gerez, J.R.; Cognié, J.; Alassane-Kpembi, I.; Bracarense, A.P.F.L.; Raymond-Letron,
I.; Oswald, I.P.; Kolf-Clauw, M. Nivalenol Has a Greater Impact than Deoxynivalenol on Pig
Jejunum Mucosa in Vitro on Explants and in Vivo on Intestinal Loops. Toxins 2015, 7, 1945-
1961.
3). Cheat S, Pinton P, Lafaix O, Cossalter AM, Cognie J, Raymond-Letron I, Oswald IP, Kolf-
Clauw M. Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and nivalenol
show synergism on jejunal enterocytes. J. Appli. Toxicol., in submission
Posters
1). Cheat S, Pinton P, Lafaix O, Cossalter AM, Cognie J, Raymond-Letron I, Oswald I, Kolf-
Clauw M. Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and nivalenol
show synergism on jejunal enterocytes. The poster presented at Gordon Research Conference:
Mycotoxins and Phycotoxins, Massachusetts (USA), 14-19 June 2015
2). Cheat S, Younanian M, Lafaix O, Cognie J, Raymond-Letron I, Cossalter AM, Oswald IP,
Kolf-Clauw M. Effects of mycotoxin exposure on proliferation and apoptosis in the porcine
intestinal mucosa.
The poster presented at:
- European Society for Health Pig Management (ESHPM), Sorrento (Italy), 7-9 May 2014
- Journées “Mycotoxines”. Montpellier (France), 5-6 June 2014
- The 8th conference of “the world Mycotoxin Forum”, Vienna (Austria), 10-12 November
2014
3). Cheat S, Lafaix O, Younanian M, Raymond-Letron I, Cognie J, Kolf-Clauw M. Development
of jejunal loop model: effect of mycotoxins on proliferation and apoptosis in porcine enterocytes.
The poster presented at:
- “Journées de l’école Doctorale SEVAB 2013”, Toulouse (France), 12 November 2013
7
- Société Française de Toxicologie (SFT), Paris (France) 14-15 November 2013
- “Journées des Scientifiques Toxalim”, Toulouse (France), 17-18 December 2013
4). Younanian M, Lafaix O, Cheat S, Kolf-Clauw M. Effects of single and multiple mycotoxin-
contaminated diets on proliferation and apoptosis in the porcine intestinal mucosa. Poster
presentation. Merial Veterinary Scholars Program (MVSP), Michigan (USA), August 2013.
8
List of abbreviations
bw : Body weight CO2 : Carbon dioxide Ctrl : Control °C : Degree Celsius
DNA : Deoxyrebonuceic acid DON : Deoxynivalenol
EC : European Commission EU : European Union
ENN : Enniatin B1 ENVT : Ecole Nationale Vétérinaire de Toulouse EFSA : European Food Safety Authority
Fa : Fraction affected FB: Fumonisin mycotoxin
Fig : Figure g : Gram
GGT : Gamma-glutamyl transferase GLM : General Linear Model
g/L : Gram per liter h : Hour
HE : Hematoxylin-eosin IEC : Intestinal epithelial cell
kg : Kilogram L : Liter
mg.kg-1 : Milligram per kilogram mg : Milligram µM : Micromole µL : Microliter µm : Micrometer
mM : Millimole mRNA : Messenger ribonucleic acid
n : number of sample nM : Nanomole
NIV : Nivalenol nL : Non-loop segment P : Probability value
PhD : Doctor of Philosophy qRT-PCR : Quantitative Real-Time Polymerase Chain Reaction
SEVAB : Sciences Ecologiques, Vétérinaires, Agronomiques & Bioingénieries T-2 : T-2 toxin TDI : Tolerable daily intake
TECHNO1 : Engineering Technology Education and Research Exchanges Toxalim : Research Center in Food Toxicology
UPS : Université Paul-Sabatier U/L : Unit per litre
WME : Williams’ culture media
9
Introduction
The today’s growing world population requires the earth to produce more sufficient and safety food
to feed the entire world. In this context, food and feed safety play an important role for both animal
and human being to assure that they are toxin free for consumption. Even though, toxigenic fungi
often grow on edible plants, thus grains and processed grains which are used as food or feed stuffs
often contaminated with mycotoxins worldwide. This contamination can occur due to inappropriate
agricultural practice, storage and the climate change. As a result, common mycotoxin-contaminated
agricultural commodities are of potential concerns for human and animal health when unintentional
ingestion or once those stuffs heavily contaminated, destroy action must be taken that lead to
economic loss.
Chapter I: General background and objective of the work
1.1. Context of the study
The contaminants in food, feed, drinking water and environment resulting from industrial,
agricultural practices or climate changes, and occurring either as single or as mix forms, raise
concerns for adverse effects after long-term and low-doses exposure. Generally, human and animals
are exposed to these compounds primarily via food, and consequently intestinal tissue is the first
physiological barrier tissue potentially highly exposed to these contaminants (Pinton and Oswald
2014; Bouhet and Oswald 2005). Among the major contaminants, mycotoxins, the natural food/feed
contaminants, can represent an important risk factor for human and animal health. After ingestion,
mycotoxins will cause lowered performance, induce various pathologies on humans and animals
depending on the type, duration and level of exposure. However, the signs are not directly
recognized in relation to mycotoxins due to their effects on the immune system, the gut barrier or
the oxidative status of the animals (Pestka and Smolinski 2005; Pestka et al. 2004).
1.1.1. Mycotoxins
Mycotoxins are toxic secondary metabolites produced by fungi in response to stress although they
are not essential to fungal growth. They can occur before or under post-harvest conditions, and that
up to 72% of one mycotoxin and to 38% of co-contamination with two or more mycotoxins in
agricultural commodities, particularly cereals and grains had been found to be contaminated
worldwide which result in potential deterioration of human and animal health (Streit et al. 2013;
10
Schatzmayr and Streit 2013; Wild and Gong 2010; Rai and Varma 2010; Oswald et al. 2005). They
are mainly produced by fungi in the Aspergillus, Penicillium and Fusarium genera. More than 300
mycotoxins are identified, and this number is increasing, especially because of the masked
mycotoxins, plant metabolites or food processes of mycotoxins and emerging mycotoxins, not
routinely determined mycotoxins. Among those, the major produced mycotoxins and the most often
occurring mycotoxins, particularly in swine feed, are aflatoxins, ochratoxins (A) fumonisins,
zearalenone and trichothecenes i.e. deoxynivalenol (Berthiller et al. 2013; Galaverna et al. 2009;
Creppy 2002; Miller 1998). The trichothecence mycotoxins are extremely prevalent and broadly
produced by Fusarium genus, the genus that is capable of forming a variety of secondary
metabolites (Pinton and Oswald 2014). The trichothecenes are divided into two groups: Type A,
including T-2 toxin, HT-2 toxin, neosolaniol and diacetoxyscirpenol (DAS), while the Type B
including fusarenon-X (FUS-X), nivalenol (NIV) and deoxynivalenol (DON) and its 3-acetyl and
15-acetyl derivatives (3- and 15-ADON). The limit levels of DON of 0.2 to 1.75 mg/kg are for
cereals and derived products for the human consumer. In feed, the maximum levels depend on the
species, from 0.9 to 5 mg/kg for complementary and complete feedstuffs have been recommended
(EC 2006). NIV has also been established a tolerable daily intake (TDI) of 1.2 µg/kg b.w. per day in
grains and grain-based foods for human while the concerns in animal remained underestimated
(EFSA 2013).
Co-occurrence of DON and NIV has been shown in grains and grain products; with DON usually
present at higher concentrations than NIV (Rasmussen et al. 2003). Recently, mycotoxins
contaminated maize in South-East of France has been reported with 100% and those with more than
one mycotoxins (Trichothecenes, zearalenone, fumonisins) (Airfaf 2015). A large scale data survey
has indicated that DON and NIV are present in 57% and 16%, respectively, of food samples
collected in the European Union (Schothorst and van Egmond, 2004). This occurrence brought up a
concern for European Commission. In consequence, EFSA was asked to assess the co-occurrence of
nivalenol with deoxynivalenol in feed and food, as signs of toxicity in animal (pigs) can be
observed (EFSA 2013). Therefore, our study has been designed to give scientific data contributing
to human or animal risk health assessment of DON and NIV.
1.1.2. Pig intestine as a target for DON and NIV
Pig is the most sensitive species to DON followed by rodent > dog > cat > poultry >ruminants
(Pestka and Smolinski 2005) also a species suggested by European Commission (EC 2000) to be
sensitive to NIV. Pig digestive physiology is very similar to human (Kararli 1995), and this species
11
can be regarded as the most relevant animal model for extrapolating to human (Rothkötter et al.
2002; Nejdfors et al. 2000; Rotter et al. 1996). Following the ingestion of contaminated food/feed or
toxic chemicals, the gastrointestinal tract intrinsically able to resist or regulate those stuffs. Its
principal functions when subject to those contaminants include storage, propulsion, digestion,
absorption, secretion, barrier activity and elimination (Haschek et al. 2010). Small intestine, a
segment of gastrointestinal tract, responsible for secretion and absorption of nutrient (95%), water
uptake regulations and moreover, the intestinal epithelium acts as a selective and effective barrier to
biotransforms xenobiotics, exclusion of potential pathogens in luminal contents (bacteria and
nonabsorbed compounds) out of the body (Gelberg 2012; Vereeke et al. 2011; Haschek et al. 2010;
Oswald 2006). Small intestinal mucosa morphology consists of surface epithelium, crypts/glands,
lamina propria, and a thin layer of muscle separating the mucosa and submucosa. It can be
artificially divided into two zones: villi for absorptive and enzyme release functions; and crypts for
secretion and replacement (Haschek et al. 2010).
The intestinal epithelium is a specialized monolayer of columnar cells lining the gut lumen (Fig.1).
Four main types of differentiated cell types are present: goblet cells, Paneth’s cells, enterocytes and
enteroendocrine cells with multi-functional roles as the most crucial role of barrier to the passage
from the external environment into the organism (van der Flier and Clevers 2009; Groschwitz and
Hogan 2009). The process of cell shedding under homeostatic conditions must be tightly regulated
to preserve the integrity of the intestinal barrier, and proliferative regeneration after cytotoxic
damage, appear to originates at crypt site (Vereeke et al. 2011; Booth and Potten 2000). Meanwhile,
different cellular outputs from a crypt and induction of the stem cells to favor the forms of
differentiation, displacement or apoptosis may be required due to the changes in the tissue
environment (Booth and Potten 2000). Apoptosis is an organized process of programmed cell death.
A process of apoptosis that is induced by a loss of anchorage, is seen as the main mechanism by
which epithelial cells are eliminated at the villus tip. The epithelial proliferation and turnover, under
inflammatory conditions (Vandenbroucke et al. 2011, Bracarense et al. 2012), are accelerated, result
in increasing the risk of barrier leakage.
12
Figure 1. Schematic overview of the crypt-villus architecture and the cellular composition of the
small intestine. Adapted from Zachary and McGavin (2012) and Vereecke et al. (2011)
1.1.3. Sensitive biomarkers of mycotoxins in small intestine
Pig intestinal epithelial cells serve as a dynamic barrier. An increasing number of studies suggest
that they are targets for deoxynivalenol (DON) and other Type B trichothecenes (Pinton et al. 2009;
Pinton and Oswald 2014; Hooper and Macpherson 2010), and for testing the effects of mycotoxins
(Table 1.). The jejunum is selected for this study because it is the most absorptive part (95% of
nutrient absorption), with the highest villi, and the longest segment of the small intestine (Gelberg
2012; Haschek et al. 2010) (Fig. 2.). Several endpoints can be used as biomarkers of toxicity and
have been described with DON and other trichothecenes (Table 2.).
13
Figure 2. Schematic diagram of the topographic histology of the digestive tube, adapted from
Gelberg (2012)
Table 1.
Pig digestive effects induced by DON, NIV and other trichothecenes
Modes Segment Toxins Concentrations Effects References
In vivo Jejunum,
ileum DON
1.5 mg/kg feed;
4 weeks
Induced atrophy, induced
histological lesions; decreased
villus height in jejunum;
reduced crypt depth in jejunum
and ileum
Gerez et al. 2015
In vivo Jejunum DON 2.3 mg/kg feed;
5 weeks Induced histological lesions Lucioli et al. 2013
In vivo Jejunum,
ileum DON
4 mg/kg feed;
30 days
Enhanced permeability;
damaged villi Xiao et al. 2013
In vivo Jejunum,
ileum DON
3 mg/kg feed; 5
weeks
Induced atrophy; fused and
decreased villi height
Bracarense et al.
2012
In vivo Jejunum DON 3 mg/kg feed;
10 weeks Increased crypt depth
Dänicke et al.
2012
In vivo Jejunum DON, 15-
ADON
2.29 mg/kg
feed; 4weeks
Induced atrophy, histological
lesions; fused villi, necrosis Pinton et al. 2012
In vivo intestines NIV 2.5, or 5 mg/kg; Gastrointestinal erosions Hedman et al.
14
3 weeks 1997
Ex vivo Jejunal
explant ENN, T-2 0.3–30 nM; 4h
Induced histological lesions;
cubic epithelial cells; induced
cellular debris, lysis of villi
and oedema in the lamina
propria
Kolf-Clauw et al.
2013
Ex vivo Jejunum
explant
DON, 3-
ADON
15-
ADON
10 µM; 4h
Induced histological lesions,
lyses of enterocytes; flattened
and coalescent villi
Pinton et al. 2012
Ex vivo Jejunal
explant DON
0.2-5 µM; 4h
and 8h
Flattened and coalesced villi;
edema and necrosis in the
lamina propria; pyknotic
nuclei in enterocytes
Kolf-Clauw et al.
2009
Effects on proliferation and apoptosis have been described in vivo, ex vivo and in vitro (Table 2.).
The biomarker endpoints used here were Ki-67 and Caspase-3 for jejunal epithelial cell
proliferation and apoptosis, respectively. The Ki-67 was suggested and reported as a reliable marker
of mitosis because it is expressed during mitosis in all mammalian species from rodents to humans,
and its half-life is very short. Moreover, it is an endogenous marker that does not have any adverse
effects on living cells (Markovits et al. 2013; Kee et al. 2002; Scholzen and Gerdes 2000; Endl and
Gerdes 2000). It is reported that one of the most important biochemical markers of apoptosis is
activation of caspase-3. Besides, a central event in the process of apoptosis is the activation of the
death protease caspase-3, and protease assays are mostly used to measure caspase-3 activity in the
lysate of a whole population of treated cells. Consequenly, the caspase-3 is considered to play a
pivotal role at the final step producing DNA fragmentation in the process of apoptosis (Werner and
Steinfelder 2008; Budihardjo et al. 1999; Arends and Wyllie 1991).
Table 2.
Small intestinal and cellular proliferation and apoptosis from different modes of mycotoxin exposures
Modes Cells Toxins Concentrations Effects References
In vivo Pig jejunum,
ileum DON
4 mg/kg feed;
37 days
Inhibited cell
proliferation Wu et al. 2014
In vivo Pig jejunum,
ileum DON
4 mg/kg feed;
30 days
Epithelial cell
proliferation Xiao et al. 2013
15
In vivo Pig jejunum,
ileum DON
3 mg/kg feed; 5
weeks
Epithelial apoptosis;
Decreased
proliferation in crypt
Bracarense et al.
2012
Ex vivo Pig jejunal
explant T-2 0.3–10 nM; 4h
Decreased epithelial
cell proliferation
Kolf-Clauw et al.
2013
Ex vivo Pig jejunum DON 10 µM; 4h Induced apoptosis Pinton et al. 2012
Ex vivo Pig jejunal
explant DON
0.2-5 µM; 4h
and 8h
Apoptotic cells in
lamina propria
Kolf-Clauw et al.
2009
In vitro Rat IEC-6 DON, NIV 0.5–80 µM; 24h Apoptosis, NIV
greater than DON Bianco et al. 2012
In vitro J774A.1 murine
macrophages DON, NIV 10-100 µM; 24h
Apoptosis, NIV
greater than DON
Marzocco et al.
2009
1.2. Mycotoxin outbreak in animal feed (book chapter)
The book chapter was accepted to publish in Carol A. Wallace and Louise J. Manning, editors.
Foodborne diseases: Case studies of outbreaks in agri-food industries. The CRC Press, UK; 2015?
16
Mycotoxin Outbreak in Animal Feed
Sophal CHEAT1,2,3,4, Isabelle P. OSWALD1,3, Martine KOLF-CLAUW2,3
1 Université de Toulouse, INP, UMR1331, Toxalim, F- 31000 Toulouse, France
2 Université de Toulouse, INP-ENVT, Ecole Nationale Vétérinaire de Toulouse, F- 31076 Toulouse, France
3 INRA, UMR1331, Toxalim, Research Center in Food Toxicology, F- 31076 Toulouse, France
4 Faculty of Animal Science and Veterinary Medicine, Royal University of Agriculture, Phnom Penh,
Cambodia
Introduction
1 Mycotoxin Occurrence
1.1 Origins of Mycotoxin and Occurrence
1.1.1 Fungal Species
1.1.2 Toxinogenesis: Conditions Favoring Mycotoxin Production
1.1.3 Mycotoxins in Feed
1.2 Mycotoxin Contamination of Feedstuffs
2 Mycotoxins and Pathologies
2.1 Mycotoxins and Livestock Diseases
2.1.1 Aflatoxins
2.1.2 Deoxynivalenol
2.1.3 Fumonisins
2.1.4 Ochratoxins
2.1.5 Zearalenone
2.2 Diagnoses of Mycotoxicosis
2.3 Field Cases
3 Mycotoxins and Animal Productivity
3.1 Feed Intake
3.2 Animal Reproduction
3.3 Animal Immunomodulation
17
3.4 Economic Impacts of Mycotoxin
3.4.1 Feed Securities
3.4.2 Tissue Residues
4 Strategies for Prevention and Management
4.1 Agricultural Practices
4.2 Feed Storage and Processing
4.3 Decontamination
4.3.1 Physical Methods
4.3.2 Chemical Methods
4.4 Mycotoxin-Detoxified Agents
4.4.1 Binders
4.4.2 Biotransforming Agents
Conclusions
References
18
Introduction
In recent years, the occurrence of mycotoxins is increasing in food and feed especially because of new
technologies such as the production of bioethanol and biodiesel, and the increasing availability of new by-
products suitable for inclusion in animal feeds from these technical processes. For example, distillers dried
grains are known to contain unexpected high concentrations of mycotoxins (EFSA 2012). Climate change
trends could affect fungal infection of crops and the degree of mycotoxin production particularly resulting in
higher pre-harvest levels of mycotoxins. This poses both economic and health risks (Wu et al. 2011).
Mycotoxins, secondary metabolites produced by fungi, have been found to contaminate up to 72% of one
mycotoxin and 38% of co-contamination with two or more mycotoxins in agricultural commodities
(n=17,316) worldwide, particularly cereals and grains, resulting in potential deterioration of human and
animal health (Streit et al. 2013; Schatzmayr and Streit 2013; Wild and Gong 2010; Rai and Varma 2010;
Oswald et al. 2005). The remaining forms of extractable conjugated or non-extractable bound mycotoxins
are present in the plant tissue, but are currently neither routinely screened for in food nor regulated by
legislation, thus they may be considered as “masked” as the analysis of the mycotoxin content of samples
containing these compounds leads to their underestimation (Berthiller et al. 2013). Meanwhile, there are a
number of mycotoxins that either have a low incidence or are unknown that may (re-) emerge or be (re-)
introduced into the food chain (Van der Fels-Klerx et al. 2009). Furthermore, mycotoxin co-occurrence, in
particular the interaction effects, could impact animal health at already low doses (Streit et al. 2012).
Following the findings and reports, the European Food Safety Authority (EFSA) has raised concern for both
human and animal health. The toxicological syndromes in human, caused by ingestion of mycotoxins,
include growth impairment, induction of cancer (Bryden 2007), impaired intestinal health and pathogen
fitness, resulting in altered host pathogen interactions (Antonissen et al. 2014) and decreased resistance to
infectious diseases (CAST 2003). The Fusarium contamination of cereals and related products also causes
feed-borne intoxication especially in farm animals (Fink-Gremmels and Malekinejad 2007).
1. Mycotoxin Occurrence
1.1 Origins of Mycotoxin and Occurrence
19
1.1.1 Fungal Species
The fungal species (Table 1-1) most often implicated in the field cases of mycotoxicoses belong to the
Aspergillus, Alternaria, Claviceps, Fusarium, Penicillium and Stachybotrys genera (Milićević et al. 2010).
Other genera including Chaetomium, Cladosporium, Diplodia, Myrothecium, Phoma, Phomopsis,
Pithomyces also contain mycotoxic fungi (Moss 1991). Aspergillus, Fusarium and Penicillium are the genera
of most concern, particularly in Europe, (Creppy 2002; Miller 1998). The major toxins (Figure 1-1) produced
by these three genera include aflatoxins, ochratoxins, trichothecenes, zearalenone (ZEA) and fumonisins
(Miller 1998). Bayman and co-workers (2002) reported various metabolites of different species of
Aspergillus, including A. alliaceus, A. auricomus, A. carbonarius, A. ochraceus, A. glaucus, A. melleus, and
A. niger that belong to ochratoxin family. The most important toxigenic Fusarium species occurring in grains
and animal feedstuffs are F. culmorum, F. equiseti, F. graminearum, F. langsethiae, F. moniliforme, F. poae
and F. sporotrichioides. A variety of Fusarium fungi, that are common soil fungi, are routinely found on
cereals grown in the temperate regions of America, Europe and Asia. They produce a number of different
mycotoxins of the class of trichothecenes in addition to ZEA. Trichothecene mycotoxins can be classified
into two types: Type A including T-2 toxin and HT-2 toxin, diacetoxyscirpenol (DAS) and neosolaniol, and
Type B including deoxynivalenol (DON), nivalenol (NIV) and fusarenon X (FX) as determined by Sugita-
Konsihi and Nakajima (2010) and Creppy (2002). Fusarium toxins have been shown to cause a variety of
toxic effects in both experimental animals and livestock.
[Insert Table 1-1 here]
20
Table 1-1. Mycotoxin occurrences found on cereal grains, their fungal species and clinical signs in farm animals (pig, poultry, ruminants
and horse)
Mycotoxins Fungal species Cereal/food
commodity Mycotoxicosis Clinical signs
Aflatoxins (B)
Aspergillus
flavus,
Aspergillus
parasticus
Barley,
maize, rice,
sorghum,
wheat
Aflatoxicosis
Mortality, hemorrhage, liver damage, reduced productivity, increased
susceptibility to disease, immunosuppression, inferior egg shell and
carcass quality, demineralization, weight loss
Deoxynivalenol Fusarium sp.
Barley,
maize, oats,
wheat
Fusariotoxicosis,
mouldy corn toxicosis
Immunosuppression, hepatic lesions, ovary damage, hemorrhage, beak
and mouth necrosis, digestive-mucosa ulceration, ataxia, decreased egg
production, decreased feed intake and weight gain
Fumonisins (B1)
Fusarium
vericilloides
(moniliforme,
F. proliferatum
Maize
Porcine pulmonary
edema (PPE); Equine
leukoencephalomalacia
(ELEM)
Respiratory distress and cyanosis (PPE), neurotoxicity (ELEM),
hepatotoxicity, nephrotoxicity, cardiotoxicity, decreased feed intake,
depression, ataxia, blindness, hysteria
Ochratoxin A Penicillium
verrucosum
Barley, Rye,
wheat Porcine nephropathy
Mainly affects proximal tubules of the kidneys in pigs and poultry;
kidneys are grossly enlarged and pale; fatty livers in poultry, hepatic
lesions, mouth lesions, diarrhea, digestive-mucosa ulceration, ataxia, feed
refusal, demineralization, decreased egg production
21
Zearalenone Fusarium
graminearum
Barley,
maize,
wheat
Hyperestrogenism
Immunosuppression, embryonic mortality, swollen, reddened vulva,
reduced fertility, vaginal prolapse and sometimes rectal prolapse in pigs;
suckling piglets may show enlargement of vulvae; bind to estrogen
receptors, causing functional and morphologic changes in the responsive
reproductive organs
Adapted from Wawrzyniak and Waskiewicz (2014); Bryden, (2012); Sugita-Konsihi and Nakajima (2010); Milićević et al. (2010)
22
[Insert Figure 1-1 here]
Deoxynivalenol Aflatoxin B1 Zearalenone
Ochratoxin A Fumonisin B1
Figure 1-1. Chemical structures of the main occurring mycotoxins in animal feed
In addition to Aspergillus and Fusarium, Penicillium species have been reported to produce a variety of
mycotoxins or toxic metabolites such as P. citrinum; producing citrinin, P. verrucosum; producing
ochratoxin, P. patulum or P. urticae or P. griseofulvum, P. expansum; producing patulin, P. crustosum;
producing penitrem A, P. cyclopium or P. aurantiogriseum, P. camembertii; producing cyclopiazonic acid,
P. roqueforti, P. camemberti or P. caseicola; producing penicillin acid, roquefortine, isoflumigaclavines A,
B, PR toxin, and cyclopiazonic acid (Wawrzyniak and Waskiewicz 2014; Tannous et al. 2014; Bennett and
Klich 2003).
1.1.2 Toxinogenesis: Conditions Favoring Mycotoxin Production
The presence of fungi, the commodity composition, the agronomy practices, the harvest conditions, handling
and storage practices all affect the ability of molds and fungi to produce mycotoxins (Bryden 2009).
Moisture and temperature are the two major influences on growth of mold and on production of mycotoxins
(Pitt and Hocking 2009). Higher moisture levels (20-25%) are usually required by pathogenic fungi that
attack and spread into crops prior to harvest than for fungi to proliferate during storage (13-18%). In addition
to moisture and temperature, other factors such as water activity within the interval 0.90-0.995 and at least
23
50% of CO2 being available also affect the reduction of production of ochratoxin A (OTA), and particularly
inhibit the growth of P. verrucosum and other molds in wheat grain (Battacone et al. 2010). For this reason,
some mycotoxin contaminations are preferentially driven, prior to harvest (on field contamination) and
others the optimum conditions cause contamination in storage. As a result most feedstuffs with moisture
contents above 13% are susceptible to mold growth and mycotoxin formation (Magan 2006). Toxins are
produced at temperatures ranging from 0°C to 35°C depending on the fungal species (Frisvad 1995). For
instance, the temperatures for optimum growth and for OTA production by P. verrucosum have been shown
to be with 15-35°C (Magan and Aldred 2005). In partially dried grain, the key mycotoxigenic molds are P.
verrucosum (ochratoxin) in damp cool climates of Northern Europe, and A. flavus (aflatoxins), A. ochraceus
(ochratoxin) and some Fusarium species (fumonisins, trichothecenes) on temperate and tropical cereals
(Magan and Aldred 2007). Thus, the geographic-repartitioned temperatures indicate that globally there will
be a differentiation between the fungal species that are active and thus the potential for contamination with
the toxins they produce.
1.1.3 Mycotoxins in Feed
In general only a few mycotoxins, and in particular five mycotoxins/mycotoxin groups have received
widespread attention among 300-400 mycotoxins known today (Schatzmayr and Streit 2013; Bennett and
Klich 2003; Hussein and Brasel 2001). These five mycotoxins/mycotoxin groups and their prevalence as a
percentage of the 19,757 samples of feed and feed raw material tested (with the average contamination
expressed as µg/kg feed or feed raw materials) are aflatoxins most often detected in South Asia (78%
positives; 128 µg/kg), followed by South-East Asia (55%; 61 µg/kg). ZEA was most prevalent in North Asia
with 56% positive samples containing an average of 386 µg/kg of the mycotoxin. North Asia is also the
region where the occurrence of DON was highest (78%; 1,060 µg/kg). The highest average DON
contamination however has been observed in North America, where positive samples (68%) contained an
average of 1,418 µg/kg DON. Fumonisins were most frequently detected in South American samples (77%;
2,691 µg/kg). OTA prevalence and average contamination were highest in South Asia (55%; 20 µg/kg).
Eastern European samples frequently showed positive for OTA as well (49%), but the average contamination
was much lower at 4 µg/kg feed (Schatzmayr and Streit 2013; Streit et al. 2013; Rodrigues and Naehrer
24
2012). In maize, peanuts, cotton seed, rice and spices, significant levels and types of aflatoxin can be found
in the various countries in the world, and that producing aflatoxigenic species (Reddy et al. 2010).
Ochratoxin contamination can occur in wheat, barley, rye and grapes (Jørgensen 2005). In many situations,
especially pre-harvest, the fungi that produce these toxins also produce other toxins and co-contamination
may occur (Glenn 2007) as 38% of 17,316 samples analyzed contained two or more mycotoxins, suggesting
that co-contamination is frequently observed in finished feed sample (Streit et al. 2013; Schatzmayr and
Streit 2013). A global survey of the incidence of mycotoxins (aflatoxin B1 (AFB1), DON, fumonisins B1
(FB1), B2 (FB2) and B3 (FB3), OTA, T-2 toxin and ZEA) in animal feedstuffs showed significant regional
differences at low level of contamination, particularly between tropical and temperate areas (Rodrigues and
Naehrer 2011; Rodrigues and Griessler 2010).
Apart from those mentioned mycotoxins, orther mycotoxins or toxic metabolites have been reported such as
ergot alkaloids, citrinin, patulin or its metabolites (clavacin, claviformin, expansin, mycoin c and penicidin),
DON metabolites (DOM-1, 3-epi-DON, DON-3-glucoside, 3-acetyl-DON, 15-acetyl-DON, etc.),
moniliformin, phomopsins, tremorgenic mycotoxins, glutinosin (a mixture of the macrocyclic trichothecenes
verrucarin A and B), penicillin acid, roquefortine, isoflumigaclavines A and B, PR toxin, penitrems,
janthitrems, lolitrems, aflatrem, paxilline, paspaline, paspalicine, paspalinine, paspalitrem A and B,
cyclopiazonic acid, citreoviridin, luteoskyrin, rugulosin, rubroskyrin, etc. (Milićević et al. 2010; Bennett and
Klich 2003).
1.2 Mycotoxin Contamination of Feedstuffs
Many factors (Figure 1-2) contribute to feed contamination and subsequent animal exposure (Bryden 2012).
Two mains factors are genetic modification of crops to resist fungal attack and feed handling on farm.
Mycotoxins can occur in the food chain in the field or/and during storage, and their occurrence increases
when shipping, handling, and storage practices permitting mold growth (Reddy et al. 2010). Incorrect bulk
handling and inferior storage conditions, such as prolonged time in storage and low dry matter content
(below 87%), influence contamination of feedstuffs. The on-farm occurrence of ZEA, DON and aflatoxin in
forage, cereal grains and straw was investigated in Australia and the mycotoxins were found in all the
25
commodities, and highest occurrence being ZEA (Moore et al. 2008). Recent study raised concerns the
excessive aflatoxin levels in maize from Bulgaria, Romania and Serbia (Schatzmayr and Streit 2013). In the
survey, the lowest frequency of contamination was found in grains whereas grains are often considered the
only source of mycotoxins when examining a field toxicosis. These results pointed out the potential risk of
contamination of feedstuffs and forages rather than grain used in animal production. In addition, the
contamination of straw, which may be used as a roughage source in ruminant and horse diets or as bedding
for horse, poultry and pigs, may also be a source of mycotoxin exposure on farm (Katie 2013; Degen 2011).
[Insert Figure 1-2 here]
Environment Biology Harvesting
Crops
Storage
Feed/food
Animals Human
Diseases Animal products
Pathology and reduced productivity
- Conventional effect
- Unconventional effect
Figure 1-2. Factors affecting mycotoxins occurrence in feed/food
Pub
lic h
ealth
26
2. Mycotoxins and Pathologies
The pathologies induced by mycotoxins and the field cases will be described in livestock excluding pets,
whilst noting the sensitivity of the pets to some mycotoxins i.e. dogs and cats to Aflatoxin and dogs to OTA
(Bryden 2012).
2.1 Mycotoxins and Livestock Diseases
Livestock may be accidentally fed with contaminated feed resulting in animal disease or health problem
because of the toxic effect of the mycotoxins. The susceptibility of species like pigs, poultry or ruminants to
mycotoxins is different (Steyn et al. 2009), and these differential sensitivities might be due to the difference
in absorption, metabolism, distribution, and elimination of the mycotoxins (Petska 2007). Presented below
are the toxic effects of the five mycotoxins or mycotoxin groups that are considered to be most frequently
occurring and worldwide the most significant ones (Schatzmayr and Streit 2013; Bryden 2012).
2.1.1 Aflatoxins
Three species of Aspergillus including A. flavus, A. parasiticus, and A. nomius that contaminate plants and
plant products may produce aflatoxins (Reddy et al. 2010; JECFA 2001) with several chemical forms such as
aflatoxin B1, B2, G1, G2, M1. AFB1 is the most frequently occurring, leading to AFB1’s metabolite in milk
from lactating humans and animals that consume AFB1-contaminated food or feed: aflatoxin M1 (Alborzi et
al. 2006). AFB1 is the most potent known carcinogen inducing hepatocarcinogenicity in both animals and in
humans (JECFA 2001; IARC 1993). The absorption of aflatoxin is rapid before primary metabolism by liver
microsomal enzymes to active or detoxified metabolites (Haschek et al. 2002). The reliable biomarkers of
aflatoxin exposure are blood (aflatoxin-albumin adducts in serum) and urine (aflatoxin N7-guanine adducts)
(Wild and Turner 2002; JECFA 2001).
In poultry, aflatoxin contaminated feed ingestion is frequently observed as chronic toxicity (Bailly and
Guerre 2008). Doses of about 0.1 mg/kg, 0.3-0.5 mg/kg and 0.5-2 mg/kg feed in duck, turkey and chicken,
27
respectively, for long exposure of more than 2.5 months resulted in poor growth performances and
productions, hemorrhage (Dalvi 1986), hepatic lesions, fibrosis and proliferation of biliary ducts (Bailly and
Guerre 2008). Similar signs have also been observed in ruminants such as reduced feed intake and milk
production, diarrhea, biochemical changes in serum, hepatitis changes at necropsy such as congestion,
hemorrhage, enlarged gall bladder and color changes showing cirrhosis and necrosis (Morgavi et al. 2008).
The decreases of growth rate and feed intake with increasing aflatoxin concentrations in the diet were
reported in pig (Dersjant-Li et al. 2003). Adult animals are less sensitive to the toxic effect of aflatoxins than
young animals (Barringer and Doster 2001). For aflatoxins, specific regulations have been set, particularly in
feed for dairy cattle in a number of EU countries, ranging from 5ppb (the majorities of country) to 50 ppb for
aflatoxin B1 in animal feed and from 0 or 0.01 ppb to 50 ppb for total aflatoxins (FAO, 2004).
2.1.2 Deoxynivalenol (DON)
DON is the main mycotoxin of the type B trichothecenes, which occurs predominantly in grains such as
wheat, barley, and maize and less often in oats, rice, rye, sorghum and triticale (Sugita-Konsihi and
Nakajima 2010). DON is rapidly metabolized (Petska 2007) and de-epoxidation via gut microbiota may be
extensive i.e. in pigs (Eriksen et al. 2002), cows (Annison and Bryden 1998) and rats, but not in chickens,
horses and dogs (Swanson et al. 1988). It is suggested that pigs are most sensitive species to DON (Pestka
2010). The classical clinical signs or response following ingestion of DON are feed refusal and emesis;
probably due to a neurochemical imbalance in the brain (Pestka and Smolinski 2005). It was reported that
DON stimulates the main structures involved in feed intake in pigs, and the anorexigenic effects of DON
could be contributed by catecholaminergic and NUCB2/nesfatin-1 neurons (Gaigé et al. 2013).
Feed intake and body weight were reduced when the piglets were fed the diet contaminated with DON
2.29mg/kg feed for 4 weeks (Pinton et al. 2012). However, a chronic exposure to low doses of DON did not
elicit important clinical signs such as body weight gain, hematology and biochemistry in piglets (Grenier et
al. 2011). Feed refusal, reduced weight gain, and emesis have been observed in pigs while consuming a level
of DON as low as 1 mg/kg, >2–5 mg/kg and >20 mg/kg feed, respectively (Haschek et al. 2002; Trenholm et
al. 1984). DON has been found to decrease feed intake in ruminants at the levels of 10-20 mg/kg feed
28
(Osweiler 2000) whereas poultry tolerate up to 20 mg/kg DON in feed (Petska 2007). The resistance to DON
explained by the detoxification by the intestinal microflora of DON to DOM-1 (He et al. 1992), poor
absorption into plasma, rapid elimination in excreta and low-level residues in tissues in chicken (Prelusky et
al. 1986). Although poultry can tolerate the toxin, in broiler chickens, 10 mg/kg DON in the diet has been
found to impair nutrient cotransport in the jejunum and appeared to alter the gut function while not affecting
the growth performance (Awad et al. 2004).
Pestka (2008) reported the lethal DON doses that affect histopathology range from hemorrhage or necrosis of
the intestinal tract, necrosis in lymphoid tissues and bone marrow, to kidney and heart lesions. The clinical
signs of ingestion of DON include gastrointestinal disorders, diarrhea, (Haschek et al. 2002) alteration in
immune function (Bondy and Pestka 2000) and predisposition to infections by enteric pathogens (Bracarense
et al. 2011). A lethal dose (LD50) for DON at 27 mg/kg body weight (subcutaneously) and 140 mg/kg body
weight (orally) have been reported in 10-day old duckling and 1-day-old broiler chicks, respectively whereas
acute exposure to relatively low doses at ≥50µg/kg body weight (intraperitoneally or orally) can cause
vomiting in pigs. However, no lethal doses have been suggested in ruminants because of their rumen
microflora metabolism which plays a significant role in DON detoxification (Petska 2008; Pestka 2007).
Furthermore, mild renal nephrosis, reduced thyroid size, gastric mucosal hyperplasia, increased
albumin/alpha-globulin ratio, and sometimes mild changes in other hematological parameters in pigs have
also been reported due to the effects of DON (JECFA 2001). Taken together, DON is not considered to be
acutely toxic to farm animals, and the concern is economic losses due to poor performance (Morgavi and
Riley 2007).
2.1.3 Fumonisins
It has been shown that fumonisins at high doses cause porcine pulmonary edema and equine
leukoencephalomalacia (Haschek et al. 2002). Porcine pulmonary edema syndrome is characterized by
dyspnea, weakness, cyanosis and death. The reproduction and performance disturbance are not frequently
observed (Taranus et al. 2008). Different states of interstitial and interlobular edema with pulmonary edema
and hydrothorax at varying amounts of clear yellow fluid accumulate in the pleural cavity have been seen in
29
pig necropsy affected by fumonisins (WHO 2000). Fumonisins disrupt sphingolipid metabolism by
inhibiting ceramide, an enzyme responsible for the acylation of sphinganine and sphingosine (Steyn et al.
2009). Available biomarkers of exposure to toxic levels of fumonisins in farm animals can be used through
plasma, ratio of sphinganine/sphingosine in serum or urine (Voss et al. 2007) and the increase in serum and
tissue of free sphingoid bases (Riley et al. 1994).
Equine leukoencephalomalacia is characterized by lethargy, head pressing and reduced feed intake, followed
by convulsions and death after several days (Morgavi and Riley 2007), and the presence of liquefactive
necrotic lesions in the cerebrum white matter, however, the grey matter may also be involved (WHO 2000).
In addition, abnormalities of histology in kidney and liver such as apoptosis and cell regeneration have also
been found in horses and ponies, following minimum toxic doses of FB1 between 15 ppm and 22 ppm in
feed, but not below 6 ppm (JECFA 2001). It has been reported, besides liver and lung, that fumonisins target
pulmonary intravascular macrophages, kidney, pancreas, oesophagus and heart (Morgavi and Riley 2007;
WHO 2000). In poultry, diarrhea, increased liver weight and growth retardation have been reported when
consuming the fumonisins-contaminated feed. In feed, pure FB1 at 10 ppm and fumonisins B1 at 30 ppm
from F. verticillioides culture material have altered haematological parameters in broiler chicks (Morgavi
and Riley 2007; JECFA 2001).
2.1.4 Ochratoxins
The kidney is the target organ of ochratoxins, particularly OTA that induces nephropathy (Marquardt and
Frohlich 1992). Ochratoxin has been detected in blood, milk including human, pork and other animal tissues
(Reddy et al. 2010). Ruminants are insensitive to OTA, because they largely convert OTA into ochratoxin α
in the rumen (Jouany and Diaz 2005; Galtier and Alvinerie 1976) and OTA naturally occurring in feed is not
regarded as a health threat. It is highly toxic, however, in monogastric farm animals for instance poultry and
pigs. High doses of 20 mg/kg can reduce feed intake or cause death with friable livers and pulmonary edema
in sheep and in lambs respectively (Morgavi et al. 2008).
30
Feed contaminated by ochratoxins caused poultry disease (Hamilton et al. 1982) and endemic disease in
Denmark (Krogh 1987). In poultry, the concentration of OTA at 0.3-4 mg/kg feed for several weeks and at 2-
10 mg/kg once was reported to induce chronic and acute toxicity, respectively with decreased growth rate,
poor feed conversion ratio, low egg production, moist feces, degeneration and focal necrosis of liver (Bailly
and Guerre 2008). Significant toxic effects have been shown in chicken fed a diet of about 4 mg/kg for
degeneration of internal organs such as kidney, liver, lymphoid, changes of biochemical parameters, and also
immunosuppression (Stoev 2008).
Ochratoxin showed a mild effect on microscopic lesions in 3-4 month pigs with level of about 200 µg/kg
feed and 90 µg/kg feed in combination with penicillic acid, and a macroscopic kidney damage with 180
µg/kg feed in combination with penicillic acid. These results suggested that interaction effects of ochratoxin
with other mycotoxins are very important to studied (Stoev 2008). Battacone et al. (2010) reported reduced
feed intake and altered metabolism in pigs exposed to OTA, with several changes of serum blood parameters
such as hyperproteinemia and azotemia, hypocholesterolemia and hypercalcemia.
Toxicological studies from animals lead to European Union Scientific Committee to postulate a limit level of
OTA intake below 5 ng/kg of body weight per day (Sweeney et al. 2000). However the EFSA revised this to
17 ng/kg of body weight per day due to its indirect effect on genotoxicity (EFSA 2006), and this revision has
been currently applied (EFSA 2010).
2.1.5 Zearalenone (ZEA)
McErlean (1952) was the first to suggest that Fusarium graminearium caused probably hyperoestrogenism in
pigs (Bryden 2012). Farm animals, particularly pigs, a very sensitive species, are reported to be affected by
ZEA acting by hyperrestrogenism at prepuberty (Gremmels and Malekinejad 2007; Osweiler 2000) and
inducing vulvovaginitis and anestrus (Raisbeck et al. 1991). Dietary levels of ZEA 1-5 ppm and 3-10 ppm
can induce vulvovaginitus and anestrus respectively while other clinical signs have been observed in
ovariectomized sows, such as tenesmus. Vaginal and rectal prolapse, reduced litter size, fetal resorption,
implantation failure, reduced libido and reduced plasma testosterone have been seen in young female pigs
31
(Osweiler 1986; Weaver et al. 1986). Alpha-zearalenol and β-zearalenol are major metabolites resulting from
the interaction of ZEA with estrogen receptors. The metabolites elicit estrogenic activity in animals,
particularly pigs, which correspond to their binding affinities for mammary, uteri and hypothalamic
oestrogen receptors (Fink-Gremmels and Malekinejad 2007; Zinedine et al. 2007). ZEA is reported in the
field outbreaks of estrogenic syndrome in pigs in Europe, Africa, North America, Africa, Australia and Asia
(Christensen 1979), and suspected to cause reproductive problems in grazing sheep (CAST 2003), ruminants
(Raisbeck et al. 1991). It was reported to disturb an induction of parturition program together with signs of
estrogenism in newborn piglets (Alexopoulos 2001). However, cattle (Weaver et al. 1986), cycling mares
(Juhasz et al. 2001) and poultry (Haschek et al. 2002) have been reported more resistant to the estrogenic
effects of ZEA at low doses similar to the natural contamination.
2.2 Diagnoses of Mycotoxicosis
In cases where animal productivity is reduced or in cases of disease, a mycotoxicosis may be suspected when
outbreaks exhibit the following characteristics: the cause is not readily identifiable; the condition is not
transmissible; syndromes may be associated with certain batches of feed; treatment with antibiotics or other
drugs has little effect; and outbreaks may be seasonal as weather conditions may affect mold growth (Bryden
2012).
