occurrence of mycotoxigenic fungi in maize from food...
TRANSCRIPT
Faculty of Bioscience Engineering
Academic year 2014 – 2015
Occurrence of Mycotoxigenic Fungi in Maize from Food
Commodity Markets in Kenya
Evalyne Nyakio Kibe
Promoters: Prof. dr. ir. Monica Hofte
Master’s dissertation submitted in fulfillment of the requirements for the degree of Master of Science in Nutrition and Rural Development,
Main subject: Public Health Nutrition
Copyright
“All rights reserved. The author and the promoters permit the use of this Master’s Dissertation for consulting purposes and copying of parts for personal use. However, any other use falls under the limitations of copyright regulations, particularly the stringent obligation to explicitly mention the source when citing parts out of this Master’s dissertation.”
Ghent University, August 2015
Promoter Author
Prof. dr. ir. Monica Hofte Evalyne Nyakio Kibe
........................................ ...................................
i
ABSTRACT
Maize is an important cereal crop in Kenya; it contributes to 3% of Kenya’s Gross Domestic Product
(GDP). Maize is Kenya’s staple food; hence majority of the population is potentially exposed to
chronic doses of mycotoxins in their daily diet. Maize consumption levels in Kenya are at the rate of
about 0.4kg maize/person/day; even the lowest amount of toxins consumed could lead to significant
effects. The majority of the grain is traded in informal commodity markets and usually involves small-
scale traders who buy maize from the local farmers and a few wholesale traders who transport and sell
grain within the country. The maize value chain in Kenya lacks mechanisms that ensure grain quality
and safety.
This study sought to identify toxigenic fungi and assess their potential ability to produce mycotoxins
in maize purchased from commodity markets in different agro-ecological zones of Kenya. To mitigate
and reduce the impact of mycotoxins in food and feed chain, comprehensive understanding of the
fungal ecology is critical in the development of efficient and innovative control strategies. Maize
kernel samples were collected from agricultural commodity markets in the different maize growing
agro-ecological zones in Kenya; humid, sub-humid, semi-arid and semi-arid to semi-humid. Isolates
obtained from the maize kernels were identified to species level using standard keys and molecular
markers. Their potential to form toxins was also confirmed using PCR-based assays.
The study identified Fusarium poae, Fusarium verticillioides, Fusarium boothii as the primary
mycotoxin producing fungi contaminating the maize samples. Fusarium verticillioides was found to
be predominant (33%), followed by Fusarium boothii (17%) and Fusarium poae (12%). The maize
samples from the semi-arid and sub-humid zones were highly contaminated with Fusarium species.
Agro-ecological zones with high infection levels of Fusarium species had low levels of Lasiodiplodia
theobromae, Mucor nidicola, and Nigrospora oryzae. Fusarium boothii and Fusarium poae were
identified as DON and NIV-producers respectively using PCR-based diagnosis. The mycotoxin-
producing Fusarium species identified in this study belong to the FGSC and the FFSC groups which
are known to contaminate maize with trichothecenes and fumonisins respectively. Multiple
contaminations of maize in different Fusarium species suggest a potential risk of maize contamination
with various mycotoxins. Multiple mycotoxins may have synergistic toxicity that is greater than the
total toxicity of each mycotoxin.
ii
AKNOWLEGDEMENTS
First and foremost I would like to express my profound gratitude to my promoter Prof.dr. ir. Monica
Hofte. The work presented in this dissertation is a testament of her invaluable advice, foresight,
patience, and dedication. I would also like to thank Ilse Delaere and Kris Audenaert for the most
productive correspondence I had during the research study, their input was invaluable. I wish them
unending success in their exemplary professional life.
All this would not have been possible without the generous financial support from the Vlaamse
Interuniversitaire Raad - University Development Cooperation (VLIR-UOS).
I am truly grateful for giving me this opportunity to study at the Ghent University.
To my colleagues from the Laboratory of Phytopathology, I say thank you for all the support. I do
hope everyone remains successful in their individual endeavors and continue to contribute as a unified
group in making the laboratory even more successful than it already is.