To ascertain that a mycotoxin is the underlying cause of a field problem it is necessary to demonstrate
biologically effective concentrations of the toxin in the suspect feed. This needs a homogenous feed sample
representative (Whitaker 2006). In making a diagnosis, not only mycotoxins must be considered for their
unique effects, but also they must be evaluated for possible interactions with infectious agents and
environmental stressors commonly encountered in animal production (Hamilton 1978). As animals may be
fed with diets that contain low levels of more than one toxin, then field situations are often more
complicated. For instant, aflatoxins, DON, ZEA and fumonisins can occur together in the same grain (CAST
2003). Moreover, many fungi simultaneously produce several mycotoxins, especially Fusarium species.
Toxicity resulting from the interaction between mycotoxins is usually additive and not synergistic as often
suggested (CAST 2003). Thuvander et al. (1999) found that combination of NIV with T-2 toxin, DAS or
32
DON resulted in an additive effect. In addition, recent results in Caco-2 cells model showed that interaction
between DON and NIV were synergistic at in vitro cell level (Alassane-Kpembi et al. 2013) and less than
additive at ex vivo explant level (Kolf-Clauw’s personal communication). Besides, mycotoxin interaction is
complex which varies according to the animal species, the toxin doses, the exposure duration as well as the
end points measured (Grenier and Oswald 2011).
In any situation, keeping aware of the possible consequences of mycotoxin-contaminated feed when animal
productivity is identified as being poor or simply unexplainable and the condition cannot be diagnosed as
being caused by pathogenic agents.
2.3 Field cases
A disease outbreak in the field suspected to a specific mycotoxin in feedstuff can be very difficult to define
since the signs of disease are generally subtle and unspecific (Morgavi and Riley 2007), and they usually do
not cause acute disease. In the case of acute diseases, multiple interacting factors can modify the expression
of toxicity (Hamilton et al. 1982). However, the incidence of acute disease, not associated with known
infectious diseases and often involving mortality or evidence of acute toxicity, in farm animals indicated the
presence of mycotoxins in feeds (Morgavi and Riley 2007).
Long before these toxins were discovered, aflatoxin, DON, ergot, fumonisins and ZEA, mold-contaminated
feed was assumed to be the cause of animal disease in field outbreaks (Morgavi and Riley 2007). Feed
contaminated with aflatoxin (corn and peanut meal) killed 12 yearling colts, 2-year-old horses, and a 7-year-
old mare in Thailand and the southern USA, respectively. The similar autopsy and hematological and serum
biochemical changes were found suggesting that horses are susceptible to aflatoxicosis (Smith and Girish
2008). In pigs, cases of pulmonary edema were reported during 1989 in the US. It was concluded that this
was due to consumption of corn contaminated with Fusarium verticilloides, a fumonisins-produced fungus,
ranging in levels from 20-360 mg/kg feed. This syndrome was experimentally reproduced in 3 of 4 piglets
treated with FB1 at 10mg/kg feed, that were observed to have a slight pulmonary edema (Taranu et al. 2008).
33
Another study in pigs fed Fusarium culture material reported evidence of pulmonary edema was detected at
a concentration of FB1 equivalent to 0.4 mg/kg body weight per day (JECFA 2001).
Fumonisins-caused equine leukoencephalomalacia has been reported in corn contaminated with fumonisins,
and the fatal equine leukoencephalomalacia has been reproduced with a contamination of 10mg/kg feed.
Fumonisins B1 at the level of greater than 10mg/kg often encounter the field outbreak of equine
leukoencephalomalacia since 1983 in many regions of the US including Indiana, and Southern Brazil (Smith
and Girish 2008). Thus, 66 purebred Arabian horses in Arizona fed with the diet containing FB1 37-122
mg/kg showed the clinical feature such as hemorrhagic foci of the brain stem, liquefactive necrosis of
cerebral white matter, histopathological changes including rarefied white matter with pyknotic nuclei and
eosinophilic (Smith and Girish 2008). The other cases of equine leukoencephalomalacia outbreaks have also
been reported in South Africa suspectedly caused by consumption of moldy maize, and the clinical signs
were blindness and ataxia (Pienaar et al. 1981).
Mycotoxicosis from Stachybotrys (atra), a saprophytic mold, was first reported in deer in Western Europe in
1977 and has been reported as frequent causes that lead to the death of horses, particularly in the Southern
parts of France (Le Bars and Le Bars 1996). In Morocco in 1991, approximately 800 donkeys, mules and
horses died from Stachybotryotoxicosis. In any cases of death, moldy straw was suspected. The symptoms of
this mycotoxicosis ranging from mild cases: hyperesthesia (jump refusal in race horse), rhinitis,
conjunctivitis to severe cases: oral mucosa necrosis, bleeding (from small injuries), tissue hemorrhage (Le
Bars and Le Bars 1996). Spontaneous porcine and avian nephropathy were frequently observed. The relative
concentrations ranged from 91 to 310 ppm of OTA in feed samples in Bulgaria where the nephropathy
occurrences in different batches of slaughtered pigs/chicks varied from 1-2% up to 90-100% (Stoev 2008).
Field outbreaks of porcine hyperestrogenism (vulvo-vaginitis) characterized by swelling and reddening of
the vulva and teats in prepubertal gilts reported in South Africa, were caused by the ingestion of Fusarium
graminearum infected maize contaminated with ZEA 10 mg/kg feed (Aucock et al. 1980).
34
In farm animal disease outbreaks, DON and other trichothecenes (including T-2 toxin and DAS) have been
implicated in many areas of the world, and in pigs, cattle and chickens, the most commonly observed effect
is feed refusal (Morgavi and Riley 2007; Haschek et al. 2002; Osweiler 2000). In suspected field outbreaks
of DON in farm animals or human, β-glucuronidase is a useful urinary biomarker since it hydrolyzes DON-
glucuronide to DON (Meky et al. 2003).
3. Mycotoxins and Animal Productivities
The most difficult consequence after mycotoxin contamination of animal feed supply chain is the reduction
of the animal productivity, but not acute disease episodes (Bryden 2012). The poor growth performance of
animal which is not due to the nutritional content in feed, sometimes related to a low dose ingestion of toxin
which resulted in metabolic disturbances and/or may be accompanied by pathological change (Haschek et al.
2002). The effects of mycotoxins may considerably vary according to the type of mycotoxins involved and
the animal species. Pig is considered as the most sensitive species to DON toxic effects followed by rodent >
dog > cat > poultry > ruminants (Pestka and Smolinski 2005). Pig has been shown to be also the most
sensitive species to other mycotoxins, like NIV (EFSA 2013), ZEA (Fink-Gremmels 2008), fumonisins
(Morgavi and Riley 2007) whereas horses are also the species most sensitive to fumonisins (Smith and
Girish 2008). An overview of the animal performances affected by mycotoxins, particularly pig and poultry
(ruminants are more resistant) have highlighted that the effects of trichothecenes on feed intake may be
influenced by factors such as age, body weight, sex, feeding period, feeding system and diet, specifically in
pigs (Eriksen 2003). Furthermore, the genetic heterogeneity of these species may often lead to large
individual differences and inconsistent results comparing to rodents.
3.1 Feed Intake
Growth retardation, commonly induced after repeated ingestion of a contaminated feed (chronic
mycotoxicosis), is usually the first sign. However, Hedman et al. (1997a) study on NIV in young male pigs
(pathogen-free Swedish Landrace x Yorkshire) exposed to 2.5 or 5 mg purified NIV/kg feed in the diet for 3
weeks revealed no sign of altered feed intake or body weight and no vomiting or clinical problem. Feed
35
intake was found to be reduced in pig fed a diet containing 5.8mg NIV/kg feed or more but not in pigs fed
2.9 mg NIV/kg feed. In animal studies, DON (in pigs) and ergot alkaloids (in chickens) are the mycotoxins
most often involved in feed refusal, which probably involve neurochemical mechanisms (Brake et al. 2000;
Bakau et al. 1998). It has also been demonstrated that chronic dietary exposure to DON causes impaired
weight gain, anorexia, decreased nutritional efficiency and immune dysregulation (Haschek et al. 2002;
Trenholm et al. 1984). Moreover, it is estimated that the diet contaminated with low level of aflatoxin,
fumonisins and DON, depressed the growth rate and feed intake. For instance in the diet, each increasing
mg/kg (0.2-4mg/kg) of aflatoxin leads to 16% depressed in pigs and 5% in broilers; and DON (1-20mg/kg
feed) leads to 8% depressed marginal growth rate reduction (MGR) in pigs while broilers showed no
response to DON concentrations below 16 mg/kg feed. In the same consequence, fumonisin impacted less on
the growth rate that was estimated to be at 0.4% and 0%/mg per kg for pigs and broilers, respectively
(Battacone et al. 2010; Dersjant-Li et al. 2003).
3.2 Animal Reproduction
Mycotoxin ingestion may affect reproductive efficiency of both males and females with impairment of
metabolic function (Diekman and Green 1992). ZEA may increase abortion, stillbirths and neonatal mortality
in pregnant gilts and sows. These two stages of swine, gilt and sow, particularly the prepubertal gilts are the
most sensitive ones (Kanora and Maes 2009). ZEA at 22 mg/kg diet cause alterations in the reproductive
tract of swine such as in the uterus, and affects follicular and embryo development (Tiemann and Dänicke
2007). Litter size may be decreased by ergot alkaloids (Kanora and Maes 2009; Bryden 1994).
3.3 Animal Immunomodulation
It is pointed out that mycotoxins are immunomodulators, mostly immunosuppressive (Richard 2008) and are
known to increase the susceptibility of animals to infectious disease (CAST 2003). Pestka et al. (2004)
showed that dose frequency and duration of exposure to DON will determine whether it has an
immunostimulatory or immunosuppressant effect including apoptosis and differential gene expression in
immune cells. The experimental result in pig showed that DON could be immunotoxic with a lowest-
36
observed-adverse effect level of 0.12 mg/kg body weight per day (Petska 2010) or chronic exposure to low
doses of DON or FB especially in the combination (Grenier et al. 2011; Pinton et al. 2008). NIV has also
been observed to adversely affect immune system by decreasing the cellularity of the spleen in animals
exposed to 5 mg NIV/kg feed (Hedman et al. 1997b). Negative effect of OTA has been reported consisting in
severe immunosuppression in laying hens fed a diet contaminated at 1mg/kg of feed for 60 days (Battacone
et al. 2010).
Ingestion of toxins can reduce the effectiveness of vaccination programmes and this failure during
aflatoxicosis is related to the immunotoxicity. The toxin impairs the immune function by decreasing cell-
mediated immunity and by inducing an inflammatory response (Meissonnier et al. 2008; Oswald et al. 2005).
Bracarense et al. (2011) postulated that the chronic ingestion of low dose of mycotoxins alters the intestine
(induces tissue lesions, modulate the immune cell count as well as the cytokine synthesis and decreases the
expression of proteins involved in cell adhesion) and thus may predispose animals to infections by enteric
pathogens. In agreement to that, studies in pigs have revealed that fumonisins have increased susceptibility to
intestinal infection with Escherichia coli (Oswald et al. 2003).
3.4 Economic Impacts of Mycotoxin
The economic effects of mycotoxin contamination are profound, and crops with large amounts of
mycotoxins often have to be destroyed or diverted into animal feed resulting in reduced growth rates, illness,
and death (Reddy et al. 2010). Iheshiulor et al. (2011) suggested that there are multiple criteria for assessing
the economic impact of mycotoxins on animal agriculture and human including loss of animal life, livestock
production and forage crops and increased cost of health care, veterinary care regular costs and research
costs focusing on relieving the impact and severity of the mycotoxin problems. Moreover, the impact can be
on feed safety as well as security.
3.4.1 Feed Securities
37
Between humans and animals and at the same time with the world population growing, competition is
increased for food commodities as developing countries raise their appetite for animal products (Woodward
2010). The threat from fungal invasion of crops is also likely to increase due to the climate change (Garrett et
al. 2006). In consequence, fungal infection of crops can also be facilitated by the change in insect population
dynamics due to the climate change (Wu et al. 2011). It is obvious that mycotoxins remain a threat to global
food supplies as a product of plant disease (Strange and Scott 2005) and the degree of risk depends on the
country or region in which crops are grown. These concerns are due to the biological complexity involving
predicting changes in ambient temperature, relative humidity, carbon dioxide levels, interrelationships
between different fungal genera and different crops in different geographical locations (Bryden 2012).
3.4.2 Tissue Residues
Animals consuming mycotoxin-contaminated feeds can produce meat and milk that contains potentially
toxic residues (Reddy et al. 2010). Contamination of animal products with mycotoxins or their metabolic
products has been a crucial issue and poses problems in public health (Boudergue et al. 2009). There is no
evidence for tissue accumulation of DON (Eriksen et al. 2003; JECFA 2001) and its transfer into milk
(Keese et al. 2008) due to its rapid metabolism and de-epoxidation via gut microbiota (Eriksen et al. 2002).
However, aflatoxin residues are most likely contained in milk, especially the hydroxylated metabolite of
AFB1, aflatoxin M1 in milk representing from 1 to 6% of dietary intake of aflatoxins (Fink-Gremmels
2008). In several European countries, OTA has been found in kidneys, blood, muscle tissues and liver of the
pigs (Van Egmond and Speijers 1994). Petterrson (2004) showed the half-life of OTA in chickens and pigs
as being of 140-180 h and approximately 4 h, respectively. However the tissue deposition of toxins, for
instance OTA, is different between poultry and pig due to their pharmacokinetics (Petterrson 2004).
Consumption of pork has been a significant source of human exposure to OTA (Jørgensen and Petersen
2002) and the presence of this mycotoxin in animal-derived products (Gareis and Scheuer 2000).
Not all residues of mycotoxins such as trichothecenes, fumonisins and ZEA are a threat to public health.
Experimental animals were fed with very high levels of the toxins, and very low levels were actually found
in the animal tissues (Petterrson 2004; Pestka 1995). Fumonisins are able to disrupt sphingolipid metabolism
38
(Steyn et al. 2009), and as the result, sphinganine accumulation in tissues initiates a cascade of events that
may cause toxicity, especially of the liver and kidneys, and carcinogenicity (Voss et al. 2007). When
extrapolating or predicting tissue residues, caution should be made as there are often insufficient data on
which to anticipate the outcome of any field toxicosis (Pestka 1995).
4. Strategies for Prevention and Management
Reducing the concentration of mycotoxins in feed or a given crop is possible with the preventive methods.
However, concentrations exceeding the limit prescribed in regulations may still occur in spite of all efforts
(Schatzmayr and Streit 2013). Because of the stability of these compounds, reduction is a difficult task (Cole
1986). Therefore, it is important to limit the mycotoxin contamination of food and feed materials prior to
harvest. The best approach is minimizing mycotoxin production itself by harvesting the grain at maturity and
low moisture and then storing it at cool and dry conditions. This is difficult to achieve during a wet season
harvest or in countries with a warm and humid climate (Huwig et al. 2001). Prevention and reduction of the
occurrence and the impact of mycotoxins requires an integrated understanding of crop biology, agronomy,
fungal ecology, harvesting methods, storage conditions, feed processing and detoxification strategies
(Schatzmayr and Streit 2013; Bryden 2009). Prevention involves first reduction of mycotoxin levels in
feed/foodstuffs and then further increasing the intake of diet components through supplementation such as
vitamins, antioxidants, suphur-containing amino acids, trace elements and substances that are known to
prevent carcinogenesis (Creppy 2002; Nahm 1995).
However, no single treatment in degrading or removing toxins and retaining the nutritional and functional
qualities of the treated commodity has proved completely successful since grains may be naturally
contaminated with multi-mycotoxins and their distinct chemical characteristics (Bryden 2012; Park and Price
2001).
4.1 Agricultural Practices
39
Good agricultural practice such as crop rotation and tillage, ploughing after wheat and maize, reducing plant
density and adequate irrigation, can all minimize the likelihood of mycotoxin formation (Schatzmayr and
Streit 2013). For example, DON level was low (from 15.1ppm to 1.2ppm) in the wheat crop following maize
as a result of one year rotation between crops (Jouany 2007; Schaafsma et al. 2001). Plant protection
products such as microbial antagonists are a promising alternative to conventional fungicides and are also
regarded as biological control. For example Bacillus subtilis strains have been reported to inhibit the growth
of fusaria (Jouany 2007) and atoxigenic A. flavus strains successfully reduce aflatoxin contamination in
treated crops (Cole and Cotty 1990). Genetic modification of fungi and crops is considered as the best
solution. For example, quantitative trait loci for Fusarium resistance have been identified in wheat, and often
coincide with genes controlling morphological plant characteristics (Miedaner et al. 2006). However, other
varietal characteristics that do not seem to relate to fungal resistance may also have an impact on mycotoxin
levels (Anderson 2007).
4.2 Feed Storage and Processing
Grains have to be dry to minimize mycotoxin production. Whilst grain may go into storage at a uniform
temperature, over a period the grain mass will cool at different rates in the center compared to the periphery.
Storage of grain at an appropriate moisture content, generally below 13% moisture, regular inspection of
grain for temperature, wet spots and insect infestation will limit the potential for fungal development in feeds
and feedstuffs. The rapid turnover of feed in high volume animal units will also reduce the risk of feed
contamination, because there will be less time for fungi to grow and to produce toxins (Magan et al. 2010).
Good and Hamilton (1981) demonstrated that poultry performance can be improved significantly by
increasing feed turnover or decreasing feed residence time on farm simply by reducing the amount of feed
per delivery. Thirty five years later it is still good practice to match feed deliveries and storage time to usage
to minimize residence period.
Animal feed pelleting, milling or processing affect mycotoxin levels in finished feed. It is reported that most
mycotoxins are heat-resistant within the range of common food processing temperatures (80-121 °C), so
little or no reduction in overall toxin levels occurs as a result of normal cooking conditions such as frying
40
and boiling (Kabak 2009). However, AFB1 and AFB2 levels can be reduced by cooking and/or processing of
feed up to 41% of their initial levels (Furtado et al. 1981). Processing time and temperature affect the
decomposition rate of fumonisins B1 and B2 which start at 150 to 175 °C. It is known that 90% of
contamination was them were lost after 60 min treatment (Jackson et al. 1996). DON and ZEA are reported
as being stable compounds and not known to be destroyed by thermal processing (Visconti et al. 2004;
Gajecki 2002). Over 50% of OTA in wheat was decomposed at 100°C after 120 min (Boudra et al. 1995).
DON, NIV, ZEA and fumonisins have been shown almost free from wet milling starch of maize and at the
same time DON and NIV are recovered in steep water whereas fumonisins and ZEA are found mainly in the
gluten fraction (Meister and Springer 2004).
The risk of mycotoxin feed contamination would be minimized by ensuring moisture control and
undertaking regular monitoring and where necessary turning of feed materials. It is also important to note
that the amount of reduction of mycotoxins relies heavily on the methods of processing e.g. cooking
conditions, such as temperature, time, water and pH, as well as the type of mycotoxins and their
concentration in the food or feedstuff.
4.3 Decontamination
Pre- and post-harvest technologies have been investigated to avoid or minimize mycotoxicosis. These are
physical methods, chemical methods and detoxifying agents (Jouany 2007; Kabak et al. 2006; CAST 2003;
Ramos and Hernandez 1997; Park 1993).
4.3.1 Physical Methods
Physically, DON, ZEA, fumonisins and aflatoxins in grains can be reduced by implementing washing
procedures using water and sodium carbonate solution or saturated sodium chloride solution. The DON level
could be reduced by 65-69% in barley and maize wash (Kabak et al. 2006) while a 54% reduction of patulin
was observed in apple during washing and handling stages (Acar et al. 1998). A 66% reduction of OTA has
also been reported in hard wheat containing 618µg/kg toxin by using standard milling techniques (Kabak et
41
al. 2006). Cleaning the kernel surface, thus removing the more heavily contaminated particulate matter, have
been proved effective in reducing mycotoxin concentrations when there is light to medium contamination of
the feed. However, this depends on the level of fungal penetration of the endosperm (Kabak et al. 2006). In
many situations once maize is contaminated with fumonisins, removing the screenings will also remove the
greatest portion of the grain (Bryden 2012). A simple and the most widely used method for improving
animal performance is the dilution of mycotoxin-contaminated grain with uncontaminated grain by physical
mixing (Bryden 2012).This practice is not allowed in some countries e.g. Europe.
4.3.2 Chemical Methods
Chemically, the reduction of aflatoxin levels in feed by ammoniation detoxification is an approved procedure
for the detoxication of aflatoxin-contaminated feed in some US States as well as in Senegal, France, and the
UK (Park and Price 2001). It can be also applied to fumonisin concentrations in maize (Norred et al. 1991).
Calcium hydroxide monoethylamine, ammonia and ozone can destroy some mycotoxins (Huwig et al. 2001;
Lemke et al. 1999; McKenzie et al. 1997; Park 1993). Nevertheless, the ineffectiveness of these agents
against other mycotoxins and the possible deterioration of the animal health by excessive residual ammonia
being present in the feed are the main disadvantages of using this detoxicant. Feed additives like
antioxidants, sulphur-containing amino acids, vitamins, and trace elements can also be useful as detoxicants
(Nahm 1995).
4.4 Mycotoxin-Detoxified Agents
Mycotoxin-detoxified agents are assumed to detoxify the contaminated feedstuffs during passage through the
digestive tract by adsorbing and/or degrading the mycotoxins (Döll and Dänicke 2004). However, their
efficacy is determined by the chemical structure of both the detoxifying agent and the mycotoxin
(Avantaggiato et al. 2005). Besides, the effect of specific mycotoxins and detoxifying agents differ for each
type of animal species. Therefore, the evaluation of the efficacy of detoxifying agents against the different
mycotoxins presents in feeds is undertaken separately for poultry, swine, ruminants, rodents and other
species (Boudergue et al. 2009).
42
Furthermore, potential mycotoxin-binding agents such as bleaching clays, synthetic cation or anion exchange
zeolites, bentonite, lucerne, spent canola oil and hydrated sodium calcium aluminosilicate (HSCAS) have
been investigated to reduce toxicity in poultry and livestock (Oguz 2011; Jouany 2007; Huwig et al. 2001).
Phillips et al. (2002) reported that HSCAS is a high affinity adsorbent for aflatoxins, capable of forming a
very stable complex with the toxin and hence reducing its bioavailability, but is less effective with other
mycotoxins.
4.4.1 Binders
The efficiency of mycotoxin binders differs considerably depending primarily on the chemical structure of
both the adsorbent and the toxin (Huwig et al. 2001). A yeast cell wall derived glucomann prepared from
Saccharomyces cerevisiae has been shown in vitro to efficiently adsorb aflatoxin, ZEA and fumonisins
(Jouany 2007). The cell wall harboring proteins, lipids and polysaccharides exhibits numerous different and
easily accessible adsorption centers and different mechanisms such as hydrogen bonds, ionic or hydrophobic
interaction. It has been suggested that on one gram of cell wall it is possible to bind 2.7 mg ZEA (Huwig et
al. 2001). Different adsorbents added to mycotoxin-contaminated diets provide hope of being effective in the
gastro-intestinal tract in a prophylactic rather than in a therapeutic manner. This would make them good
candidates as feed additives. Natural clay products and synthetic polymers are used as inorganic-mycotoxin-
adsorbing agents. Sodium bentonite has been reported to adsorb AFB1 and FB, while zeolites affect OTA,
NIV, DAS, T-2 toxin, ZEA and AFB1 (Boudergue et al. 2009). At the same time, activated charcoal which is
formed by pyrolysis of organic materials is reported to adsorb aflatoxins, fumonisins, OTA and
trichothecenes (Huwig et al. 2001); while activated carbon showed relevant ability in binding DON and NIV
(Avantaggiato et al. 2005). Bentonites, zeolites and aluminosilicates are the most common feed additives that
are effective in binding aflatoxins. Furthermore, cholestyramine was proven to be an effective binder for
fumonisins (in vivo) and ZEA using an in vitro-dynamic gastrointestinal model (Avantaggiato et al. 2005).
The utilization of mycotoxin-binding adsorbents is the most applied way of protecting animals against the
harmful effects of decontaminated feed (Ramos et al. 1996).
43
4.4.2 Biotransforming Agents
Isolating microorganisms and/or enzymes that will degrade or metabolize a mycotoxin rendering it nontoxic
takes considerable effort (Schatzmayr et al. 2006). For instance, trichothecenes can be detoxified by
stabilized bacterium (Eubacterium: BBSH 797 and LS100 are two potential microorganisms), i.e. a feed
additive that removes the epoxide group in vivo (Boudergue et al. 2009; Fuchs et al. 2002) and as such are
regarded as an approach to mycotoxin decontamination (Molnar et al. 2004). It has been reported that
interesting results were obtained by applying Flavobacterium aurantiacum NRRL B-184, the soil bacterium,
to significantly remove aflatoxins from several substrates, including animal feeds, and it was found safe for
use with chicks (Boudergue et al. 2009). The mixture of aflatoxin-contaminated substance and
Flavobacterium aurantiacum were incubated at 28°C for 12 hours and it was observed that all of the
aflatoxin G was removed, as well as a part of aflatoxin B, which was diminished. Moreover, the strain
Nocardia asteroids reduced AFB1 by biotransformation to another fluorescent product (Boudergue et al.
2009). Recently, fumonisin esterase (FUMzyme®), an enzyme-based feed additive produced from a
genetically modified strain of Komagataella pastoris, which is intended to degrade fumonisin mycotoxins
found as contaminants in feeds for growing pigs has been approved by EFSA. Metabolites of fumonisin B1
produced by the action of the active agent have a lower toxicity than the parent compound. Thus, it is
considered safe for consumers of pigs and pork product (EFSA FEEDAP Penel 2014).
Other suggestions of animal feed additive have been made for Trichosporon mycotoxinivorans, a yeast strain
showing the potential to detoxify or degrade OTA and ZEA (Molnar et al. 2004). ZEA is degraded by the
yeast to be carbon oxide and other non-toxic metabolites while OTA is detoxified with the cleavage of the
phenylalanine moiety from the isocumarin derivate ochratoxin α. This metabolite has been described to be
non-toxic or at least 500 times less toxic than the parent compound (Molnar et al. 2004). However, with
transformation of mycotoxins by microorganisms, their application in detoxification of animal feeds has
been limited. This may be due to the lack of information about mechanisms of transformation, toxicity of
transformation products, effects of the transformation reactions on nutritional values of the feeds as well as
the safety towards animals (Boudergue et al. 2009). Fermentation procedures with microorganisms can be
used to detoxify mycotoxin contaminated feed. However, these have not yet been used in practice though the
44
number of corresponding patents has increased (Duvick and Rood 2000). The microorganism conversion is
generally slow and incomplete (Karlovsky 1999; Sweeney and Dobson 1998).
Conclusions
Mycotoxins are presenting in farming, feed manufacturing and food production, and many are harmful to
animals and if not fatal they can importantly impact on their performances and productivity. In order to
reduce the exposure of animals and humans to mycotoxins, necessary practices such as the prevention of the
occurrence of mycotoxins in the first place, ensuring the consistent quality of raw feed materials, and the
implementing and verifying the effectiveness of control and test procedures should be fully considered.
However, high concentrations of those mycotoxins may still exist in food and feed ingredients spite the best
of efforts. It is also difficult to predict the concentration of the mycotoxin precisely in a large bulk lot
because of the heterogeneity of their distribution in commodities i.e. clumping can occur, and the large
variability associated with the overall mycotoxin isolation procedure. Therefore, it is crucial to continuously
monitor food and feed ingredients with fast and reliable screening methods so that the extent of
contamination can be fully and accurately determined and effective measures can be adopted at the relevant
stages in the supply chain to mitigate such contamination should it occur.
Drying and moisture control during storage is generally well understood as a control measure, in addition to
identification of various crop genotypes that are resistant to mycotoxigenic fungus infection and the potential
use of biocompetitive agents in different biological control strategies to prevent the pre-harvest mycotoxins
particularly aflatoxin contamination of crops.
Comprehensive food safety programs targeting both market vendor and local farmers may prevent or
minimize the outbreaks of mycotoxin, especially aflatoxins. An occurrence of mycotoxins in agricultural
commodities may continue to remain as a on the health and an economic issue caused in part by the
complexity of the problem of masked mycotoxins, emerging mycotoxins and the problem of mycotoxin
mixtures.
45
References
Acar, Jale, Vural Gökmen, and Esma Elden Taydas. 1998. “The Effects of Processing Technology on the Patulin
Content of Juice during Commercial Apple Juice Concentrate Production.” Zeitschrift Für
Lebensmitteluntersuchung: 328–331. http://link.springer.com/article/10.1007/s002170050341.
Alassane-Kpembi, Imourana, Martine Kolf-Clauw, Thierry Gauthier et al. 2013. “New Insights into Mycotoxin
Mixtures: The Toxicity of Low Doses of Type B Trichothecenes on Intestinal Epithelial Cells Is Synergistic.”
Toxicology and Applied Pharmacology 272 (1) (October 1): 191–8. doi:10.1016/j.taap.2013.05.023.
Alborzi, Solmaz, Bahman Pourabbas, Mahmood Rashidi, and Behrooz Astaneh. 2006. “Aflatoxin M1 Contamination in
Pasteurized Milk in Shiraz (south of Iran).” Food Control 17 (7) (July): 582–584.
doi:10.1016/j.foodcont.2005.03.009.
Alexopoulos, C. 2001. “Association of Mycotoxicosis with Failure in Applying an Induction of Parturition Program
with PGF2alpha and Oxytocin in Sows.” Theriogenology 55 (8) (May): 1745–1757. doi:10.1016/S0093-
691X(01)00517-9.
Anderson, James A. 2007. “Marker-Assisted Selection for Fusarium Head Blight Resistance in Wheat.” International
Journal of Food Microbiology 119 (1-2) (October 20): 51–3. doi:10.1016/j.ijfoodmicro.2007.07.025.
Annison, E F, and W L Bryden. 1998. “Perspectives on Ruminant Nutrition and Metabolism I. Metabolism in the
Rumen.” Nutrition Research Reviews 11 (2) (December): 173–98. doi:10.1079/NRR19980014.
Antonissen, Gunther, An Martel, Frank Pasmanset al. 2014. “The Impact of Fusarium Mycotoxins on Human and
Animal Host Susceptibility to Infectious Diseases.” Toxins 6 (2) (February): 430–52. doi:10.3390/toxins6020430.
Aucock, H W, W F Marasas, C J Meyer, and P Chalmers. 1980. “Field Outbreaks of Hyperoestrogenism (vulvo-
Vaginitis) in Pigs Consuming Maize Infected by Fusarium Graminearum and Contaminated with Zearalenone.”
Journal of the South African Veterinary Association 51 (3) (September): 163–6.
http://www.ncbi.nlm.nih.gov/pubmed/6455520.
Avantaggiato, G, M Solfrizzo, and A Visconti. 2005. “Recent Advances on the Use of Adsorbent Materials for
Detoxification of Fusarium Mycotoxins.” Food Additives and Contaminants 22 (4) (April): 379–88.
doi:10.1080/02652030500058312.
Awad, W. A., J. Bohm, E. Razzazi-Fazeli, H. W. Hulan, and J. Zentek. 2004. “Effects of Deoxynivalenol on General
Performance and Electrophysiological Properties of Intestinal Mucosa of Broiler Chickens.” Poultry Science 83
(12) (December 1): 1964–1972. doi:10.1093/ps/83.12.1964.
Bakau, W. J. K., W. L. Bryden, T. Garland, and A. C. Barr. 1998. "Ergotism and feed aversion in poultry." Toxic plants
and other natural toxicants. CAB International, Wallingford, UK, pp. 493-496.
46
Bailly, J. D., and P. Guerre. 2008. “Mycotoxicosis in Poultry.” In Mycotoxins in Farm Animals, edited by P. Oswald, I
and I. Taranu, 1–28.
Battacone, Gianni, Anna Nudda, and Giuseppe Pulina. 2010. “Effects of Ochratoxin a on Livestock Production.” Toxins
2 (7) (July): 1796–824. doi:10.3390/toxins2071796.
Bayman, Paul, James L Baker, Mark A Doster, Themis J Michailides, and Noreen E Mahoney. 2002. “Ochratoxin
Production by the Aspergillus Ochraceus Group and Aspergillus Alliaceus.” Applied and Environmental
Microbiology 68 (5) (May 1): 2326–2329. doi:10.1128/AEM.68.5.2326–2329.2002.
Barringer, S. and W. R. Doster 2001. "Case Report-Suspected M1 Aflatoxicoses on a Western Dairy Calf Ranch."
Bovine practitioner 35:126-130.
Bennett, J. W., and M. Klich. 2003. “Mycotoxins.” Clinical Microbiology Reviews 16 (3) (July 1): 497–516.
doi:10.1128/CMR.16.3.497-516.2003.
Berthiller, Franz, Colin Crews, Chiara Dall’Asta et al. 2013. “Masked Mycotoxins: A Review.” Molecular Nutrition &
Food Research 57 (1) (January): 165–86. doi:10.1002/mnfr.201100764.
Bondy, G S, and J J Pestka. 2000. “Immunomodulation by Fungal Toxins.” Journal of Toxicology and Environmental
Health. Part B, Critical Reviews 3 (2): 109–43. doi:10.1080/109374000281113.
Boudergue, Caroline, Christine Burel, Sylviane Dragacci et al. 2009. “Review of mycotoxin-detoxifying agents used as
feed additives: mode of action, efficacy and feed/food safety and natural plant toxicants.” Scientific Report
submitted to EFSA: CFP/EFSA/FEEDAP/ 2009/01
Bracarense, AP, and Joelma Lucioli, Bertrand Grenier et al. 2011. “Chronic Ingestion of Deoxynivalenol and
Fumonisin, Alone or in Interaction, Induces Morphological and Immunological Changes in the Intestine of
Piglets.” Br. J. … 107 (12) (June): 1776–86. doi:10.1017/S0007114511004946.
Boudra, Hamid, Pierrette Le Bars, and Joseph Le Bars. 1995. “Thermostability of Ochratoxin A in Wheat under Two
Moisture Conditions.” Applied and Environmental Microbiology 61 (3): 1156–1158.
http://aem.asm.org/content/61/3/1156.full.pdf.
Brake, J, P B Hamilton, and R S Kittrell. 2000. “Effects of the Trichothecene Mycotoxin Diacetoxyscirpenol on Feed
Consumption, Body Weight, and Oral Lesions of Broiler Breeders.” Poultry Science 79 (6) (June): 856–63.
http://www.ncbi.nlm.nih.gov/pubmed/10875768.
Bryden, Wayne L. 1994. “The Many Guises of Ergotism.” In Plant-Associated Toxins: Agricultural, Phytochemical and
Ecological Aspects, edited by S. M. Colegate and P. R. Dorling, 381–386. CAB International.
Bryden, Wayne L. 2007. “Mycotoxins in the Food Chain: Human Health Implications.” Asia Pacific Journal of Clinical
Nutrition 16 Suppl 1 (Suppl 1) (January): 95–101. http://www.ncbi.nlm.nih.gov/pubmed/17392084.
47
Bryden, Wayne L. 2009. "Mycotoxins and mycotoxicoses: significance, occurrence and mitigation in the food chain."
General, Applied and Systems Toxicology DOI: 10.1002/9780470744307.gat157
Bryden, Wayne L. 2012. “Mycotoxin Contamination of the Feed Supply Chain: Implications for Animal Productivity
and Feed Security.” Animal Feed Science and Technology 173 (1-2) (April): 134–158.
doi:10.1016/j.anifeedsci.2011.12.014. http://linkinghub.elsevier.com/retrieve/pii/S0377840111005037.
CAST (Council for Agricultural Science and Technology) 2003. “Mycotoxins: Risks in Plant and Animal Systems.”
Task Force Report 138
Christensen, C.M. 1979. “Zearalenone” In: Shimoda, W. (Ed.), Conference on Mycotoxins in Animal Feeds and Grains
Related to Animal Health. US Department of Commerce, National Technical Information Service, Springfield,
VA, pp. 1–79.
Cole, RJ. (Ed.) 1986. “Modern Methods in the Analysis and Structural Elucidation of Mycotoxins.” Academic Press,
New York, USA.
Cole, RJ, and PJ Cotty. 1990. “Biocontrol of Aflatoxin Production by Using Biocompetitive Agents.” A Perspective on
Aflatoxin in Field Crops and animal food products in the United States: A Symposium, pp. 62-66.
http://ag.arizona.edu/research/cottylab/apdfs/Biocontrol of Aflatoxin Producion by Using Biocompetative
Agents.pdf.
Creppy, Edmond E. 2002. “Update of Survey, Regulation and Toxic Effects of Mycotoxins in Europe.” Toxicology
Letters 127 (1-3) (February 28): 19–28. http://www.ncbi.nlm.nih.gov/pubmed/12052637.
Dalvi, R. R. 1986. “An Overview of Aflatoxicosis of Poultry: Its Characteristics, Prevention and Reduction.” Veterinary
Research Communications 10 (1) (December): 429–443. doi:10.1007/BF02214006.
http://link.springer.com/10.1007/BF02214006.
Degen, G. H. 2011. “Tools for Investigating Workplace-Related Risks from Mycotoxin Exposure.” World Mycotoxin
Journal 4 (3) (August 1): 315–327. doi:10.3920/WMJ2011.1295.
Dersjant-Li, Yueming, Martin W A Verstegen, and Walter J J Gerrits. 2003. “The Impact of Low Concentrations of
Aflatoxin, Deoxynivalenol or Fumonisin in Diets on Growing Pigs and Poultry.” Nutrition Research Reviews 16
(2) (December): 223–39. doi:10.1079/NRR200368.
Diekman, M a, and M L Green. 1992. “Mycotoxins and Reproduction in Domestic Livestock.” Journal of Animal
Science 70 (5) (May): 1615–27. http://www.ncbi.nlm.nih.gov/pubmed/1388147.
Döll, S, and S Dänicke. 2004. “In Vivo Detoxification of Fusarium Toxins.” Archives of Animal Nutrition 58 (6)
(December): 419–41. doi:10.1080/00039420400020066.
Duvick, Jon, and Tracy A. Rood. 2000. "Zearalenone detoxification compositions and methods." U.S. Patent 6,074,838.
http://patentimages.storage.googleapis.com/pdfs/US6074838.pdf.
48
EFSA FEEDAP Penel (EFSA Panel on Additives and Products or Substances used in Animal Feed). 2014. “Scientific
Opinion on the Safety and Efficacy of Fumonisin Esterase (FUMzyme®) as a Technological Feed Additive for
Pigs.” EFSA 12 (5): 3667. doi:10.2903/j.efsa.2014.3667.
EFSA (European Food Safety Authority) 2013. “Scientific Opinion on risks for animal and public health related to the
presence of nivalenol in food and feed.” EFSA Panel on Contaminants in the Food Chain (CONTAM); EFSA
Journal 11(6): 3262. doi:10.2903/j.efsa.2013.3262.
EFSA (European Food Safety Authority) 2012. “EFSA Panels on Biological Hazards (BIOHAZ), on Contaminants in
the Food Chain (CONTAM), and on Animal Health and Welfare (AHAW); Scientific Opinion on the public
health hazards to be covered by inspection of meat (poultry).” EFSA Journal 10 (6): 1–179.
doi:10.2903/j.efsa.2012.2741.
EFSA (European Food Safety Authority) 2010. “Scientific Opinion: Statement on Recent Scientific Information on the
Toxicity of Ochratoxin A_EFSA Panel on Contaminants in the Food Chain.” EFSA Journal 8 (6): 1–7.
doi:10.2903/j.efsa.2010.1626.
EFSA (European Food Safety Authority) 2006. “Opinion of the Scientific Panel on Contaminants in the Food Chain on
a Request from the Commission Revealed to Ochratoxin A in Food.” The EFSA Journal 365: 1–56.
http://www.efsa.europa.eu/en/scdocs/doc/contam_op_ej365_ochratoxin_a_food_en.pdf.
Eriksen, G. S., H. Pettersson, K. Johnsen, and J. E. Lindberg. 2002. “Transformation of Trichothecenes in Ileal Digesta
and Faeces from Pigs.” Archiv Für Tierernaehrung 56 (4) (August): 263–274. doi:10.1080/00039420214343.
Eriksen, G. S., H. Pettersson, and J. E. Lindberg. 2003. “Absorption, Metabolism and Excretion of 3-Acetyl Don in
Pigs.” Archives of Animal Nutrition 57 (5) (October): 335–345. doi:10.1080/00039420310001607699.
Eriksen, Gunnar Sundstøl. 2003. Metabolism and Toxicity of Trichothecenes. http://pub.epsilon.slu.se/id/eprint/287.
FAO (Food and Agriculture Organization) 2004. “Worldwide regulations for mycotoxins in food and feed.” Food and
Nutrition Paper 64.
Fink-Gremmels, J., and H. Malekinejad. 2007. “Clinical Effects and Biochemical Mechanisms Associated with
Exposure to the Mycoestrogen Zearalenone.” Animal Feed Science and Technology 137 (3-4) (October): 326–
341. doi:10.1016/j.anifeedsci.2007.06.008.
Fink-Gremmels, Johanna. 2008. “Mycotoxins in Cattle Feeds and Carry-over to Dairy Milk: A Review.” Food
Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment 25 (2) (February):
172–80. doi:10.1080/02652030701823142.
Fuchs, E, E M Binder, D Heidler, and R Krska. 2002. “Structural Characterization of Metabolites after the Microbial
Degradation of Type A Trichothecenes by the Bacterial Strain BBSH 797.” Food Additives and Contaminants 19
(4) (April): 379–86. doi:10.1080/02652030110091154.
49
Furtado, R. M., A. M. Peason, J. I. Gray, M. G. Hogberg, and E. R. Miller. 1981. “Effects of Cooking And/or
Processing Upon Levels of Aflatoxins in Meat from Pigs Fed A Contaminated Diet.” Journal of Food Science 46
(5) (September): 1306–1308. doi:10.1111/j.1365-2621.1981.tb04160.x.
Frisvad, Jens C. 1995. “Mycotoxins and mycotoxigenic fungi in storage.” In: Jayas, D.S., White, N.D.G., Muir, W.E.
(Eds.), Stored-Grain Ecosystems. Marcel Dekker, Inc, New York, pp. 251–288.
Gaigé, Stéphanie, Marion S Bonnet, Catherine Tardivel et al. 2013. “C-Fos Immunoreactivity in the Pig Brain
Following Deoxynivalenol Intoxication: Focus on NUCB2/nesfatin-1 Expressing Neurons.” Neurotoxicology 34
(January): 135–49. doi:10.1016/j.neuro.2012.10.020.
Gajecki, M. 2002. “Zearalenone--Undesirable Substances in Feed.” Polish Journal of Veterinary Sciences 5 (2)
(January): 117–22. http://www.ncbi.nlm.nih.gov/pubmed/12189947.
Gareis M, Scheuer R. 2000. “Ochratoxin A in meat and meat products.” Archiv Lebensmittelhyg. 51:102–104.
Garrett, K A, S P Dendy, E E Frank, M N Rouse, and S E Travers. 2006. “Climate Change Effects on Plant Disease:
Genomes to Ecosystems.” Annual Review of Phytopathology 44 (January): 489–509.
doi:10.1146/annurev.phyto.44.070505.143420.
Galtier P., M. Alvinerie. 1976. “In Vitro Transformation of Ochratoxin A by Animal Microbial Floras.” Annales de
Recherches Vétérinaires 7 (no. 1): 91–98. http://hal.archives-ouvertes.fr/docs/00/90/08/73/PDF/hal-
00900873.pdf.
Glenn, a.E. 2007. “Mycotoxigenic Fusarium Species in Animal Feed.” Animal Feed Science and Technology 137 (3-4)
(October): 213–240. doi:10.1016/j.anifeedsci.2007.06.003.
Good, R.E., Hamilton, P.B. 1981. “Beneficial effect of reducing the feed residence time in a field problem of suspected
mouldy feed.” Poultry Science 60, no. 7: 1403-1405.
Grenier, B., and I. P. Oswald. 2011. “Mycotoxin Co-Contamination of Food and Feed: Meta-Analysis of Publications
Describing Toxicological Interactions.” World Mycotoxin Journal 4 (3) (August 1): 285–313.
doi:10.3920/WMJ2011.1281.
Grenier, Bertrand, Ana-Paula Loureiro-Bracarense, Joelma Lucioli et al. 2011. “Individual and Combined Effects of
Subclinical Doses of Deoxynivalenol and Fumonisins in Piglets.” Molecular Nutrition & Food Research 55 (5)
(May): 761–71. doi:10.1002/mnfr.201000402.
Hamilton, P.B. 1978. “Fallacies in our understanding of mycotoxins: aflatoxins, feed, poultry, mycotoxicosis." Journal
of Food Protection. 41: 404-408.
Hamilton, P.B., Huff, W.E., Harris, J.R., Wyatt, R.D. 1982. “Natural occurrences of ochratoxicosis in poultry.” Poultry
Science 61, no. 9: 1832-1841.
50
Haschek, W.M., Voss, K.A., Beasley, V.R. 2002. “Selected mycotoxins affecting animal and human health.” In:
Haschek, W.M., Rousseaux, C.G., Wallig, M.A. (Eds.), Handbook of Toxicologic Pathology, 1, 2nd ed.
Academic Press, New York, pp. 645–699.
He, P, L G Young, and C Forsberg. 1992. “Microbial Transformation of Deoxynivalenol (vomitoxin).” Applied and
Environmental Microbiology 58 (12) (December): 3857–63.
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=183194&tool=pmcentrez&rendertype=abstract
Hedman, R., H. Pettersson, and J.E. Lindberg. 1997a. “Absorption and Metabolism of Nivalenol in Pigs.” Archiv Für
Tierernaehrung 50 (1) (January): 13–24. doi:10.1080/17450399709386115.
Hedman, R, A Thuvander, I Gadhasson, M Reverter, and H Pettersson. 1997b. “Influence of Dietary Nivalenol
Exposure on Gross Pathology and Selected Immunological Parameters in Young Pigs.” Natural Toxins 5 (6)
(January): 238–46. http://www.ncbi.nlm.nih.gov/pubmed/9615312.
Huwig, a, S Freimund, O Käppeli, and H Dutler. 2001. “Mycotoxin Detoxication of Animal Feed by Different
Adsorbents.” Toxicology Letters 122 (2) (June 20): 179–88. http://www.ncbi.nlm.nih.gov/pubmed/11439224.
Hussein, H S, and J M Brasel. 2001. “Toxicity, Metabolism, and Impact of Mycotoxins on Humans and Animals.”
Toxicology 167 (2) (October 15): 101–34. http://www.ncbi.nlm.nih.gov/pubmed/11567776.
IARC. 1993. “Some Naturally Occurring Substances: Food Items and Constituents, Heterocyclic Aromatic Amines and
Mycotoxins.” International Agency for Research on Cancer 56: 599.
Iheshiulor, O.O.M., B.O. Esonu, O.K. Chuwuka, A.A. Omede, I.C. Okoli, and I.P. Ogbuewu. 2011. “Effects of
Mycotoxins in Animal Nutrition: A Review.” Asian Journal of Animal Sciences 5 (1) (January 1): 19–33.
doi:10.3923/ajas.2011.19.33.
Jackson, Lauren S., Jason J. Hlywka, Kannaki R. Senthil, and Lloyd B. Bullerman. 1996. “Effects of Thermal
Processing on the Stability of Fumonisin B 2 in an Aqueous System.” Journal of Agricultural and Food
Chemistry 44 (8) (January): 1984–1987. doi:10.1021/jf9601729.
JECFA. 2001. “Summary and Conclusions.” In 56th Meeting. Geneva: Joint FAO/WHO Expert Committee on Food
Additives.
Jørgensen, K, and a Petersen. 2002. “Content of Ochratoxin A in Paired Kidney and Meat Samples from Healthy
Danish Slaughter Pigs.” Food Additives and Contaminants 19 (6) (June): 562–7.
doi:10.1080/02652030110113807.
Jørgensen, Kevin. 2005. “Occurrence of Ochratoxin A in Commodities and Processed Food--a Review of EU
Occurrence Data.” Food Additives and Contaminants 22 Suppl 1 (May 2014) (January): 26–30.
doi:10.1080/02652030500344811.
Jouany, J.P. Diaz D.E. 2005. “Effects of Mycotoxins in Ruminants.” The Mycotoxin Blue Book 295-322.
51
Jouany, Jean Pierre. 2007. “Methods for Preventing, Decontaminating and Minimizing the Toxicity of Mycotoxins in
Feeds.” Animal Feed Science and Technology 137 (3-4) (October): 342–362.
doi:10.1016/j.anifeedsci.2007.06.009.
Juhasz, J., Nagy, P., Kulcsar, M., Szigeti, M., Reiczigel, J., Huszenicza, G., 2001. “Effect of low-dose zearalenone
exposure on luteal function, follicular activity and uterine oedema in cycling mares.” Acta Veterinaria Hungarica.
49: 211–222.
Kabak, Bulent, Alan D W Dobson, and Işil Var. 2006. “Strategies to Prevent Mycotoxin Contamination of Food and
Animal Feed: A Review.” Critical Reviews in Food Science and Nutrition 46 (8) (January): 593–619.
doi:10.1080/10408390500436185.
Kabak, Bulent. 2009. “The Fate of Mycotoxins during Thermal Food Processing.” Journal of the Science of Food and
Agriculture 89 (4) (March 15): 549–554. doi:10.1002/jsfa.3491.
Kanora, A, and D Maes. 2009. “The Role of Mycotoxins in Pig Reproduction: A Review.” Veterinarni Medicina 2009
(12): 565–576. https://biblio.ugent.be/publication/890458.
Karlovsky, Petr. 1999. “Biological Detoxification of Fungal Toxins and Its Use in Plant Breeding, Feed and Food
Production.” Natural Toxins 7 (May): 1–23. http://www.ask-force.org/web/Bt/Karlovsky-Biological-
Decontamination-1999.pdf.
Katie Stephen 2013. “Ventilating alone is not enough: Sows bedded on straw can be a big mycotoxin risk.” Pig
Progress magazine 29 (November) number 9. http://www.pigprogress.net/Digital-
Magazine/?title=23&edition=444&page=0&tn=pigprogress
Keese, Christina, Ulrich Meyer, Hana Valenta, et al. 2008. “No Carry over of Unmetabolised Deoxynivalenol in Milk
of Dairy Cows Fed High Concentrate Proportions.” Molecular Nutrition & Food Research 52 (12) (December):
1514–29. doi:10.1002/mnfr.200800077.
Krogh, P. 1987. “Ochratoxins in food” In Mycotoxins in Food, edited by Krogh, P., 97-21. Academic Press, London.
Le Bars, J and P Le Bars. 1996. “Review Article Recent Acute and Subacute Mycotoxicoses Recognized in France.”
Veterinary Research (27): 383–394. http://hal.archives-ouvertes.fr/docs/00/90/24/30/PDF/hal-00902430.pdf.
Lemke, S L, K Mayura, S E Ottinger, et al. 1999. “Assessment of the Estrogenic Effects of Zearalenone after Treatment
with Ozone Utilizing the Mouse Uterine Weight Bioassay.” Journal of Toxicology and Environmental Health.
Part A 56 (4) (February 26): 283–95. doi:10.1080/009841099158114.
Magan, Naresh, and David Aldred. 2005. “Conditions of Formation of Ochratoxin A in Drying, Transport and in
Different Commodities.” Food Additives and Contaminants 22 Suppl 1 (January): 10–6.
doi:10.1080/02652030500412154.
52
Magan, Naresh. 2006. “Mycotoxin Contamination of Food in Europe: Early Detection and Prevention Strategies.”
Mycopathologia 162 (3) (September): 245–53. doi:10.1007/s11046-006-0057-2.
Magan, Naresh, and David Aldred. 2007. “Post-Harvest Control Strategies: Minimizing Mycotoxins in the Food
Chain.” International Journal of Food Microbiology 119 (1-2) (October 20): 131–9.
doi:10.1016/j.ijfoodmicro.2007.07.034.
Magan, Naresh, David Aldred, Kalliopi Mylona, and Ronald J W Lambert. 2010. “Limiting Mycotoxins in Stored
Wheat.” Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment 27
(5) (May): 644–50. doi:10.1080/19440040903514523.
Marquardt, R R, and a a Frohlich. 1992. “A Review of Recent Advances in Understanding Ochratoxicosis.” Journal of
Animal Science 70 (12) (December): 3968–88. http://www.ncbi.nlm.nih.gov/pubmed/1474034.
McKenzie, K.S., A.B. Sarr, K. Mayura, et al. 1997. “Oxidative Degradation and Detoxification of Mycotoxins Using a
Novel Source of Ozone.” Food and Chemical Toxicology 35 (8) (August): 807–820. doi:10.1016/S0278-
6915(97)00052-5.
Meissonnier, Guylaine M, Philippe Pinton, Joëlle Laffitte, et al. 2008. “Immunotoxicity of Aflatoxin B1: Impairment of
the Cell-Mediated Response to Vaccine Antigen and Modulation of Cytokine Expression.” Toxicology and
Applied Pharmacology 231 (2) (September 1): 142–9. doi:10.1016/j.taap.2008.04.004.
Meister, Ute, and Monika Springer. 2004. “Mycotoxins in Cereals and Cereal Products: Occurrence and Changes during
Processing.” Journal of Applied Botany and Food Quality 78 (3): 168–173.
http://cat.inist.fr/?aModele=afficheN&cpsidt=16378581.
Meky, F A, P C Turner, A E Ashcroft, et al. 2003. “Development of a Urinary Biomarker of Human Exposure to
Deoxynivalenol.” Food and Chemical Toxicology : An International Journal Published for the British Industrial
Biological Research Association 41 (2) (February): 265–73. http://www.ncbi.nlm.nih.gov/pubmed/12480302.
Miedaner, T, F Wilde, B Steiner, H Buerstmayr, V Korzun, and E Ebmeyer. 2006. “Stacking Quantitative Trait Loci
(QTL) for Fusarium Head Blight Resistance from Non-Adapted Sources in an European Elite Spring Wheat
Background and Assessing Their Effects on Deoxynivalenol (DON) Content and Disease Severity.” TAG.
Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik 112 (3) (February): 562–9.
doi:10.1007/s00122-005-0163-4.
Mili ćević, Dragan R, Marija Skrinjar, and Tatjana Baltić. 2010. “Real and Perceived Risks for Mycotoxin
Contamination in Foods and Feeds: Challenges for Food Safety Control.” Toxins 2 (4) (April): 572–92.
doi:10.3390/toxins2040572.
Miller, J. D. 1998. "Global significance of mycotoxins." Mycotoxins and Phycotoxins–Developments in Chemistry,
Toxicology and Food Safety Alaken Inc., Ford Collins, Colorado. 3-15.
53
Molnar, Orsolya, Gerd Schatzmayr, Elisabeth Fuchs, and Hansjoerg Prillinger. 2004. “Trichosporon Mycotoxinivorans
Sp. Nov., a New Yeast Species Useful in Biological Detoxification of Various Mycotoxins.” Systematic and
Applied Microbiology 27 (6) (November): 661-71. doi:10.1078/0723202042369947.
Moore, D.D., Chin, L.-J., Bryden, W.L.. 2008. “Contamination of Australian animal feedstuffs and forages with
mycotoxins.” Proceedings Australian Society of Animal Production 27:35.
Morgavi, D.P., and R.T. Riley. 2007. “An Historical Overview of Field Disease Outbreaks Known or Suspected to Be
Caused by Consumption of Feeds Contaminated with Fusarium Toxins.” Animal Feed Science and Technology
137 (3-4) (October): 201–212. doi:10.1016/j.anifeedsci.2007.06.002.
Morgavi, D. P., H. Boudra, and J. P. Jouany. 2008. “Consequences of Mycotoxins in Ruminant Production.” In
Mycotoxins in Farm Animals, edited by I Oswald and I. P.;Taranu, 29–46.
Moss, M.O., 1991. “Mycology of cereal grain and cereal products.” In: Chelkowski, J. (Ed.), Cereal Grain: Mycotoxins,
Fungi and Quality in Drying and Storage. Elsevier Science Publishing Inc, New York, pp. 23–51.
Nahm, K. H. 1995. “Possibilities for Preventing Mycotoxicosis in Domestic Fowl.” World’s Poultry Science Journal 51
(2) (July 1): 177–185. doi:10.1079/WPS19950012.
Norred, W.P., K.A. Voss, C.W. Bacon, and R.T. Riley. 1991. “Effectiveness of Ammonia Treatment in Detoxification
of Fumonisin-Contaminated Corn.” Food and Chemical Toxicology 29 (12) (January): 815–819.
doi:10.1016/0278-6915(91)90108-J.
Oguz, Halis. 2011. “A Review from Experimental Trials on Detoxification of Aflatoxin in Poultry Feed.” Journal of
Veterinary Sciences 27 (1): 1–12. http://eurasianjvetsci.org/pdf/pdf_EJVS_540.pdf.
Oswald, Isabelle P, Clarisse Desautels, Sylvie Fournout, et al. 2003. “Mycotoxin Fumonisin B 1 Increases Intestinal
Colonization by Pathogenic Escherichia Coli in Pigs” 69 (10): 5870–5874. doi:10.1128/AEM.69.10.5870–
5874.2003.
Oswald, I P, D E Marin, S Bouhet, P Pinton, I Taranu, and F Accensi. 2005. “Immunotoxicological Risk of Mycotoxins
for Domestic Animals.” Food Additives and Contaminants 22 (4) (April): 354–60.
doi:10.1080/02652030500058320.
Osweiler, Gary D. 1986. “Occurrence and Clinical Manifestations of Trichothecene Toxicoses and Zearalenone
Toxicoses.” In Diagnosis of Mycotoxicoses, edited by J. L. Richard and J. R. Thurston, 31–42. Springer
Netherlands. doi:10.1007/978-94-009-4235-6_3.
Osweiler, G D. 2000. “Mycotoxins. Contemporary Issues of Food Animal Health and Productivity.” The Veterinary
Clinics of North America. Food Animal Practice 16 (3) (November): 511–30, vii.
http://www.ncbi.nlm.nih.gov/pubmed/11084990.
54
Park, D L. 1993. “Perspectives on Mycotoxin Decontamination Procedures.” Food Additives and Contaminants 10 (1):
49–60. doi:10.1080/02652039309374129.
Park, D.L., Price, W.D. 2001. “Reduction of aflatoxin hazards using ammoniation.” Reviews of Environmental
Contamination and Toxicology 171:139-175.
Petterrson, H. 2004. “Controlling mycotoxins in animal feeds.” In Mycotoxins in Food, edited by Magan, N., Olsen,
M., 262–304.Woodhead Publishing, Cambridge.
Pestka, J.J. 1995. “Fungal toxins in raw and fermented meats.” In Fermented Meats, edited by Campbell-Platt, G.,
Cook, P.E., 194–216. Blackie Academic and Professional, Glasgow, UK.
Pestka, James J, Hui-Ren Zhou, Y Moon, and Y J Chung. 2004. “Cellular and Molecular Mechanisms for Immune
Modulation by Deoxynivalenol and Other Trichothecenes: Unraveling a Paradox.” Toxicology Letters 153 (1)
(October 10): 61–73. doi:10.1016/j.toxlet.2004.04.023.
Pestka, James J, and Alexa T Smolinski. 2005. “Deoxynivalenol: Toxicology and Potential Effects on Humans.”
Journal of Toxicology and Environmental Health. Part B, Critical Reviews 8 (1): 39–69.
doi:10.1080/10937400590889458.
Pestka, James J. 2007. “Deoxynivalenol: Toxicity, Mechanisms and Animal Health Risks.” Animal Feed Science and
Technology 137 (3-4) (October): 283–298. doi:10.1016/j.anifeedsci.2007.06.006.
Pestka, J.J. 2008. “Mechanisms of Deoxynivalenol-Induced Gene Expression and Apoptosis.” Food Additives &
Contaminants: Part A 25 (9) (September): 1128–1140. doi:10.1080/02652030802056626.
Pestka, James J. 2010. “Deoxynivalenol: Mechanisms of Action, Human Exposure, and Toxicological Relevance.”
Archives of Toxicology 84 (9) (September): 663–79. doi:10.1007/s00204-010-0579-8.
Phillips, Timothy D., Shawna L. Lemke, and Patrick G. Grant. 2002. “Characterization of Clay-Based Enterosorbents
for the Prevention of Aflatoxicosis.” In Mycotoxins and Food Safety, edited by Jonathan W. DeVries, Mary W.
Trucksess, and Lauren S. Jackson, 157–171. Springer US. doi:10.1007/978-1-4615-0629-4_16.
Pienaar, J G, T S Kellerman, and W F Marasas. 1981. “Field Outbreaks of Leukoencephalomalacia in Horses
Consuming Maize Infected by Fusarium Verticillioides (= F. Moniliforme) in South Africa.” Journal of the South
African Veterinary Association 52 (1) (March): 21–4. http://www.ncbi.nlm.nih.gov/pubmed/7265095.
Pinton, Philippe, Dima Tsybulskyy, Joelma Lucioli et al. 2012. “Toxicity of Deoxynivalenol and Its Acetylated
Derivatives on the Intestine: Differential Effects on Morphology, Barrier Function, Tight Junctions Proteins and
MAPKinases.” Toxicological Sciences: 1–36. http://toxsci.oxfordjournals.org/.
Pinton, Philippe, Francesc Accensi, Erwan Beauchamp et al. 2008. “Ingestion of Deoxynivalenol (DON) Contaminated
Feed Alters the Pig Vaccinal Immune Responses.” Toxicology Letters 177 (3) (April 1): 215–22.
doi:10.1016/j.toxlet.2008.01.015.
55
Pitt, John I., and Ailsa D. Hocking. 2009. “Fungi and Food Spoilage.” Boston, MA: Springer US. doi:10.1007/978-0-
387-92207-2.
Prelusky, D.B., R.M.G. Hamilton, H.L. Trenholm, and J.D. Miller. 1986. “Tissue Distribution and Excretion of
Radioactivity Following Administration of 14C-Labeled Deoxynivalenol to White Leghorn hens*1.”
Fundamental and Applied Toxicology 7 (4) (November): 635–645. doi:10.1016/0272-0590(86)90113-2.
Rai Mahendra and Varma Ajit, 2010. “Mycotoxins in food, feed and Bioweapons” Springer Heidelberg Dordrecht
London New York.
Raisbeck, M.F., G.E. Rottinghaus, and J.D. Kendall. 1991. “Effects of Naturally Occurring Mycotoxins on Ruminants.”
In Mycotoxins and Animal Foods, edited by J.E. Smith and R.S. Henderson, 647–677.
Ramos, Antonio-Javier; Fink-Gremmels, Johana; Hernández, Enrique. 1996. “Prevention of Toxic Effects of
Mycotoxins by Means of Nonnutritive Adsorbent Compounds.” Journal of Food Protection 59 (6): 631–641.
Ramos, A.J., and E. Hernández. 1997. “Prevention of Aflatoxicosis in Farm Animals by Means of Hydrated Sodium
Calcium Aluminosilicate Addition to Feedstuffs: A Review.” Animal Feed Science and Technology 65 (1-4)
(April): 197–206. doi:10.1016/S0377-8401(96)01084-X.
Reddy, Krn, B Salleh, B Saad, Hk Abbas, Ca Abel, and Wt Shier. 2010. “An Overview of Mycotoxin Contamination in
Foods and Its Implications for Human Health.” Toxin Reviews 29 (1) (March): 3–26.
doi:10.3109/15569541003598553.
Richard, John L. 2008. “Discovery of aflatoxins and significant historical features.” Toxin Reviews 27 (3-4) (January):
171–201. doi:10.1080/15569540802462040.
Riley, R.T., Wang, E., Merrill Jr., A.H. 1994. “Liquid chromatography of sphinganine and sphingosine: use of the
sphinganine to sphingosine ratio as a biomarker for consumption of fumonisins.” Journal of AOAC International.
77:533-540.
Rodrigues, I., Griessler, K. 2010. “Mycotoxin survey 2009: moulds remain a problem for the whole farm-to-fork.” All
About Feed 1 (3):12-14.
Rodrigues, I. and Naehrer, K. 2011. “Biomin Survey 2010 : Mycotoxins Inseparable from Animal Commodities and
Feed.” AllAboutFeed 2 (2): 17–20.
Rodrigues, Inês, and Karin Naehrer. 2012. “A Three-Year Survey on the Worldwide Occurrence of Mycotoxins in
Feedstuffs and Feed.” Toxins 4 (9) (September): 663–75. doi:10.3390/toxins4090663.
Schaafsma, A W, L Tamburic-Ilinic, J D Miller, et al. 2001. “Agronomic Considerations for Reducing Deoxynivalenol
in Wheat Grain.” Molecular and Physiological Pathology In , 285:279–285.
Schatzmayr, Gerd, Florian Zehner, Martin Täubel et al. 2006. “Microbiologicals for Deactivating Mycotoxins.”
Molecular Nutrition & Food Research 50 (6) (May): 543–51. doi:10.1002/mnfr.200500181.
56
Schatzmayr, G., and E. Streit. 2013. “Global Occurrence of Mycotoxins in the Food and Feed Chain: Facts and
Figures.” World Mycotoxin Journal 6 (3) (August 1): 213–222. doi:10.3920/WMJ2013.1572.
Smith, T. K.; Girish, C. K. 2008. “The Effects of Feed Borne Mycotoxins on Equine Performance and Metabolism.” In
Mycotoxins in Farm Animals, edited by I. Oswald, I, P.;Taranu, 47–70.
Streit, Elisabeth, Gerd Schatzmayr, Panagiotis Tassis et al. 2012. “Current Situation of Mycotoxin Contamination and
Co-Occurrence in Animal Feed--Focus on Europe.” Toxins 4 (10) (October): 788–809.
doi:10.3390/toxins4100788.
Streit, Elisabeth, Karin Naehrer, Inês Rodrigues, and Gerd Schatzmayr. 2013. “Mycotoxin Occurrence in Feed and Feed
Raw Materials Worldwide: Long-Term Analysis with Special Focus on Europe and Asia.” Journal of the Science
of Food and Agriculture 93 (12) (September): 2892–9. doi:10.1002/jsfa.6225.
Steyn, Pieter S., Wentzel C.A. Gelderblom, Gordon S. Shephard, and Fanie R. van Heerden. 2009. “Mycotoxins with a
Special Focus on Aflatoxins, Ochratoxins and Fumonisins.” Edited by Bryan Ballantyne, Timothy C. Marrs, and
Tore Syversen. General and Applied Toxicology (December) 15: 3467-3527.
doi:10.1002/9780470744307.gat150.
Stoev, S. D. 2008. “Mycotoxic Nephropathies in Farm Animals - Diagnostics, Risk Assessment and Preventive
Measures.” In Mycotoxins in Farm Animals, edited by I. Oswald, I, P.;Taranu, 155–195.
Strange, Richard N, and Peter R Scott. 2005. “Plant Disease: A Threat to Global Food Security.” Annual Review of
Phytopathology 43 (January): 83–116. doi:10.1146/annurev.phyto.43.113004.133839.
Sugita-Konishi, Yoshiko, and Takashi Nakajima. 2010. “Nivalenol: The Mycology, Occurrence, Toxicology, Analysis
and Regulation.” In Mycotoxins in Food, Feed and Bioweapons, edited by Mahendra Rai and Ajit Varma, 253–
273. doi:10.1007/978-3-642-00725-5_15.
Swanson, S.P., C. Helaszek, W.B. Buck, H.D. Rood, and W.M. Haschek. 1988. “The Role of Intestinal Microflora in
the Metabolism of Trichothecene Mycotoxins.” Food and Chemical Toxicology 26 (10) (January): 823–829.
doi:10.1016/0278-6915(88)90021-X.
Sweeney, M J, and A D Dobson. 1998. “Mycotoxin Production by Aspergillus, Fusarium and Penicillium Species.”
International Journal of Food Microbiology 43 (3) (September 8): 141–58.
http://www.ncbi.nlm.nih.gov/pubmed/9801191.
Sweeney, M. J.;, S.; White, and A. D. W. Dobson. 2000. “Mycotoxins in Agriculture and Food Safety.” Irish Journal of
Agricultural and Food Research 39 (2): 235–244.
Tannous, Joanna, Rhoda El Khoury, Selma P Snini et al. 2014. “Sequencing, Physical Organization and Kinetic
Expression of the Patulin Biosynthetic Gene Cluster from Penicillium Expansum.” International Journal of Food
Microbiology 189C (July 31): 51–60. doi:10.1016/j.ijfoodmicro.2014.07.028.
57
Taranu, I.;, D. E.; Marin, S.; Bouhet, and I. P. Oswald. 2008. “Effect of Fumonisin on the Pig.” In Mycotoxins in Farm
Animals, edited by I. Oswald, I, P.;Taranu, 91–111.
Trenholm, H L, R M Hamilton, D W Friend, B K Thompson, and K E Hartin. 1984. “Feeding Trials with Vomitoxin
(deoxynivalenol)-Contaminated Wheat: Effects on Swine, Poultry, and Dairy Cattle.” Journal of the American
Veterinary Medical Association 185 (5) (September 1): 527–31.
Tiemann, U, and S Dänicke. 2007. “In Vivo and in Vitro Effects of the Mycotoxins Zearalenone and Deoxynivalenol on
Different Non-Reproductive and Reproductive Organs in Female Pigs: A Review.” Food Additives and
Contaminants 24 (3) (March): 306–14. doi:10.1080/02652030601053626.
Thuvander, A, C Wikman, and I Gadhasson. 1999. “In Vitro Exposure of Human Lymphocytes to Trichothecenes:
Individual Variation in Sensitivity and Effects of Combined Exposure on Lymphocyte Function.” Food and
Chemical Toxicology 37: 639–648. http://www.sciencedirect.com/science/article/pii/S0278691599000381.
Van der Fels-Klerx, H. J., M. C. Kandhai, S. Brynestad,et al. 2009. “Development of a European System for
Identification of Emerging Mycotoxins in Wheat Supply Chains.” World Mycotoxin Journal 2 (2) (May 1): 119–
127. doi:10.3920/WMJ2008.1122.
Van Egmond, Hans P., Speijers, G.J.A., 1994. “Survey of data on the incidence of ochratoxin A in food and feed
worldwide.” Journal of Natural Toxins 3:125-144.
Visconti, Angelo, Edith Miriam Haidukowski, Michelangelo Pascale, and Marco Silvestri. 2004. “Reduction of
Deoxynivalenol during Durum Wheat Processing and Spaghetti Cooking.” Toxicology Letters 153 (1) (October
10): 181–9. doi:10.1016/j.toxlet.2004.04.032.
Voss, K.a., G.W. Smith, and W.M. Haschek. 2007. “Fumonisins: Toxicokinetics, Mechanism of Action and Toxicity.”
Animal Feed Science and Technology 137 (3-4) (October): 299–325. doi:10.1016/j.anifeedsci.2007.06.007.
Wawrzyniak, J, and a Waśkiewicz. 2014. “Ochratoxin A and Citrinin Production by Penicillium Verrucosum on Cereal
Solid Substrates.” Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk
Assessment 31 (1) (January): 139–48. doi:10.1080/19440049.2013.861933.
Weaver, G A, H J Kurtz, J C Behrens, T S Robison, B E Seguin, F Y Bates, and C J Mirocha. 1986. “Effect of
Zearalenone on the Fertility of Virgin Dairy Heifers.” American Journal of Veterinary Research 47 (6) (June):
1395–7. http://www.ncbi.nlm.nih.gov/pubmed/2942065.
Whitaker, T B. 2006. “Sampling Foods for Mycotoxins.” Food Additives and Contaminants 23 (1) (January): 50–61.
doi:10.1080/02652030500241587.
WHO. 2000. “Fumonisin B1.” In Environmental Health Criteria 219, edited by W.H.O. Marasas, J.D. Miller, R.T.
Riley, and A. Visconti. Geneva. http://whqlibdoc.who.int/ehc/WHO_EHC_219.pdf.
58
Wild, C P, and P C Turner. 2002. “The Toxicology of Aflatoxins as a Basis for Public Health Decisions.” Mutagenesis
17 (6) (November): 471–81. http://www.ncbi.nlm.nih.gov/pubmed/12435844.
Wild, C. P., and Y. Y. Gong. 2010. “Mycotoxins and Human Disease: A Largely Ignored Global Health Issue.”
Carcinogenesis 31 (1) (October 29): 71–82. doi:10.1093/carcin/bgp264.
Woodward, David. 2010. “Great Wealth Poor Health: Contemporary Issues in Eating and Living.” Nutrition & Dietetics
67 (3) (August 25): 202–202. doi:10.1111/j.1747-0080.2010.01457.x.
Wu, F., D. Bhatnagar, T. Bui-Klimke et al. 2011. “Climate Change Impacts on Mycotoxin Risks in US Maize.” World
Mycotoxin Journal 4 (1) (January 1): 79–93. doi:10.3920/WMJ2010.1246.
Zinedine, Abdellah, Jose Miguel Soriano, Juan Carlos Moltó, and Jordi Mañes. 2007. “Review on the Toxicity,
Occurrence, Metabolism, Detoxification, Regulations and Intake of Zearalenone: An Oestrogenic Mycotoxin.”
Food and Chemical Toxicology : An International Journal Published for the British Industrial Biological
Research Association 45 (1) (January): 1–18. doi:10.1016/j.fct.2006.07.030.
59
1.3. Objectives of the PhD thesis
The thesis was aimed to:
- Develop an intestinal “loop” model for studying mycotoxins toxicology (the model in
between in vivo and ex vivo)
- Compare the individual or combined effect of DON and NIV on jejunum segment at
different concentrations in in vivo and ex vivo models
- Identify and characterize the most sensitive and/or relevant biomarkers or the endpoints at
different level of tissue to be used in each model
1.4. The PhD thesis structure
The thesis includes of three chapters:
- Chapter I General background and objective of the work
- Chapter II Materials and methods
- Chapter III Results and discussion: paper 1, paper 2 and general discussion
In Chapter III, the first published article is mainly based on the concordant results found at 4-h
incubation between explant and loops model of the effect of individual DON and NIV. The second
in-submitting article is based on the dose-response interaction analysis in loops and the confirmed
concordant results found between 24-h-incubation loops and 28-day animal experiment of DON or
DON combined with NIV.
60
Chapter II: Materials and Methods
To achieve the thesis objectives, three biological experimental models (Fig. 3.) were used and
various samplings were performed on pigs. The 3 experimental pig models are (i) Explant (ex-vivo),
(ii) Loops surgical model (in vivo) and (iii) animal experiment (in vivo).
Figure 3. The diagram illustrates the 3 biological models from pig and contaminations dosages used
2.1. Biological models
2.1.1. Explant model (Kolf-Clauw et al. 2009)
Six pigs were used with 3 treatments at different levels of DON and NIV and DON+NIV (1:1) at a
concentration of 0, 1, 3, and 10 µM in the culture medium. In total, 72 paraffin blocks (3 explants
per block) were made. The methods for explant culture, toxin exposure, histological scoring,
61
histological processing, immunohistochemistry, architectural changes, proliferative and apoptosis
indices are described in paper1. Sampling process is shown in Fig. 4.
- Explant procedures
Six 4-to-5-month-old crossbred piglets, housed in the animal facility of the INRA Toxalim,
Research center in food toxicology, Toulouse, France, fed ad libitum with free access to water were
used to obtain explants of jejunal tissue. The procedures of explant culture were performed as
previously described in Kolf-Clauw et al. (2009) and Girard et al. (2005) with slight modifications.
In brief, feed was deprived for 6 h prior to the explant procedures. A 5-cm middle jejunum segment
was collected in prewarmed PBS added with 200 U/mL penicillin and 200 µg/mL streptomycin
(Sigma, Saint-Quentin Fallavier, France). The jejunum was opened longitudinally, without
removing external tunica muscularis and washed for 10 min at 39 °C, in culture medium contained
with 200 U/mL penicillin and 200 µg/mL streptomycin. Sterilized biopsy punch (Stiefel
laboratories LTD., Sligo, Ireland) was used to dissect the segment into 6 mm-piece diameter
explants. All these operations were achieved in less than 1 h after the pig had been euthanized.
The pigs jejunal explants were incubated villi up in 6-well culture plates (Nunclon, Sigma) for 4 h
in the complete cell culture medium, Williams E at 37 °C prewarmed and gassed under CO2-
controlled atmosphere, 95% O2/5% CO2 with orbital shaking. The medium (WME), contains 100
U/mL penicillin, 100 µg/mL streptomycin and 50 µg/mL gentamicin and supplemented with D-
glucose (2.5 g/L) and 30 mM Alanine-Glutamine (Sigma). Three explants per well were incubated
on 1-cm2 biopsy sponge, in standard culture conditions.
62
Figure 4. The process of explants sampling. (A) Sampling jejunum segment. (B) Punching jejunum
segment opened. (C) Explants treated with the mycotoxins solutions. (D) Paraffin blocks of
included explants. (E) A microtome for slicing the explant blocks. (F) The slides ready for viewing
under a microscope.
2.1.2. Loops model (Gerdts et al. 2001)
Five pigs were used for surgery of the jejunal loops; three pigs were sampled for 4h and two pigs
24h after injection of mycotoxin into loops. Eleven loops were made, nine of which treated with
different concentrations and two of which were control loops. Each pig, one normal intestinal
segment (non-loop) was also sampled. Each loop was injected with 3 mL mycotoxin solution of
DON and NIV and DON+NIV (1:1) at a concentration of 0, 1, 3 and 10 µM. In total, 70 paraffin
blocks (3 pieces of intestinal segment per block) were made. The methods for loops incubation,
toxin exposure, histological processing, immunohistochemistry, architectural changes, proliferative
and apoptosis indices are described in paper 1 and 2.
- Loops surgical processes and procedures
Five 2-month-old Large White female pigs weighing 20-25 kg, maintained in warmed
compartments with straw, fed with pelleted stock diet (Sevryplus-SANDERS) were used. Animals
were fasted for 6 h prior to surgery but the pigs had full access to water. The loop surgery was
performed as described in Girard-Misguich et al. (2011) and Gerdts et al. (2001). In short, for
63
anaesthesia, premedication was started with an intra-muscular (IM) injection of 2 mg/kg bw
Xylazine (Rompun® 2%, Bayer-Schering AG, Leverkusen, Germany) with 20 mg/kg bw ketamine
(Imalgene® 1000, Merial SAS, Villeurbanne, France). The animals were intubated using a cuffed
endotracheal tube (Rüsch, Waiblingen, Germany) and anaesthesia was maintained with closed
circuit of Isoflurane 3% and oxygen and ventilated with a veterinary anesthesia ventilator (Model
2000, Hallowell EMC, Pittsfield, MA, USA) in volume-controlled mode (100% oxygen).
After cleaning and disinfection of the abdomen, a midline abdominal incision was made and a 100-
150 cm long segment of intestine was exteriorized and surgically prepared in the jejunum, where
Peyer’s Patches could rarely be individualized. Eleven loops, each 10-12 cm in length with 2-3 cm
interloop in between were produced from one pig through the mesentery without damaging grossly
visible mesenteric arcades and thus maintaining full blood supply for both loops and interloop
segments (Fig. 5.). An end-to-end anastomosis was made to maintain the intestinal flow from
duodenum to jejunum and ileum in the gut besides the isolated loops. Before producing the loops,
ingesta in the prepared jejunal segments were removed by flushing 2 times with a warm 100 mL
physiological water solution. The exteriorized jejunum was frequently moistened with sterile
physiological serum. The created-jejunum segments were in situ maintained and the midline
abdominal incision was closed with U-shape interrupted sutures (peritoneum and muscles or
abdominal wall) and the continuous sutures (skin). Pigs were treated with 0.15 mg/kg IM analgesic
buprenorphine (Buprecare, Animalcare, Dunnington York, UK) immediately after the operation had
been finished. The surgery lasted for almost 2 h per pig.
After 4 h (3 pigs) and 24 h (2 pigs) post-surgery, the pigs were intravenously (IV) euthanized by
barbiturate overdose to collect created jejunum-loop segments. Jejunal loops were quickly collected
and washed twice with physiological serum prior to be fixed within 10% formalin.
64
Figure 5. Surgical creation of intestinal segment (A) and loops (B/I). The intestinal segment at 100-150 cm
long was separated from the jejunum, which was then rejoined with an end-to-end anastomosis (B/II). The
intestinal segment was subdivided into 11 loops per pig. Each loop was 10-12 cm long with 2-3 cm
interloops (B/III).
2.1.3. Animal experiment
Two different animal experiments each carried out at 2 different locations (Arvalis, Vendome and
Toxalim, Toulouse) with 24 pigs (male and female) and with duration of 28 days per each, and a
total of 48 pigs were sampled. Four treatments were designed with DON, DON+NIV and DON+.
The animals were fed with naturally contaminated feed. The exposed groups were Control (Similar
to non-contaminated feed), DON at 2.89 mg.kg-1 feed, DON 3.5 mg.kg-1 + NIV 0.72 mg.kg-1 feed
and DON+ at 4.3 mg.kg-1 feed. Samples were taken from 9 organs such as duodenum, jejunum,
ileum, Peyer’s patch jejunum, colon, thymus, liver and mesenteric lymph nodes. There were 432
samples embedded in paraffin block in total from 48 pigs. In the experiment conducted at Toxalim,
pigs (n=24) were blood sampled at day0 (the first day) before feeding, at day7 and at day28 (the end
of the experiment). The parameters (Fig. 6.) examined in vivo were growth performance, feed
intake, clinical biochemistry: blood total protein, albumin, fibrinogen, Gamma-glutamyl transferase
(GGT). The animal housing conditions and experimental protocols are described in paper 2. The
results and discussions will be mainly focused excluding the DON+ treatment due to the realistic
contamination of the mycotoxin.
65
Figure 6. The diagram showing parameters for sampling in the animal experiment.
2.2. Histological assessment
2.2.1. Morphometry
The jejunum segments from the three biological models were used for an assessment. The explants
were assessed by a morphological scoring system. The loops (4h and 24 h) and the animal
experiment were assessed by measuring villus height and crypt depth. The assessment and
measurement protocols are described in paper 1.
2.2.2. Immunohistochemistry
The tissues from loops model (jejunum segment) and from animal experiment (jejunum and Peyer’s
patches jejunum) were processed for histology and immunohistochemistry (for proliferation; Ki-67
and apoptosis; caspase-3). The procedures of this process are described in paper 1 and paper 2. The
intestinal crypts were first chosen for proliferative enterocyte count, and then followed by total-cell
66
proliferation and total-cell apoptosis count, finally the proliferative enterocyte and apoptotic
enterocyte counts at the tip of the villi.
2.3. Gene expression (qRT-PCR)
Since DON acts on intestinal immunomodulation and junction protein genes, we investigated the
effects of DON by using qRT-PCR (quantitative Real-Time Polymerase Chain Reaction) analysis in
loops model. In the jejunum segments, treated at 10 µM DON (4 h and 24 h), were determined the
expression of mRNA encoding for IL-1α, IL-1β, IL-6, IL-8, IL-10, IL12-p40, IL-21, TNF-α, TGF-
β, CCL-20, IFN-γ, EDN-2, NF-κB, ALP, TLR-1, TLR-2, TLR-5, TLR-9, PCNA, Lysozyme, ZO-1,
E-cadherin, Occludin, Claudin-1, Claudin-2, Claudin-3, Claudin-4 (Table 3.). The cyclo A and β-
actin were used as housekeeping genes to normalize the values obtained. The genes expression was
calculated relative to the control treatment. The protocols were previously described in Cano et al.
(2013). Briefly, the jejunum tissue pieces stored at -80 °C after fixing in liquid nitrogen, were
extracted with Trizol Reagent (Extract all, Eurobio) for total RNA. RNA quality, concentration and
integrity were assessed spectrophotometrically using Nanodrop ND1000 (Labtech International,
Paris, France). Then, the steps of reverse transcription and real-time qPCR were performed as
described in Meissonnier et al. 2008. To verify genomic DNA amplification signal, non-reverse
transcripted RNA was used as non-template control. Finally, dissociation curves were analyzed and
assessed for the specificity of qPCR products after the reactions. Primers were purchased from
Invitrogen (Invitrogen, Life Technologies Corporation, Paisley, UK). The DDCt method was used
to determined amplification efficiency and initial fluorescence.
Table 3. List of genes used in qTR-PCR and theirs primer sequences (F: forward, 5'�3'; R: reverse, 3'�5').
Gene symbol Gene name Primer sequence Accession number
(reference)
IL-1α Interleukin 1 - alpha F: TCAGCCGCCCATCCA NM_214029,1
R: AGCCCCCGGTGCCATGT (Cano et al. 2013)
IL-1β Interleukin 1 - beta F: ATGCTGAAGGCTCTCCACCTC NM_214055
R: TTGTTGCTATCATCTCCTTGCAC (Von der Hardt et al. 2004)
IL-6 Interleukin 6 F: TTCACCTCTCCGGACAAAACTG NM_214399
R: TCTGCCAGTACCTCCTTGCTGT (Gourbeyre et al. 2014)
IL-8 Interleukin 8 F: GCTCTCTGTGAGGCTGCAGTTC NM_213867
R: AAGGTGTGGAATGCGTATTTATGC (Grenier et al. 2011)
IL-10 Interleukin 10 F: TGAGAACAGCTGCATCCACTTC NM_214041
R: TCTGGTCCTTCGTTTGAAAGAAA (Royaee et al. 2004)
IL12-p40 Interleukin 12 p40 F: GGTTTCAGACCCGACGAACTCT NM_214013
R : CATATGGCCACAATGGGAGATG (Cano et al. 2013)
67
IL-21 Interleukin 21 F: GGCACAGTGGCCCATAAATC MN_214415
R: GCAGCAATTCAGGGTCCAAG (Kiros et al. 2011)
TNF-α Tumor necrosis factor - alpha F: ACTGCACTTCGAGGTTATCGG NM_214022
R: GGCGACGGGCTTATCTGA (Meissonnier et al. 2008)
TGF-β Transforming growth factor - beta F: GAAGCGCATCGAGGCCATTC NM_214015
R: GGCTCCGGTTCGACACTTTC (Meurens et al. 2009)
CCL-20 Chemokine (CCL20) F: GCTCCTGGCTGCTTTGATGTC NM_001024589
R: CATTGGCGAGCTGCTGTGTG (Meurens et al. 2009)
IFN-γ Interferon - gamma F: TGGTAGCTCTGGGAAACTGAATG NM_213948
R: GGCTTTGCGCTGGATCTG (Royaee et al. 2004)
EDN-2 Endothelin 2 F: TACTTCTGCCACTTGGACATCATC ENST00000372587
R: GGCCGTAAGGAGCTGTCTGT (Gourbeyre et al. 2014)
NF-κB Nuclear factor-kappa-B F: CCTCCACAAGGCAGCAAATAG ENSSSCT00000033438
R: TCCACACCGCTGTCACAGA (Present study)
ALP alkaline phosphatase F: AAGCTCCGTTTTTGGCCTG ENSSSCT00000017732
R: GGAGGTATATGGCTTGAGATCCA (Gourbeyre et al. 2014)
TLR-1 Toll-like receptor 1 F: TGCTGGATGCTAACGGATGTC AB219564
R: AAGTGGTTTCAATGTTGTTCAAAGTC (Arce et al. 2010)
TLR-2 Toll-like receptor 2 F: TCACTTGTCTAACTTATCATCCTCTTG AB085935
R: TCAGCGAAGGTGTCATTATTGC (Gourbeyre et al. 2014)
TLR-5 Toll-like receptor 5 F: CCTTCCTGCTTCTTTGATGG NM_001123202
R: CTGTGACCGTCCTGATGTAG (Meurens et al. 2009)
TLR-9 Toll-like receptor 9 F: CACGACAGCCGAATAGCAC AY859728
R: GGGAACAGGGAGCAGAGC (Arce et al. 2010)
PCNA Proliferating cell nuclear antigen F: GTTGATAAAGAGGAGGAAGCAGTT ENSSSCT00000032581
R: TGGCTTTTGTAAAGAAGTTCAGGTAC (Gourbeyre et al. 2014)
Lysozyme Lysozyme F: GGTCTATGATCGGTGCGAGTTC ENSSSCT00000034939
R: TCCATGCCAGACTTTTTCAGAAT (Gourbeyre et al. 2014)
ZO-1 Zonula occludens-1 F: ATAACATCAGCACAGTGCCTAAAGC AJ318101
R: GTTGCTGTTAAACACGCCTCG (Present study)
E-cadherin E-cadherin F: ACCACCGCCATCAGGACTC ENSSSCG00000006369
R: TGGGAGCTGGGAAACGTG (Present study)
Occludin Occludin F: AGCTGGAGGAAGACTGGATCAG U79554
R: TGCAGGCCACTGTCAAAATT Yamagata et al. 2004
Claudin-1 Claudin-1 F: GGGCAGATCCAGTGCAAAGT AJ318102
R: GGCTATTAGTCCCAGCAGGATG (Present study)
Claudin-2 Claudin-2 F: CAGCATGAAATTTGAGATCGGA NM_001161638.1
R: GAGGAAATGATGCCCAAGTAGAGA (Present study)
Claudin-3 Claudin-3 F: CTGCTCTGCTGCTCGTGCCC AY625258
R: TCATACGTAGTCCTTGCGGTCGTAG (Present study)
Claudin-4 Claudin-4 F: CTGCTTTGCTGCAACTGCC AK233156
R: TCAACGGTAGCACCTTACACGTAGT (Present study)
Cyclo A Cyclophilin A F: CCCACCGTCTTCTTCGACAT NM_214353
R: TCTGCTGTCTTTGGAACTTTGTCT (Curtis 2009)
β-actin beta actin F: TCATCACCATCGGCAACG AY550069
R: TTCCTGATGTCCACGTCGC (Von der Hardt et al. 2004)
68
Chapter III: Results and discussion
3.1. Paper 1: Nivalenol has a greater impact than deoxynivalenol on pig jejunum mucosa in
vitro on explants and in vivo on intestinal loops
Toxins 2015, 7, 1945-1961; doi:10.3390/toxins7061945
toxins ISSN 2072-6651
www.mdpi.com/journal/toxins
Article
Nivalenol Has a Greater Impact than Deoxynivalenol on Pig Jejunum Mucosa in Vitro on Explants and in Vivo on Intestinal Loops
Sophal Cheat 1,2,3,†,*, Juliana R. Gerez 1,2,4,†, Juliette Cognié 5, Imourana Alassane-Kpembi 1,2,6,
Ana Paula F. L. Bracarense 4, Isabelle Raymond-Letron 7,8, Isabelle P. Oswald 1,2 and
Martine Kolf-Clauw 1,2,*
1 Université de Toulouse, Institut National Polytechnique-Ecole Nationale Vétérinaire (INP-ENVT),
Unité Mixte de Recherche UMR 1331 Toxalim, Research Center in Food Toxicology,
23 chemin des Capelles, F-31300 Toulouse, France; E-Mail: [email protected] (J.R.G.) 2 INRA, UMR 1331 Toxalim, Research Center in Food Toxicology, 180 chemin de tournefeuille
F-31027 Toulouse, France; E-Mails: [email protected] (I.A.K.);
[email protected] (I.P.O.) 3 Faculty of Animal Science and Veterinary Medicine, Royal University of Agriculture,
P.O. box 2696, Phnom Penh, Cambodia 4 Laboratory of Animal Pathology, Universidade Estadual de Londrina, 86057-990 Londrina, Brazil;
E-Mail: [email protected] 5 Plate-forme CIRE Chirurgie et Imagerie pour la Recherche et l’Enseignement UMR 085 PRC,
INRA, 37380 Nouzilly, France; E-Mail: [email protected] 6 Hôpital d’Instruction des Armées, Camp Guézo 01BP517 Cotonou, Benin 7 INP-ENVT, Université de Toulouse, F-31300 Toulouse, France
8 STROMALab UMR5273 UPS EFS INSERM U1031, 1 Avenue Jean Poulhes, 31403 Toulouse,
France; E-Mail: [email protected]
† These authors contributed equally to this work.