Special thanks to very dedicated Annie- Marie Remaut and Marian Mareen for their continued support
throughout my study and stay at the University of Ghent.
To the Kibe’s, my brothers, sister and my dear parents’; words will never be able to explain my
gratitude for your unconditional love, support and encouragement fully. I am indebted to the
unconditional friendships of Jelle De Cauwer, Linet Nkirote, and Gladwell Ngiru. May we continue to
encourage and challenge each other to be the best at what we do and who we are.
In fair honesty, it is impossible to mention everyone I am immensely indebted to for their help in and
outside of the study. To those I did not mention, thank you and may you be blessed with only the best
in your lives.
Thank you
Dank U wel
Asante
iii
TABLE OF CONTENTS
ABSTRACT i
AKNOWLEGDEMENTS ii
TABLE OF CONTENTS iii
LIST OF TABLES v
LIST OF FIGURES vi
LIST OF ABBREVIATIONS vii
1 CHAPTER ONE: INTRODUCTION 1
1.1 Background information 1
1.2 Overview of the Study Area 2
1.3 Rationale of the Study 3
1.4 Research Objectives 4
1.4.1 Main Objective 4
1.4.2 Specific Objectives 4
2 CHAPTER TWO: LITERATURE REVIEW 5
2.1 Global Importance of Maize 5
2.2 Importance of Maize in Kenya 6
2.3 Post-Harvest Losses in Maize 8
2.3.1 Postharvest Losses in Maize in Kenya 10
2.3.2 The Role of Fungi in Postharvest Losses in Maize 12
2.4 Important Mycotoxins in Cereal Grain 13
2.4.1 Fusarium Toxins 14
2.4.2 Aflatoxins 18
2.4.3 Ochratoxins 20
2.5 Mycotoxin Problem in Africa 21
2.5.1 Fusarium in Africa 22
2.6 Food Safety and Health Hazard Implications Associated with Mycotoxins 24
2.7 Mitigation Strategies for Mycotoxins 27
2.7.1 Reducing Mycotoxin Exposure 28
iv
2.7.2 Biological Control Strategies- The Aflasafe Project 31
3 CHAPTER THREE: MATERIALS AND METHODS 33
3.1 Sampling Strategy 33
3.2 Media Preparation 34
3.3 Isolation and Identification of Fungal Pathogens 35
3.4 Molecular Analysis 36
3.4.1 DNA Extraction 36
3.4.2 PCR Amplification 36
3.5 Screening for the ability to produce Mycotoxins 38
3.5.1 PCR Diagnosis for Chemotypes 38
3.5.2 FGSC synthesis of Trichothecenes 39
3.5.3 Fumonisin B, A, C Production in Fusarium verticillioides 40
4 CHAPTER FOUR: RESULTS 41
4.1 Distribution of Pathogenic Fungi in Kenya 41
4.2 Isolates and Morphological Characteristics 43
4.3 Molecular Analysis 45
4.3.1 PCR Amplification 45
4.3.2 Screening for the ability to produce Mycotoxins 48
5 CHAPTER FIVE: DISCUSSION 49
6 CHAPTER SIX: CONCLUSIONS AND RECOMMENDATIONS 52
LIST OF REFERENCES 54
v
LIST OF TABLES
Table 2-1 Average Maize Production 2005-2010 7
Table 2-2 Phytopathogenic Fusarium Species and their Mycotoxins 17
Table 2-3 Examples of food commodities and aflatoxin contamination levels in Africa 18
Table 2-4 Aflatoxicosis in Maize consuming countries 25
Table 2-5 Carcinogenicity Risk evaluated by IARC for Fusarium Mycotoxins 26
Table 2-6 Toxicological Safe Limits for Mycotoxins 28
Table 2-7 Concentrations of some essential oils and the antioxidant resveratrol (ppm) needed for 50%
inhibition of (a) growth and ochratoxin production by Aspergillus ochraceus at different
environmental conditions 30
Table 3-1 Maize Growing Regions Sampled 33
Table 3-2 Sequence of Primers used in the PCR Amplification 36
Table 3-3 Primer designations, anticipated sizes of the PCR fragments 39
Table 4-1 Isolates Collection from agro- ecological zones in Kenya 44
Table 4-2 Pathogenic Fungi Species Identified 46