* Authors to whom correspondence should be addressed;
E-Mails: [email protected] or [email protected] (S.C.); [email protected] (M.K.-C.);
Tel.: +855-12555-572 (S.C.); +33-561-193-283 (M.K.-C.); Fax: +33-561-193-978 (M.K.-C.).
Academic Editor: Sven Dänicke
Received: 22 March 2015 / Accepted: 20 May 2015 / Published: 29 May 2015
OPEN ACCESS
Toxins 2015, 7 1946
Abstract: The mycotoxins deoxynivalenol (DON) and nivalenol (NIV), worldwide cereal
contaminants, raise concerns for animal and human gut health, following contaminated food
or feed ingestion. The impact of DON and NIV on intestinal mucosa was investigated after
acute exposure, in vitro and in vivo. The histological changes induced by DON and NIV
were analyzed after four-hour exposure on pig jejunum explants and loops, two alternative
models. On explants, dose-dependent increases in the histological changes were induced by
DON and NIV, with a two-fold increase in lesion severity at 10 µM NIV. On loops, NIV
had a greater impact on the mucosa than DON. The overall proliferative cells showed 30%
and 13% decrease after NIV and DON exposure, respectively, and NIV increased the
proliferative index of crypt enterocytes. NIV also increased apoptosis at the top of villi and
reduced by almost half the proliferative/apoptotic cell ratio. Lamina propria cells (mainly
immune cells) were more sensitive than enterocytes (epithelial cells) to apoptosis induced
by NIV. Our results demonstrate a greater impact of NIV than DON on the intestinal mucosa,
both in vitro and in vivo, and highlight the need of a specific hazard characterization for NIV
risk assessment.
Keywords: mycotoxins; jejunum explant; loops; deoxynivalenol; nivalenol; enterocytes;
histomorphology
1. Introduction
Fungi of the Fusarium genus commonly contaminate cereals in the temperate climatic zones of the
world and contribute to poor quality grains entering the feed and food chain. Among the mycotoxins
produced by Fusarium, the large group of trichothecenes is extremely prevalent, particularly
deoxynivalenol (DON) for which many exposure and toxicological surveys have been carried out or
reviewed recently [1,2]. Nivalenol (NIV), classified with DON as a type B trichothecene, is a
biologically active metabolite of DON, present in agricultural commodities [3,4]. A large-scale data
survey has indicated that DON and NIV are present in 57% and 16%, respectively, of food samples
collected in the European Union [5].
From their first discovery, there has been concern about the relationship between trichothecenes
exposure and health damage based on both experimental toxicity and epidemiological data. Studies have
shown that mycotoxins cause toxic effects in humans as well as in all animal species so far investigated,
the pig being the most sensitive species [6]. Studies in laboratory and farm animals have revealed a
complex spectrum of toxic effects. Experimentally, low to moderate acute oral exposure to
trichothecenes cause vomiting, diarrhea and gastroenteritis, whereas higher doses cause severe damage
to the lymphoid and epithelial cells of the gastrointestinal mucosa resulting in hemorrhage, endotoxemia
and shock. Chronic exposure to trichothecenes can cause anorexia, reduced weight gain, diminished
nutritional efficiency, neuroendocrine changes, and immune modulation. Although not as prevalent as
DON [7], NIV showed higher acute toxicity than DON in animal studies, with oral LD50 values in mice
of 78 and 39 mg·kg−1 for DON and NIV, respectively [8]. NIV is of added concern for food safety but
in vivo information for assessing the health risk remain scarce, and NIV toxicity is considered similar to
Toxins 2015, 7 1947
DON toxicity for protecting human health [9]. At the molecular level, DON and NIV, like other
trichothecenes, display multiple inhibitory effects on the primary metabolism of eukaryotic cells
including the inhibition of proteins, DNA and RNA synthesis [10]. This impairment leads to altered cell
proliferation in tissues with high rates of cell turnover such as spleen, bone marrow, thymus and
intestinal mucosa [11].
Following ingestion of contaminated feed or food, the intestine and intestinal mucosa can be exposed
to a high concentration of food contaminants, such as mycotoxins [12]. However, only a few studies
have investigated the effects of mycotoxins on this target, even though there is increasing evidence that
intestinal epithelium is repeatedly exposed to mycotoxins at a higher concentration than other
tissues [13]. Pigs receiving 3 mg/kg feed of DON for five weeks showed significant histopathological
changes compared to control animals, such as atrophy and fusion of villi and reduction of the number of
goblet cells and lymphocytes [14]. Little is known about the effects of NIV on the intestinal tract of pigs.
Pigs receiving 2.5 or 5 mg NIV/kg of feed for three weeks, showed gastrointestinal erosions [15] and
reduced enzymatic ability of the intestinal epithelium [16].
In the context of implementing the 3Rs, “Replace, Reduce, Refine” [17], in vitro and in vivo
alternatives can be used to reduce the number of experimental animals. An intestinal explants-in vitro
model and an intestinal loops-in vivo model have been developed for studying intestinal responses to
pathogens [18,19]. The culture of intestinal explants allows preservation of the normal histological
structure in vitro [20]. The pig jejunal explant model has previously been used to study the digestive
effects of the mycotoxin DON [21–23], and to analyze the toxicity of mixtures of mycotoxins [24]. The
present work was designed to compare the acute impacts of DON and NIV on pig jejunal mucosa. The
above two models were used in parallel. First, a dose-response study with explants was carried out to
estimate the toxic dose for DON and NIV on the mucosa, then, jejunal loops were injected with the two
toxins at the selected toxic dose. In the two models, the results, assessed after 4-h of exposure, were
concordant, showing a greater impact of NIV compared to DON on the intestinal mucosa.
2. Results
2.1. Explants Model
2.1.1. Histological Analysis before and after Incubation and Effect of DMSO
First, the effects of the culture and of DMSO on the histology of the jejunal explants were
investigated. The explants were observed microscopically and scored from 22 (no lesion) to 0. Before
incubation (T0), the scores were between 16 and 21 for all explants (Figure 1 panel I). The histological
lesions observed were mild edema in the lamina propria and slight dilatation of the lymphatic vessels,
resulting in an average score of 18 ± 2 (Figure 1 panels I and IIa).
After incubation in Williams E Medium (WME) for 4 h, with or without DMSO, the scores did not
differ significantly from those of the non-incubated explants (Figure 1I), although flattened villi were
apparent after this incubation period (Figure 1IIb). The mean villus height was 141 ± 29 µm in the
explants incubated with WME alone and 147 ± 41 µm in the explants incubated with DMSO and did not
differ significantly from the T0 results. No statistically significant difference was observed between the
different incubation groups, with 0.1% DMSO, or without DMSO (Figure 1I). The scores of control
Toxins 2015, 7 1948
explants with or without DMSO were grouped into a single 4-h culture control group for subsequent
analyses (n = 84).
Figure 1. Histological scores of jejunal explants. (I) Explants exposed to different
treatments: T0 (Time 0H, before culture ), T4/WME (4 h in William’s medium E), T4/WME
+ 0.1%DMSO (dimethylsulfoxyde), DON (deoxynivalenol) or NIV (nivalenol): 1, 3 and
10 µM. Values are mean ± SEM. (II) Effect of DON and NIV on the histological score after
4 hours of exposure. Values are mean ± SEM. a, b, c scripts are different at p ≤ 0.05 by
Tukey’s test (II) (a) Jejunal explant uncultured (T0; n = 12). Slight dilatation of the
lymphatic vessels (arrow), HE (hematoxylin-eosin), ×200; (b) explants exposed to WME
with 0.1% DMSO (DMSO n = 42). Edema of the lamina propria and mild villus atrophy
(arrow), HE ×200; (c) 3 µM DON-exposed explant. Moderate fusion and cubic epithelial
cells (arrow) (HE, ×200); (d) 10 µM NIV-exposed explant. Fusion and atrophy of villi with
severely flattened epitelium (arrow) and apical denudation of villi (dotted arrow) (HE, ×200).
Toxins 2015, 7 1949
2.1.2. Effect of Mycotoxins on the Histological Scores
Each treatment, DON (1–10 µM) and NIV (1–10 µM) induced a dose-dependent decrease in the
histological scores of the jejunal explants after 4 h of exposure (p < 0.01) (Figure 1II). In the explants
exposed to DON, the main morphological change was coalescence with moderate fusion of villi. Lesions
included cubic epithelial cells instead of the cylindrical epithelial cells seen in the control, areas of edema
in the lamina propria, villus atrophy and apical denudation of villi with focal loss of apical enterocytes
(Figure 1IIc). In the group treated with NIV, the changes were similar to those of the group exposed to
DON but both the flattening of the epithelial cells and apical denudation of the villi were more severe
(Figure 1IId). The individual treatments with the mycotoxins DON and NIV resulted in a significant
decrease of the histological score from doses of 3 µM and 1 µM, respectively. The corresponding scores
were reduced to about 70% of the control explants by 3 µM and 10 µM DON or 1 µM NIV, to almost
half the mean score of control explants (59% ± 6%) by the highest NIV concentration (Figure 1II).
So, NIV showed greater toxicity than DON in the explant model, with a lowest observed effect
concentration of 1 µM.
Figure 2. Jejunum morphology in a non-loop segment (a) and in a control loop (b) showing
vascular changes in the submucosa (large arrow) and edema of the villi central lymphatic
vessels (thin arrows); (c) Ki-67 immunostaining in a control loop, showing the methodology
for morphometric and proliferation assessments.
Toxins 2015, 7 1950
2.2. Loops Model
2.2.1. Comparison of Loops Segments with Non-Loops Segments
The surgery induced vascular disorders in the loops, more pronounced in the serosa and submucosa
layers, with moderate interstitial edema, congestion, focal blood extravasation and moderate focal
dilation of the central lacteal in the villi tips (Figure 2b). The proliferation and apoptosis counts did not
differ between the control loops and non-loops segments, and were subsequently used as endpoints after
toxins exposure.
2.2.2. Effect of DON and NIV Exposure on Morphometry in the Loops
The mean crypt-depth to villus-height ratios after DON (0.99 ± 0.15) and NIV (1.01 ± 0.16)
treatments were increased by 15%–20% compared to the control ratio (0.86 ± 0.11) without significant
difference between DON and NIV (Figure 3).
Figure 3. Morphometric analysis of the jejunum loops: crypt-depth to villus-height ratio
after DON and NIV exposure at 10 µM for 4 h. Mean values ± SEM expressed as % of the
control group; a, b scripts are different at p ≤ 0.05; Tukey’s test; n = 3 to 6 loops,
30 well-oriented villi and crypts per loop.
2.2.3. Effect of DON and NIV Exposure on Proliferation in the Loops
At the villus tip, a significant decrease was observed in the total cells proliferation compared with
control loops. NIV exposed loops showed a significant 30% decrease in the number of cells proliferating
in the mucosa (p < 0.001), while DON-exposed loops showed a 13% decrease compared with the
controls (Figure 4A). At the crypt level, proliferative index of crypt enterocytes was increased only after
NIV treatment (p = 0.001, Figure 4B).
2.2.4. Effect of DON and NIV Exposure on Apoptosis in the Loops
At the villus tip, the number of total apoptotic cells was higher in NIV-exposed loops than in the
controls. A tendency was detected for the enterocyte apoptotic index (p = 0.057) with mean values of
Toxins 2015, 7 1951
2.36% ± 1.12%, 2.57% ± 1.52% and 3.43% ± 2.55% for the control, DON and NIV, respectively. The
total-cell proliferation to total-cell apoptosis ratios at villus tip showed a significant decrease (p < 0.001)
with values of 6.98 ± 1.84, 5.60 ± 1.65 and 3.89 ± 1.2 for the controls, DON and NIV, respectively. NIV
reduced the total-cell proliferation to total-cell apoptosis ratio at the tip of the villus by 44% compared
to the controls, while DON reduced this ratio by only 20% (Figure 4D).
In lamina propria, the number of apoptotic cells was significantly increased by NIV (p < 0.001,
Figure 4C).
Figure 4. Proliferation and apoptosis in the jejunum loops after DON and NIV exposure at
10 µM for 4 h. Mean values ± SEM expressed as % of the control group (Ctrl) (A) total cell
proliferation at villus tip (upper one-third), p < 0.001; (B) proliferative index of crypt
enterocytes, p = 0.001; (C) lamina propria apoptosis at villus tip (upper one-third),
p < 0.001; and (D) total proliferating cells to total apoptotic cell ratio, at villus tip p < 0.001.
a, b, c scripts are different at p ≤ 0.05; Tukey’s test; n = 3 to 6 loops, 20 villi/loop.
3. Discussion
Two alternative models were used in this study to analyze intestinal mucosal toxicity, a major target
for xenobiotics. An explant model, previously shown to be sensitive [23,24], was first used to
demonstrate dose-related toxicity following in vitro exposure to DON and NIV, and a higher toxicity of
NIV. This result was then confirmed in vivo, using the intestinal loops model.
0
50
100
150
200
% c
omp
ared
to
Ctr
l
(A) Global proliferation (total cell count)
a bc
0
50
100
150
200
% c
omp
ared
to
Ctr
l
(B) Proliferative index of crypt enterocytes
aa
b
0
50
100
150
200
Ctrl DON NIV
% c
omp
ared
to
Ctr
l
(C) Lamina propria apoptosis
aab
b
0
50
100
150
200
Ctrl DON NIV
% c
omp
ared
to
Ctr
l
(D) Villus proliferation/apoptosis ratio
a
b
c
Toxins 2015, 7 1952
3.1. The Jejunum Explants and Loops Alternative Models Reduce the Number of Animals
These two alternative models enabled to reduce the number of animals in experiments, according to
the 3Rs recommendations, as the explants or loops are the experimental unit and not the whole animal.
Pig intestinal explant culture represent a relevant model for investigating the effects of feed and food
contaminants, due to the relevance of the pig model-species in relation to humans, and its high sensitivity
to mycotoxins. In the current study, before analyzing the effects of the mycotoxins DON and NIV on
the scores, the histological scoring was refined and demonstrated the absence of impact of DMSO up to
0.1% as solvent. This study illustrates for the first time, to the best of our knowledge, the use of intestinal
loops in toxicology. However, the scoring system developed for the explants was not suitable to use in
the loops model, because of the inter-loops variations brought about by the surgery-induced vascular
changes (edema in the lamina propria). Proliferation and apoptosis were used to assess the in situ
mucosal changes, being quantifiable biomarkers specifically affected in vitro and in vivo by the
trichothecenes [14,25–28].
3.2. Acute Exposure to NIV More Toxic in Vitro on Jejunum Mucosa than DON
Our study revealed higher intestinal mucosa changes after acute exposure to NIV than to DON
exposure, both in vitro and in vivo. Following in vitro 4-h single exposure, both trichothecenes induced
a dose-related decrease of the explants scores, NIV showing a higher toxicity than DON. Significant
changes were observed in explants exposed to 3 and 10 µM DON. The main histological changes were
focal enterocyte desquamation, moderate atrophy and fusion of villi, in accordance with previous
studies [21,23,27]. The 30% reduction of the histological score following 10 µM DON was similar to
the results obtained by Basso et al. [21] who reported a 37% decrease of the histological score. In our
experiment, all doses of NIV significantly affected the histological scores of the explants. NIV toxicity
on intestinal cells in vitro has already been reported. For example, NIV decreased dose-dependently the
viability of Caco-2 and IPEC-J2 cells [29,30]. In a previous study, the reduction of IEC-6 viability due
to treatment with NIV was related to apoptosis induction [26]. The less severe toxic effect of DON,
as compared to NIV, on intestinal explants is also in accordance with previous studies, which
demonstrated that NIV exerted a stronger effect than DON on both intestinal and non-intestinal cell
lines [26,28,29,31,32].
3.3. Acute Exposure to NIV More Toxic in Vivo on Jejunum Mucosa than DON
In the loops model, as in the explants study, the intestinal toxicity of NIV was higher than that of
DON. At 10 µM, both DON and NIV increased the crypt-depth to villus-height ratios, reflecting
intestinal damage in vivo, as described in conventional animal experiments [33]. At 10 µM, DON and
NIV induced in vivo lamina propria apoptosis and decreased total cells proliferation at the villus tip in
the loops model, while only NIV increased the enterocytes proliferation index at the crypt level. So, our
study shows that the lamina propria cell populations are the most sensitive target of the jejunum mucosa,
after DON and NIV exposure. The major cell populations of lamina propria, besides connective tissue
cells, are immune cells, with high proliferative rate, recognized as the most sensitive cells to DON
toxicity. These targets have been previously described to explain the modulation of the intestinal immune
Toxins 2015, 7 1953
response induced by DON and other trichothecenes [34]. Few studies have analyzed the action of NIV
on intestinal morphology. Chronic ingestion of NIV induced gastrointestinal erosions in young pigs
(2.5 or 5 mg/kg) [15], whereas C57BL/6 mice exposed to NIV subchronically or chronically by feeding
did not show any alterations in the histological architecture of small intestine [35,36]. These differences
could be related to the highest sensitivity of the pig, reported to be the most sensitive species to
mycotoxins [6,37]. In the present study, the proliferation mucosal response at crypt level was significant
for NIV. These results are in accordance with previous comparative studies of the two toxins, in vitro or
in vivo, with other endpoints than the intestinal target. For example, NIV showed higher anorectic
potency in mice [38].
3.4. DON and NIV Induced Apoptosis in Vivo on Loops
The intestinal effects observed after 4-h exposure to DON and NIV can be mediated by oxidative
stress, inducing intestinal cell membrane alteration and apoptosis. DON-induced oxydative stress has
been shown in splenic tissue in a rodent model [39], as well as lipid peroxidation in vitro in HepG2 cells
exposed to levels similar to the present study [40]. The alterations caused by DON in jejunal explants
have been correlated to MAPKs signaling pathway activation [22], and to up-regulation of
pro-inflammatory cytokines [41].
3.5. Relevance of the Results for Risk Characterization
The effects of mycotoxins were assessed at realistic concentrations in the present study, considering
the concentrations of mycotoxins to which the consumer can be exposed via food. The results are
therefore of high relevance for risk characterization of DON and NIV exposure. DON concentrations of
0.16–2 μg/mL (0.5–7 μM) in the human gut can be considered as realistic [42]. The lower concentration
corresponds to the mean estimated daily intake of French adult consumers on a chronic basis [43]. The
higher concentration is the simulated levels that can be attained after the consumption of heavily
contaminated food, and is occasionally encountered. The amount of NIV in cereal products varies
considerably between different countries across the world (from 20–60 µg/kg in France, to
584–1780 µg/kg in China) [44]. Significant architectural and lesional alterations were observed from
doses of 1 µM NIV in this study, which is consistent with the levels plausibly encountered in the
gastrointestinal tract after the consumption of heavily contaminated food.
4. Materials and Methods
4.1. Animals
For explants sampling, six 4–5 week-old crossbred piglets were used, housed in the animal facility of
the INRA ToxAlim Laboratory (Toulouse, France). For the loops experiment, three two-month-old
Large White female pigs were used and housed in the animal facility at INRA Nouzilly. All animals
were fasted for 6 h before explants sampling or loops surgery. The experimental procedures were
conducted in accordance with European Guidelines for the Care and Use of Animals for Research
Purposes and were approved by the INRA local ethical committees for animal experimentation
Toxins 2015, 7 1954
(C2EA-86 for explants, and “Comité d’Ethique en Expérimentation Animale Val de Loire”, C2EA-06,
for the loops experiments).
4.2. Toxins
DON was acquired from Sigma (St Quentin Fallavier, France) and NIV from Waco Pure Chemical
Industries LTD (Osaka, Japan). Stock solutions of these mycotoxins were dissolved in dimethyl
sulfoxide (DMSO Sigma, Saint-Quentin Fallavier, France) at the following concentrations: 15 mM DON
and 10 mM NIV for explants, and at 30 mM DON and NIV for the loops experiments. These stock
solutions were stored at −20 °C. Working dilutions were prepared in William’s medium E (WME-Sigma,
Saint-Quentin Fallavier, France) for the explants, and in physiological saline solution for the loops. The
concentrations range for the dose-response explants study was 0–10 µM, selected after preliminary
explants cultures with 0.1 to 30 µM of each toxin.
4.3. Jejunum Explants Experiment (in Vitro)
4.3.1. Jejunal Explants
The procedure for the culture of explants was as previously described [23,24]. Explants were
incubated for 4 h with WME at 37 °C under a CO2-controlled atmosphere with orbital shaking.
Uncultured control tissue was placed in fixative immediately after dissection, as time 0 controls
(T0, n = 12, two explants/pig). In view of the possible effects of DMSO on intestinal morphology,
the final concentration of 0.1% DMSO corresponding to the highest DMSO concentration in the working
dilutions was tested in 42 explants (with and without DMSO: 84 explants). Twelve explants were
exposed to purified DON and NIV at each of the concentration 1, 3 and 10 µM, for 4 h, respectively
(two explants/pig for each condition).
4.3.2. Histological Scoring
For histological analysis, the explants fixed in 10% formalin (VWR, Strasbourg, France) were
embedded in paraffin (VWR) and sectioned at 3–5 µm thickness parallel to the villus axis and stained
with hematoxylin (VWR) and eosin (CML, Nemours, France) (HE) using standard procedures.
The resulting slides were analyzed independently by two observers, at 100× magnification.
The histological changes were evaluated using a tissue scoring system [23] with minor modifications.
The scoring system included both architectural and lesional criteria, as shown in Table 1. The maximum
score was attributed to the T0 tissue, before incubation, for each criterion. The architectural score
included the number of villi per explant and the fusion of villi. This latter was expressed as the 97.5th
percentile of the percentage of fused villi (number of fused villi/non fused villi 100×). The score of 3 for
villus fusion corresponded to a maximum of 11% fused villi. At least 25 villi needed to be counted per
explant to obtain the score of 3.
The lesional score included morphology of enterocytes (score 3 for columnar epithelium), the degrees
of edema and apoptosis in the lamina propria (score 2 for slight flattening of villi), and the extent of
discontinued epithelium qualified as apical denudation of villi. This endpoint was quantified by the
97.5th percentile of the percentage of the villi showing apical denudation (score 3 for T0 explants).
Toxins 2015, 7 1955
For explants lesions, score 3 corresponded to a maximum of 10% apical denudation and scores of 2, 1,
and 0, to 11%–40%, 41%–70%, and 71%–100%, respectively. For lesion of the lamina propria,
localized edema was scored as 1, whereas multifocal edema and apoptosis were scored as 0. The total
score was calculated by taking into account the degree of severity for the lesions (severity factor). For
each lesion, the score (according to intensity or observed frequency) was multiplied by the severity factor
of 2. The total score for each explant was then obtained from the sum of each criterion. Each score value
was the result of 2 explants/pig/condition. The maximum score (22 points) indicated overall integrity of
the intestine. The histological scoring system was applied to compare the microscopic changes observed
after 4-h exposure of the explants to DON and NIV.
Table 1. Explants histological scoring: endpoints used and severity factor.
Score component Criteria (severity factor) End-point Score
Lesional part of the Score
Enterocytes morphology (2)
Columnar epithelium 3 <50% cuboid epithelium 2 >50% cuboid epithelium 1
Flattened epithelium 0
Apical denudation of villi (2)
0%–10% 3 11%–40% 2 41%–70% 1 71%–100% 0
Lesions of lamina propria (2)No lesions, slight flattening of villi 2
Localized edema and apoptosis 1 Multifocal edema and apoptosis 0
Architectural part of the Score
Villi fusion (1)
0%–11% 3 12%–40% 2 41%–70% 1 71%–100% 0
Number of villi (1)
≥25 3 16–24 2 5–15 1 ≤4 0
4.4. Jejunum Loops Experiment (in Vivo)
4.4.1. Jejunal Loops Injection and Sampling
A 1-m long segment of intestine was surgically prepared in the jejunum, to constitute the loops as
previously described [19,45]. This segment was then subdivided into consecutive segments, designated
as “loops” (10 cm long, 6 loops), separated by “inter-loops”. Three treatments, control (Ctrl), DON and
NIV at 10 µM concentration were used for each of the 3 pigs (1 to 2 loops/pig for each condition, n = 6
loops for the controls) by injecting 3 mL of each test condition into each loop. Four hours after surgery,
the pigs were euthanized by barbiturate overdose (pentobarbital, Vetoquinol, Lure, France) and the
created jejunum-loop segments were collected. These loops were washed twice with physiological serum
prior to fixation. In addition, a non-loop segment was sampled and processed in parallel.
Toxins 2015, 7 1956
4.4.2. Histological Processing
A routine histological processing sequence (from 10% buffered formalin to paraffin block) was used.
Paraffin sections 4-µm thick were stained with HE to assess architectural changes and
immunohistochemically labeled (IHC) to assess proliferation and apoptosis.
4.4.3. Immunohistochemistry
Two commercial antibodies were used as previously described [46,47]. Briefly, four-micrometer
paraffin-embedded transverse sections from formalin-fixed jejunum specimens were dewaxed in toluene
and rehydrated by an acetone bath then deionized water. Antigen retrieval was performed in 10 mM
citrate buffer pH 6.0 for 30 min in a water bath at 95 °C. Cooled sections were then incubated in Dako
peroxidase blocking solution (Dako S2023) to quench endogenous peroxidase activity. Non-specific
binding was blocked by incubation in normal goat serum (dilution 1:10, Dako X0902) for 20 min at
room temperature. The primary antibodies were anti-Ki-67antigen (Dako M7240, dilution 1:50) and
anti-active caspase-3 (R&D system, AF835, dilution 1:300). Sections were incubated with primary
antibodies for 50 min at room temperature (RT). Bound primary antibodies were detected with
EnVision™ + Horse Radish Peroxydase (HRP) Systems (Dako, K4061) 30 min at RT. Peroxidase
activity was revealed by 3,3′-diaminobenzidine tetrahydrochloride substrate (Dako K3468). Finally,
sections were counterstained with Harris hematoxylin, dehydrated and coverslipped.
4.4.4. Architectural Changes
Eclipse E400 Nikon microscope, with DS-FI camera driven by NIS-D element software (Nikon) was
used to capture images (100× magnification) and take the measurements for architectural evaluation of
the digestive mucosa. A total of about 30 well-oriented villi and crypts per loop were selected on each
section. A villus was measured from the tip to the shoulder (crypt-villus junction) and a crypt was
measured from the shoulder to its base (Figure 1c). The crypt-depth to villus-height ratio was calculated
to assess the intestinal architectural changes.
4.4.5. Proliferative and Apoptosis Indexes
Proliferative and apoptotic cells were counted after immunohistochemistry in several sites on the
mucosa. A minimum of 20 well-oriented villi and crypt units were assessed on scanned marked slides
(Panoramic 250 Flash II–3D Histech), and analyzed with Pannoramic Viewer software (v. 1.15.2,
3DHISTECH Ltd, Budapest, Hungary,). Proliferative cells were counted in the upper one-third of the
villi, i.e. villus tip (positive cells/total cells: lamina propria plus epithelial cells), and in the bottom
two-thirds of the crypts from the basis (proliferative index of crypt enterocytes) (Figure 1c).
For apoptosis, the total cells counts, lamina propria counts and villus enterocytes counts were measured
in villus tip (upper one-third). The enterocyte apoptotic index was calculated by dividing the positive
enterocyte number by the total number of enterocytes (×100) in the villus tips while the proliferative
index of crypt enterocytes was calculated by dividing the number of positive enterocytes by the total
number of enterocytes (×100) in the crypt bases (Table 2).
Toxins 2015, 7 1957
Table 2. Summary of the cell counts and indexes used for assessing proliferation and
apoptosis in loops.
Endpoint
Counted
area
(Figure 2)
Cells counts Indexes
Proliferation
Villus tip
Total cells: lamina
propria cells +
enterocytes
Crypt bases Crypt enterocytes
Proliferative index of crypt enterocytes:
number of positive enterocytes/total number of
enterocytes (×100)
Apoptosis
Villus tip
Enterocytes
Lamina propria cells
(mainly immune cells)
Total cells: lamina
propria + enterocytes
Enterocyte apoptotic index: number of positive
enterocytes/total number of enterocytes (×100)
Ratio
Proliferation/Apoptosis
Villus tip
Total cells: lamina
propria cells +
enterocytes
Total-cell proliferation
to total cell apoptosis ratio
4.5. Statistical Analysis
The two experiments were designed as randomized blocks. The explants and loops data are presented
as means ± SEM, expressed as percentages of the control values. Plots of fits versus residuals followed
by Bartlett’s test, and normal plots of the residuals by Anderson-Darling’s test were carried out to
confirm the assumptions of homogeneity of variances and the normal distribution of residuals,
respectively. If these assumptions did not hold, the data were normalized and homogenized by log10 or
square root transformation prior to being analyzed. All tests were performed using the MINITAB
package software (V.13.0, Minitab Inc., State College, PA, USA). The data were analyzed by applying
the GLM option of ANOVA analysis, followed by pairwise comparisons, Tukey’s or Bonferroni’s tests.
The datasets for the control loops and non-loops were analyzed with the Wilcoxon matched pairs test
and paired t-test for apoptosis and proliferation counts, respectively [48].
5. Conclusions
To conclude, the present study shows that pig intestinal explants and loops provide concordant results
and permit investigating the digestive effects of DON and NIV with a reduced number of animals
(implementation of the 3Rs). Acute NIV exposure induced mucosal changes at a lower concentration
than DON in vitro. In vivo, lamina propria cells showed a higher sensitivity than enterocytes to
NIV-induced apoptosis. Our results demonstrate that NIV toxicity is not similar to DON on the digestive
target, highlighting the need of a specific hazard characterization for NIV health risk assessment.
Toxins 2015, 7 1958
Acknowledgments
This study was supported by the ANR DON & Co project. S Cheat was supported by doctoral
fellowships from TECHNO I Scholar Program, Erasmus Mundus. J. Gerez was supported by Grant No.
593/08 from CAPES/COFECUB.
The authors are grateful to AM Cossalter and the CIRE team for the animals care and handling; to O.
Lafaix for helping in the loops experiments; to P. Pinton and S. Desto for helping in explants
experiments; to C. Bleuart and I. Pardo for technical assistance for immunohistochemistry; to F. Lyazhri
for statistical advice; and to D. Warwick for language editing. The loops surgery was conducted at INRA
Centre de recherche Val de Loire (Plate-forme CIRE Chirurgie et Imagerie pour la Recherche et
l’Enseignement, UMR Physiologie de la Reproduction et des Comportements (INRA 0085,
CNRS 7247, université François-Rabelais de Tours, Institut français du cheval et de l’équitation),
37380 Nouzilly, France).
Author Contributions
M.K.C., I.P.O., and I.R.L. have contributed to the conception and the design of the study. S.C. and
J.C. carried out the loops experiments. J.R.G. and I.A.K. carried out the explants experiments. S.C. and
J.R.G. analyzed, interpreted the data, and drafted the manuscript under the direct supervision of M.K.C.
M.K.C., I.P.O., I.R.L. and A.P.B. revised critically the article. All authors read and approved the
final manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
1. Smith, L.E.; Stoltzfus, R.J. Prendergast, a. Food Chain Mycotoxin Exposure, Gut Health, and
Impaired Growth: A Conceptual Framework. Adv. Nutr. An Int. Rev. J. 2012, 3, 526–531.
2. Pestka, J.J. Deoxynivalenol: Mechanisms of action, human exposure, and toxicological relevance.
Arch. Toxicol. 2010, 84, 663–679.
3. Schollenberger, M.; Müller, H.M.; Rüfle, M.; Suchy, S.; Planck, S.; Drochner, W. Survey of
Fusarium toxins in foodstuffs of plant origin marketed in Germany. Int. J. Food Microbiol. 2005,
97, 317–326.
4. Tanaka, K.; Kobayashi, H.; Nagata, T.; Manabe, M. Natural occurrence of trichothecenes on lodged
and water-damaged domestic rice in Japan. Shokuhin Eiseigaku Zasshi 2004, 45, 63–66.
5. Schothorst, R.C.; van Egmond, H.P. Report from SCOOP task 3.2.10 “collection of occurrence data
of Fusarium toxins in food and assessment of dietary intake by the population of EU member states”
Subtask: Trichothecenes. Toxicol. Lett. 2004, 153, 133–143.
6. Pestka, J.J.; Smolinski, A.T. Deoxynivalenol: Toxicology and potential effects on humans.
J. Toxicol. Environ. Health. B. Crit. Rev. 2005, 8, 39–69.
7. Leblanc, J.-C.; Tard, A.; Volatier, J.-L.; Verger, P. Estimated dietary exposure to principal food
mycotoxins from the first French Total Diet Study. Food Addit. Contam. 2005, 22, 652–672.
Toxins 2015, 7 1959
8. IARC (International Agency for Research on Cancer). Some Naturally Occurring Substances, Food
Items and Constituents, Heterocyclic Aromatic Amines and Mycotoxins. Monograph on the
Evaluation of Carcinogenic Risks to Humans; World Health Organization, International Agency for
Research on Cancer: Lyon, France, 1993; pp. 397–444.
9. EFSA. Scientific Opinion on risks for animal and public health related to the presence of nivalenol
in food and feed. EFSA J. 2013, 11, 1–119, doi:10.2903/j.efsa.2013.3262.
10. Rocha, O.; Ansari, K.; Doohan, F.M. Effects of trichothecene mycotoxins on eukaryotic cells: A
review. Food Addit. Contam. 2005, 22, 369–378.
11. Van De Walle, J.; Sergent, T.; Piront, N.; Toussaint, O.; Schneider, Y.-J.; Larondelle, Y.
Deoxynivalenol affects in vitro intestinal epithelial cell barrier integrity through inhibition of
protein synthesis. Toxicol. Appl. Pharmacol. 2010, 245, 291–298.
12. Maresca, M.; Yahi, N.; Younès-Sakr, L.; Boyron, M.; Caporiccio, B.; Fantini, J. Both direct and
indirect effects account for the pro-inflammatory activity of enteropathogenic mycotoxins on the
human intestinal epithelium: Stimulation of interleukin-8 secretion, potentiation of interleukin-1β
effect and increase in the transepithelial passage of commensal bacteria. Toxicol. Appl. Pharmacol.
2008, 228, 84–92.
13. Grenier, B.; Applegate, T.J. Modulation of intestinal functions following mycotoxin ingestion:
Meta-analysis of published experiments in animals. Toxins (Basel) 2013, 5, 396–430.
14. Bracarense, A.-P.F.L.; Lucioli, J.; Grenier, B.; Drociunas Pacheco, G.; Moll, W.-D.;
Schatzmayr, G.; Oswald, I.P. Chronic ingestion of deoxynivalenol and fumonisin, alone or in
interaction, induces morphological and immunological changes in the intestine of piglets. Br. J.
Nutr. 2012, 107, 1776–1786.
15. Hedman, R.; Thuvander, A.; Gadhasson, I.; Reverter, M.; Pettersson, H. Influence of dietary
nivalenol exposure on gross pathology and selected immunological parameters in young pigs.
Nat. Toxins 1997, 5, 238–246.
16. Madej, M.; Lundh, T.; Lindberg, J.E. Effect of exposure to dietary nivalenol on activity of enzymes
involved in glutamine catabolism in the epithelium along the gastrointestinal tract of growing pigs.
Arch. Tierernahr. 1999, 52, 275–284.
17. Russel, W.M.S.; Burch, R.L. The Principles of Human Experimental Technique; Methuen: London,
UK, 1959; pp. 54–66.
18. Girard, F.; Dziva, F.; van Diemen, P.; Phillips, A.D.; Stevens, M.P.; Frankel, G. Adherence of
enterohemorrhagic Escherichia coli O157, O26, and O111 strains to bovine intestinal explants
ex vivo. Appl. Environ. Microbiol. 2007, 73, 3084–3090.
19. Meurens, F.; Berri, M.; Auray, G.; Melo, S.; Levast, B.; Virlogeux-Payant, I.; Chevaleyre, C.;
Gerdts, V.; Salmon, H. Early immune response following Salmonella enterica subspecies enterica
serovar Typhimurium infection in porcine jejunal gut loops. Vet. Res. 2009, 40, 41–44.
20. Nietfeld, J.C.; Tyler, D.E.; Harrison, L.R.; Cole, J.R.; Latimer, K.S.; Crowell, W.A. Culture and
morphologic features of small intestinal mucosal explants from weaned pigs. Am. J. Vet. Res. 1991,
52, 1142–1146.
21. Basso, K.; Gomes, F.; Bracarense, A.P.L. Deoxynivanelol and fumonisin, alone or in combination,
induce changes on intestinal junction complexes and in E-cadherin expression. Toxins (Basel) 2013,
5, 2341–2352.
Toxins 2015, 7 1960
22. Lucioli, J.; Pinton, P.; Callu, P.; Laffitte, J.; Grosjean, F.; Kolf-Clauw, M.; Oswald, I.P.; Bracarense,
A.P.F.R.L. The food contaminant deoxynivalenol activates the mitogen activated protein kinases in
the intestine: Interest of ex vivo models as an alternative to in vivo experiments. Toxicon 2013, 66,
31–36.
23. Kolf-Clauw, M.; Castellote, J.; Joly, B.; Bourges-Abella, N.; Raymond-Letron, I.; Pinton, P.;
Oswald, I.P. Development of a pig jejunal explant culture for studying the gastrointestinal
toxicity of the mycotoxin deoxynivalenol: Histopathological analysis. Toxicol. In Vitro 2009, 23,
1580–1584.
24. Kolf-Clauw, M.; Sassahara, M.; Lucioli, J.; Rubira-Gerez, J.; Alassane-Kpembi, I.; Lyazhri, F.;
Borin, C.; Oswald, I.P. The emerging mycotoxin, enniatin B1, down-modulates the gastrointestinal
toxicity of T-2 toxin in vitro on intestinal epithelial cells and ex vivo on intestinal explants.
Arch. Toxicol. 2013, 87, 2233–2241.
25. Gerez, J.R.; Pinton, P.; Callu, P.; Grosjean, F.; Oswald, I.P.; Bracarense, A.P.F.L. Deoxynivalenol
alone or in combination with nivalenol and zearalenone induce systemic histological changes in
pigs. Exp. Toxicol. Pathol. 2015, 67, 89–98.
26. Bianco, G.; Fontanella, B.; Severino, L.; Quaroni, A.; Autore, G.; Marzocco, S. Nivalenol and
Deoxynivalenol Affect Rat Intestinal Epithelial Cells: A Concentration Related Study. PLoS ONE
2012, 7, doi:10.1371/journal.pone.0052051.
27. Pinton, P.; Tsybulskyy, D.; Lucioli, J.; Laffitte, J.; Callu, P.; Lyazhri, F.; Grosjean, F.;
Bracarense, A.P.; Kolf-clauw, M.; Oswald, I.P. Toxicity of deoxynivalenol and its acetylated
derivatives on the intestine: Differential effects on morphology, barrier function, tight junction
proteins, and mitogen-activated protein kinases. Toxicol. Sci. 2012, 130, 180–190.
28. Marzocco, S.; Russo, R.; Bianco, G.; Autore, G.; Severino, L. Pro-apoptotic effects of nivalenol
and deoxynivalenol trichothecenes in J774A.1 murine macrophages. Toxicol. Lett. 2009, 189,
21–26.
29. Alassane-Kpembi, I.; Kolf-Clauw, M.; Gauthier, T.; Abrami, R.; Abiola, F.A.; Oswald, I.P.;
Puel, O. New insights into mycotoxin mixtures: The toxicity of low doses of Type B trichothecenes
on intestinal epithelial cells is synergistic. Toxicol. Appl. Pharmacol. 2013, 272, 191–198.
30. Wan, L.Y.M.; Turner, P.C.; El-Nezami, H. Individual and combined cytotoxic effects of Fusarium
toxins (deoxynivalenol, nivalenol, zearalenone and fumonisins B1) on swine jejunal epithelial cells.
Food Chem. Toxicol. 2013, 57, 276–283.
31. Luongo, D.; de Luna, R.; Russo, R.; Severino, L. Effects of four Fusarium toxins (fumonisin
B1, alpha-zearalenol, nivalenol and deoxynivalenol) on porcine whole-blood cellular proliferation.
Toxicon 2008, 52, 156–162.
32. Minervini, F.; Fornelli, F.; Flynn, K.M. Toxicity and apoptosis induced by the mycotoxins nivalenol,
deoxynivalenol and fumonisin B1 in a human erythroleukemia cell line. Toxicol. Vitr. 2004, 18, 21–28.
33. Haschek, W.M.; Rousseaux, C.G.; Wallig, M.A. Fundamentals of Toxicologic Pathology, 2nd ed.;
Academic Press-Elsevier: London, UK, 2010; pp. 168–169.
34. Pinton, P.; Oswald, I.P. Effect of deoxynivalenol and other type B trichothecenes on the intestine:
A review. Toxins (Basel) 2014, 6, 1615–1643.