Table 4-3 Distribution of Fungi identified from sampled bags 47
vi
LIST OF FIGURES
Figure 1-1 Maize Growing Zones 2
Figure 2-1 Traditional Maize Granary (Gitonga et al., 2015) 9
Figure 2-2 Recommended Metal Silos for Maize Storage (Gitonga et al., 2015) 10
Figure 2-3 Villagers Shelling Maize in Rural Kenya 11
Figure 2-4 Mould Infested Maize Cobs 12
Figure 2-5 Important Mycotoxins in Cereal Grain (Schmidt, 2013) 13
Figure 2-6 Phylogenetic relationships of key Fusarium species (Takayuki et al., 2014) 15
Figure 2-7 Aflatoxin and disease pathways in humans (Wu, 2010) 19
Figure 2-8 How aflasafe works (IITA, 2012) 32
Figure 3-1 Agro-Ecological Zones sampled 34
Figure 3-2 (a)Plated maize kernels on PDA; (b) Fungal growth on PDA plates after 3 days of
incubation at room temperature; (c) Fungal growth after 6 days of incubation on new PDA plates; (d)
PDB well plates after 7days of incubation at 25 °C 35
Figure 3-3 Fragments from the PCR of the rDNA ITS region 37
Figure 3-4 Fragments from PCR Amplification of the TEF region 38
Figure 4-1 Distribution of Fungi species identified 41
Figure 4-2 Maps showing (a) Markets sampled (b) Distribution of Fusarium species identified in the
sub-humid and semi-arid regions 42
Figure 4-3 Chemotypes for Fusarium boothii (rep1) Ekm.001, (rep2) WBm.001b and Fusarium poae
(rep1) Mg.001, (rep2) Ekm.003H 48
vii
LIST OF ABBREVIATIONS
AcDON Mono-acetyldeoxynivalenol
AcNIV Mono-acetylnivalenol
AEZ Agro-Ecological Zones
AF Aflatoxin
APHLIS African Postharvest Losses Information System
BEA Beauvericin
CAST Council for Agricultural Science and Technology
CDC Center for Disease Control
CIMMYT International Maize and Wheat Improvement Center
DAcNIV Di-acetylnivalenol
DAS Diacetoxyscirpenol
DNA DeoxyriboNucleic Acid
DON Deoxynivalenol (Vomitoxin)
DON Deoxynivalenol
EF Elongation Factor
FAO Food Agricultural Organisation
FAOSTAT Food Agricultural Organisation Statistical Division
FB1 Fumonisin B1
FB2 Fumonisin B2
FB3 Fumonisin B3
FFSC Fusarium fujikuroi Species Complex
FGSC Fusarium graminearum Species Complex
FUC Fusarochromanone
FUM Fumonisin
FUP Fusaproliferin;
FUS Fusarenone
GDP Gross Domestic Product
HT2 HT-2 toxin
IARC International Agency for Research on Cancer
ITS Internal Transcribed Spacer
KMDP Kenya Maize Development Program
MAS Monoacetoxyscirpenol
MAS Monoacetoxyscirpenol
MLST Multilocus Sequence Typing
MOA Ministry of Agriculture
viii
MON Moniliformin
NCPB National Cereals and Produce Board
NEO Neosolaniol
NIV Nivalenol
OT Ochratoxins
PCR Polymerase Chain Reaction
PDA Potato Dextrose Agar
PDB Potato Dextrose Broth
SSA Sub-Saharan Africa
T Trichothecenes
T2 T-2 toxin
TEF Translation Elongation Factor
WHO World Health Organization
ZEA Zearalenone
ZOH Zearalenols, (α and β isomers)
1
1 CHAPTER ONE: INTRODUCTION
1.1 Background information
Maize (Zea mays L. ) is one of the most important staple food and feed crops in the world. Maize is a
popular crop in many developing countries. This is probably so, because of its ability to be applicable
in many farming systems. Maize can adapt to a broad range of environmental conditions, produces
high yields per unit of land and has a relatively good nutritive profile. Maize is a great contributor to
the enhancement of household food security in many low and middle-income countries. Its production
has been rising already the past several years but still, maize production and food production globally
have to increase even more to meet the future demands (Bekele, 2011).