35. Yamamura, H.; Kobayashi, T.; Ryu, J.C.; Ueno, Y.; Nakamura, K.; Izumiyama, N.; Ohtsubo, K.
Subchronic feeding studies with nivalenol in C57BL/6 mice. Food Chem. Toxicol. 1989, 27, 585–590.
Toxins 2015, 7 1961
36. Ryu, J.C.; Ohtsubo, K.; Izumiyama, N.; Nakamura, K.; Tanaka, T.; Yamamura, H.; Ueno, Y. The
acute and chronic toxicities of nivalenol in mice. Toxicol. Sci. 1988, 11, 38–47.
37. Kararli, T.T. Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans
and commonly used laboratory animals. Biopharm. Drug Dispos. 1995, 16, 351–380.
38. Wu, W.; Flannery, B.M.; Sugita-Konishi, Y.; Watanabe, M.; Zhang, H.; Pestka, J.J. Comparison of
murine anorectic responses to the 8-ketotrichothecenes 3-acetyldeoxynivalenol,
15-acetyldeoxynivalenol, fusarenon X and nivalenol. Food Chem. Toxicol. 2012, 50, 2056–2061.
39. Zhou, H.R.; Islam, Z.; Pestka, J.J. Rapid, sequential activation of mitogen-activated protein kinases
and transcription factors precedes proinflammatory cytokine mRNA expression in spleens of mice
exposed to the trichothecene vomitoxin. Toxicol. Sci. 2003, 72, 130–142.
40. Zhang, X.; Jiang, L.; Geng, C.; Cao, J.; Zhong, L. The role of oxidative stress in
deoxynivalenol-induced DNA damage in HepG2 cells. Toxicon 2009, 54, 513–518.
41. Cano, P.M.; Seeboth, J.; Meurens, F.; Cognie, J.; Abrami, R.; Oswald, I.P.; Guzylack-Piriou, L.
Deoxynivalenol as a New Factor in the Persistence of Intestinal Inflammatory Diseases: An
Emerging Hypothesis through Possible Modulation of Th17-Mediated Response. PLoS ONE 2013,
8, doi:10.1371/journal.pone.0053647.
42. Sergent, T.; Parys, M.; Garsou, S.; Pussemier, L.; Schneider, Y.J.; Larondelle, Y. Deoxynivalenol
transport across human intestinal Caco-2 cells and its effects on cellular metabolism at realistic
intestinal concentrations. Toxicol. Lett. 2006, 164, 167–176.
43. Sirot, V.; Fremy, J.M.; Leblanc, J.C. Dietary exposure to mycotoxins and health risk assessment in
the second French total diet study. Food Chem. Toxicol. 2013, 52, 1–11.
44. Hsia, C.C.; Wu, Z.Y.; Li, Y.S.; Zhang, F.; Sun, Z.T. Nivalenol, a main Fusarium toxin in dietary
foods from high-risk areas of cancer of esophagus and gastric cardia in China, induced benign and
malignant tumors in mice. Oncol. Rep. 2004, 12, 449–456.
45. Girard-Misguich, F.; Cognie, J.; Delgado-Ortega, M.; Berthon, P.; Rossignol, C.; Larcher, T.; Melo,
S.; Bruel, T.; Guibon, R.; Chérel, Y.; et al. Towards the establishment of a porcine model to study
human amebiasis. PLoS ONE 2011, 6, doi:10.1371/journal.pone.0028795.
46. Abot, A.; Fontaine, C.; Raymond-Letron, I.; Flouriot, G.; Adlanmerini, M.; Buscato, M.; Otto, C.;
Bergès, H.; Laurell, H.; Gourdy, P.; et al. The AF-1 activation function of estrogen receptor α is
necessary and sufficient for uterine epithelial cell proliferation in vivo. Endocrinology 2013, 154,
2222–2233.
47. Laprie, C.; Abadie, J.; Amardeilh, M.F.; Raymond, I.; Delverdier, M. Detection of the Ki-67
proliferation associated nuclear epitope in normal canine tissues using the monoclonal antibody
MIB-1. Anat. Histol. Embryol. 1998, 27, 251–256.
48. Festing, M.F.W.; Overend, P.; Borja, M.C.; Berdoy, M. The Design of Animal Experiments:
Reducing the Use of Animals in Research through Better Experimental Design; Royal Society of
Medicine Press Limited: London, UK, 2002; pp. 38–59.
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/4.0/).
86
3.2. Paper 2: Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and
nivalenol show synergism on jejunal enterocytes
87
Alternative in vivo pig loops model for toxicity study: Deoxynivalenol and nivalenol
show synergism on jejunal enterocytes
Sophal Cheat1,2,3,*, Philippe Pinton1,2, Anne-Marie Cossalter1,2, Juliette Cognie4, Isabelle Raymond-
Letron5,6, Isabelle P. Oswald1,2, Martine Kolf-Clauw1,2,*
1 Université de Toulouse, Institut National Polytechnique-Ecole Nationale Vétérinaire (INP-ENVT), Unité Mixte de
Recherche UMR 1331 Toxalim, Research Center in Food Toxicology, 23 chemin des Capelles, F-31300 Toulouse,
France 2 INRA, UMR 1331 Toxalim, Research Center in Food Toxicology, 180 chemin de Tournefeuille F-31027 Toulouse,
France 3 Faculty of Animal Science and Veterinary Medicine, Royal University of Agriculture, P.O. box 2696, Phnom Penh,
Cambodia 4 Plate-forme CIRE Chirurgie et Imagerie pour la Recherche et l’Enseignement UMR 085 PRC, INRA, 37380 Nouzilly,
France 5 INP-ENVT, Université de Toulouse, F-31300 Toulouse, France 6 STROMALab UMR5273 UPS EFS INSERM U1031, 1 Avenue Jean Poulhes, 31403 Toulouse, France
* Authors to whom correspondence should be addressed;
E-mails: [email protected] or [email protected] (S.C.); [email protected] (M.K.-C.);
Tel.: +855-12555-572 (S.C.); +33-561-193-283 (M.K.-C.); Fax: +33-561-193-978 (M.K.-C.).
Abstract
Food and feed safety pose an issue due to mycotoxins, secondary fungal metabolites and usually found as
mixtures in cereals products. The aim of this work was to analyze the effects of two main mycotoxins, alone
or associated, deoxynivalenol (DON) and nivalenol (NIV), on the intestinal pig mucosa either after a single
exposure in vivo, or after repeated exposure of animals. The animals received a natural contaminated feed,
with DON (2.89 mg.kg-1 feed) or with DON+NIV (3.50 mg.kg-1 /0.72 mg.kg-1 feed) for 28 days. The loops
model was developed to assess an acute single exposure of DON and NIV individually and in combination
(1:1) at 1, 3 and 10 µM for 24h. Histological investigations, including morphometry, proliferation and
apoptosis assessments were conducted. Both experiments were concordant for the total-cell proliferation
decreased at the villus tips after DON or DON+NIV at 10 µM acutely after 24h, or repeatedly after 28 days,
by 30-35% and 20-25%, respectively in loops and in animals. In loops model, apoptotic enterocytes at villus
tips increased dose-dependently by either DON, NIV alone or in combination. The combination in loops at
10 µM showed higher effects on proliferation and apoptosis than DON alone. The interaction analysis
showed synergism between DON and NIV for villus apoptotic enterocyte. It is concluded that proliferative
enterocyte and total-cell proliferation at the villus tips were sensitive to DON and DON+NIV in both models.
Intestinal loops, in the context of 3Rs, represent a model allowing to investigate the digestive effects of
88
mycotoxins and of food contaminants, and can contribute to improve our knowledge on plausible
interactions of contaminants present simultaneously at the intestinal level.
Keywords: Apoptosis, Fusarium fungi, intestine mucosa, morphometry, surgical model
1. Introduction
The worldwide contamination of agricultural grain commodities by mycotoxins raise a high
concern for food and feed safety (Streit et al 2013). Mycotoxins are low-molecular-weight
secondary metabolites produced by toxigenic fungi (Bouhet and Oswald 2005).
The Fusarium fungi are commonly found on cereals grown in the temperate regions of
America, Europe and Asia. They produce mycotoxins, Fusarium toxins, including deoxynivalenol
(DON) and nivalenol (NIV). F. graminearum and F. culmorum on wheat are both co-producers of
DON and NIV (Logrieco et al 2002; Bottalico and Perrone 2002). These toxins cause a variety of
toxic effects in both animals and human (Creppy 2002). DON may have adverse health effects after
acute or chronic administration. After acute administration of high dose, DON produces mainly
decrease in feed consumption (anorexia) and emesis (vomiting) of neurogenic origin (Gaigé et al
2013). The repeated ingestion of low dose of mycotoxins in pig alters the intestine (induces tissue
lesions, modulate the immune cell count as well as the cytokine synthesis and decreases the
expression of proteins involved in cell adhesion). Thus it may predispose animals to infections by
enteric pathogens (Bracarense et al 2012; Pinton et al 2009). DON is capable to disrupt
proliferation, to induce programmed cell death and to alter genes expression (Petska 2010). Pig is
the most sensitive species to DON and to NIV toxicity (Pestka and Smolinski 2005; EC 2000).
Because of its digestive physiology is very similar to that of human (Kararli 1995), pig can be
regarded as the most relevant animal model for extrapolating to human (Rotter et al 1996).
NIV health damage is regarded as a serious problem. NIV is considered to be one of the
mycotoxins needing regulation (SCOOP EU 2003; EFSA 2013). However, the occurrence of NIV
contamination is limited to some parts of Europe and Asia. Consequently, NIV has been poorly
studied, and the risks have not been evaluated (EFSA 2013). In vitro, NIV inhibited proliferation of
human lymphocytes (Thuvander et al 1999). In young male pigs fed with 2.5 or 5 mg purified
NIV/kg feed for 3 weeks, there was no sign of altered feed intake or body weight and no vomiting
or clinical problem (Hedman et al 1997b). The rate of absorption of NIV in pig was 11-43% during
7.5 hours after feeding with 0.05 mg NIV/kg bw twice daily (Hedman et al 1997a).
Globally, mycotoxin co-occurrence is common (Schatzmayr and Streit 2013), particularly in
finished feed: for example 58% of which 4548 samples contained two or more mycotoxins (Streit et
89
al 2013). DON and NIV usually co-occur in grains and grain products, and the DON concentration
is generally higher than that of NIV (Yazar and Omurtag 2008; Schothorst and van Egmond 2004).
DON and NIV were detected in 57% (n=11022) and 16% (n=4166), respectively, in food samples
in the European Union (Schothorst and van Egmond 2004). The combination of NIV with DON, T-
2 toxin, or DAS resulted in an additive effect in vitro on human lymphocytes (Thuvander et al
1999). Interaction between DON and NIV were synergistic in vitro Caco-2 cells (Alassane-Kpembi
et al 2013). Less additive effect was observed in ex vivo explant (data not published).
Most researches have been targeted on gastrointestinal tract because it is the first organ
exposed to food/feed contaminants or xenobiotics (Haschek et al 2010). The gastrointestinal tract
plays multi-function roles in regulation, storage, propulsion, digestion, absorption, secretion, barrier
activity and elimination (Pinton and Oswald 2014; Gelberg 2012; Haschek et al 2010). In the
approach of “3Rs”-Replacement, Reduction and Refinement (Russell and Burch 1959), an
alternative experimental model will be needed. Many biological models have been used in toxicity
study such as in vitro (cell culture; Pinton et al 2009) and ex vivo (explants; Kolf-Clauw et al 2009)
in parallel to conventional animal experiments (Hedman et al. 1997a & 1997b). The intestinal loops
model has been developed previously in parasitology or in bacteriology studies (Gerdts et al 2001;
Pernthaner et al 1996; Vandenbroucke et al 2011). Jejunal loops model is an in vivo model allowing
to analyze the in situ effects of toxics on intestinal mucosa (Cheat et al 2015).
In our previous study, the digestive effects of DON and NIV were investigated in explants
and in loops after 4-h exposure, and we identified villus apoptosis and proliferation as sensitive
endpoints (Cheat et al 2015). In the present study, we investigated these endpoints to compare the
digestive effects of DON and NIV alone or associated, after a single 24-h exposure in loops, or after
28-day repeated exposure of animals.
2. Materials and methods
2.2. Purified toxins
DON was acquired from Sigma (St Quentin Fallavier, France) and NIV from Waco Pure
Chemical Industries LTD (Osaka, Japan). Stock solutions of these mycotoxins were dissolved in
dimethyl sulfoxide (DMSO) at the 30 mM DON and NIV for the loops experiments. These stock
solutions were stored at -20 °C. Working dilutions were prepared in physiological saline solution.
The concentrations at 0 (Ctrl), 1, 3 and 10 µM were used for the dose-response of individual or
combined mycotoxins.
90
2.2. Animals and toxins exposure
2.2.1. Loops
For the loops experiment, two 2-month-old Large White female pigs weighting 20 and 25 kg
were used and housed in the animal facility at INRA Nouzilly. The experimental procedures were
conducted in accordance with European Guidelines for the Care and Use of Animals for Research
Purposes and were approved by the Val de Loire local ethical committees for animal
experimentation (C2EA-06). The animals were fasted for 6h before loops surgery. A 2-m long
segment of jejunum was surgically prepared, to constitute the loops as previously described (Girard-
Misguich et al 2011; Meurens 2009). This segment was then subdivided into consecutive segments,
designated as “loops” (10 cm long, 12 loops), separated by “inter-loops”. Treatments, control (Ctrl),
DON and NIV at 1 µM, 3 µM and 10 µM and DON+NIV (1:1) at 1 µM, 3 µM and10 µM
concentration were used for each of the 2 pigs (1 loops/pig for each condition) by injecting 3 mL of
each test condition into each loop. After surgery (24 h), the pigs were intravenously (IV) euthanized
by barbiturate overdose and the jejunum loop were collected. These loops were washed twice with
physiological serum prior to fixation in 10% formalin. In addition, jejunum normal segments (nL)
were sampled and processed in parallel.
2.2.2. Animal experiment
For the animal experiment, 24-crossbred castrated-male piglets (4-week old) with a mean
weight of 11.2 (SD 1.2) kg were used. Pigs were acclimatized for 1 week in the animal facility of
the Toxalim laboratory, INRA (Toulouse, France) before the experimental protocols. They were
randomly allocated to 4 experimental batch pens with equal numbers. The experimental procedures
were conducted in accordance with European Guidelines for the Care and Use of Animals for
Research Purposes and were approved by the INRA local ethical committees for animal
experimentation (Directive 63/2010/EEC).
DON and NIV were obtained from a natural contaminated feed source. The levels of the
other mycotoxins were below the detection limits or considered as negligible (Table A1.). A diet
without toxins (Ctrl) or with natural single contamination (DON) at 2.89 mg DON/kg feed or co-
contamination (DON+NIV) at 3.50 mg DON/kg with 0.72 mg NIV/kg feed were used to expose
orally the animals for 28 days. Feed and water were provided ad libitum throughout the
experimental period. The feed composition is given (Table A1.).
Body weights were measured before starting the experiment (day 0). The body weights and
feed intake were measured weekly and at the end of the experiment period (day 28). The blood
samples were collected at days 0, 7 and at 28 for biochemistry analysis: total serum protein (TP),
91
albumin, fibrinogen, gamma-glutamyl transferase (GGT). At the end of the experiment, the pigs
were fasted overnight prior to be subjected to electrical stunning and euthanized by exsanguination.
The jejunum segments were immediately collected and processed as the “Swiss rolls” (Moolenbeek
and Ruitenberg 1981), then fixed in 10% buffered formalin solution for histological procedure.
2.3. Histological assessment
2.3.1. Histological processing and architectural changes
A routine histological processing sequence was used. Paraffin sections from the loops and
from the animal experiment, 4-µm thick were stained with HE to assess architectural changes and
immunohistochemically labeled (IHC) to assess proliferation and apoptosis.
Eclipse E400 Nikon microscope, with DS-FI camera driven by NIS-D element software
(Nikon) was used to capture images (x100 magnification) and take the examinations for
architectural evaluation of the digestive mucosa. Approximately 30 well-oriented villi and crypts
per loop were selected on each section to measure villus height and crypt depth. A villus was
measured from the tip to the shoulder (crypt-villus junction) and a crypt was measured from the
shoulder to its base, as described previously (Cheat et al 2015). The index was calculated as
described previously (Cheat et al 2015). The crypt-depth to villus-height ratio was calculated to
assess the intestinal architectural changes after the treatment (Haschek et al 2010).
2.3.2. Immunohistochemistry
Briefly, four-micrometer paraffin-embedded transverse sections from formalin-fixed
jejunum specimens were dewaxed in toluene and rehydrated by an acetone bath then deionized
water. Antigen retrieval was performed in 10 mM citrate buffer pH 6.0 for 30 min in a water bath at
95°C. Cooled sections were then incubated in Dako peroxidase blocking solution (Dako S2023) to
quench endogenous peroxidase activity. Non-specific binding was blocked by incubation in normal
goat serum (dilution 1:10, Dako X0902) for 20 min at room temperature. Two commercial
antibodies were used as previously described (Abot et al 2013; Laprie et al 1998). The primary
antibodies were anti-Ki-67antigen (Dako M7240, dilution 1:50) and anti-active caspase-3 (R&D
system, AF835, dilution 1:300). Sections were incubated with primary antibodies for 50 min at
room temperature (RT). Bound primary antibodies were detected with EnVision™ + Horse Radish
Peroxydase (HRP) Systems (Dako, K4061) 30 min at RT. Peroxidase activity was revealed by 3,
3’-diaminobenzidine tetrahydrochloride substrate (DAKO, K3468). Finally, sections were
counterstained with Harris hematoxylin, dehydrated and coverslipped.
92
Proliferative and apoptotic cells were counted after immunohistochemistry in several sites
on the mucosa. A minimum of 20 well-oriented villi and crypt units were assessed on scanned
marked slides (Panoramic 250 Flash II – 3D Histech), and analyzed with Pannoramic Viewer
software (v. 1.15.2) as previously described (Cheat et al 2015). The counts were performed at villus
tip and crypt basis. Proliferative and apoptotic cells were counted in the upper one-third of the villi,
i.e. villus tip (positive-total cells: lamina propria plus epithelial cells or enterocyte only).
Proliferative enterocytes were also counted in the bottom two-thirds of the crypts from the basis.
The proliferative index of crypt enterocytes was calculated by dividing the number of positive
enterocytes by the total number of enterocytes (x100) in the crypt bases. The ratios were calculated
by dividing the number of proliferative cells by the number of apoptotic cells, for enterocytes or
total cell (lamina propria and epithelial cells).
2.3.3. Interaction analysis of the mycotoxins
Median-effect doses and combination index (CI) were determined by the Chou-Talalay
median-effect equation (Chou and Talalay 1984) as previously described in Kolf-Clauw et al
(2013). Briefly, the median-effect plot of Chou was applied to the individual toxins, and a median-
enterocyte-apoptosis dose (Dm) was calculated for each toxin (CompuSyn Software 2007). For the
mixture of DON and NIV, the Dm for the mixture was calculated. The CI was calculated for a 10,
20 and 30 % increase of cell apoptosis.
2.4. Statistical analysis
The Completely randomized and the randomized blocks designs were used in the animal
experiment and in the loop experimental model, respectively. The result s are presented as means ±
SD. Plots of fits versus residuals followed by Levene’s and Bartlett’s test, and normal plots of the
residuals by Anderson-Darling’s test were carried out to confirm the assumptions of homogeneity
of variances and the normal distribution of residuals, respectively. If these assumptions did not
hold, the data were normalized and homogenized by log10 or square root prior to analysis to them
being analyzed. If none of the transformations resolve these problems, then Kruskal-Wallis test was
used. All tests were performed using the MINITAB package software (V.13.0, Minitab Inc., State
College, PA, USA). The data were analyzed by applying the GLM option of ANOVA. The datasets
of control loops and normal segments were analyzed with Wilcoxon matched pairs test and paired t-
test. When there was a significant difference at P-value ≤0.05, then the all pairwise comparisons of
means were generated by Tukey’s or Behrens Fisher tests and Asymptotic Mann-Whitney tests
(Bate and Clark 2014; Festing et al 2002).
93
3. Results
3.1. Loops model
The loop results were obtained from 2 pigs after 24 h in situ incubation.
3.1.1. Comparison of loops segments with normal segments
The morphometry was affected by the surgery in the loop (Table 1.). After surgery, the villi
of the control loops were shorter and the crypts were deeper compared to normal segments. The
ratio of crypt-depth to villus-height was significantly higher in control loops than in normal
segments. The number of proliferative total cells or enterocytes at villus tip, the crypt index of
proliferative enterocyte, the number of apoptotic cells at villus tip, and the ratio total-cell
proliferation to total-cell apoptosis at villus tip did not differ between the surgical loop condition
and normal segments.
3.1.2. Effect of the single mycotoxins on proliferation and apoptosis in loops
a. Effect of DON
DON induced a bell-shaped curve for the total number of proliferative cells at the villus tip.
The two lowest concentrations, 1 and 3 µM DON increased the total proliferation by about 20%
compared to the control loops (Fig. 1A-I), whereas 10-µM DON strongly reduced by about 35% the
villus total-cell proliferation compared to control loops.
Villus enterocyte proliferation was not affected at 1 or 10 µM but only at 3 µM was
observed a slight decrease compared to the control loops (Fig. 1B-I). Villus total cell apoptosis did
not show clear evidence of DON related effect (data not shown), while the number of apoptotic
enterocytes at the villus tip increased dose-dependently, with a 20% increase at the highest DON
concentration (Fig. 1C-I).
The total-cell proliferation to total-cell apoptosis ratio showed a bell-shaped curve. The ratio
was about twofold significantly lower at 10-µM DON compared to control loops and about two-to-
threefold higher at 1 and 3 µM compared to control loops (Fig. 1D-I).
b. Effect of NIV
A similar dose-response tendency to that of DON was observed for the total number of
villus proliferative cells, with a 40% decrease of total-cell proliferation at 10-µM NIV compared to
94
control loops (Fig. 1A-II). The enterocyte proliferation was not affected at any concentrations (Fig.
1B-II).
Enterocyte apoptosis at the villus tips significantly increase in loops at 3 µM and 10 µM
(Fig. 1C-II). At these concentrations, 3 µM and 10 µM, the ratio of enterocyte proliferation to
enterocyte apoptosis decreased by about 30% (Fig. 1F-II). The total-cell proliferation to total-cell
apoptosis ratio showed a bell-shaped curve, as for DON, with a twofold decrease at 10 µM DON,
compared to control loops (Fig. 1D-II).
3.1.3. Effect of the mixture DON+NIV (1:1) on proliferation and apoptosis in loops
Similar dose-response curves were observed with the binary combination, compared to
single mycotoxins. For total-cell proliferation at villus tips, a bell-shaped curve similar to that of
DON was observed, with an about 30% increase with the lowest doses, and an about 35% decrease
of the total-cells proliferation at 10-µM DON+NIV (Fig. 1A-III). A dose-dependent relationship
was found for the increase in enterocyte proliferation at villus tips, with 33% and 15% increase of
enterocyte proliferation compared to control loops, at 10 and 3 µM respectively (Fig. 1B-III).
DON+NIV increased dose-dependently enterocyte apoptosis at the villus tips at different
concentrations (P<0.001). DON+NIV (10 µM) increased the enterocyte apoptosis by 68%
compared with control loops (Fig. 1C-III).
Villus enterocyte proliferation to villus enterocyte apoptosis ratio was significantly
decreased for treated loops reaching 30% compared to control loops, at all concentrations of the
mixture (Fig. 1F-III).
3.1.4. Comparative effect of DON+NIV (1:1) in loops at 10 µM showed higher effects on
proliferation and apoptosis than DON alone (Table B2.)
Enterocyte proliferation at the villus tips was significantly increased by 33% for DON+NIV
treated loops compared to control loops (Fig. 2A). The effect of DON+NIV was also found at crypt
levels (Fig. 2B), where DON+NIV exposed loops decreased crypt cell proliferation by 12 %.
A significant increase was observed in the villus enterocyte apoptosis for DON and
DON+NIV loops by 21% and 68% (Fig. 2C), respectively, compared with control loops (P<0,001).
DON+NIV loops increased total-cell apoptosis at the villus tips by about 10% compared with DON
loops and controls.
3.1.5. Interaction analysis of DON+NIV (1:1) for villus enterocyte apoptosis
The effect between DON and NIV was synergist for villus enterocyte apoptosis (Fig. 3) with
CI<1 for an effect below 70% of the control values.
95
3.2. Animal experiment
3.2.1. Zootechnical and clinical pathology: effect of DON and DON+NIV
In this animal experiment, DON and DON+NIV natural contamination at 2.89 mg DON/kg
feed and 3.50 mg DON+0.72mg NIV/kg feed did not affect weight gain, feed intake (Table A2.),
blood total protein, gamma-glutamyl transferase (GGT), albumin and fibrinogen (Table A3.).
3.2.2. Morphometry, proliferation and apoptosis: effect of DON and DON+NIV (Table A4.)
Dietary exposure to co-contamination DON+NIV significantly increased crypt depth by
about 5% compared to DON and to control animals (Fig. 4A).
DON+NIV exposed animals showed a 10-20% decreased in villus enterocyte proliferation
compared to control animals (Fig. 4B). DON+NIV and DON exposed animals showed 20-25%
decrease in the number of total proliferating cells at villus tips (Fig. 4C).
4. Discussion
4.1. Models
A conventional experimental animal model (animal experiment) was used to confirm
endpoints described with loops model. The animal experiment allows to expose the animals to
natural contaminated feed repeatedly (28-day study). Loops model is the alternative model that
enables to reduce the number of animals in toxicology study. The interest of the loops model is that
it has tremendous advantages compared with the models using individual pigs because one pig can
provide approximately 30 individual loops (Girard-Misguich et al 2011; Boyen et al 2009; Meurens
2009) and allows multiple doses assessment. The intestinal loop model has been used in several
species to explore the responses of the intestinal epithelial cells i.e. using bacteria in pigs
(Vandenbroucke et al 2011; Boyen et al 2009), using bacteria in pigs and bovines (Bolton et al
1999), using nematode parasites in sheep (Pernthaner et al 1996), studying mucosal immune
responses in sheep (Gerdts et al 2001). In our study, 24-h in situ incubation was used according to
our research objective. Besides, this model allows the in situ incubation to be maintained for longer
durations for example two weeks (Girard-Misguich et al 2011) or four weeks (Gerdts et al 2001)
without macroscopic lesions or alteration of blood flow.
However, the limitations of the loop model may be the preservation of normal metabolism
for morphological preservation and structural integrity on one side. In this model, the comparison
96
between non-loop segment (nL) and control loops (Ctrl) for the tissue architecture such as villus
height, crypt depth as well as crypt-depth to villus-height ratio revealed a change made by surgery.
It is the first time, at our knowledge, that these changes are reported and we also previously
reported vascular changes after 4-h exposure (Cheat et al 2015). A marked atrophy of the villi at the
vicinity of ulcerative lesions has been reported in villosity architecture of infected and not infected
jejunal loops (Girard-Misguich et al 2011). On another side, the concentration reaching the targets
cell might be modulated potential by loops-to-loops transfer, and it is not possible to have neither
repeated exposure nor natural-occurred mycotoxins treatment via feeding.
4.2. Exposure level and endpoints
The selected concentration ranging from 1 to 10 µM DON was related to previous studies
(Bracarense et al 2012; Pinton et al. 2012; Marzocco et al 2009), and to realistic concentrations for
the consumer via food. Each mycotoxin showed significant effects at 10 µM. This latter
concentration corresponds to an exposure to 3 mg DON/kg contaminated feed or food, assuming
that DON diluted in one liter of gastrointestinal fluid is ingested in one meal and is 100%
bioavailable (Sergent et al 2006). The jejunum was chosen to prepare the loops, because it was
easier than with duodenum or ileum (Girard-Misguich et al 2011). In animal experiment, jejunum
was chosen because of previous experiments in vivo and ex vivo on this segment (Pinton et al 2009,
2012; Kolf-Clauw et al 2013) and because of its anatomy and physiology (Haschek et al 2010). The
discussions will be focused on the highest dose (10 µM) of each toxin.
In animal experiment, the exposure of natural contaminated DON and DON+NIV at 2.89
mg DON/kg feed and 3.50 mg DON+0.72mg NIV/kg feed did not induce any change in the
zootechnical and pathological endpoints studied. The results of clinical pathology were in parallel to
those of Alizadeh et al. (2015). Effects on the weight gain and feed intake has been shown in
previous studies from 2 mg/kg feed for four weeks (Gerez et al 2015; Bracarense et al 2012; Pinton
et al 2012). It is reported that DON is able to decrease nutrient absorption (Ghareeb et al 2015). In
growing pig exposed to 0.9 mg DON/kg feed for 10 days, weight gain was negatively affected but
not feed intake (Alizadeh et al 2015). So, in the present study, jejunum mucosa was exposed to
subclinical level of toxins. Proliferation and apoptosis were chosen as potential sensitive endpoints,
used in parallel to the loops model, to investigate, in absence of zootechnical effects, the
consequences of the toxins in situ on the jejunum mucosa.
Proliferation and apoptosis at different sites of the villi or crypts were selected because there
was no modification between non-loops and control loops segment for theses endpoints.
Trichothecenes are well known to act on highly proliferative cells (Pestka 2010), and the intestinal
97
epithelium has been identified as a target for DON and other derivatives in vitro, ex vivo, and in
vivo (Pinton and Oswald 2014; Kolf-Clauw et al 2013). So, these two endpoints, proliferation and
apoptosis, are specially relevant to assess the in situ mucosa changes, specifically affected in vitro
and in vivo by the trichothecenes (Gerez et al 2015; Bianco et al 2012; Bracarense et al 2012; Pinton
et al 2012; Marzocco et al 2009).
4.3. Effect of DON, NIV and DON+NIV on morphometry
In animal model, crypt depth was increased after DON+NIV exposure but not after DON
exposure. Jejunal crypts were shown deeper after 3 mg/kg DON feeding for 10 weeks (Dänicke et
al 2012) and after 0.9 mg/kg DON feeding for 10 days (Alizadeh et al 2015). These results contrast
with previous other results showing shorter crypt depth after 1.5 mg/kg DON feeding (Gerez et al
2015). No change in crypt depth was observed after repeated exposure to 3 and 6 mg DON/kg feed
for 5 weeks and to 3.1 mg DON/kg feed for 37 days (Klunker et al 2013; Bracarense et al 2012).
The change of crypt depth is shown when more enterocytes need to be generated to migrate
progressively along the side of its villus, particularly toward the tip, caused by mechanical, toxic or
xenobiotic damages i.e. the case of malabsorptive diarrheas. Thus, the crypts elongate compared to
healthy crypts, and this morphologic change is suggested to be site-specific of toxicant involved
(Haschek et al 2010). Each crypt produces 300-400 cells per day from a relatively few stem cells,
which in turn divide several more times in the lower and middle portion of the crypts. The rate of
cell proliferation in the crypts with the rate of mature cell loss at the villus tips is coordinated by
negative feedback mechanisms (Haschek et al 2010).
4.4. Effect of DON, NIV and DON+NIV on proliferation, apoptosis and the ratio
proliferation/apoptosis
The experimental loops and the experimental animal models provided concordance for the
total-cell proliferation decrease at the villus tips after exposure to 10 µM DON or DON+NIV (1:1)
acutely after 24h or repeatedly after 28 days. These results are in accordance with the
downregulation of total mRNA of proliferative marker Ki-67 in jejunum of piglet fed purified 0.9
mg DON/kg diet (Alizadeh et al 2015). This confirms that proliferation is a sensitive endpoint for
the responses to DON or DON+NIV. Proliferative enterocytes were affected by DON+NIV in
animal experiment. At villus tips, proliferative enterocytes decreased after 28 days. These results
are in agreement with those of Bracarense et al (2012). However, proliferative enterocytes were
found increased in loops treated at 10 µM. In loops model, the decrease of villus total-cell
98
proliferation after 24-h exposed to 10-µM DON and 10-µM NIV is concordant with our recently
findings with the same concentration but 4-h exposure (Cheat et al 2015). In this previous study
after exposure to DON and NIV, enterocyte proliferation was not affected, showing that lamina
propria cells were more affected by these individual mycotoxins. When these two mycotoxins are
mixed (DON+NIV), both villus total-cell proliferation and villus enterocyte proliferation were
affected. The 24-h response of enterocytes to the toxins might be dependent on the cell renewal
cycle because these epithelial cells of the small intestine are replaced every 2-4 days in adult and
takes longer in neonate (Haschek et al 2010).
In loops, the results showed bell-shaped dose-response curves for proliferation and apoptosis of
total cells at villus tips and for the ratio proliferation to apoptosis for individual or combined DON
and NIV. These non-linear of dose-response curves have been described previously for several
endpoints, for example cell proliferation in human lung fibroblasts and apoptosis in mouse
lymphocytes (Calabrese and Baldwin 2001). These biological responses could be related to the
well-known immunomodulation described with DON and the mechanism of protein inhibition of
NIV (Severino et al 2006). DON is low-dose stimulation and high-dose inhibition of immune
response corresponding to lymphocytes proliferation. DON is known as ribotoxic stress response,
where DON binds to ribosomes and inhibits protein synthesis. NIV inhibits peptidyl transferase
with subsequent inhibition of peptide bond formation by acting on the initial step of protein
synthesis and elongation-termination step. Therefore, trichothecenes, particularly DON and NIV are
toxic to tissues with a high cell proliferation rate (Rocha et al 2005). This suggests a direct
stimulatory response of immune cells and a response that occurred only as overcompensation to
initial injury. These responses are concordant with the previously described induction of mitogen
activated protein kinases (MAPKs) or increased reactive oxygen species (ROS) production in T-
cells and B-cells (Krishnaswamy et al 2010; Pestka 2007)
The high impact on apoptotic enterocytes with 10-µM DON and 10-µM DON+NIV in loops
might be due to the impaired antioxidant status of cell and increased production of ROS,
particularly induced by DON. It has been observed previously in in vitro studies with intestinal
epithelial cells (Pestka 2007). The effect of DON and NIV on proliferation and apoptosis in the
intestine, also described in other species (Payros, personal communication), are confirmed in our in
vivo study with DON and NIV. So, human intestine should be similarly affected. The apoptotic
enterocytes observed in loops showed similarities with several other human intestinal diseases for
example microvillus inclusion disease and coeliac disease (Groisman et al 2000; Moss et al 1996).
4.5. Effect of DON on gene expression in vivo
99
In the present study in loops, we did not observe any differences after 24 h in cytokine genes
expression for IL-1α, IL-1β, IL-6, IL-8, IL-21, IL12-p40, TGF-β (data not shown). Our negative
results on cytokines from acute 24-h exposure might be due to the time needed for the response
observed after repeated exposure: for example IL-1β expression was increased in duodenum of
piglets fed a DON diet (0.9 mg/kg feed) for 10 days, IL-1β and IL-6 expression were up-regulated
in jejunum of piglets fed a DON diet (3 mg/kg feed) for 35 weeks, or IL-8 expression were up-
regulated in ileum of piglets fed a DON diet (3.5 mg/kg feed) for 42 days (Alizadeh et al 2015;
Lessard et al 2015; Bracarense et al 2012).
However the present result, tight junction protein expression for claudin-4, one important
component of tight junction protein, was not altered (data not shown). DON exposure, through the
activation mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase/AKT (protein
kinase B) signaling pathways, is capable to modulate inflammatory response and to influence the
expression of tight junction proteins (Mishra et al 2014; Pinton et al 2009). In the similar exposed
time (24h) in vitro, claudin-4 was up-regulated in Caco-2 cells exposed to increasing concentrations
(1.39, 4.17, and 12.5 µM) of DON (Akbari et al 2014), whereas DON inhibits the expression of
claudin-4 in IPEC-1 (Pinton et al 2009). The first hypothesis for addressing this difference between
the in vitro and our in vivo loop result is the fact that the samples taken in the in vivo loop contained
the entire intestinal wall, not only the epithelial cell layer. Another hypothesis could be the contact
time of DON in loops too limited compared to in vitro studies.
4.6. Interaction analysis
In vitro, exposure of intestinal and non-intestinal cells to the trichothecenes alone or in
combination decreased proliferation (Alassane-Kpembi, et al 2013; Wan et al 2013; Pinton et al
2012; Petska 2010, Thuvander et al 1999). Concordantly, a decrease was observed in enterocyte
proliferation to enterocyte apoptosis ratio in loops after 10-µM DON+NIV. Alassane-Kpembi, et al
(2013) found that NIV and DON+NIV were more toxic than DON alone in Caco-2 cells. The
present study shows a similar type of interaction between DON and NIV on a different target. The
interaction analysis confirmed synergism between the two mycotoxins for villus enterocyte
apoptosis. Our results are of high relevance, because they were obtained in models (animals or
loops) more complex than the cell lines. A recent study on the pig intestinal cell line IEC-6
suggested also a more than additive interaction between DON and NIV based on their pro-oxidant
effect (Del Regno et al 2015).
Conclusion
100
The current study showed that proliferative enterocyte and total-cell proliferation at the
villus tips were sensitive to DON and DON+NIV in both models. The loops allowed testing the
interaction between the two mycotoxins, DON and NIV. Taking together from the previous study
(Cheat et al. 2015), our data indicate that intestinal loops model, in the context of 3Rs, represents a
relevant and sensitive model to investigate the digestive effects of food contaminants. Limitations to
unique exposure and to non-natural occurring mycotoxin treatments are its main disadvantages.
Acknowledgement
This study was supported by the ANR DON & Co project. S Cheat was supported by
doctoral fellowships from TECHNO I Scholar Program, Erasmus Mundus. The authors are grateful
to the CIRE team for the animals care and handling, to the E5-team for helping in animal
experiment sampling, to C Bleuart and I Pardo for technical assistance for immunohistochemistry,
and to F Lyazhri for statistical advice. The loops surgery was conducted at INRA Centre de
recherche Val de Loire (Plate-forme CIRE Chirurgie et Imagerie pour la Recherche et
l’Enseignement, UMR Physiologie de la Reproduction et des Comportements (INRA 0085, CNRS
7247, université François-Rabelais de Tours, Institut français du cheval et de l’équitation), 37380
Nouzilly, France).
References
Abot A, Fontaine C, Raymond-Letron I, Flouriot G, Adlanmerini M, Buscato M, Otto C, Bergès H, Laurell
H, Gourdy P, Lenfant F, Arnal JF, 2013. The AF-1 activation function of estrogen receptor α is
necessary and sufficient for uterine epithelial cell proliferation in vivo. Endocrinology 154, 2222–2233.
doi:10.1210/en.2012-2059
Akbari P, Braber S, Gremmels H, Koelink PJ, Verheijden KAT, Garssen J, Fink-Gremmels J, 2014.
Deoxynivalenol: a trigger for intestinal integrity breakdown. FASEB J. doi:10.1096/fj.13-238717
Alassane-Kpembi I, Kolf-Clauw M, Gauthier T, Abrami R, Abiola FA, Oswald IP, Puel O, 2013. New
insights into mycotoxin mixtures: the toxicity of low doses of Type B trichothecenes on intestinal
epithelial cells is synergistic. Toxicol. Appl. Pharmacol. 272, 191–8. doi:10.1016/j.taap.2013.05.023
Alizadeh A, Braber S, Akbari P, Garssen J, Fink-Gremmels J, 2015. Deoxynivalenol Impairs Weight Gain
and Affects Markers of Gut Health after Low-Dose, Short-Term Exposure of Growing Pigs. Toxins
(Basel). 7, 2071–2095. doi:10.3390/toxins7062071
Bate ST, Clark RA, 2014. The Design and Statistical Analysis of Animal Experiment. Cambridge University
Press, UK.
101
Bianco G, Fontanella, B, Severino L, Quaroni A, Autore G, Marzocco S, 2012. Nivalenol and
Deoxynivalenol Affect Rat Intestinal Epithelial Cells: A Concentration Related Study. PLoS One 7.
doi:10.1371/journal.pone.0052051
Bolton AJ, Osborne MP, Wallis TS, Stephen J, 1999. Interaction of Salmonella choleraesuis, Salmonella
dublin and Salmonella typhimurium with porcine and bovine terminal ileum in vivo. Microbiology 145,
2431–2441.
Bottalico A, Perrone G, 2002. Toxigenic Fusarium species and mycotoxins associated with head blight in
small-grain cereals in Europe. Eur. J. Plant Pathol. 108, 611–624. doi:10.1023/A:1020635214971
Bouhet S, Oswald IP, 2005. The effects of mycotoxins, fungal food contaminants, on the intestinal epithelial
cell-derived innate immune response. Vet. Immunol. Immunopathol. 108, 199–209.
doi:10.1016/j.vetimm.2005.08.010
Boyen F, Pasmans, F, Van Immerseel F, Donné E, Morgan E, Ducatelle R, Haesebrouck F, 2009. Porcine in
vitro and in vivo models to assess the virulence of Salmonella enterica serovar Typhimurium for pigs.
Lab. Anim. 43, 46–52. doi:10.1258/la.2007.007084
Bracarense A-PFL, Lucioli J, Grenier B, Drociunas Pacheco G, Moll W-D, Schatzmayr G, Oswald IP, 2012.
Chronic ingestion of deoxynivalenol and fumonisin, alone or in interaction, induces morphological and
immunological changes in the intestine of piglets. Br. J. Nutr. 107, 1776–86.
doi:10.1017/S0007114511004946
Calabrese EJ, Baldwin LA, 2001. Hormesis: U-shaped dose-response and their centrality in toxicology.
Trends Pharmacol Sci 22, 286–291.
Cheat S, Gerez J, Cognié J, Alassane-Kpembi I, Bracarense A, Raymond-Letron I, Oswald I, Kolf-Clauw M,
2015. Nivalenol Has a Greater Impact than Deoxynivalenol on Pig Jejunum Mucosa in Vitro on
Explants and in Vivo on Intestinal Loops. Toxins (Basel). 7, 1945–1961. doi:10.3390/toxins7061945
Chou TC, Talalay P, 1984. Quantitative analysis of dose-effect relationships: the combined effects of
multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22, 27–55. doi:10.1016/0065-2571(84)90007-
4
Creppy EE, 2002. Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicol. Lett. 127,
19–28.
Dänicke S, Brosig B, Klunker LR, Kahlert S, Kluess J, Döll S, Valenta H, Rothkötter HJ, 2012. Systemic
and local effects of the Fusarium toxin deoxynivalenol (DON) are not alleviated by dietary
supplementation of humic substances (HS). Food Chem. Toxicol. 50, 979–988.
doi:10.1016/j.fct.2011.12.024
Del Regno M, Adesso S, Popolo A, Quaroni A, Autore G, Severino L, Marzocco S, 2015. Nivalenol induces
oxidative stress and increases deoxynivalenol pro-oxidant effect in intestinal epithelial cells. Toxicol.
Appl. Pharmacol. doi:10.1016/j.taap.2015.04.002
EC (European Commission), 2000. Opinion of the Scientific Committee on Food on Fusarium Toxins Part
41: NIVALENOL. Heal. Consum. Prot. Dir. 1–10.
102
EFSA (European food Safety Authority), 2013. Scientific Opinion on risks for animal and public health
related to the presence of nivalenol in food and feed. EFSA J. 11, 1–119. doi:10.2903/j.efsa.2013.3262
Festing MFW, Overend P, Das RG, Borja MC, Berdoy M, 2002. The Design of Animal Experiments:
Reducing the use of animals in research through better experimental design. Royal Society of
Medicine Press Limited, London.
Gaigé S, Bonnet MS, Tardivel C, Pinton P, Trouslard J, Jean A, Guzylack L, Troadec JD, Dallaporta M,
2013. C-Fos immunoreactivity in the pig brain following deoxynivalenol intoxication: Focus on
NUCB2/nesfatin-1 expressing neurons. Neurotoxicology 34, 135–149. doi:10.1016/j.neuro.2012.10.020
Gelberg HB, 2012. Pathology of organ systems: Alimentary system and the peritoneum, omentum,
mesentery, and peritoneal cavity. In Pathologic Basis of Veterinary Diseases, Zachary, J., McGavin, M.
(eds). Penny Rudolph, Missouri, USA, pp. 355–400.
Gerdts V, Uwiera RRE, Mutwiri GK, Wilson DJ, Bowersock T, Kidane A, Babiuk LA, Griebel, PJ, 2001.
Multiple intestinal “loops” provide an in vivo model to analyse multiple mucosal immune responses. J.
Immunol. Methods 256, 19–33. doi:10.1016/S0022-1759(01)00429-X
Gerez JR, Pinton P, Callu P, Grosjean F, Oswald IP, Bracarense APFL, 2015. Deoxynivalenol alone or in
combination with nivalenol and zearalenone induce systemic histological changes in pigs. Exp. Toxicol.
Pathol. 67, 89–98. doi:10.1016/j.etp.2014.10.001
Ghareeb K, Awad WA, Böhm J, Zebeli Q, 2015. Impacts of the feed contaminant deoxynivalenol on the
intestine of monogastric animals: poultry and swine. J. Appl. Toxicol. 35, 327–337.
doi:10.1002/jat.3083
Girard-Misguich F, Cognie J, Delgado-Ortega M, Berthon P, Rossignol C, Larcher T, Melo S, Bruel T,
Guibon R, Chérel Y, Sarradin P, Salmon H, Guillén N, Meurens F, 2011. Towards the establishment of
a porcine model to study human amebiasis. PLoS One 6. doi:10.1371/journal.pone.0028795
Groisman GM, Sabo E, Meir A, Polak-Charcon S, 2000. Enterocyte apoptosis and proliferation are increased
in microvillous inclusion disease (familial microvillous atrophy). Hum. Pathol. 31, 1404–1410.
doi:10.1053/hupa.2000.19831
Haschek WM, Rousseaux CG, Wallig MA, 2010. Fundamenatls of Toxicologic Pathology, 2nd ed.
Academic Press-Elsevier, London.
Hedman R, Pettersson H, Lindberg JE, 1997a. Absorption and metabolism of nivalenol in pigs. Arch. für
Tierernaehrung 50, 13–24. doi:10.1080/17450399709386115
Hedman R, Thuvander A, Gadhasson I, Reverter M, Pettersson H, 1997b. Influence of dietary nivalenol
exposure on gross pathology and selected immunological parameters in young pigs. Nat. Toxins 5,
238–246. doi:10.1002/(SICI)1522-7189(1997)5:6<238::AID-NT4>3.0.CO;2-M
Kararli TT, 1995. Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans and
commonly used laboratory animals. Biopharm. Drug Dispos. doi:10.1002/bdd.2510160502
Klunker LR, Kahlert S, Panther P, Diesing AK, Reinhardt N, Brosig B, Kersten S, Dänicke S, Rothkötter HJ,
Kluess JW, 2013. Deoxynivalenol and E.coli lipopolysaccharide alter epithelial proliferation and spatial
103
distribution of apical junction proteins along the small intestinal axis. J. Anim. Sci. 91, 276–285.
doi:10.2527/jas.2012-5453
Kolf-Clauw M, Castellote J, Joly B, Bourges-Abella N, Raymond-Letron I, Pinton P, Oswald IP, 2009.
Development of a pig jejunal explant culture for studying the gastrointestinal toxicity of the mycotoxin
deoxynivalenol: histopathological analysis. Toxicol. In Vitro 23, 1580–4. doi:10.1016/j.tiv.2009.07.015
Kolf-Clauw M, Sassahara M, Lucioli J, Rubira-Gerez J, Alassane-Kpembi I, Lyazhri F, Borin C, Oswald IP,
2013. The emerging mycotoxin, enniatin B1, down-modulates the gastrointestinal toxicity of T-2 toxin
in vitro on intestinal epithelial cells and ex vivo on intestinal explants. Arch. Toxicol. 87, 2233–2241.
doi:10.1007/s00204-013-1067-8
Krishnaswamy R, Devaraj SN, Padma VV, 2010. Lutein protects HT-29 cells against Deoxynivalenol-
induced oxidative stress and apoptosis: Prevention of NF-κB nuclear localization and down regulation
of NF-κB and Cyclo-Oxygenase - 2 expression. Free Radic. Biol. Med. 49, 50–60.
doi:10.1016/j.freeradbiomed.2010.03.016
Laprie C, Abadie J, Amardeilh MF, Raymond I, Delverdier M, 1998. Detection of the Ki-67 proliferation
associated nuclear epitope in normal canine tissues using the monoclonal antibody MIB-1. Anat. Histol.
Embryol. 27, 251–256.
Lessard M, Savard C, Deschene K, Lauzon K, Pinilla VA, Gagnon CA, Lapointe J, Guay F, Chorfi Y, 2015.
Impact of deoxynivalenol (DON) contaminated feed on intestinal integrity and immune response in
swine. Food Chem. Toxicol. 80, 7–16. doi:10.1016/j.fct.2015.02.013
Logrieco A, Mulè G, Moretti A, Bottalico A, 2002. Toxigenic Fusarium species and mycotoxins associated
with maize ear rot in Europe, in: European Journal of Plant Pathology. pp. 597–609.
doi:10.1023/A:1020679029993
Marzocco S, Russo R, Bianco G, Autore G, Severino L, 2009. Pro-apoptotic effects of nivalenol and
deoxynivalenol trichothecenes in J774A.1 murine macrophages. Toxicol. Lett. 189, 21–26.
doi:10.1016/j.toxlet.2009.04.024
Meurens F, Berri M, Auray G, Melo S, Levast B, Virlogeux-Payant I, Chevaleyre C, Gerdts V, Salmon H,
2009. Early immune response following Salmonella enterica subspecies enterica serovar Typhimurium
infection in porcine jejunal gut loops. Vet. Res. 40, 41–44. doi:10.1051/vetres:2008043
Mishra S, Dwivedi PD, Pandey HP, Das M, 2014. Role of oxidative stress in Deoxynivalenol induced
toxicity. Food Chem. Toxicol. 72, 20–29. doi:10.1016/j.fct.2014.06.027
Moolenbeek C, Ruitenberg EJ, 1981. The “Swiss roll”: a simple technique for histological studies of the
rodent intestine. Lab. Anim. 15, 57–59. doi:10.1258/002367781780958577
Moss SF, Attia L, Scholes JV, Walters JR, Holt PR, 1996. Increased small intestinal apoptosis in coeliac
disease. Gut 39, 811–817. doi:10.1136/gut.39.6.811
Pernthaner A, Cabaj W, Shaw RJ, Rabel B, Shirer CL, Stankiewicz M, Douch PGC, 1996. The immune
response of sheep surgically modified with intestinal loops to challenge with Trichostrongylus
colubriformis. Int. J. Parasitol. 26, 415–422. doi:10.1016/0020-7519(96)00004-5
104
Pestka JJ, 2010. Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Arch.
Toxicol. 84, 663–79. doi:10.1007/s00204-010-0579-8
Pestka JJ, 2007. Deoxynivalenol: Toxicity, mechanisms and animal health risks. Anim. Feed Sci. Technol.
137, 283–298. doi:10.1016/j.anifeedsci.2007.06.006
Pestka JJ, Smolinski AT, 2005. Deoxynivalenol: toxicology and potential effects on humans. J. Toxicol.
Environ. Health. B. Crit. Rev. 8, 39–69. doi:10.1080/10937400590889458
Pinton P, Oswald IP, 2014. Effect of deoxynivalenol and other type B trichothecenes on the intestine: A
review. Toxins (Basel). 6, 1615–1643. doi:10.3390/toxins6051615
Pinton P, Tsybulskyy D, Lucioli J, Laffitte J, Callu P, Lyazhri F, Grosjean F, Bracarense AP, Kolf-clauw M,
Oswald IP, 2012. Toxicity of deoxynivalenol and its acetylated derivatives on the intestine: Differential
effects on morphology, barrier function, tight junction proteins, and mitogen-activated protein kinases.
Toxicol. Sci. 130, 180–190. doi:10.1093/toxsci/kfs239
Pinton P, Nougayrède J-P, Del Rio J-C, Moreno C, Marin DE, Ferrier L, Bracarense A-P, Kolf-Clauw M,
Oswald IP, 2009. The food contaminant deoxynivalenol, decreases intestinal barrier permeability and
reduces claudin expression. Toxicol. Appl. Pharmacol. 237, 41–8. doi:10.1016/j.taap.2009.03.003
Rocha O, Ansari K, Doohan FM, 2005. Effects of trichothecene mycotoxins on eukaryotic cells: a review.
Food Addit. Contam. 22, 369–378. doi:10.1080/02652030500058403
Rotter BA, Prelusky DB, Pestka JJ, 1996. Toxicology of deoxynivalenol (vomitoxin). J. Toxicol. Environ.
Health 48, 1–34. doi:10.1080/009841096161447
Russel WMS, Burch R, 1959. The Principles of Human Experimental Technique. Methuen, London, UK.
Schatzmayr G, Streit E, 2013. Global occurrence of mycotoxins in the food and feed chain: facts and figures.
World Mycotoxin J. 6, 213–222. doi:10.3920/WMJ2013.1572
Schothorst RC, Van Egmond HP, 2004. Report from SCOOP task 3.2.10 “collection of occurrence data of
Fusarium toxins in food and assessment of dietary intake by the population of EU member states”
Subtask: Trichothecenes. Toxicol. Lett. 153, 133–143. doi:10.1016/j.toxlet.2004.04.045
SCOOP European Union, 2003. Reports on tasks for scientific cooperation. Collection of occurrence data of
Fusarium toxins in food and assessment of dietary intake by the population of EU Member States.
Sergent T, Parys M, Garsou S, Pussemier L, Schneider YJ, Larondelle Y, 2006. Deoxynivalenol transport
across human intestinal Caco-2 cells and its effects on cellular metabolism at realistic intestinal
concentrations. Toxicol. Lett. 164, 167–176. doi:10.1016/j.toxlet.2005.12.006
Severino L, Luongo D, Bergamo P, Lucisano A, Rossi M, 2006. Mycotoxins nivalenol and deoxynivalenol
differentially modulate cytokine mRNA expression in Jurkat T cells. Cytokine. 36, (1-2):75–82.
Streit E, Naehrer K, Rodrigues I, Schatzmayr G, 2013. Mycotoxin occurrence in feed and feed raw materials
worldwide: Long-term analysis with special focus on Europe and Asia. J. Sci. Food Agric. 93, 2892–
2899. doi:10.1002/jsfa.6225
Thuvander A, Wikman C, Gadhasson I, 1999. In Vitro Exposure of Human Lymphocytes to Trichothecenes:
Individual Variation in Sensitivity and Effects of Combined Exposure on Lymphocyte Function. Food
Chem. Toxicol. 37, 639–648.
105
Vandenbroucke V, Croubels S, Martel A, Verbrugghe E, Goossens J, Van Deun K, Boyen F, Thompson A,
Shearer N, De Backer P, Haesebrouck F, Pasmans F, 2011. The mycotoxin deoxynivalenol potentiates
intestinal inflammation by Salmonella typhimurium in porcine ileal loops. PLoS One 6, e23871.
doi:10.1371/journal.pone.0023871
Wan LYM, Turner PC, El-Nezami H, 2013. Individual and combined cytotoxic effects of Fusarium toxins
(deoxynivalenol, nivalenol, zearalenone and fumonisins B1) on swine jejunal epithelial cells. Food
Chem. Toxicol. 57, 276–283. doi:10.1016/j.fct.2013.03.034
Yazar S, Omurtag GZ, 2008. Fumonisins, trichothecenes and zearalenone in cereals. Int. J. Mol. Sci. 9,
2062–2090. doi:10.3390/ijms9112062
106
Table and figure legends
Table 1. Comparison of control loops and non-loops segments for surgical effect after 24h post-surgery on
morphometry, proliferation-cell and apoptosis-cell counts of the jejunum.
Figure 1. Proliferation and apoptosis in the jejunum loops after exposed to DON (I), NIV (II) and
DON+NIV (1:1) (III) at 1, 3 and 10 µM for 24h. Mean values ± SD expressed as % of the control group
(Ctrl). (A-I, A-II, A-III) Total-cell proliferation at villus tip (upper one-third); (B-I, B-II, B-III) Villus
enterocyte proliferation; (C-I, C-II, C-III) Villus enterocytes apoptosis; (D-I, D-II, D-III) Total-cell
proliferation to total-cell apoptosis ratio at villus tip; (E-I, E-II, E-III) Villus total-cell apoptosis; and (F-I, F-
II, F-III) Villus enterocyte proliferation to apoptosis ratio. Letter a, b and c are different at P≤0.05; Behrens
Fisher tests and Asymptotic Mann-Whitney tests; n = 2 or 4 (Ctrl) loops, 20 villi or crypts/loop.
Figure 2. Combined effect of the mixture of DON and NIV (1:1) in loops at 10 µM showed higher effects on
proliferation and apoptosis than DON alone. Mean values ± SD expressed as % of the control group (Ctrl).
(A) Enterocyte proliferation at villus tip (upper one-third), P<0.001; (B) Enterocytes proliferation at crypt
base (lower two-third), P=0.001; and (C) Villus enterocyte apoptosis, P<0.001. Letter a, b and c are different
at P≤0.05; Tukey’s test or Behrens Fisher tests and Asymptotic Mann-Whitney tests; n = 2 or 4 (Ctrl) loops,
20 villi or crypts/loop.
Figure 3. Isobolograms illustrating the combined effect of the mixture of DON and NIV (1:1) for reaching
10% (Fa = 0.1, circle), 20 % (Fa = 0.2, square), or 30 % increase (Fa = 0.3, triangle) of villus enterocyte
apoptosis in jejunal loops model. The points on each axis are mean concentrations of dose– response curves
of each toxin alone (CompuSyn® software analysis).
Figure 4. Jejunal morphology, proliferation and apoptosis in in vivo animal after exposed to DON natural
single- at 2.89 mg.kg-1 feed and co-contamination to DON+NIV at 3.50 mg.kg-1 feed. Mean values ± SD
expressed as % of the control group (Ctrl). (A) Crypt depth, P=0.007; (B) Enterocyte proliferation at villus
tip (upper one-third), P<0.001 and (C) Total cell proliferation at villus tip, P=0.009.
107
Table 1.
Comparison of control loops (Ctrl) and non-loops segments (nL) for surgical effect after 24h
post-surgery on morphometry, proliferation-cell and apoptosis-cell counts of the jejunum
Parameters nL Ctrl P-value
Morphometry
Villus height (µm) 378.1 ±63.8 339.6 ±64.5 0.014**
Crypt depth (µm) 336.2 ±40.9 364.6 ±50.7 0.007**
Crypt-depth to villus-height ratio 0.90 ±0.20 1.11 ±0.28 <0.001***
Proliferation
Villus total cell 33.08 ±6.17 35.23 ±4.86 0.127w
Crypt index (x100) 66.6 ±9.8 64.8 ±10.4 0.453 w
Apoptosis
Villus total cell 3.55 ±0.90 3.54 ±0.97 0.976
Ratio
Total-cell proliferation to total-cell apoptosis 9.84 ±4.67 10.70 ±7.93 0.216
- Data presented as mean ± standard deviation (SD);Paired t-test
- w = Wilcoxon matched pairs test
- ** : Significant level P≤0.01; *** : Significant level P≤0.001
- Morphometry: n= 2 or 4 (Ctrl) loops, 30 villi or crypt /loop; Values are mean numbers per
villus or per crypt
- Proliferation and apoptosis: n= 2 or 4 (Ctrl) loops, 20 villi or crypt/loop; Values are mean
numbers per1/3 villus tip or per 2/3 crypt base
108
Figure 1. Proliferation and apoptosis in the jejunal loops after exposed to DON (I), NIV (II) and
DON+NIV (1:1) (III) at 1, 3 and 10 µM for 24h. Mean values ± SD expressed as % of the control
group (Ctrl). (A-I, A-II, A-III) Total-cell proliferation at villus tip (upper one-third); (B-I, B-II, B-III)
Villus enterocyte proliferation; (C-I, C-II, C-III) Villus enterocytes apoptosis; (D-I, D-II, D-III) Total-
cell proliferation to total-cell apoptosis ratio at villus tip; (E-I, E-II, E-III) Villus total-cell apoptosis;
and (F-I, F-II, F-III) Villus enterocyte proliferation to apoptosis ratio. Letter a, b and c are different at
P≤0.05; Behrens Fisher tests and Asymptotic Mann-Whitney tests; n = 2 or 4 (Ctrl) loops, 20 villi or
crypts/loop.
0
50
100
150
200
250
% c
ompa
red
to C
trl
(A-I) Villus total cell proliferation after 24h
a
b b
c
P<0,001
0
50
100
150
200
250
% c
ompa
red
to C
trl
(A-II) Villus total cell proliferation after 24h
aa
a
b
P<0,001
0
50
100
150
200
250
% c
ompa
red
to C
trl
(A-III) Villus total cell proliferation after 24h
a
ba
c
P<0,001
0
50
100
150
200
250
% c
ompa
red
to C
trl
(B-I) Villus enterocyte proliferation after 24
P=0,023
a ab ba
0
50
100
150
200
250
% c
ompa
red
to C
trl
(B-II) Villus enterocyte proliferation after 24
P=0,751
0
50
100
150
200
250
% c
ompa
red
to C
trl
(B-III) Villus enterocyte proliferation after 24
P<0,001
aab b
c
0
50
100
150
200
250
% c
ompa
red
to C
trl
(C-I) Villus enterocyte apoptosis after 24hP=0,021
a a ab b
0
50
100
150
200
250
% c
ompa
red
to C
trl
(C-II) Villus enterocyte apoptosis after 24h
P<0,001
a ab
cbc
0
50
100
150
200
250
% c
ompa
red
to C
trl
(C-III) Villus enterocyte apoptosis after 24h
P<0,001
a
bc b
c
0
50
100
150
200
250
300
350
400
% c
ompa
red
to C
trl
(D-I) Villus total cell proliferation to total cell apoptosis ratio after 24h
a
b
b
c
P<0,001
0
50
100
150
200
250
300
350
400
% c
ompa
red
to C
trl
(D-II) Villus total cell proliferation to total cell apoptosis ratio after 24h
a
b
ab
c
P<0,001
0
50
100
150
200
250
300
350
400
% c
ompa
red
to C
trl
(D-III) Villus total cell proliferation to total cell apoptosis ratio after 24h
a
b
b
c
P<0,001
0
50
100
150
200
250
Ctrl DON1 DON3 DON10
% c
ompa
red
to C
trl
(E-I) Villus enterocyte proliferation to apoptosis ratio after 24h
P=0,107
0
50
100
150
200
250
Ctrl NIV1 NIV3 NIV10
% c
ompa
red
to C
trl
(E-II) Villus enterocyte proliferation to apoptosis ratio after 24h
P=0,002a
ab
c bc
0
50
100
150
200
250
Ctrl DON1+NIV1 DON3+NIV3 DON10+NIV10
% c
ompa
red
to C
trl
(E-III) Villus enterocyte proliferation to apoptosis ratio after 24h
P=0,001a
b bb
109
Figure 2. Combined effect of DON and NIV (1:1)
in loops at 10 µM showed higher effects on
proliferation and apoptosis than DON alone. Mean
values ± SD expressed as % of the control group
(Ctrl). (A) Enterocyte proliferation at villus tip
(upper one-third), P<0.001; (B) Enterocytes
proliferation at crypt base (lower two-third),
P=0.001; and (C) Villus enterocyte apoptosis,
P<0.001. Letter a, b and c are different at P≤0.05;
Tukey’s test or Behrens Fisher tests and
Asymptotic Mann-Whitney tests; n = 2 or 4 (Ctrl)
loops, 20 villi or crypts/loop.
0
50
100
150
200
250
% c
ompa
red
to C
trl
(A) Villus enterocyte proliferation after 24h
P<0,001
a
b
a
0
50
100
150
200
250
% c
ompa
red
to C
trl
(B) Crypt enterocyte proliferation after 24h
a ab
P=0,001
0
50
100
150
200
250
Ctrl DON DON+NIV
% c
ompa
red
to C
trl
(C) Villus enterocyte apoptosis after 24h
P<0,001
ab
c
110
Figure 3. Isobolograms illustrating the combined effect of the
mixture of DON and NIV (1:1) for reaching 10% (Fa = 0.1,
circle), 20 % (Fa = 0.2, square), or 30 % increase (Fa = 0.3,
triangle) of villus enterocyte apoptosis in jejunal loops model.
The points on each axis are mean concentrations of dose-
response curves of each toxin alone (CompuSyn®)
2.5 NIV (µM)
DO
N (µ
M)
111
Figure 4. Jejunal architecture, proliferation and apoptosis in in vivo animal after exposed to DON
(2.89 mg.kg-1 feed) natural single- and co-contamination to DON+NIV (3.50 + 0.72 mg.kg-1 feed).
Mean values ± SD expressed as % of the control group (Ctrl). (A) Crypt depth, P=0.007; (B)
Enterocyte proliferation at villus tip (upper one-third), P<0.001; (C) Total cell proliferation at villus
tips, P=0.009.; and (D) Crypt-depth to villus-height ratio, P<0.001.
0
50
100
150
200
% c
ompa
red
to C
trl
(A) Crypt depth after 28 days
a ba
P=0,007
0
50
100
150
200
% c
ompa
red
to C
trl
(C) Villus total cell proliferation after 28 days
bb
a
P=0,009
0
50
100
150
200
Ctrl DON DON+NIV
% c
ompa
red
to C
trl
(B) Villus enterocyte proliferation after 28 days
aa
b
P<0,001
0
50
100
150
200
Ctrl DON DON+NIV
% c
ompa
red
to C
trl
(D) Crypt-depth to villus-height ratio after 28 days
ab
b
P<0,001
112
3.3. General discussion
3.3.1. Benefits and limitations of the alternative models
Biological models can be used in toxicology studies such as in vitro, cell culture (Pinton et al.
2009); ex vivo, explants, (Kolf-Clauw et al. 2009) and in vivo, animal experiment (Claude 1957;
Hedman et al. 1997). Among those models, in vivo is costly, time consuming and limited by
individual variations. In this work, we use conventional animal experiment (in vivo), but also
alternative models either in vivo (loops) or ex vivo (explants). These models allow to reduce the
number of animals used in agreement with the 3Rs recommendation of Russel and Burch (1959).
However, the in vivo model provides a complete animal biological response to the treatments. Loop
is an in vivo model the created loops being in situ maintained inside the pigs. This model has been
used in bacterial infection studies on different animal species (Girard-Misguich et al. 2011;
Vandenbroucke et al. 2011; Gerdts et al. 2001; Bolton et al. 1999; Pernthaner et al. 1996). To the
best of our knowledge, to date, the use of this model is neglected in toxicologic studies. The
discussions below are related to the concordant results obtained from the three types of model.
3.3.2. In animal experiment
Feed intake and weight gain have been found to be depressed in several studies after repeated
exposure to DON (Xiao et al. 2013; Pinton et al. 2012; Danicke et al. 2012a; Danicke et al. 2012b).
However in the present study, DON and DON+NIV, natural contamination at 2.89 mg DON/kg
feed and 3.50 mg DON+0.72 mg NIV/kg feed did not impact weight gain nor feed intake, and of
the clinical biochemistries investigated such as blood total protein, gamma-glutamyl transferase
(GGT), albumin and fibrinogen did not change. The proportion of co-contamination used here in
animal experiment were similar to that of DON and NIV in the analyzed samples from food
collected in the European Union (Schothorst and van Egmond 2004). These toxins are of concern
for human and animal health (EFSA 2013). A similar result for the unchanged-weight gain was
reported in DON-exposed animals at 1.5 mg.kg-1 diet (Gerez et al. 2015). Our study showed a high
toleration of the pigs to the levels of mycotoxins used while various studies reported that pig could
be tolerate up to DON 0.9 mg.kg-1 feed without any adverse effects on feed intake and live weight
gain (EFSA 2007).
The current study shows that villus height was increased after DON exposure but not after
DON+NIV exposure in animal experiment. In general assumption, intestinal morphological
113
changes of small intestine, caused by injurious agents such as DON (Diesing et al. 2011),
xenobiotics (Haschek et al. 2010) are reduction of the villus height because of villus contraction,
which support the restoration of the barrier function through minimizing the surface area
(Blikslager et al. 2007). By contrast, the present result is not the case when villi were higher than
control animals after DON exposure. DON from 1.5-3 mg.kg-1 feed reduction of villus height has
been previously reported in animal experiments (Gerez et al. 2015, Lucioli et al. 2013, Bracarense
et al. 2012; Pinton et al. 2012). Our observation could also be incidental, as DON+NIV had no
effect on villus height in the current study which is not consistent with observations of Gerez et al.
(2015) using a tertiary combinations of DON+NIV+ZEA.
3.3.3. Proliferation
Trichothecenes have been reported to highly act on proliferative cells, and the intestinal epithelium
has been identified as a target for DON and other derivatives in vitro, ex vivo, and in vivo (Kolf-
Clauw et al. 2013; Gauthier et al. 2013; Bianco et al. 2012; Bracarense et al. 2011; Pinton et al.
2012). Although effects have been found for subchronical exposure, the current study, showed
significant impact, starting from a 3 µM concentration on proliferative enterocytes with combined
DON and NIV after 24h on loops.
At intestinal epithelium, enterocytes originate from the small intestinal crypts which surround the
base of each villus. Biologically, these enterocytes progressively move along the side of the villus
toward the tip, crypt-villus axis. As senescent enterocytes slough from the tip of villi, the absorptive
epithelium is replaced from below by dividing epithelium cells. Each crypt produces 300-400 cells
per day from a relatively few stem cells that produce committed daughter cells, which in turn divide
several more times in the lower and middle portion of the crypts and are replaced every 2-4 days in
adult, but replacement take longer in the neonate (Haschek et al. 2010; Booth and Potten 2000).
However, this basic biological phenomenon for tissue homeostasis was effectively induced only
when the combined DON and NIV were ingested repeatedly. The result of the impact of
mycotoxins on proliferative enterocytes is in correlation to a concept that intestinal epithelial cells
are important targets for the toxic effects of mycotoxins resulted only when they are exposed for
subchronical period (Bouhet et al. 2004). Damage of intestinal epithelium cell can be induced and
might have consequences for animal and human health exposed to xenobiotics or contaminated
feed/food (Pinton et al. 2009).
114
Watson (1995) suggested that more studies are required to describe the fate of cells at the villus tip.
Thus the current studies, at least in part, support this suggestion since the negative feedback
mechanisms coordinate the rate of cell proliferation in the crypts with the rate of mature cell loss at
the villus tip (Haschek et al. 2010), although it is not certain if the form of apoptosis is responsible
for epithelial cell sloughing from the villus tips (Watson 1995). The result of total-cell count,
assuming that most cells were lymphocytes, DON and DON+NIV inhibited proliferation at 10 µM
in 24-h loops. In a dose-dependent manner, limited variation was sensitive between individuals or
combined DON and NIV in 24-h loops and the inhibition was in accordance with Thuvander et al.
(1999).
3.3.4. Apoptosis
In the small intestinal mucosa, apoptosis has been extensively studied (Groisman et al. 2000).
However, to the best of our knowledge, it seems to be scarce using this biomarker in
mycotoxicologic study, particularly for DON and NIV. Apoptosis is defined that cells undergoing
apoptosis are morphologically characterized by condensation of nuclear chromatin into caps at the
edge of the nucleus and detachment from their neighbors (Watson 1995). In particular, caspase-
dependent apoptosis plays an executive role in the pathogenesis of a huge number of human
diseases i.e. autoimmune diseases, multiple types of cancer, (Favaloro et al. 2012), and diseases of
intestinal tract, for instance microvillous inclusion disease (Groisman et al. 2000; Watson 1995).
Therefore, quantifying this biomarker will improve our knowledge of the health risk caused by
mycotoxin.
In this study, apoptotic cells were counted at the villus tips compared to the crypts. Groisman et al.
(2000) found that apoptotic cells were located in the upper third of villi in the normal small
intestinal biopsies. Therefore, the upper one-third of villi where the current study assessed is
corroborative the findings of Groisman et al. (2000) and the descriptions of Haschek et al. (2010)
and cellular events of Watson (1995). At 24-h acute exposure in loops, individual 10 µM DON and
starting from 3 µM NIV significantly increased apoptotic enterocyte at the villi, while the
combination of this two mycotoxins affected even from 1 µM concentration. The lower doses, for
example in NIV or in the combined DON and NIV, seemed to produce modulations with biological
activity below the traditional toxicological threshold. Thus, it is assumed that follows a partern of
hormesis, a dose-response phenomenon characterized by low-dose stimulation and high-dose
inhibition (Calabrese 2002). It also well known that mycotoxins are immunomodulators for
gastrointestinal tract (Oswald et al. 2005). A strong impact of the combined mycotoxins in the
115
present study reflects the results from previous reports. Thuvander et al. (1999) found that
combinations of NIV with DON or T-2 toxin, DAS resulted in an additive effect. Caco-2 cells
showed a different interaction effect between DON and NIV at in vitro cell level (Alassane-Kpembi
et al. 2013). As results, the present combination of DON and NIV showed interaction effect on
enterocytes for apoptosis in 24-h loops, and proliferation from both 24-h loops and animal
experiment because the effects were greater when these two mycotoxins were combined.
The apoptotic enterocyte increase after 24-h exposed to 10 µM DON and DON+NIV, show
similarity in microvillus inclusion disease (MID) and coeliac disease. MID is a specific disorder
causing severe refractory diarrhea with diffuse villus atrophy without inflammatory changes in
neonates. Coeliac disease is characterized by flat mucosa despite epithelial hyperproliferation in
human (Groisman et al. 2000; Moss et al. 1996). The lesional changes such as villi atrophy,
flattening of the epithelial cells found in explant after DON or NIV exposure were similar to those
disease characteristics. In both cases, Groisman et al. (2000) and Moss et al. (1996) hypothesized
that increased apoptosis is a major factor in the increased cell loss in MID and coeliac disease even
if another forms of cell loss are exist. This is apparently shown in the present study. The absolute
numbers of proliferating cells in the current study surpassed those of apoptotic cells at the villi.
Thus, proliferative enterocyte to apoptotic enterocyte ratio at the villi was calculated, showing that
DON+NIV had lower ratio in comparison with control loops and similar in comparison with DON
treated loops. In loops model, many interleukin inflammatory genes which response to an
inflammation were quantified by qRT-PCR, expressed no difference in 10-µM DON after 4-h and
24-h exposure. These results, at least in part, could support the similar characteristics of DON and
MID affect intestinal health.
Either in 4-h loops or in 24-h loops a biological response for proliferation and apoptosis occurred
immediately after exposure to DON or NIV. It was clearly shown that enterocyte apoptosis was not
affected after 4-h exposure to DON or NIV. However, both proliferation and apoptosis of the total-
cell counts were affected, with NIV impacted greater than DON after 4-h exposure. So, our studies
show that lamina propria cells, mainly lymphocytes are more sensitive than enterocytes. The strong
impact of NIV is confirmed with Wan et al. (2013) that NIV had the potency greater than DON in
cell viability. Although, in the current study, these biological responses were not seen after 24-h
incubation, suggesting that compensating responses might loss at this time because significant
effects were found from individual, except for dose-dependent NIV and combined mycotoxins on
the same counts.
116
A balance between cell proliferation and cell apoptosis is thought to preserve the normal
architecture in the small intestine. It is reported that proliferative cells are found in the base of the
crypts, and apoptotic cells are seen most frequently toward the tips of the villi (Watson 1995; Hall
et al. 1994). In our study, one hand showed in 4-h loops that apoptotic enterocytes at the villi were
not different after DON or NIV exposures, although crypt index proliferation was increased by
NIV. On the other hand, 24-h loops showed that apoptotic enterocytes at the villi were significantly
increased in DON or DON+NIV treated loops, even though crypt proliferation index was not
affected at 10-µM exposure. These might be the insufficient time (after 4 h) shown for engulfment
of apoptotic bodies by adjacent cells that would permit reutilization of the cellular materials.
3.4. General conclusion
In explant, the mucosa changes were induced by NIV at lower concentrations than DON. The total-
cell count, mainly lymphoid cells, showed higher sensitivity than enterocytes to NIV-induced
apoptosis after 4-h exposure in loops model. In loops model, DON+NIV showed high impact on
proliferative enterocytes at both villus tip and crypt base after 24-h exposure. It also impacted
enterocyte apoptosis and total-cell count at villus tip. In animal experiment, DON and DON+NIV
decreased total-cell count proliferation at the villus tip while only DON+NIV affected enterocyte
proliferation and significantly elongated the crypt depth. DON or NIV exposure has characteristics,
at least in part, related to human diseases, microvillus inclusion disease and celiac disease leading to
impaired nutrient absorption.
NIV alone or in combination with DON induced enterocyte proliferation and enterocyte apoptosis
at the villi of pig small intestine following acute or repeated exposure. The interaction was shown
on enterocytes for apoptosis in 24-h loops, and for proliferation in both 24-h loops and animal
experiment. Thus, enterocytes were found to be a biomarker for the toxin effects for the two
models, loops and animal experiment. In addition, loops model allowed in situ testing possible for
dose-response and analyzing the interaction of the mycotoxins, despite the fact that it is not
convenient to model repeated exposures. Owing to the lack of sufficient toxicological data for most
of the masked mycotoxins and emerging mycotoxins, the loops model may contribute to risk
assessments of these toxins.
3.5. Perspectives
117
The blood tests for the mycotoxin concentrations will indicate the real internal exposure of the
animals, and these can verify the absorption, distribution, metabolism and excretion patterns in
toxicology. The immunomodulation impact from individual or combined of DON and NIV at lower
concentrations i.e. 1 µM or 3 µM, should be considered.
More efforts will be given to differentiate enterocytes and their migration rate along the villus axis.
Furthermore, to identify the cells that mainly involved in the mucosa level in response to immune
response i.e. neutrophils, eosinophils, monocytes, lymphocytes, etc. Then, proliferation and
apoptosis scenarios, particularly in lamina propria should be considered.
118
References
Abot, Anne, Coralie Fontaine, Isabelle Raymond-Letron, Gilles Flouriot, Marine Adlanmerini, Melissa
Buscato, Christiane Otto, et al. 2013. “The AF-1 Activation Function of Estrogen Receptor Α Is
Necessary and Sufficient for Uterine Epithelial Cell Proliferation in Vivo.” Endocrinology 154 (6):
2222–2233. doi:10.1210/en.2012-2059.
Acar, Jale, Vural Gökmen, and Esma Elden Taydas. 1998. “The Effects of Processing Technology on the
Patulin Content of Juice during Commercial Apple Juice Concentrate Production.” Zeitschrift Für
Lebensmitteluntersuchung …: 328–331. http://link.springer.com/article/10.1007/s002170050341.
Adams, William J, Ronny Blust, Uwe Borgmann, Kevin V Brix, David K DeForest, Andrew S Green,
Joseph S Meyer, et al. 2011. “Utility of Tissue Residues for Predicting Effects of Metals on Aquatic
Organisms.” Integrated Environmental Assessment and Management 7 (1) (January): 75–98.
doi:10.1002/ieam.
AFSSA. 2006. “Risk Assessment for Mycotoxins in Human and Animal Food Chains Summary Report.”
French Food Safety Agency (12).
Airfaf. 2015. “Rapport Mycotoxines Maïs Recolte 2014/2015.” Bulletin Regional Sud-Est (1): 11–13.
Akbari, Peyman, Saskia Braber, Hendrik Gremmels, Pim J Koelink, Kim A T Verheijden, Johan Garssen,
and Johanna Fink-Gremmels. 2014. “Deoxynivalenol: A Trigger for Intestinal Integrity Breakdown.”
FASEB Journal : Official Publication of the Federation of American Societies for Experimental
Biology (February 25). doi:10.1096/fj.13-238717.
Alassane-Kpembi, Imourana, Martine Kolf-Clauw, Thierry Gauthier, Roberta Abrami, François A Abiola,
Isabelle P Oswald, and Olivier Puel. 2013. “New Insights into Mycotoxin Mixtures: The Toxicity of
Low Doses of Type B Trichothecenes on Intestinal Epithelial Cells Is Synergistic.” Toxicology and
Applied Pharmacology 272 (1) (October 1): 191–8. doi:10.1016/j.taap.2013.05.023.
Alborzi, Solmaz, Bahman Pourabbas, Mahmood Rashidi, and Behrooz Astaneh. 2006. “Aflatoxin M1
Contamination in Pasteurized Milk in Shiraz (south of Iran).” Food Control 17 (7) (July): 582–584.
doi:10.1016/j.foodcont.2005.03.009.
Alexopoulos, C. 2001. “Association of Mycotoxicosis with Failure in Applying an Induction of Parturition
Program with PGF2alpha and Oxytocin in Sows.” Theriogenology 55 (8) (May): 1745–1757.
doi:10.1016/S0093-691X(01)00517-9.
Alizadeh, Arash, Saskia Braber, Peyman Akbari, Johan Garssen, and Johanna Fink-Gremmels. 2015.
“Deoxynivalenol Impairs Weight Gain and Affects Markers of Gut Health after Low-Dose, Short-Term
Exposure of Growing Pigs.” Toxins 7 (6): 2071–2095. doi:10.3390/toxins7062071.
Anderson, James A. 2007. “Marker-Assisted Selection for Fusarium Head Blight Resistance in Wheat.”
International Journal of Food Microbiology 119 (1-2) (October 20): 51–3.
doi:10.1016/j.ijfoodmicro.2007.07.025.
Annison, E F, and W L Bryden. 1998. “Perspectives on Ruminant Nutrition and Metabolism I. Metabolism
in the Rumen.” Nutrition Research Reviews 11 (2) (December): 173–98. doi:10.1079/NRR19980014.
119
Antonissen, Gunther, An Martel, Frank Pasmans, Richard Ducatelle, Elin Verbrugghe, Virginie
Vandenbroucke, Shaoji Li, Freddy Haesebrouck, Filip Van Immerseel, and Siska Croubels. 2014. “The
Impact of Fusarium Mycotoxins on Human and Animal Host Susceptibility to Infectious Diseases.”
Toxins 6 (2) (February): 430–52. doi:10.3390/toxins6020430.
Arce, C., M. Ramírez-Boo, C. Lucena, and J. J. Garrido. 2010. “Innate Immune Activation of Swine
Intestinal Epithelial Cell Lines (IPEC-J2 and IPI-2I) in Response to LPS from Salmonella
Typhimurium.” Comparative Immunology, Microbiology and Infectious Diseases 33 (2): 161–174.
doi:10.1016/j.cimid.2008.08.003.
Arends, M J, and A H Wyllie. 1991. “Apoptosis: Mechanisms and Roles in Pathology.” International Review
of Experimental Pathology 32: 223–254.
Aucock, H W, W F Marasas, C J Meyer, and P Chalmers. 1980. “Field Outbreaks of Hyperoestrogenism
(vulvo-Vaginitis) in Pigs Consuming Maize Infected by Fusarium Graminearum and Contaminated
with Zearalenone.” Journal of the South African Veterinary Association 51 (3) (September): 163–6.
Avantaggiato, G, M Solfrizzo, and a Visconti. 2005. “Recent Advances on the Use of Adsorbent Materials
for Detoxification of Fusarium Mycotoxins.” Food Additives and Contaminants 22 (4) (April): 379–88.
doi:10.1080/02652030500058312.
Awad, W. A., J. Bohm, E. Razzazi-Fazeli, H. W. Hulan, and J. Zentek. 2004. “Effects of Deoxynivalenol on
General Performance and Electrophysiological Properties of Intestinal Mucosa of Broiler Chickens.”
Poultry Science 83 (12) (December 1): 1964–1972. doi:10.1093/ps/83.12.1964.
Bailly, J. D., and P. Guerre. 2008. “Mycotoxicosis in Poultry.” In Mycotoxins in Farm Animals, edited by P.
Oswald, I and I. Taranu, 1–28.
Bakau, W. J. K., W. L. Bryden, T. Garland, and A. C. Barr. 1998. Ergotism and Feed Aversion in Poultry.
Edited by A. C. Garland, T.;Barr. http://www.cabdirect.org/abstracts/20073012493.html.
Basso, Karina, Fernando Gomes, and Ana Paula Loureiro Bracarense. 2013. “Deoxynivanelol and
Fumonisin, Alone or in Combination, Induce Changes on Intestinal Junction Complexes and in E-
Cadherin Expression.” Toxins 5 (12): 2341–2352. doi:10.3390/toxins5122341.
Bate, Simon T, and Robin A Clark. 2014. The Design and Statistical Analysis of Animal Experiment. New
York: Cambridge University Press.
Battacone, Gianni, Anna Nudda, and Giuseppe Pulina. 2010. “Effects of Ochratoxin a on Livestock
Production.” Toxins 2 (7) (July): 1796–824. doi:10.3390/toxins2071796.
Battilani, P, L G Costa, A Dossena, M L Gullino, R Marchelli, Galaverna, Pietri G.c, et al. 2008.
“Mycotoxins and Natural Plant Toxicants.” In . CFP/EFSA/CONTAM/2008/1.
Bayman, Paul, James L Baker, Mark A Doster, Themis J Michailides, and Noreen E Mahoney. 2002.
“Ochratoxin Production by the Aspergillus Ochraceus Group and Aspergillus Alliaceus.” Applied and
Environmental Microbiology 68 (5) (May 1): 2326–2329. doi:10.1128/AEM.68.5.2326–2329.2002.
Bennett, J. W., and M. Klich. 2003. “Mycotoxins.” Clinical Microbiology Reviews 16 (3) (July 1): 497–516.
doi:10.1128/CMR.16.3.497-516.2003.
120
Berthiller, Franz, Colin Crews, Chiara Dall’Asta, Sarah De Saeger, Geert Haesaert, Petr Karlovsky, Isabelle
P Oswald, Walburga Seefelder, Gerrit Speijers, and Joerg Stroka. 2013. “Masked Mycotoxins: A
Review.” Molecular Nutrition & Food Research 57 (1) (January): 165–86.
doi:10.1002/mnfr.201100764.
Bianco, Giuseppe, Bianca Fontanella, Lorella Severino, Andrea Quaroni, Giuseppina Autore, and Stefania
Marzocco. 2012. “Nivalenol and Deoxynivalenol Affect Rat Intestinal Epithelial Cells: A
Concentration Related Study.” PLoS ONE 7 (12). doi:10.1371/journal.pone.0052051.
Blikslager, Anthony T, Adam J Moeser, Jody L Gookin, Samuel L Jones, and Jack Odle. 2007. “Restoration
of Barrier Function in Injured Intestinal Mucosa.” Physiological Reviews 87 (2): 545–564.
doi:10.1152/physrev.00012.2006.
Bolton, Alex J., Michael P. Osborne, Tim S. Wallis, and John Stephen. 1999. “Interaction of Salmonella
Choleraesuis, Salmonella Dublin and Salmonella Typhimurium with Porcine and Bovine Terminal
Ileum in Vivo.” Microbiology 145 (9): 2431–2441.
Bondy, G S, and J J Pestka. 2000. “Immunomodulation by Fungal Toxins.” Journal of Toxicology and
Environmental Health. Part B, Critical Reviews 3 (2): 109–43. doi:10.1080/109374000281113.
Booth, Catherine, and Christopher S. Potten. 2000. “Gut Instincts: Thoughts on Intestinal Epithelial Stem
Cells.” Journal of Clinical Investigation 105 (11): 1493–1499. doi:10.1172/JCI10229.
Bottalico, Antonio, and Giancarlo Perrone. 2002. “Toxigenic Fusarium Species and Mycotoxins Associated
with Head Blight in Small-Grain Cereals in Europe.” European Journal of Plant Pathology 108 (7):
611–624. doi:10.1023/A:1020635214971.
Boudergue, Caroline, Christine Burel, Sylviane Dragacci, Marie-christine Favrot, Jean-marc Fremy, Claire
Massimi, and Philippe Prigent. 2009. “Review of Mycotoxin-Detoxifying Agents Used as Feed
Additives : Mode of Action , Efficacy and Feed / Food.”
Boudra, Hamid, Pierrette Le Bars, and Joseph Le Bars. 1995. “Thermostability of Ochratoxin A in Wheat
under Two Moisture Conditions.” Applied and Environmental Microbiology 61 (3): 1156–1158.
http://aem.asm.org/content/61/3/1156.full.pdf.
Bouhet, Sandrine, Edith Hourcade, Nicolas Loiseau, Asmaa Fikry, Stéphanie Martinez, Marianna Roselli,
Pierre Galtier, Elena Mengheri, and Isabelle P. Oswald. 2004. “The Mycotoxin Fumonisin B1 Alters
the Proliferation and the Barrier Function of Porcine Intestinal Epithelial Cells.” Toxicological Sciences
77 (1): 165–171. doi:10.1093/toxsci/kfh006.
Bouhet, Sandrine, and Isabelle P. Oswald. 2005. “The Effects of Mycotoxins, Fungal Food Contaminants, on
the Intestinal Epithelial Cell-Derived Innate Immune Response.” Veterinary Immunology and
Immunopathology 108 (1-2 SPEC. ISS.): 199–209. doi:10.1016/j.vetimm.2005.08.010.
Boyen, F, F Pasmans, F Van Immerseel, E Donné, E Morgan, R Ducatelle, and F Haesebrouck. 2009.
“Porcine in Vitro and in Vivo Models to Assess the Virulence of Salmonella Enterica Serovar
Typhimurium for Pigs.” Laboratory Animals 43 (1): 46–52. doi:10.1258/la.2007.007084.
Bracarense, Ana-Paula F L, Joelma Lucioli, Bertrand Grenier, Graziela Drociunas Pacheco, Wulf-Dieter
Moll, Gerd Schatzmayr, and Isabelle P Oswald. 2012. “Chronic Ingestion of Deoxynivalenol and
121
Fumonisin, Alone or in Interaction, Induces Morphological and Immunological Changes in the
Intestine of Piglets.” The British Journal of Nutrition 107 (12): 1776–1786.
doi:10.1017/S0007114511004946.
Brake, J, P B Hamilton, and R S Kittrell. 2000. “Effects of the Trichothecene Mycotoxin Diacetoxyscirpenol
on Feed Consumption, Body Weight, and Oral Lesions of Broiler Breeders.” Poultry Science 79 (6)
(June): 856–63. http://www.ncbi.nlm.nih.gov/pubmed/10875768.
Bryden, Wayne L. 2007. “Mycotoxins in the Food Chain: Human Health Implications.” Asia Pacific Journal
of Clinical Nutrition 16 Suppl 1 (Suppl 1) (January): 95–101.
http://www.ncbi.nlm.nih.gov/pubmed/17392084.
Bryden, Wayne L. 1994. “The Many Guises of Ergotism.” In Plant-Associated Toxins: Agricultural,
Phytochemical and Ecological Aspects, edited by S. M. Colegate and P. R. Dorling, 381–386. CAB
International. http://www.cabdirect.org/abstracts/19951401423.html.
Bryden, Wayne L. 2009. “Mycotoxins and Mycotoxicoses: Significance, Occurrence and Mitigation in the
Food Chain.” Toxicology. doi:10.1002/9780470744307.gat157.
Bryden, Wayne L. 2012. “Mycotoxin Contamination of the Feed Supply Chain: Implications for Animal
Productivity and Feed Security.” Animal Feed Science and Technology 173 (1-2) (April): 134–158.
doi:10.1016/j.anifeedsci.2011.12.014.
Budihardjo, Imawati, Holt Oliver, Michael Lutter, X Luo, and X Wang. 1999. “Biochemical Pathways of
Caspase Activation during Apoptosis.” Annual Review of Cell and Developmental Biology 15: 269–90.
doi:10.1146/annurev.cellbio.15.1.269.
Calabrese, Edward J, and Linda A Baldwin. 2001. “Hormesis: U-Shaped Dose-Response and Their
Centrality in Toxicology.” Trends Pharmacol Sci 22 (6): 286–291.
Calabrese, Edward J. 2002. “Hormesis: Changing View of the Dose-Response, a Personal Account of the
History and Current Status.” Mutation Research - Reviews in Mutation Research 511 (3): 181–189.
doi:10.1016/S1383-5742(02)00013-3.
Cano, Patricia M., Julie Seeboth, François Meurens, Juliette Cognie, Roberta Abrami, Isabelle P. Oswald,
and Laurence Guzylack-Piriou. 2013. “Deoxynivalenol as a New Factor in the Persistence of Intestinal
Inflammatory Diseases: An Emerging Hypothesis through Possible Modulation of Th17-Mediated
Response.” PLoS ONE 8 (1). doi:10.1371/journal.pone.0053647.
Cheat, Sophal, Juliana Gerez, Juliette Cognié, Imourana Alassane-Kpembi, Ana Bracarense, Isabelle
Raymond-Letron, Isabelle Oswald, and Martine Kolf-Clauw. 2015. “Nivalenol Has a Greater Impact
than Deoxynivalenol on Pig Jejunum Mucosa in Vitro on Explants and in Vivo on Intestinal Loops.”
Toxins 7 (6): 1945–1961. doi:10.3390/toxins7061945.
Chou, T C, and P Talalay. 1984. “Quantitative Analysis of Dose-Effect Relationships: The Combined Effects
of Multiple Drugs or Enzyme Inhibitors.” Advances in Enzyme Regulation 22: 27–55.
doi:10.1016/0065-2571(84)90007-4.
Claude, Bernard. 1957. An Introduction to the Study of Experimental Medicine. Courier Corporation.
122
Cole, RJ, and PJ Cotty. 1990. “Biocontrol of Aflatoxin Production by Using Biocompetitive Agents.” A
Perspective on Aflatoxin in Field Crops and …: 62–66.
Creppy, Edmond E. 2002. “Update of Survey, Regulation and Toxic Effects of Mycotoxins in Europe.”
Toxicology Letters 127 (1-3) (February 28): 19–28. http://www.ncbi.nlm.nih.gov/pubmed/12052637.
Curtis, Meredith M., and Sing Sing Way. 2009. “Interleukin-17 in Host Defence against Bacterial,
Mycobacterial and Fungal Pathogens.” Immunology 126 (2): 177–185. doi:10.1111/j.1365-
2567.2008.03017.x.
Dalvi, R. R. 1986. “An Overview of Aflatoxicosis of Poultry: Its Characteristics, Prevention and Reduction.”
Veterinary Research Communications 10 (1) (December): 429–443. doi:10.1007/BF02214006.
http://link.springer.com/10.1007/BF02214006.
Dänicke, Sven, Bianca Brosig, Leslie Raja Klunker, Stefan Kahlert, Jeannette Kluess, Susanne Döll, Hana
Valenta, and Hermann Josef Rothkötter. 2012. “Systemic and Local Effects of the Fusarium Toxin
Deoxynivalenol (DON) Are Not Alleviated by Dietary Supplementation of Humic Substances (HS).”
Food and Chemical Toxicology 50 (3-4): 979–988. doi:10.1016/j.fct.2011.12.024.
De Walle, Jacqueline Van, Thérèse Sergent, Neil Piront, Olivier Toussaint, Yves-Jacques Schneider, and
Yvan Larondelle. 2010. “Deoxynivalenol Affects in Vitro Intestinal Epithelial Cell Barrier Integrity
through Inhibition of Protein Synthesis.” Toxicology and Applied Pharmacology 245 (3) (June 15):
291–8. doi:10.1016/j.taap.2010.03.012.
Degen, G. H. 2011. “Tools for Investigating Workplace-Related Risks from Mycotoxin Exposure.” World
Mycotoxin Journal 4 (3) (August 1): 315–327. doi:10.3920/WMJ2011.1295.
Dersjant-Li, Yueming, Martin W A Verstegen, and Walter J J Gerrits. 2003. “The Impact of Low
Concentrations of Aflatoxin, Deoxynivalenol or Fumonisin in Diets on Growing Pigs and Poultry.”
Nutrition Research Reviews 16 (2) (December): 223–39. doi:10.1079/NRR200368.
Diekman, M a, and M L Green. 1992. “Mycotoxins and Reproduction in Domestic Livestock.” Journal of
Animal Science 70 (5) (May): 1615–27. http://www.ncbi.nlm.nih.gov/pubmed/1388147.
Diesing, Anne-Kathrin, Constanze Nossol, Patricia Panther, Nicole Walk, Andreas Post, Jeannette Kluess,
Peter Kreutzmann, Sven Dänicke, Hermann-Josef Rothkötter, and Stefan Kahlert. 2011. “Mycotoxin
Deoxynivalenol (DON) Mediates Biphasic Cellular Response in Intestinal Porcine Epithelial Cell Lines
IPEC-1 and IPEC-J2.” Toxicology Letters 200 (1-2) (January 15): 8–18.
doi:10.1016/j.toxlet.2010.10.006.
Döll, S, and S Dänicke. 2004. “In Vivo Detoxification of Fusarium Toxins.” Archives of Animal Nutrition 58
(6) (December): 419–41. doi:10.1080/00039420400020066.
Duvick, Jon and Tracy A. Rood. 1999. “Zearalenone Detoxification Compositions and Methods” (2000).
http://patentimages.storage.googleapis.com/pdfs/US6074838.pdf.
EC (European Commission). 2000. “Opinion of the Scientific Committee on Food on Fusarium Toxins Part
41: NIVALENOL.” Health & Consumer Protection Directorate-General: 1–10.
123
EC (European Commission). 2006. “Commission Recommendation (2006/576/EU) of 17 August 2006 on
the Presence of Deoxynivalenol, Zearalenone, Ochratoxin A, T-2 and HT-2 and Fumonisins in Products
Intended for Animal Feeding.” Official Journal of the European Union L 229 (March 2005): 7–9.
EFSA (European food Safety Authority). 2006. “Opinion of the Scientific Panel on Contaminants in the
Food Chain on a Request from the Commission Revealed to Ochratoxin A in Food.” The EFSA Journal
365: 1–56. http://www.efsa.europa.eu/en/scdocs/doc/contam_op_ej365_ochratoxin_a_food_en.pdf.
EFSA (European food Safety Authority). 2007. “Opinion of the Scientific Panel on Contaminants in the
Food Chain on a Request from the Commission Related to Deoxynivalenol (DON) as Undesirable
Substance in Animal Feed (Question N° EFSA-Q-2003-036) Adopted on 2 June 2004.” The EFSA
Journal (February): 1–42.
EFSA (European food Safety Authority). 2012. “EFSA Panel on Biological Hazards ( BIOHAZ ), EFSA
Panel on Contaminants in the Food Chain (CONTAM) and EFSA Panel on Animal Health and Welfare
(AHAW); Scientific Opinion on the Public Health Hazards to Be Covered by Inspection of Meat
(poultry).” EFSA Journal 10 (6): 1–179. doi:10.2903/j.efsa.2012.2741.
EFSA (European food Safety Authority). 2013. “Scientific Opinion on Risks for Animal and Public Health
Related to the Presence of Nivalenol in Food and Feed.” EFSA Journal 11 (6): 1–119.
doi:10.2903/j.efsa.2013.3262.
EFSA (European food Safety Authority). 2010. “Scientific Opinion: Statement on Recent Scientific
Information on the Toxicity of Ochratoxin A_EFSA Panel on Contaminants in the Food Chain.” EFSA
Journal 8 (6): 1–7. doi:10.2903/j.efsa.2010.1626.
EFSA FEEDAP Penel. 2014. “Scientific Opinion on the Safety and Efficacy of Fumonisin Esterase
(FUMzyme®) as a Technological Feed Additive for Pigs.” EFSA 12 (5): 3667.
doi:10.2903/j.efsa.2014.3667.
Endl, E, and J Gerdes. 2000. “The Ki-67 Protein: Fascinating Forms and an Unknown Function.”
Experimental Cell Research 257 (2): 231–237. doi:10.1006/excr.2000.4888.
Eriksen, G. S., H. Pettersson, K. Johnsen, and J. E. Lindberg. 2002. “Transformation of Trichothecenes in
Ileal Digesta and Faeces from Pigs.” Archiv Für Tierernaehrung 56 (4) (August): 263–274.
doi:10.1080/00039420214343.
Eriksen, G. S., H. Pettersson, and J. E. Lindberg. 2003. “Absorption, Metabolism and Excretion of 3-Acetyl
Don in Pigs.” Archives of Animal Nutrition 57 (5) (October): 335–345.
doi:10.1080/00039420310001607699.
Eriksen, Gunnar Sundstøl. 2003. Metabolism and Toxicity of Trichothecenes. Doctoral t. Uppsala:
Department of Animal Nutrition and Management, Swedish University of Agricultural Sciences.
http://pub.epsilon.slu.se/id/eprint/287.
Favaloro, B., N. Allocati, V. Graziano, C. Di Ilio, and V. De Laurenzi. 2012. “Role of Apoptosis in Disease.”
Aging 4 (5): 330–349.
124
Festing, Michael F.W., Philip Overend, Rose Graines Das, Mario Cortina Borja, and Manuel Berdoy. 2002.
The Design of Animal Experiments: Reducing the Use of Animals in Research through Better
Experimental Design. London: Royal Society of Medicine Press Limited.
Fink-Gremmels, J., and H. Malekinejad. 2007. “Clinical Effects and Biochemical Mechanisms Associated
with Exposure to the Mycoestrogen Zearalenone.” Animal Feed Science and Technology 137 (3-4)
(October): 326–341. doi:10.1016/j.anifeedsci.2007.06.008.
Fink-Gremmels, Johanna. 2008. “Mycotoxins in Cattle Feeds and Carry-over to Dairy Milk: A Review.”
Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment
25(2) (February): 172–80. doi:10.1080/02652030701823142.
Fuchs, E, E M Binder, D Heidler, and R Krska. 2002. “Structural Characterization of Metabolites after the
Microbial Degradation of Type A Trichothecenes by the Bacterial Strain BBSH 797.” Food Additives
and Contaminants 19 (4) (April): 379–86. doi:10.1080/02652030110091154.
Furtado, R. M., A. M. Pearson, J. I. Gray, M. G. Hogberg, and E. R. Miller. 1981. “Effects of Cooking
And/or Processing Upon Levels of Aflatoxins in Meat from Pigs Fed A Contaminated Diet.” Journal of
Food Science 46 (5) (September): 1306–1308. doi:10.1111/j.1365-2621.1981.tb04160.x.
Gaigé, Stéphanie, Marion S Bonnet, Catherine Tardivel, Philippe Pinton, Jérôme Trouslard, André Jean,
Laurence Guzylack, Jean-Denis Troadec, and Michel Dallaporta. 2013. “C-Fos Immunoreactivity in the
Pig Brain Following Deoxynivalenol Intoxication: Focus on NUCB2/nesfatin-1 Expressing Neurons.”
Neurotoxicology 34 (January): 135–49. doi:10.1016/j.neuro.2012.10.020.
Gajecki, M. 2002. “Zearalenone--Undesirable Substances in Feed.” Polish Journal of Veterinary Sciences 5
(2) (January): 117–22. http://www.ncbi.nlm.nih.gov/pubmed/12189947.
Galaverna, G., C. Dallsta, M. Mangia, A. Dossena, and R. Marchelli. 2009. “Masked Mycotoxins: An
Emerging Issue for Food Safety.” Czech Journal of Food Sciences 27 (SPEC. ISS.): 89–92.
Galaverna, G., C. Dallsta, M. Mangia, A. Dossena, R. Marchelli, Franz Berthiller, Colin Crews, et al. 2013.
“Masked Mycotoxins: A Review.” Czech Journal of Food Sciences 57 (1) (January): 89–92.
doi:10.1002/mnfr.201100764.
Galtier P., M. Alvinerie. 1976. “In Vitro Transformation of Ochratoxin A by Animal Microbial Floras.”
Annales de Recherches Vétérinaires 7 (no. 1): 91–98. http://hal.archives-
ouvertes.fr/docs/00/90/08/73/PDF/hal-00900873.pdf.
Gareis, M.; Scheuer, R. 2000. “Ochratoxin A in Meat and Meat Products.” Archiv Für Lebensmittelhygiene.
http://www.cabdirect.org/abstracts/20003024260.html.
Garrett, K A, S P Dendy, E E Frank, M N Rouse, and S E Travers. 2006. “Climate Change Effects on Plant
Disease: Genomes to Ecosystems.” Annual Review of Phytopathology 44 (January): 489–509.
doi:10.1146/annurev.phyto.44.070505.143420.
Gauthier, Thierry, Yann Waché, Joëlle Laffitte, Ionelia Taranu, Nazli Saeedikouzehkonani, Yasuyuki Mori,
and Isabelle P. Oswald. 2013. “Deoxynivalenol Impairs the Immune Functions of Neutrophils.”
Molecular Nutrition and Food Research 57 (6): 1026–1036. doi:10.1002/mnfr.201200755.
125
Gelberg, Howard B. 2012. “Pathology of Organ Systems: Alimentary System and the Peritoneum,
Omentum, Mesentery, and Peritoneal Cavity.” In Pathologic Basis of Veterinary Diseases, edited by JF
Zachary and MD McGavin, 5th ed., 355–400. Missouri, USA: Penny Rudolph.
Gelineau-van Waes, Janee, Lois Starr, Joyce Maddox, Francisco Aleman, Kenneth a Voss, Justin
Wilberding, and Ronald T Riley. 2005. “Maternal Fumonisin Exposure and Risk for Neural Tube
Defects: Mechanisms in an in Vivo Mouse Model.” Birth Defects Research. Part A, Clinical and
Molecular Teratology 73 (7) (July): 487–97. doi:10.1002/bdra.20148.
Gerdts, Volker, Richard R E Uwiera, George K. Mutwiri, Don J. Wilson, Terry Bowersock, Argaw Kidane,
Lorne a. Babiuk, and Philip J. Griebel. 2001. “Multiple Intestinal ‘Loops’ Provide an in Vivo Model to
Analyse Multiple Mucosal Immune Responses.” Journal of Immunological Methods 256 (1-2): 19–33.
doi:10.1016/S0022-1759(01)00429-X.
Gerez, Juliana R., Philippe Pinton, Patrick Callu, François Grosjean, Isabelle P. Oswald, and Ana Paula F.L.
Bracarense. 2015. “Deoxynivalenol Alone or in Combination with Nivalenol and Zearalenone Induce
Systemic Histological Changes in Pigs.” Experimental and Toxicologic Pathology 67 (2): 89–98.
doi:10.1016/j.etp.2014.10.001.
Ghareeb, Khaled, Wageha A. Awad, Josef Böhm, and Qendrim Zebeli. 2015. “Impacts of the Feed
Contaminant Deoxynivalenol on the Intestine of Monogastric Animals: Poultry and Swine.” Journal of
Applied Toxicology 35 (4): 327–337. doi:10.1002/jat.3083.
Girard, Francis, Isabelle Batisson, Gad M. Frankel, Josée Harel, and John M. Fairbrother. 2005. “Interaction
of Enteropathogenic and Shiga Toxin-Producing Escherichia Coli and Porcine Intestinal Mucosa: Role
of Intimin and Tir in Adherence.” Infection and Immunity 73 (9): 6005–6016.
doi:10.1128/IAI.73.9.6005-6016.2005.
Girard, Francis, Francis Dziva, Pauline Van Diemen, Alan D. Phillips, Mark P. Stevens, and Gad Frankel.
2007. “Adherence of Enterohemorrhagic Escherichia Coli O157, O26, and O111 Strains to Bovine
Intestinal Explants Ex Vivo.” Applied and Environmental Microbiology 73 (9): 3084–3090.
doi:10.1128/AEM.02893-06.
Girard-Misguich, Fabienne, Juliette Cognie, Mario Delgado-Ortega, Patricia Berthon, Christelle Rossignol,
Thibaut Larcher, Sandrine Melo, et al. 2011. “Towards the Establishment of a Porcine Model to Study
Human Amebiasis.” PLoS ONE 6 (12). doi:10.1371/journal.pone.0028795.
Glenn, A. E. 2007. “Mycotoxigenic Fusarium Species in Animal Feed.” Animal Feed Science and
Technology 137 (3-4) (October): 213–240. doi:10.1016/j.anifeedsci.2007.06.003.
Gourbeyre, P., M. Berri, Y. Lippi, F. Meurens, S. Vincent-Naulleau, J. Laffitte, C. Rogel-Gaillard, P. Pinton,
and I. P. Oswald. 2015. “Pattern Recognition Receptors in the Gut: Analysis of Their Expression along
the Intestinal Tract and the Crypt/villus Axis.” Physiological Reports 3 (2): e12225–e12225.
doi:10.14814/phy2.12225.
Grenier, B., and I. P. Oswald. 2011. “Mycotoxin Co-Contamination of Food and Feed: Meta-Analysis of
Publications Describing Toxicological Interactions.” World Mycotoxin Journal 4 (3) (August 1): 285–
313. doi:10.3920/WMJ2011.1281.
126
Grenier, Bertrand, and Todd J. Applegate. 2013. “Modulation of Intestinal Functions Following Mycotoxin
Ingestion: Meta-Analysis of Published Experiments in Animals.” Toxins 5 (2): 396–430.
doi:10.3390/toxins5020396.
Grenier, Bertrand, Ana-Paula Loureiro-Bracarense, Joelma Lucioli, Graziela Drociunas Pacheco, Anne-
Marie Cossalter, Wulf-Dieter Moll, Gerd Schatzmayr, and Isabelle P Oswald. 2011. “Individual and
Combined Effects of Subclinical Doses of Deoxynivalenol and Fumonisins in Piglets.” Molecular
Nutrition & Food Research 55 (5) (May): 761–71. doi:10.1002/mnfr.201000402.
Groisman, Gabriel M., Edmond Sabo, Alona Meir, and Sylvie Polak-Charcon. 2000. “Enterocyte Apoptosis
and Proliferation Are Increased in Microvillous Inclusion Disease (familial Microvillous Atrophy).”
Human Pathology 31 (11): 1404–1410. doi:10.1053/hupa.2000.19831.
Groschwitz, Katherine R, and Simon P Hogan. 2009. “Intestinal Barrier Function: Molecular Regulation and
Disease Pathogenesis.” The Journal of Allergy and Clinical Immunology 124 (1): 3–20; quiz 21–22.
doi:10.1016/j.jaci.2009.05.038.
Hall, Peter A, Philip J Coates, Bijan Ansari, and David Hopwood. 1994. “Regulation of Cell Number in the
Mammalian Gastrointestinal Tract: The Importance of Apoptosis.” Journal of Cell Science 107 (Pt 1):
3569–3577.
Haschek, Wanda M., Colin G. Rousseaux, and Matthew A. Wallig. 2010. Fundamenatls of Toxicologic
Pathology. 2nd ed. UK: Academic Press-Elsevier.
He, P., L. G. Young, and C. Forsberg. 1992. “Microbial Transformation of Deoxynivalenol (vomitoxin).”
Applied and Environmental Microbiology 58 (12): 3857–3863.
Hedman, R, A Thuvander, I Gadhasson, M Reverter, and H Pettersson. 1997a. “Influence of Dietary
Nivalenol Exposure on Gross Pathology and Selected Immunological Parameters in Young Pigs.”
Natural Toxins 5 (6) (January): 238–46. http://www.ncbi.nlm.nih.gov/pubmed/9615312.
Hedman, R., H. Pettersson, and J.E. Lindberg. 1997b. “Absorption and Metabolism of Nivalenol in Pigs.”
Archiv Für Tierernaehrung 50 (1) (January): 13–24. doi:10.1080/17450399709386115.
Hooper, Lora V, and Andrew J Macpherson. 2010. “Immune Adaptations That Maintain Homeostasis with
the Intestinal Microbiota.” Nature Reviews. Immunology 10 (3): 159–169. doi:10.1038/nri2710.
Hsia, Chu Chieh, Ze Yuan Wu, Yun Sian Li, Fan Zhang, and Zong Tang Sun. 2004. “Nivalenol, a Main
Fusarium Toxin in Dietary Foods from High-Risk Areas of Cancer of Esophagus and Gastric Cardia in
China, Induced Benign and Malignant Tumors in Mice.” Oncology Reports 12 (2): 449–456.
Hussein, H S, and J M Brasel. 2001. “Toxicity, Metabolism, and Impact of Mycotoxins on Humans and
Animals.” Toxicology 167 (2) (October 15): 101–34. http://www.ncbi.nlm.nih.gov/pubmed/11567776.
Huwig, A, S Freimund, O Käppeli, and H Dutler. 2001. “Mycotoxin Detoxication of Animal Feed by
Different Adsorbents.” Toxicology Letters 122 (2) (June 20): 179–88.
http://www.ncbi.nlm.nih.gov/pubmed/11439224.
IARC (International Agency for Research on Cancer). 1993. Some Naturally Occurring Substances, Food
Items and Constituents, Heterocyclic Aromatic Amines and Mycotoxins. Monograph on the Evaluation
127
of Carcinogenic Risks to Humans. UK: World Health Organization, International Agency for Research
on Cancer. http://monographs.iarc.fr/ENG/Monographs/vol56/mono56.pdf.
Iheshiulor, O.O.M., B.O. Esonu, O.K. Chuwuka, A.A. Omede, I.C. Okoli, and I.P. Ogbuewu. 2011. “Effects
of Mycotoxins in Animal Nutrition: A Review.” Asian Journal of Animal Sciences 5 (1) (January 1):
19–33. doi:10.3923/ajas.2011.19.33. http://www.scialert.net/abstract/?doi=ajas.2011.19.33.
Jackson, Lauren S., Jason J. Hlywka, Kannaki R. Senthil, and Lloyd B. Bullerman. 1996. “Effects of
Thermal Processing on the Stability of Fumonisin B 2 in an Aqueous System.” Journal of Agricultural
and Food Chemistry 44 (8) (January): 1984–1987. doi:10.1021/jf9601729.
JECFA (Joint FAO/WHO Expert Committee on Food Additives). 2001. “Summary and Conclusions.” In
56th Meeting. Geneva: Joint FAO/WHO Expert Committee on Food Additives.
Jørgensen, K, and a Petersen. 2002. “Content of Ochratoxin A in Paired Kidney and Meat Samples from
Healthy Danish Slaughter Pigs.” Food Additives and Contaminants 19 (6) (June): 562–7.
doi:10.1080/02652030110113807.
Jørgensen, Kevin. 2005. “Occurrence of Ochratoxin A in Commodities and Processed Food--a Review of EU
Occurrence Data.” Food Additives and Contaminants 22 Suppl 1 (May 2014) (January): 26–30.
doi:10.1080/02652030500344811.
Jouany, Jean Pierre. 2007. “Methods for Preventing, Decontaminating and Minimizing the Toxicity of
Mycotoxins in Feeds.” Animal Feed Science and Technology 137 (3-4) (October): 342–362.
doi:10.1016/j.anifeedsci.2007.06.009. http://linkinghub.elsevier.com/retrieve/pii/S0377840107002234.
Kabak, Bulent. 2009. “The Fate of Mycotoxins during Thermal Food Processing.” Journal of the Science of
Food and Agriculture 89 (4) (March 15): 549–554. doi:10.1002/jsfa.3491.
Kabak, Bulent, Alan D W Dobson, and Işil Var. 2006. “Strategies to Prevent Mycotoxin Contamination of
Food and Animal Feed: A Review.” Critical Reviews in Food Science and Nutrition 46 (8) (January):
593–619. doi:10.1080/10408390500436185.
Kanora, A, and D Maes. 2009. “The Role of Mycotoxins in Pig Reproduction: A Review.” Veterinarni
Medicina 2009 (12): 565–576. https://biblio.ugent.be/publication/890458.
Kararli, Tugrul T. 1995. “Comparison of the Gastrointestinal Anatomy, Physiology, and Biochemistry of
Humans and Commonly Used Laboratory Animals.” Biopharmaceutics and Drug Disposition.
doi:10.1002/bdd.2510160502.
Karlovsky, Petr. 1999. “Biological Detoxification of Fungal Toxins and Its Use in Plant Breeding, Feed and
Food Production.” Natural Toxins 7 (May): 1–23. http://www.ask-force.org/web/Bt/Karlovsky-
Biological-Decontamination-1999.pdf.
Kee, N, S Si, R Boonstra, and J M Wojtowicz. 2002. “The Utility of Ki-67 and BrdU as Proliferative
Markers of Adult Neurogenesis.” Journal of Neuroscience Methods 115: 97–105.
Keese, Christina, Ulrich Meyer, Hana Valenta, Margit Schollenberger, Alexander Starke, Ina-Alexandra
Weber, Jürgen Rehage, Gerhard Breves, and Sven Dänicke. 2008. “No Carry over of Unmetabolised
Deoxynivalenol in Milk of Dairy Cows Fed High Concentrate Proportions.” Molecular Nutrition &
Food Research 52 (12) (December): 1514–29. doi:10.1002/mnfr.200800077.
128
Kiros, Tadele G., Jill van Kessel, Lorne a. Babiuk, and Volker Gerdts. 2011. “Induction, Regulation and
Physiological Role of IL-17 Secreting Helper T-Cells Isolated from PBMC, Thymus, and Lung
Lymphocytes of Young Pigs.” Veterinary Immunology and Immunopathology 144 (3-4): 448–454.
doi:10.1016/j.vetimm.2011.08.021.
Klunker, L. R., S. Kahlert, P. Panther, a. K. Diesing, N. Reinhardt, B. Brosig, S. Kersten, S. Dänicke, H. J.
Rothkötter, and J. W. Kluess. 2013. “Deoxynivalenol and E.coli Lipopolysaccharide Alter Epithelial
Proliferation and Spatial Distribution of Apical Junction Proteins along the Small Intestinal Axis.”
Journal of Animal Science 91 (1): 276–285. doi:10.2527/jas.2012-5453.
Kolf-Clauw, Martine, Jessie Castellote, Benjamin Joly, Nathalie Bourges-Abella, Isabelle Raymond-Letron,
Philippe Pinton, and Isabelle P Oswald. 2009. “Development of a Pig Jejunal Explant Culture for
Studying the Gastrointestinal Toxicity of the Mycotoxin Deoxynivalenol: Histopathological Analysis.”
Toxicology in Vitro : An International Journal Published in Association with BIBRA 23 (8)
(December): 1580–4. doi:10.1016/j.tiv.2009.07.015.
Kolf-Clauw, Martine, Marcia Sassahara, Joelma Lucioli, Juliana Rubira-Gerez, Imourana Alassane-Kpembi,
Faouzi Lyazhri, Christiane Borin, and Isabelle P. Oswald. 2013. “The Emerging Mycotoxin, Enniatin
B1, down-Modulates the Gastrointestinal Toxicity of T-2 Toxin in Vitro on Intestinal Epithelial Cells
and Ex Vivo on Intestinal Explants.” Archives of Toxicology 87 (12): 2233–2241. doi:10.1007/s00204-
013-1067-8.
Krishnaswamy, Rajashree, S. Niranjali Devaraj, and V. Vijaya Padma. 2010. “Lutein Protects HT-29 Cells
against Deoxynivalenol-Induced Oxidative Stress and Apoptosis: Prevention of NF-??B Nuclear
Localization and down Regulation of NF-??B and Cyclo-Oxygenase - 2 Expression.” Free Radical
Biology and Medicine 49 (1): 50–60. doi:10.1016/j.freeradbiomed.2010.03.016.
Laprie, C, J Abadie, M F Amardeilh, I Raymond, and M Delverdier. 1998. “Detection of the Ki-67
Proliferation Associated Nuclear Epitope in Normal Canine Tissues Using the Monoclonal Antibody
MIB-1.” Anatomia, Histologia, Embryologia 27 (4): 251–256.
Le Bars, J, and P Le Bars. 1996. “Review Article Recent Acute and Subacute Mycotoxicoses Recognized in
France.” Veterinary Research (27): 383–394. http://hal.archives-ouvertes.fr/docs/00/90/24/30/PDF/hal-
00902430.pdf.
Leblanc, J-C, A Tard, J-L Volatier, and P Verger. 2005. “Estimated Dietary Exposure to Principal Food
Mycotoxins from the First French Total Diet Study.” Food Additives and Contaminants 22 (7): 652–
672. doi:10.1080/02652030500159938.
Lemke, S L, K Mayura, S E Ottinger, K S McKenzie, N Wang, C Fickey, L F Kubena, and T D Phillips.
1999. “Assessment of the Estrogenic Effects of Zearalenone after Treatment with Ozone Utilizing the
Mouse Uterine Weight Bioassay.” Journal of Toxicology and Environmental Health. Part A 56 (4)
(February 26): 283–95. doi:10.1080/009841099158114.
Lessard, Martin, Christian Savard, Karine Deschene, Karoline Lauzon, Vicente A. Pinilla, Carl A. Gagnon,
Jérôme Lapointe, Frédéric Guay, and Younès Chorfi. 2015. “Impact of Deoxynivalenol (DON)
129
Contaminated Feed on Intestinal Integrity and Immune Response in Swine.” Food and Chemical
Toxicology 80: 7–16. doi:10.1016/j.fct.2015.02.013.
Logrieco, A., G. Mulè, A. Moretti, and A. Bottalico. 2002. “Toxigenic Fusarium Species and Mycotoxins
Associated with Maize Ear Rot in Europe.” In European Journal of Plant Pathology, 108:597–609.
doi:10.1023/A:1020679029993.
Lucioli, Joelma, Philippe Pinton, Patrick Callu, Joëlle Laffitte, François Grosjean, Martine Kolf-Clauw,
Isabelle P. Oswald, and Ana Paula F R L Bracarense. 2013. “The Food Contaminant Deoxynivalenol
Activates the Mitogen Activated Protein Kinases in the Intestine: Interest of Ex Vivo Models as an
Alternative to in Vivo Experiments.” Toxicon 66: 31–36. doi:10.1016/j.toxicon.2013.01.024.
Luongo, D., R. De Luna, R. Russo, and L. Severino. 2008. “Effects of Four Fusarium Toxins (fumonisin
B1, ??-Zearalenol, Nivalenol and Deoxynivalenol) on Porcine Whole-Blood Cellular Proliferation.”
Toxicon 52 (1): 156–162. doi:10.1016/j.toxicon.2008.04.162.
Madej, M, T Lundh, and J E Lindberg. 1999. “Effect of Exposure to Dietary Nivalenol on Activity of
Enzymes Involved in Glutamine Catabolism in the Epithelium along the Gastrointestinal Tract of
Growing Pigs.” Archiv Fur Tierernahrung 52 (3): 275–284. doi:10.1080/17450399909386167.
Magan, Naresh. 2006. “Mycotoxin Contamination of Food in Europe: Early Detection and Prevention
Strategies.” Mycopathologia 162 (3) (September): 245–53. doi:10.1007/s11046-006-0057-2.
Magan, Naresh, and David Aldred. 2005. “Conditions of Formation of Ochratoxin A in Drying, Transport
and in Different Commodities.” Food Additives and Contaminants 22 Suppl 1 (January): 10–6.
doi:10.1080/02652030500412154.
Magan, Naresh, and David Aldred. 2007. “Post-Harvest Control Strategies: Minimizing Mycotoxins in the
Food Chain.” International Journal of Food Microbiology 119 (1-2) (October 20): 131–9.
doi:10.1016/j.ijfoodmicro.2007.07.034.
Magan, Naresh, David Aldred, Kalliopi Mylona, and Ronald J W Lambert. 2010. “Limiting Mycotoxins in
Stored Wheat.” Food Additives & Contaminants. Part A, Chemistry, Analysis, Control, Exposure &
Risk Assessment 27 (5) (May): 644–50. doi:10.1080/19440040903514523.
Maresca, Marc, Nouara Yahi, Lama Younès-Sakr, Marilyn Boyron, Bertrand Caporiccio, and Jacques
Fantini. 2008. “Both Direct and Indirect Effects Account for the pro-Inflammatory Activity of
Enteropathogenic Mycotoxins on the Human Intestinal Epithelium: Stimulation of Interleukin-8
Secretion, Potentiation of Interleukin-1β Effect and Increase in the Transepithelial.” Toxicology and
Applied Pharmacology 228 (1): 84–92. doi:10.1016/j.taap.2007.11.013.
Markovits, Judit E, Graham R Betton, Donald N McMartin, and Oliver C Tuner. 2013. “Gastrointestinal
Tract.” In Toxicologic Pathology: Nonclinical Safety Assessment, edited by Pritam S Sahota, James A
Popp, Jerry F Hardisty, and Chirukandath Gopinath, 257–312. Boca Raton: CRC Press.
Marquardt, R R, and a a Frohlich. 1992. “A Review of Recent Advances in Understanding Ochratoxicosis.”
Journal of Animal Science 70 (12) (December): 3968–88.
http://www.ncbi.nlm.nih.gov/pubmed/1474034.
130
Marzocco, Stefania, Rosario Russo, Giuseppe Bianco, Giuseppina Autore, and Lorella Severino. 2009. “Pro-
Apoptotic Effects of Nivalenol and Deoxynivalenol Trichothecenes in J774A.1 Murine Macrophages.”
Toxicology Letters 189: 21–26. doi:10.1016/j.toxlet.2009.04.024.
McKenzie, K.S., A.B. Sarr, K. Mayura, R.H. Bailey, D.R. Miller, T.D. Rogers, W.P. Norred, et al. 1997.
“Oxidative Degradation and Detoxification of Mycotoxins Using a Novel Source of Ozone.” Food and
Chemical Toxicology 35 (8) (August): 807–820. doi:10.1016/S0278-6915(97)00052-5.
Meissonnier, Guylaine M, Philippe Pinton, Joëlle Laffitte, Anne-Marie Cossalter, Yun Yun Gong,
Christopher P Wild, Gérard Bertin, Pierre Galtier, and Isabelle P Oswald. 2008. “Immunotoxicity of
Aflatoxin B1: Impairment of the Cell-Mediated Response to Vaccine Antigen and Modulation of
Cytokine Expression.” Toxicology and Applied Pharmacology 231 (2) (September 1): 142–9.
doi:10.1016/j.taap.2008.04.004.
Meister, Ute, and Monika Springer. 2004. “Mycotoxins in Cereals and Cereal Products: Occurrence and
Changes during Processing.” Journal of Applied Botany and Food Quality 78 (3): 168–173.
http://cat.inist.fr/?aModele=afficheN&cpsidt=16378581.
Meky, F A, P C Turner, A E Ashcroft, J D Miller, Y-L Qiao, M J Roth, and C P Wild. 2003. “Development
of a Urinary Biomarker of Human Exposure to Deoxynivalenol.” Food and Chemical Toxicology : An
International Journal Published for the British Industrial Biological Research Association 41 (2)
(February): 265–73. http://www.ncbi.nlm.nih.gov/pubmed/12480302.
Meurens, François, Mustapha Berri, Gael Auray, Sandrine Melo, Benoît Levast, Isabelle Virlogeux-Payant,
Claire Chevaleyre, Volker Gerdts, and Henri Salmon. 2009. “Early Immune Response Following
Salmonella Enterica Subspecies Enterica Serovar Typhimurium Infection in Porcine Jejunal Gut
Loops.” Veterinary Research 40 (1): 41–44. doi:10.1051/vetres:2008043.
Miedaner, T, F Wilde, B Steiner, H Buerstmayr, V Korzun, and E Ebmeyer. 2006. “Stacking Quantitative
Trait Loci (QTL) for Fusarium Head Blight Resistance from Non-Adapted Sources in an European
Elite Spring Wheat Background and Assessing Their Effects on Deoxynivalenol (DON) Content and
Disease Severity.” TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik 112
(3) (February): 562–9. doi:10.1007/s00122-005-0163-4.
Mili ćević, Dragan R, Marija Skrinjar, and Tatjana Baltić. 2010. “Real and Perceived Risks for Mycotoxin
Contamination in Foods and Feeds: Challenges for Food Safety Control.” Toxins 2 (4) (April): 572–92.
doi:10.3390/toxins2040572.
Miller, JD. 1998. “Global Significance of Mycotoxins.” In Mycotoxins and Phycotoxins: Developments in
Chemistry, Toxicology and Food Safety, edited by M Miraglia, HP Van Egmond, C Brera, and J
Gilbert, 3–15. Alaken: Fort Collins.
Minervini, F., F. Fornelli, and K. M. Flynn. 2004. “Toxicity and Apoptosis Induced by the Mycotoxins
Nivalenol, Deoxynivalenol and Fumonisin B1 in a Human Erythroleukemia Cell Line.” Toxicology in
Vitro 18 (1): 21–28. doi:10.1016/S0887-2333(03)00130-9.
131
Mishra, Sakshi, Premendra D. Dwivedi, Haushila P. Pandey, and Mukul Das. 2014. “Role of Oxidative
Stress in Deoxynivalenol Induced Toxicity.” Food and Chemical Toxicology 72: 20–29.
doi:10.1016/j.fct.2014.06.027.
Molnar, Orsolya, Gerd Schatzmayr, Elisabeth Fuchs, and Hansjoerg Prillinger. 2004. “Trichosporon
Mycotoxinivorans Sp. Nov., a New Yeast Species Useful in Biological Detoxification of Various
Mycotoxins.” Systematic and Applied Microbiology 27 (6) (November): 661–71.
doi:10.1078/0723202042369947.
Moolenbeek, C, and E J Ruitenberg. 1981. “The ‘Swiss Roll’: A Simple Technique for Histological Studies
of the Rodent Intestine.” Laboratory Animals 15 (1): 57–59. doi:10.1258/002367781780958577.
Morgavi, D. P., H. Boudra, and J. P. Jouany. 2008. “Consequences of Mycotoxins in Ruminant Production.”
In Mycotoxins in Farm Animals, edited by I Oswald and I. P.;Taranu, 29–46.
Morgavi, D.P., and R.T. Riley. 2007. “An Historical Overview of Field Disease Outbreaks Known or
Suspected to Be Caused by Consumption of Feeds Contaminated with Fusarium Toxins.” Animal Feed
Science and Technology 137 (3-4) (October): 201–212. doi:10.1016/j.anifeedsci.2007.06.002.
Moss, S F, L Attia, J V Scholes, J R Walters, and P R Holt. 1996. “Increased Small Intestinal Apoptosis in
Coeliac Disease.” Gut 39 (6): 811–817. doi:10.1136/gut.39.6.811.
Nahm, K. H. 1995. “Possibilities for Preventing Mycotoxicosis in Domestic Fowl.” World’s Poultry Science
Journal 51 (2) (July 1): 177–185. doi:10.1079/WPS19950012.
Nejdfors, P, M Ekelund, B Jeppsson, and B R Weström. 2000. “Mucosal in Vitro Permeability in the
Intestinal Tract of the Pig, the Rat, and Man: Species- and Region-Related Differences.” Scandinavian
Journal of Gastroenterology 35 (5): 501–507.
Nietfeld, J. C., D. E. Tyler, L. R. Harrison, J. R. Cole, K. S. Latimer, and W. A. Crowell. 1991. “Culture and
Morphologic Features of Small Intestinal Mucosal Explants from Weaned Pigs.” American Journal of
Veterinary Research 52 (7): 1142–1146.
Norred, W.P., K.A. Voss, C.W. Bacon, and R.T. Riley. 1991. “Effectiveness of Ammonia Treatment in
Detoxification of Fumonisin-Contaminated Corn.” Food and Chemical Toxicology 29 (12) (January):
815–819. doi:10.1016/0278-6915(91)90108-J.
Oguz, Halis. 2011. “A Review from Experimental Trials on Detoxification of Aflatoxin in Poultry Feed.”
Journal of Veterinary Sciences 27 (1): 1–12. http://eurasianjvetsci.org/pdf/pdf_EJVS_540.pdf.
Oswald, I P, D E Marin, S Bouhet, P Pinton, I Taranu, and F Accensi. 2005a. “Immunotoxicological Risk of
Mycotoxins for Domestic Animals.” Food Additives and Contaminants 22 (4): 354–360.
doi:10.1080/02652030500058320.
Oswald, Isabelle P, Clarisse Desautels, Sylvie Fournout, Sylvie Y Peres, Marielle Odin, Pierrette Le Bars,
Joseph Le Bars, John M Fairbrother, and Saint Hyacinthe. 2003. “Mycotoxin Fumonisin B 1 Increases
Intestinal Colonization by Pathogenic Escherichia Coli in Pigs” 69 (10): 5870–5874.
doi:10.1128/AEM.69.10.5870–5874.2003.
Oswald, Isabelle P. 2006. “Role of Intestinal Epithelial Cells in the Innate Immune Defence of the Pig
Intestine.” Veterinary Research. doi:10.1051/vetres:2006006.
132
Osweiler, G D. 2000. “Mycotoxins. Contemporary Issues of Food Animal Health and Productivity.” The
Veterinary Clinics of North America. Food Animal Practice 16 (3) (November): 511–30, vii.
http://www.ncbi.nlm.nih.gov/pubmed/11084990.
Osweiler, Gary D. 1986. “Occurrence and Clinical Manifestations of Trichothecene Toxicoses and
Zearalenone Toxicoses.” In Diagnosis of Mycotoxicoses, edited by J. L. Richard and J. R. Thurston,
31–42. Springer Netherlands. doi:10.1007/978-94-009-4235-6_3.
Park, D L. 1993. “Perspectives on Mycotoxin Decontamination Procedures.” Food Additives and
Contaminants 10 (1): 49–60. doi:10.1080/02652039309374129.
Pernthaner, A., W. Cabaj, R. J. Shaw, B. Rabel, C. L. Shirer, M. Stankiewicz, and P. G C Douch. 1996. “The
Immune Response of Sheep Surgically Modified with Intestinal Loops to Challenge with
Trichostrongylus Colubriformis.” International Journal for Parasitology 26 (4): 415–422.
doi:10.1016/0020-7519(96)00004-5.
Pestka, James J. 2010. “Deoxynivalenol: Mechanisms of Action, Human Exposure, and Toxicological
Relevance.” Archives of Toxicology 84 (9) (September): 663–79. doi:10.1007/s00204-010-0579-8.
Pestka, James J. 2008. “Mechanisms of Deoxynivalenol-Induced Gene Expression and Apoptosis.” Food
Additives & Contaminants: Part A 25 (9) (September): 1128–1140. doi:10.1080/02652030802056626.
Pestka, James J. 2007. “Deoxynivalenol: Toxicity, Mechanisms and Animal Health Risks.” Animal Feed
Science and Technology 137 (3-4) (October): 283–298. doi:10.1016/j.anifeedsci.2007.06.006.
Pestka, James J, and Alexa T Smolinski. 2005. “Deoxynivalenol: Toxicology and Potential Effects on
Humans.” Journal of Toxicology and Environmental Health. Part B, Critical Reviews 8 (1): 39–69.
doi:10.1080/10937400590889458.
Pestka, James J, Hui-Ren Zhou, Y Moon, and Y J Chung. 2004. “Cellular and Molecular Mechanisms for
Immune Modulation by Deoxynivalenol and Other Trichothecenes: Unraveling a Paradox.” Toxicology
Letters 153 (1) (October 10): 61–73. doi:10.1016/j.toxlet.2004.04.023.
Phillips, Timothy D., Shawna L. Lemke, and Patrick G. Grant. 2002. “Characterization of Clay-Based
Enterosorbents for the Prevention of Aflatoxicosis.” In Mycotoxins and Food Safety, edited by Jonathan
W. DeVries, Mary W. Trucksess, and Lauren S. Jackson, 157–171. Springer US. doi:10.1007/978-1-
4615-0629-4_16.
Pienaar, J G, T S Kellerman, and W F Marasas. 1981. “Field Outbreaks of Leukoencephalomalacia in Horses
Consuming Maize Infected by Fusarium Verticillioides (= F. Moniliforme) in South Africa.” Journal of
the South African Veterinary Association 52 (1) (March): 21–4.
http://www.ncbi.nlm.nih.gov/pubmed/7265095.
Pinton, Philippe, Francesc Accensi, Erwan Beauchamp, Anne-Marie Cossalter, Patrick Callu, François
Grosjean, and Isabelle P Oswald. 2008. “Ingestion of Deoxynivalenol (DON) Contaminated Feed
Alters the Pig Vaccinal Immune Responses.” Toxicology Letters 177 (3) (April 1): 215–22.
doi:10.1016/j.toxlet.2008.01.015.
Pinton, Philippe, Jean-Philippe Nougayrède, Juan-Carlos Del Rio, Carolina Moreno, Daniela E Marin,
Laurent Ferrier, Ana-Paula Bracarense, Martine Kolf-Clauw, and Isabelle P Oswald. 2009. “The Food
133
Contaminant Deoxynivalenol, Decreases Intestinal Barrier Permeability and Reduces Claudin
Expression.” Toxicology and Applied Pharmacology 237 (1) (May 15): 41–8.
doi:10.1016/j.taap.2009.03.003.
Pinton, Philippe, and Isabelle P. Oswald. 2014. “Effect of Deoxynivalenol and Other Type B Trichothecenes
on the Intestine: A Review.” Toxins 6 (5): 1615–1643. doi:10.3390/toxins6051615.
Pinton, Philippe, Dima Tsybulskyy, Joelma Lucioli, Joëlle Laffitte, Patrick Callu, Faouzi Lyazhri, François
Grosjean, Ana Paula Bracarense, Martine Kolf-clauw, and Isabelle P. Oswald. 2012. “Toxicity of
Deoxynivalenol and Its Acetylated Derivatives on the Intestine: Differential Effects on Morphology,
Barrier Function, Tight Junction Proteins, and Mitogen-Activated Protein Kinases.” Toxicological
Sciences 130 (1): 180–190. doi:10.1093/toxsci/kfs239.
Pitt, John I., and Ailsa D. Hocking. 2009. Fungi and Food Spoilage. Boston, MA: Springer US.
doi:10.1007/978-0-387-92207-2. http://link.springer.com/10.1007/978-0-387-92207-2.
Prelusky, D.B., R.M.G. Hamilton, H.L. Trenholm, and J.D. Miller. 1986. “Tissue Distribution and Excretion
of Radioactivity Following Administration of 14C-Labeled Deoxynivalenol to White Leghorn hens*1.”
Fundamental and Applied Toxicology 7 (4) (November): 635–645. doi:10.1016/0272-0590(86)90113-
2.
Rai, Mahendra, and Ajit Varma. 2010. Mycotoxins in Food, Feed and Bioweapons. Berlin Heidelberg:
Springer Verlag.
Raisbeck, M.F., G.E. Rottinghaus, and J.D. Kendall. 1991. “Effects of Naturally Occurring Mycotoxins on
Ruminants.” In Mycotoxins and Animal Foods, edited by J.E. Smith and R.S. Henderson, 647–677.
Boca Raton: CRC Press.
Ramos, A.J., and E. Hernández. 1997. “Prevention of Aflatoxicosis in Farm Animals by Means of Hydrated
Sodium Calcium Aluminosilicate Addition to Feedstuffs: A Review.” Animal Feed Science and
Technology 65 (1-4) (April): 197–206. doi:10.1016/S0377-8401(96)01084-X.
Ramos, Antonio-Javier; Fink-Gremmels, Johana; Hernández, Enrique. 1996. “Prevention of Toxic Effects of
Mycotoxins by Means of Nonnutritive Adsorbent Compounds.” Journal of Food Protection 59 (6):
631–641. http://www.ingentaconnect.com/content/iafp/jfp/1996/00000059/00000006/art00012.
Rasmussen, P H, F Ghorbani, and T Berg. 2003. “Deoxynivalenol and Other Fusarium Toxins in Wheat and
Rye Flours on the Danish Market.” Food Additives and Contaminants 20 (4): 396–404.
doi:10.1080/0265203031000082495.
Reddy, Krn, B Salleh, B Saad, Hk Abbas, Ca Abel, and Wt Shier. 2010. “An Overview of Mycotoxin
Contamination in Foods and Its Implications for Human Health.” Toxin Reviews 29 (1) (March): 3–26.
doi:10.3109/15569541003598553.
Richard, John L. 2008. “DISCOVERY OF AFLATOXINS AND SIGNIFICANT HISTORICAL
FEATURES.” Toxin Reviews 27 (3-4) (January): 171–201. doi:10.1080/15569540802462040.
Rocha, O, K Ansari, and F M Doohan. 2005. “Effects of Trichothecene Mycotoxins on Eukaryotic Cells: A
Review.” Food Additives and Contaminants 22 (4): 369–378. doi:10.1080/02652030500058403.
134
Rodrigues, Inês, and Karin Naehrer. 2012. “A Three-Year Survey on the Worldwide Occurrence of
Mycotoxins in Feedstuffs and Feed.” Toxins 4 (9) (September): 663–75. doi:10.3390/toxins4090663.
Rodrigues, I. and Naehrer, K. 2011. “Biomin Survey 2010 : Mycotoxins Inseparable from Animal
Commodities and Feed.” AllAboutFeed 2 (2): 17–20. Mycotoxins are, more frequently than not,.
Rothkötter, H J, E Sowa, and R Pabst. “The Pig as a Model of Developmental Immunology.” Human &
Experimental Toxicology 21 (9-10): 533–536. doi:10.1191/0960327102ht293oa.
Rotter, Barbara A, Dan B Prelusky, and James J Pestka. 1996. “Toxicology of Deoxynivalenol (vomitoxin).”
Journal of Toxicology and Environmental Health 48 (1): 1–34. doi:10.1080/009841096161447.
Royaee, Atabak R., Robert J. Husmann, Harry D. Dawson, Gabriela Calzada-Nova, William M. Schnitzlein,
Federico a. Zuckermann, and Joan K. Lunney. 2004. “Deciphering the Involvement of Innate Immune
Factors in the Development of the Host Response to PRRSV Vaccination.” Veterinary Immunology and
Immunopathology 102 (3): 199–216. doi:10.1016/j.vetimm.2004.09.018.
Russel, W.M.S., and R.L Burch. 1959. The Principles of Human Experimental Technique. London, UK:
Methuen.
Ryu, JAE CHUN, Kohichiro Ohtsubo, Naotaka Izumiyama, Kenichi Nakamura, Toshitsugu Tanaka, Hisashi
Yamamura, and Yoshio Ueno. 1988. “The Acute and Chronic Toxicities of Nivalenol in Mice.”
Toxicological Sciences 11 (1): 38–47. doi:10.1093/toxsci/11.1.38.
Schaafsma, A W, J D Miller, and D C Hooker. 2001. “Molecular and Physiological Pathology Agronomic
Considerations for Reducing Deoxynivalenol in Wheat Grain.” In , 285:279–285.
Schatzmayr, G, and E Streit. 2013. “Global Occurrence of Mycotoxins in the Food and Feed Chain: Facts
and Figures.” World Mycotoxin Journal 6 (3): 213–222. doi:10.3920/WMJ2013.1572.
Schatzmayr, G., and E. Streit. 2013. “Global Occurrence of Mycotoxins in the Food and Feed Chain: Facts
and Figures.” World Mycotoxin Journal 6 (3) (August 1): 213–222. doi:10.3920/WMJ2013.1572.
Schatzmayr, Gerd, Florian Zehner, Martin Täubel, Dian Schatzmayr, Alfred Klimitsch, Andreas Paul
Loibner, and Eva Maria Binder. 2006. “Microbiologicals for Deactivating Mycotoxins.” Molecular
Nutrition & Food Research 50 (6) (May): 543–51. doi:10.1002/mnfr.200500181.
Schollenberger, Margit, H. M. Müller, Melanie Rüfle, Sybille Suchy, Susanne Planck, and W. Drochner.
2005. “Survey of Fusarium Toxins in Foodstuffs of Plant Origin Marketed in Germany.” International
Journal of Food Microbiology 97 (3): 317–326. doi:10.1016/j.ijfoodmicro.2004.05.001.
Scholzen, Thomas, and Johannes Gerdes. 2000. “The Ki-67 Protein: From the Known and the Unknown.”
Journal of Cellular Physiology 182 (3): 311–322. doi:10.1002/(SICI)1097-
4652(200003)182:3<311::AID-JCP1>3.0.CO;2-9.
Schothorst, Ronald C., and Hans P. Van Egmond. 2004. “Report from SCOOP Task 3.2.10 ‘Collection of
Occurrence Data of Fusarium Toxins in Food and Assessment of Dietary Intake by the Population of
EU Member States’ Subtask: Trichothecenes.” Toxicology Letters 153 (1): 133–143.
doi:10.1016/j.toxlet.2004.04.045.
135
SCOOP European Union. 2003. “Reports on Tasks for Scientific Cooperation. Collection of Occurrence
Data of Fusarium Toxins in Food and Assessment of Dietary Intake by the Population of EU Member
States.”
Sergent, Thérèse, Marie Parys, Serge Garsou, Luc Pussemier, Yves Jacques Schneider, and Yvan Larondelle.
2006. “Deoxynivalenol Transport across Human Intestinal Caco-2 Cells and Its Effects on Cellular
Metabolism at Realistic Intestinal Concentrations.” Toxicology Letters 164 (2): 167–176.
doi:10.1016/j.toxlet.2005.12.006.
Severino, Lorella, Diomira Luongo, Paolo Bergamo, Antonia Lucisano, and Mauro Rossi. 2006.
“Mycotoxins Nivalenol and Deoxynivalenol Differentially Modulate Cytokine mRNA Expression in
Jurkat T Cells.” Cytokine 36 (1-2): 75–82. doi:10.1016/j.cyto.2006.11.006.
Sirot, Véronique, Jean Marc Fremy, and Jean Charles Leblanc. 2013. “Dietary Exposure to Mycotoxins and
Health Risk Assessment in the Second French Total Diet Study.” Food and Chemical Toxicology 52:
1–11. doi:10.1016/j.fct.2012.10.036.
Smith, L. E., R. J. Stoltzfus, and a. Prendergast. 2012. “Food Chain Mycotoxin Exposure, Gut Health, and
Impaired Growth: A Conceptual Framework.” Advances in Nutrition: An International Review Journal
3 (4): 526–531. doi:10.3945/an.112.002188.
Smith, T. K.; Girish, C. K. 2008. “The Effects of Feed Borne Mycotoxins on Equine Performance and
Metabolism.” In Mycotoxins in Farm Animals, edited by I. Oswald, I, P.;Taranu, 47–70.
Steyn, Pieter S., Wentzel C.A. Gelderblom, Gordon S. Shephard, and Fanie R. van Heerden. 2009.
“Mycotoxins with a Special Focus on Aflatoxins, Ochratoxins and Fumonisins.” Edited by Bryan
Ballantyne, Timothy C. Marrs, and Tore Syversen. General and Applied Toxicology (December 15).
doi:10.1002/9780470744307.gat150.
Stoev, S. D. 2008. “Mycotoxic Nephropathies in Farm Animals - Diagnostics, Risk Assessment and
Preventive Measures.” In Mycotoxins in Farm Animals, edited by I. Oswald, I, P.;Taranu, 155–195.
Strange, Richard N, and Peter R Scott. 2005. “Plant Disease: A Threat to Global Food Security.” Annual
Review of Phytopathology 43 (January): 83–116. doi:10.1146/annurev.phyto.43.113004.133839.
Streit, Elisabeth, Karin Naehrer, Inês Rodrigues, and Gerd Schatzmayr. 2013. “Mycotoxin Occurrence in
Feed and Feed Raw Materials Worldwide: Long-Term Analysis with Special Focus on Europe and
Asia.” Journal of the Science of Food and Agriculture 93 (12): 2892–2899. doi:10.1002/jsfa.6225.
Streit, Elisabeth, Gerd Schatzmayr, Panagiotis Tassis, Eleni Tzika, Daniela Marin, Ionelia Taranu, Cristina
Tabuc, et al. 2012. “Current Situation of Mycotoxin Contamination and Co-Occurrence in Animal
Feed--Focus on Europe.” Toxins 4 (10) (October): 788–809. doi:10.3390/toxins4100788.
Sugita-Konishi, Yoshiko, and Takashi Nakajima. 2010. “Nivalenol: The Mycology, Occurrence, Toxicology,
Analysis and Regulation.” In Mycotoxins in Food, Feed and Bioweapons, edited by Mahendra Rai and
Ajit Varma, 253–273. doi:10.1007/978-3-642-00725-5_15.
Swanson, S.P., C. Helaszek, W.B. Buck, H.D. Rood, and W.M. Haschek. 1988. “The Role of Intestinal
Microflora in the Metabolism of Trichothecene Mycotoxins.” Food and Chemical Toxicology 26 (10)
(January): 823–829. doi:10.1016/0278-6915(88)90021-X.
136
Sweeney, M J, and A D Dobson. 1998. “Mycotoxin Production by Aspergillus, Fusarium and Penicillium
Species.” International Journal of Food Microbiology 43 (3) (September 8): 141–58.
Sweeney, M. J.; S.; White, and A. D. W. Dobson. 2000. “Mycotoxins in Agriculture and Food Safety.” Irish
Journal of Agricultural and Food Research 39 (2): 235–244.
http://www.cabdirect.org/abstracts/20001202913.html.
Tanaka, Kenji, Hidetaka Kobayashi, Tadahiro Nagata, and Masaru Manabe. 2004. “Natural Occurrence of
Trichothecenes on Lodged and Water-Damaged Domestic Rice in Japan.” Shokuhin Eiseigaku Zasshi.
Journal of the Food Hygienic Society of Japan 45 (2): 63–66. doi:10.3358/shokueishi.45.63.
Tannous, Joanna, Rhoda El Khoury, Selma P Snini, Yannick Lippi, André El Khoury, Ali Atoui, Roger
Lteif, Isabelle P Oswald, and Olivier Puel. 2014. “Sequencing, Physical Organization and Kinetic
Expression of the Patulin Biosynthetic Gene Cluster from Penicillium Expansum.” International
Journal of Food Microbiology 189C (July 31): 51–60. doi:10.1016/j.ijfoodmicro.2014.07.028.
Taranu, I., D. E. Marin, S. Bouhet, and I. P. Oswald. 2008. “Effect of Fumonisin on the Pig.” In Mycotoxins
in Farm Animals, edited by I. Oswald, I, P.;Taranu, 91–111.
Thuvander, A, C Wikman, and I Gadhasson. 1999a. “In Vitro Exposure of Human Lymphocytes to
Trichothecenes: Individual Variation in Sensitivity and Effects of Combined Exposure on Lymphocyte
Function.” Food and Chemical Toxicology 37: 639–648.
http://www.sciencedirect.com/science/article/pii/S0278691599000381.
Tiemann, U, and S Dänicke. 2007. “In Vivo and in Vitro Effects of the Mycotoxins Zearalenone and
Deoxynivalenol on Different Non-Reproductive and Reproductive Organs in Female Pigs: A Review.”
Food Additives and Contaminants 24 (3) (March): 306–14. doi:10.1080/02652030601053626.
Trenholm, H L, R M Hamilton, D W Friend, B K Thompson, and K E Hartin. 1984. “Feeding Trials with
Vomitoxin (deoxynivalenol)-Contaminated Wheat: Effects on Swine, Poultry, and Dairy Cattle.”
Journal of the American Veterinary Medical Association 185 (5) (September 1): 527–31.
http://www.ncbi.nlm.nih.gov/pubmed/6480467.
Van der Fels-Klerx, H. J., M. C. Kandhai, S. Brynestad, M. Dreyer, T. Börjesson, H. M. Martins, M.
Uiterwijk, E. Morrison, and C. J.H. Booij. 2009. “Development of a European System for Identification
of Emerging Mycotoxins in Wheat Supply Chains.” World Mycotoxin Journal 2 (2) (May 1): 119–127.
doi:10.3920/WMJ2008.1122.
Van der Flier, Laurens G, and Hans Clevers. 2009. “Stem Cells, Self-Renewal, and Differentiation in the
Intestinal Epithelium.” Annual Review of Physiology 71: 241–260.
doi:10.1146/annurev.physiol.010908.163145.
Van Egmond, Hans P, Ronald C Schothorst, and Marco a Jonker. 2007. “Regulations Relating to
Mycotoxins in Food: Perspectives in a Global and European Context.” Analytical and Bioanalytical
Chemistry 389 (1) (September): 147–57. doi:10.1007/s00216-007-1317-9.
Van Egmond, Hans P., and G.J.A. Speijers. 1994. “Survey of Data on the Incidence of Ochratoxin A in Food
and Feed Worldwide.” Journal of Natural Toxins 3: 125–144.
137
Vandenbroucke, Virginie, Siska Croubels, An Martel, Elin Verbrugghe, Joline Goossens, Kim Van Deun,
Filip Boyen, et al. 2011. “The Mycotoxin Deoxynivalenol Potentiates Intestinal Inflammation by
Salmonella Typhimurium in Porcine Ileal Loops.” PloS One 6 (8) (January): e23871.
doi:10.1371/journal.pone.0023871.
Vereecke, Lars, Rudi Beyaert, and Geert van Loo. 2011. “Enterocyte Death and Intestinal Barrier
Maintenance in Homeostasis and Disease.” Trends in Molecular Medicine 17 (10): 584–593.
doi:10.1016/j.molmed.2011.05.011.
Versilovskis, Aleksandrs, and Sarah De Saeger. 2010. “Sterigmatocystin: Occurrence in Foodstuffs and
Analytical Methods--an Overview.” Molecular Nutrition & Food Research 54 (1) (January): 136–47.
doi:10.1002/mnfr.200900345.
Visconti, Angelo, Edith Miriam Haidukowski, Michelangelo Pascale, and Marco Silvestri. 2004. “Reduction
of Deoxynivalenol during Durum Wheat Processing and Spaghetti Cooking.” Toxicology Letters 153
(1) (October 10): 181–9. doi:10.1016/j.toxlet.2004.04.032.
Visconti, Angelo, Giancarlo Perrone, Giuseppe Cozzi, and Michele Solfrizzo. 2008. “Managing Ochratoxin
A Risk in the Grape-Wine Food Chain.” Food Additives & Contaminants. Part A, Chemistry, Analysis,
Control, Exposure & Risk Assessment 25 (2) (February): 193–202. doi:10.1080/02652030701744546.
Von Der Hardt, Katharina, Michael Andreas Kandler, Ludger Fink, Ellen Schoof, Jörg Dötsch, Olga
Brandenstein, Rainer Maria Bohle, and Wolfgang Rascher. 2004. “High Frequency Oscillatory
Ventilation Suppresses Inflammatory Response in Lung Tissue and Microdissected Alveolar
Macrophages in Surfactant Depleted Piglets.” Pediatric Research 55 (2): 339–346.
doi:10.1203/01.PDR.0000106802.55721.8A.
Voss, K.A., G.W. Smith, and W.M. Haschek. 2007. “Fumonisins: Toxicokinetics, Mechanism of Action and
Toxicity.” Animal Feed Science and Technology 137 (3-4) (October): 299–325.
doi:10.1016/j.anifeedsci.2007.06.007.
Wan, Lam Yim Murphy, Paul C. Turner, and Hani El-Nezami. 2013. “Individual and Combined Cytotoxic
Effects of Fusarium Toxins (deoxynivalenol, Nivalenol, Zearalenone and Fumonisins B1) on Swine
Jejunal Epithelial Cells.” Food and Chemical Toxicology 57: 276–283. doi:10.1016/j.fct.2013.03.034.
http://dx.doi.org/10.1016/j.fct.2013.03.034.
Watson, A J M. 1995. “Necrosis and Apoptosis in the Gastrointestinal Tract.” Gut 37 (2): 165–167.
doi:10.1136/gut.37.2.165.
Wawrzyniak, J, and a Waśkiewicz. 2014. “Ochratoxin A and Citrinin Production by Penicillium Verrucosum
on Cereal Solid Substrates.” Food Additives & Contaminants. Part A, Chemistry, Analysis, Control,
Exposure & Risk Assessment 31 (1) (January): 139–48. doi:10.1080/19440049.2013.861933.
Weaver, G A, H J Kurtz, J C Behrens, T S Robison, B E Seguin, F Y Bates, and C J Mirocha. 1986. “Effect
of Zearalenone on the Fertility of Virgin Dairy Heifers.” American Journal of Veterinary Research 47
(6) (June): 1395–7. http://www.ncbi.nlm.nih.gov/pubmed/2942065.
138
Werner, Jens Martin, and Hans Jürgen Steinfelder. 2008. “A Microscopic Technique to Study Kinetics and
Concentration-Response of Drug-Induced Caspase-3 Activation on a Single Cell Level.” Journal of
Pharmacological and Toxicological Methods 57 (2): 131–137. doi:10.1016/j.vascn.2007.11.001.
Whitaker, T B. 2006. “Sampling Foods for Mycotoxins.” Food Additives and Contaminants 23 (1) (January):
50–61. doi:10.1080/02652030500241587.
WHO (World Health Organization). 2000. “Fumonisin B1.” In Environmental Health Criteria 219, edited by
W.H.O. Marasas, J.D. Miller, R.T. Riley, and A. Visconti. Geneva.
http://whqlibdoc.who.int/ehc/WHO_EHC_219.pdf.
Wild, C P, and P C Turner. 2002. “The Toxicology of Aflatoxins as a Basis for Public Health Decisions.”
Mutagenesis 17 (6) (November): 471–81. http://www.ncbi.nlm.nih.gov/pubmed/12435844.
Wild, C. P., and Y. Y. Gong. 2010. “Mycotoxins and Human Disease: A Largely Ignored Global Health
Issue.” Carcinogenesis 31 (1) (October 29): 71–82. doi:10.1093/carcin/bgp264.
Wild, Christopher P., and Yun Yun Gong. 2009. “Mycotoxins and Human Disease: A Largely Ignored
Global Health Issue.” Carcinogenesis. doi:10.1093/carcin/bgp264.
Woodward, David. 2010. “Great Wealth Poor Health: Contemporary Issues in Eating and Living.” Nutrition
& Dietetics 67 (3) (August 25): 202–202. doi:10.1111/j.1747-0080.2010.01457.x.
Wu, F., D. Bhatnagar, T. Bui-Klimke, I. Carbone, R. Hellmich, G. Munkvold, P. Paul, G. Payne, and E.
Takle. 2011. “Climate Change Impacts on Mycotoxin Risks in US Maize.” World Mycotoxin Journal 4
(1) (January 1): 79–93. doi:10.3920/WMJ2010.1246.
Wu, Miaomiao, Hao Xiao, Wenkai Ren, Jie Yin, Bie Tan, Gang Liu, Lili Li, Charles Martin Nyachoti, Xia
Xiong, and Guoyao Wu. 2014. “Therapeutic Effects of Glutamic Acid in Piglets Challenged with
Deoxynivalenol.” PLoS ONE 9 (7): 1–12. doi:10.1371/journal.pone.0100591.
Wu, Wenda, Brenna M. Flannery, Yoshiko Sugita-Konishi, Maiko Watanabe, Haibin Zhang, and James J.
Pestka. 2012. “Comparison of Murine Anorectic Responses to the 8-Ketotrichothecenes 3-
Acetyldeoxynivalenol, 15-Acetyldeoxynivalenol, Fusarenon X and Nivalenol.” Food and Chemical
Toxicology 50 (6): 2056–2061. doi:10.1016/j.fct.2012.03.055.
Xiao, H., B. E. Tan, M. M. Wu, Y. L. Yin, T. J. Li, D. X. Yuan, and L. Li. 2013. “Effects of Composite
Antimicrobial Peptides in Weanling Piglets Challenged with Deoxynivalenol: II. Intestinal Morphology
and Function.” Journal of Animal Science 91 (10): 4750–4756. doi:10.2527/jas2013-6427.
Yamagata, Kazuo, Motoki Tagami, Fumio Takenaga, Yukio Yamori, and Shingo Itoh. 2004. “Hypoxia-
Induced Changes in Tight Junction Permeability of Brain Capillary Endothelial Cells Are Associated
with IL-1beta and Nitric Oxide.” Neurobiology of Disease 17 (3): 491–499.
doi:10.1016/j.nbd.2004.08.001.
Yamamura, H, T Kobayashi, J C Ryu, Y Ueno, K Nakamura, N Izumiyama, and K Ohtsubo. 1989.
“Subchronic Feeding Studies with Nivalenol in C57BL/6 Mice.” Food and Chemical Toxicology : An
International Journal Published for the British Industrial Biological Research Association 27 (9): 585–
590. doi:10.1016/0278-6915(89)90017-3.
139
Yazar, Selma, and Gülden Z. Omurtag. 2008. “Fumonisins, Trichothecenes and Zearalenone in Cereals.”
International Journal of Molecular Sciences 9 (11): 2062–2090. doi:10.3390/ijms9112062.
Zachary, James F, and M Donald McGavin. 2012. Pathologic Basis of Veterinary Diseases. 5th ed. Missouri,
USA: Penny Rudolph.
Zhang, Xiaoou, Liping Jiang, Chengyan Geng, Jun Cao, and Laifu Zhong. 2009. “The Role of Oxidative
Stress in Deoxynivalenol-Induced DNA Damage in HepG2 Cells.” Toxicon 54 (4): 513–518.
doi:10.1016/j.toxicon.2009.05.021.
Zhou, Hui Ren, Zahidul Islam, and James J. Pestka. 2003. “Rapid, Sequential Activation of Mitogen-
Activated Protein Kinases and Transcription Factors Precedes Proinflammatory Cytokine mRNA
Expression in Spleens of Mice Exposed to the Trichothecene Vomitoxin.” Toxicological Sciences 72
(1): 130–142. doi:10.1093/toxsci/kfg006.
Zinedine, Abdellah, Jose Miguel Soriano, Juan Carlos Moltó, and Jordi Mañes. 2007. “Review on the
Toxicity, Occurrence, Metabolism, Detoxification, Regulations and Intake of Zearalenone: An
Oestrogenic Mycotoxin.” Food and Chemical Toxicology : An International Journal Published for the
British Industrial Biological Research Association 45 (1) (January): 1–18.
doi:10.1016/j.fct.2006.07.030.
140
Appendixes
A. Animal experiment
Table A1. Composition of the experimental diets (%, g.kg-1 or kcal.kg-1 based on a DM content of 88%); ARVALISADAESO-ITP 2002 Ctrl DON DON+NIV DON+ Composition (%)
Uncontaminated Wheat Galopin 46.95 - 49.08 - Contaminated Wheat 17885 ++ 13.98 36.45 Contaminated maize 10-19077 - - 25.00 - Contaminated Wheat 17828 - 47.00 - 24.00 Uncontaminated Corn 18469 25.00 10.00 - 11.00 Soybean meal 48 21.00 22.00 18.80 21.50 Lysine HCL 0.57 0.55 0.63 0.56 L-Threonine 0.25 0.25 0.25 0.25 DL-Methionine 0.18 0.18 0.18 0.20 L-Tryptophan 0.05 0.04 0.06 0.04 Vitamins and minerals premix 4.00 4.00 4.00 4.00 Soybean oil 2.00 2.00 2.00 2.00
Nutrients (%DM) Dry matter 872.6 882.4 874.0 877.2 Total nitrogen 171.4 172.5 173.9 171.1 Crude fiber 23.7 24.2 23.3 23.9 Starch (Ewers methods) 442.0 435.3 446.4 434.9 Crude Fat 36.2 32.9 36.6 33.1 Minerals 59.4 60.7 58.4 60.3 Calcium 12.8 12.7 12.7 12.8 Phosphor 6.8 7.0 6.8 7.0 Digestible Energy 3437 3471 3456 3450 Net energy 2502 2515 2517 2503 Net energy (g4) 2494 2507 2507 2494 Total nitrogen/Net energy (g4) 69 69 69 69 LysineT 12.5 12.5 12.4 12.5 LysineD 11.5 11.5 11.5 11.5 LysineD/Net energy (g4) (g/1000 kcal) 4.6 4.6 4.6 4.6 MethinoninD/LysinD (%) 37 36 36 38 Methionine + CysteineD/LysineD 61 60 60 62 ThreonineD/LysineD 67 67 66 66 TryptophanD/LysineD 20 20 20 19 TryptophanD /Neutral amino acid 6 6 6 6
Mycotoxins (mg.kg-1) DON 0.03 2.89 3.5 4.63 NIV <0.01 0.07 0.72 0.05 ZEA <0.01 0.01 0.08 0.045 15-acétyl DON <0.01 0.01 0.19 0.015 3-acétyl DON <0.01 <0.01 <0.01 <0.01
141
Table A2. Effect of DON and DON+NIV after 28-day repeated exposure with DON natural single- at 2.89 mg.kg-1 feed and co-contamination to DON+NIV at 3.50 mg DON+ 0.72 mg NIV.kg-1 feed on weight gain and feed intake Parameters Ctrl DON DON+NIV P-value Weight gain (kg/pig)
Average daily gain 0.51 ±0.12 0.57 ±0.10 0.49 ±0.06 0.358 Day 0 11.02 ±1.43 10.87 ±1.29 11.22 ±1.09 0.893 Day 7 13.78 ±2.16 13.20 ±1.4 13.20 ±1.55 0.800 Day 14 16.93 ±2.79 17.30 ±2.39 16.38 ±1.49 0.787 Day 21 20.95 ±3.32 21.90 ±3.03 20.40 ±1.64 0.644 Day 28 25.27 ±4.71 26.53 ±3.81 24.75 ±2.16 0.699
Feed intake (kg/pig) Average weekly intake 6.15 ±1.18 6.43 ±1.88 5.72 ±1.52 0.815 Day 7 4.63 4.12 3.65 N/a Day 14 5.80 5.70 5.60 N/a Day 21 7.05 7.72 6.47 N/a Day 28 7.13 8.17 7.17 N/a
- Data presented as mean ± standard deviation (SD), ANOVA - N/a: not assessable - Weight gain or feed intake, n= 6 pigs
Table A3. Effect of DON and DON+NIV after 28-day repeated exposure with DON natural single- at 2.89 mg.kg-1 feed and co-contamination to DON+NIV at 3.50 mg DON+ 0.72 mg NIV.kg-1 feed on blood biochemistry Parameters Ctrl DON DON+NIV P-value Total protein (g/L)
Day 0 54.33 ±5.43 48.33 ±1.70 50.82 ±2.05 0.060kw Day 28 61.10 ±3.47 63.28 ±4.61 61.00 ±3.08 0.512 % changed 13.03a ±8.54 30.92b ±8.40 20.16ab ±6.90 0,005
Albumin (g/L) Day 0 29.35 ±3.57 27.53 ±2.71 29.53 ±1.90 0.417 Day 28 34.87 ±2.60 36.27 ±2.68 34.50 ±1.78 0.422 % changed 20.28 ±17.95 32.17 ±8.67 17.37 ±11.19 0.155
Fibrinogen (g/L) Day 0 17.28 ±4.37 19.15 ±3.57 20.26 ±1.84 0.408 Day 7 20.24 ±4.10 23.07 ±2.33 22.80 ±2.62 0.293 Day 28 23.52 ±3.81 20.62 ±1.25 22.48 ±3.03 0.246 % changed 38.24 ±11.44 11.52 ±26.83 22.80 ±2.62 0.060
Gamma-glutamyl transferase (U/L) Day 0 82.17a ±32.59 52.83ab ±9.54 47.67b ±14.05 0.020 Day 28 60.17 ±17.88 69.17 ±21.99 60.50 ±18.87 0.674 % changed -20.28a ±27.78 29.59b ±24.37 31.27b ±43.26 0.025
- Data presented as mean ± standard deviation (SD), ANOVA, n=6 pigs - kw: P-value from Kruskal-Wallis test - a, b mean values with different superscripts within the same row are different at P≤0.05; Tukey’s test
142
Table A4. Effect of DON and DON+NIV after 28-day repeated exposure with DON natural single- at 2.89 mg.kg-1 feed and co-contamination to DON+NIV at 3.50 mg DON+ 0.72 mg NIV.kg-1 feed on morphometry, proliferation-cell and apoptosis-cell counts of the jejunum Parameters Ctrl DON DON+NIV P-value Morphometry
Villus height (µm) 419.4a ±95.1 481.3b ±89.9 425.2a ±103.2 <0.001kw Crypt depth (µm) 340.4a ±45.4 337.1a ±57.6 354.8b ±60.3 0.007kw Crypt-depth to villus-height ratio 0.877a ±0.25 0.742b ±0.23 0.889a ±0.25 <0.001kw
Proliferation Villus total cell 77.80a ±21.31 57.83b ±14.70 62.38b ±16.78 0.009 Villus enterocytes 50.21a ±17.82 45.06a ±13.36 39.91b ±10.71 <0.001kw Lamina propria (cell) 27.59a ±8.68 12.77b ±3.52 22.47a ±6.04 0.002kw
Apoptosis Peyer’s Patches (cell) 35.17a ±9.83 38.93b ±7.71 32.03a ±12.82 0.009kw
- Data presented as mean ± standard deviation (SD), ANOVA - kw = P-values from Kruskal-Wallis test - a, b mean values with different superscripts within the same row are different at P≤0.05; Tukey’s test or Behrens Fisher tests and Asymptotic Mann-Whitney tests - Morphometry: n= 6 pigs, 30 villi or crypt /loop; Values are mean numbers per villus or per crypt - Proliferation and apoptosis: n= 6 pigs, 20 villi or crypt/loop; Values are mean numbers per1/3 villus
tip or per 2/3 crypt base
143
B. Loops model
Table B1. Gene expressions of jejunal loops treated with 10-µM DON for 4-h in situ incubation. Genes Ctrl DON P-value
IL-1α 1 ±0.872 0.702 ±0.559 0.221 IL-1β 1 ±0.661 0.584 ±0.257 0.106w IL-6 1 ±0.471 0.583 ±0.499 0.276 IL-8 1 ±0.763 0.838 ±0.599 0.595 IL-10 1 ±0.486 1.070 ±0.613 0.632 IL12-p40 1 ±0.914 0.548 ±0.283 0.590w IL-21 1 ±0.845 0.980 ±0.603 0.923 TLR-1 1 ±0.507 1.034 ±0.263 0.784 TLR-2 1 ±1.710 0.650 ±1.220 0.254 TLR-5 1 ±0.523 0.719 ±0.185 0.267 TLR-9 1 ±0.736 0.924 ±0.569 0.606 CCL-20 1 ±2.110 0.140 ±0.106 0.787w NF-κB 1 ±0.551 0.752 ±0.231 0.178 TNF-α 1 ±0.739 0.782 ±0.281 0.556 TGF-β 1 ±0.656 1.100 ±0.834 0.845 IFN-γ 1 ±0.336 1.183 ±0.416 0.205 ALP 1 ±0.771 0.701 ±0.182 0.281w EDN-2 1 ±0.820 0.859 ±0.630 0.646 Lysozyme 1 ±1.420 0.444 ±0.541 0.229 PCNA 1 ±0.566 0.744 ±0.197 0.324 Claudin-1 1 ±0.474 0.838 ±0.366 0.551 Claudin-2 1 ±1.010 0.582 ±0.341 0.262 Claudin-3 1 ±0.997 0.990 ±0.988 0.979 Claudin-4 1 ±0.852 0.613 ±0.300 0.214 Occludin 1 ±0.250 0.808 ±0.338 0.376 E-cadherin 1 ±0.823 0.635 ±0.238 0.787w ZO-1 1 ±0.267 0.777 ±0.199 0.188
- Data presented as mean ± standard deviation (SD); n= 5 (pigs); Paired t-test - w = Wilcoxon matched pairs test
144
Table B2. DON+NIV (1:1) after 24h exposure at 10µM in loops showed higher effects on proliferation-cell and apoptosis-cell counts but not morphometry of the jejunal loops Parameters Ctrl DON DON+NIV P-value Morphometry
Villus height (µm) 339.6 ±64.5 325.5 ±55.1 341.0 ±63.5 0.175 Crypt depth (µm) 364.6 ±50.7 375.2 ±38.3 363.6 ±42.7 0.269 Crypt-depth to villus-height ratio 1.11 ±0.28 1.14 ±0.21 1.17 ±0.24 0.196
Proliferation Villus total cell 35.23a ±4.86 22.60b ±4.33 22.40b ±4.55 <0.001 Villus enterocytes 18.39a ±4.47 19.15a ±4.70 24.43b ±4.91 <0.001 Crypt enterocytes 50.54a ±4.47 50.58a ±4.70 44.53b ±4.91 0.001
Apoptosis Villus enterocyte 2.46a ±0.98 2.98b ±0.80 4.13c ±1.30 <0.001kw Lamina propria (cell) 2.38 ±0.93 2.25 ±1.16 2.03 ±0.95 0.290 kw Villus total cell 3.54a ±0.97 3.56ab ±0.94 3.96b ±0.92 0.039 kw
Ratio Enterocyte proliferation to apoptosis 9.23a ±5.71 7.08ab ±3.02 6.58b ±2.80 0.021kw Total-cell proliferation to total-cell apoptosis 10.70a ±3.54 6.75b ±2.23 5.97b ±1.92 <0.001
- Data presented as mean ± standard deviation (SD), ANOVA - kw = P-values from Kruskal-Wallis test - a, b, c mean values with different superscripts within the same row are different at P≤0.05; Tukey’s test or Behrens Fisher tests and Asymptotic Mann-Whitney tests - Morphometry: n= 2 or 4 (Ctrl) loops, 30 villi or crypt /loop; Values are mean numbers per villus or per
crypt - Proliferation and apoptosis: n= 2 or 4 (Ctrl) loops, 20 villi or crypt/loop; Values are mean numbers per1/3 villus tip or per 2/3 crypt base
Table B3. Gene expressions of jejunal loops treated with 10-µM DON for 24-h in situ incubation. Genes Ctrl DON P-value
IL-1α 1 ±0.786 0.999 ±0.243 0.998 IL-1β 1 ±1.210 0.173 ±0.118 0.541 IL-6 1 ±1.160 0.275 ±0.017 1.000w IL-8 1 ±0.666 0.393 ±0.187 0.498 IL-21 1 ±0.807 0.994 ±0.936 0.961 IL12-p40 1 ±0.205 0.703 ±0.460 0.642 TGF-β 1 ±0.317 0.605 ±0.004 0.371w Claudin-4 1 ±0.233 0.642 ±0.126 0.132
- Data presented as mean ± standard deviation (SD); n= 2 (pigs); Paired t-test - w = Wilcoxon matched pairs test
Title: Individual and combined effects of the trichothecenes deoxynivalenol and nivalenol ex
vivo and in vivo on pig intestinal mucosa
Abstract
Deoxynivalenol (DON) and nivalenol (NIV), major fusariotoxins and worldwide cereal
contaminants, raise concerns for intestinal health. The impact of DON and NIV on pig intestinal
mucosa was investigated after acute exposure on jejunal explants after 4 hours (0 to 10 µM), on
jejunal loops after 4 hours and 24 hours (0 to 10 µM), and after 28-day natural contamination
feeding of animals. On explants, dose-dependent increases in the histological changes were
induced. The decrease in the overall proliferative villus cells was concordant between animal
experiment and loops, reaching after 4 hours in loops 13% and 30%, and after 24 hours 35 and 40
% for DON and NIV respectively, at 10 µM. In loops, villus apoptosis increased after DON and
NIV at 10 µM. After 24 hours, apoptotic enterocytes increased dose-dependently by DON, NIV, or
the combination DON+NIV (1:1). The interaction analysis showed synergism between DON and
NIV for villus enterocyte apoptosis.
Keywords: mycotoxins; intestinal health; loops; enterocytes; cell proliferation; apoptosis;
deoxynivalenol; nivalenol
AUTEUR : Sophal CHEAT
TITRE : Etudes ex vivo et in vivo des effets des trichothécènes déoxynivalenol et nivalénol,
seuls ou combinés, sur la muqueuse digestive du porc
DIRECTEUR DE THESE : Pr. Martine KOLF-CLAUW
LIEU ET DATE DE SOUTENANCE : Ecole Nationale Vétérinaire de Toulouse, 08 juillet
2015
RESUME :
Déoxynivalenol (DON) et nivalénol (NIV), fusariotoxines majeures des céréréales peuvent
endommager l’intestin. Les effets de DON et NIV sur la muqueuse intestinale ont été étudiés
chez le porc, après exposition aigüe d’explants jéjunaux après 4 heures (0 à 10 µM), d’anses
jéjunales après 4 et 24 heures (0 à 10 µM), et après exposition d’animaux pendant 28 jours, à
des aliments naturellement contaminés. Ex vivo sur les explants, des modifications
histologiques dose-dépendantes ont été induites. In vivo, la diminution du nombre de cellules
villositaires en prolifération a été concordante pour les anses jejunales et chez les animaux,
atteignant, pour DON et NIV respectivement, 13 et 30% après 4h, et après 24 heures 35% et
40%, à 10 µM. Dans les anses, l’apoptose a été induite au niveau des villosités à 10µM de
DON et de NIV. Après 24 heures, le nombre d’entérocytes apoptotiques a augmenté de façon
dose dépendante avec DON, NIV, et DON+NIV (1:1), et l’analyse d’interaction a montré une
synergie pour ce paramètre.
MOTS-CLES: Mycotoxines, santé digestive, anses, entérocytes, prolifération cellulaire,
apoptosis, deoxynivalénol, nivalénol
DISCIPLINE ADMINISTRATIVE : Pathologie, Toxicologie, Génétique et Nutrition
INTITULE ET ADRESSE DU LABORATOIRE :
Equipe de BioToMyc: Biosynthèse & Toxicité des Mycotoxines
UMR INRA-INPT-UPS 1331 Toxalim
Ecole Nationale Vétérinaire
23 chemin des Capelles, BP 87614
31076 Toulouse Cedex 03, France