The Kenyan economy is heavily dependent on agriculture, with maize as the main staple food. Maize
provides 60% of dietary calories and more than 50% of utilizable proteins to the consuming
population. Maize is cultivated predominantly by smallholder farmers in the Kenyan rural areas on an
average of two million hectares (45% of the cultivated area) and with average yields of 1.2-1.6 tons
per hectare. Unfortunately, maize produced in Kenya as many other tropical developing countries are
known to be highly vulnerable to contamination with fungal secondary metabolites, called mycotoxins.
Mycotoxins have attracted worldwide attention because of their impact on human and animal health,
animal productivity and the associated economic losses (Gitu, 2006).
Mycotoxins are known to be potential carcinogenic, mutagenic and teratogenic due to chronic
exposure. Other effects of chronic exposure to mycotoxins are impaired growth in children, neural
tube defects in unborn children and immunosuppression. Studies on reported mycotoxins linked
diseases in animals include leuko- encephalomalacia in horses and pulmonary edema in pigs, liver and
kidney cancer in mice and rats (Lewis et al., 2005).
Environmental conditions leading to fungal proliferation and mycotoxin production usually are a high
temperature, humidity and stress factors (poor soil fertility, drought and insect damage), monsoons,
unseasonal rains during harvest and floods. Also poor harvesting practices, unsuitable storage
conditions, improper transportation, marketing, and processing also contribute to fungal growth. These
environmental conditions as well as the food production chains are characteristic in most parts of
Africa where diets in these countries consist mainly of crops, primarily maize, susceptible to toxigenic
fungi and obviously their produced mycotoxins (Lewis et al., 2005).
2
This research analyzes the growth of mycotoxigenic molds and their potential ability for the
production of mycotoxins. The samples were collected from four different Agro-Ecological Zones
(AEZs) of Kenya (Humid, Sub-Humid, Semi-Arid, Semi-Arid-Sub-Humid). The fungi were isolated
and identified to species level, and the toxigenic species potential to produce mycotoxins was assessed.
1.2 Overview of the Study Area
The Kenyan economy is mainly dependent on agriculture, which accounts for 24% of the GDP in
2003. Approximately 75% of Kenyans rely on to agriculture as the primary source of livelihood, with
approximately 1.6 million hectares of land under cultivation. Figure 1-1 shows that maize is grown in
the different zones starting from the coast lowlands (1-1250 meters above sea level (masl)) to the high
potential highlands (>2100 masl), (Gitu, 2006). Other than agro-production, the sector boasts a
comparatively wide range of manufacturing industries, with food processing being the largest single
activity. About 66% of the manufacturing sector is based on agriculture, owing to the country’s
agricultural economy foundation. Small-scale farmers produce the majority of maize grown in Kenya
both for home consumption and trade. Majority of the maize grain is traded locally through informal
markets that are mostly comprised of small scale traders and a limited number of wholesalers who
move the grain within the country (Wanzala et al., 2001)
Figure 1-1 Maize Growing Zones
3
1.3 Rationale of the Study
Fungi contamination of subsistence crops like maize is a global public health problem. In Kenya, most
of the homegrown maize is consumed locally and is the principal source of mycotoxins exposure,
especially in the prone areas. The maize value chain in Kenya lacks well-established mechanisms for
ensuring grain quality and safety. A study conducted in the years 2005, 2006, and 2007 showed that 35%
of the maize sampled from local farmers exceeded the 20-ppb Kenyan regulatory limit with levels as
high as 48,000 ppb. This suggests that levels of aflatoxins found in home-grown maize in prone
regions of Kenya are exceedingly higher (60 times greater) than the maximum maize aflatoxin levels
found in other regions of the world (Daniel et al., 2011).
In Kenya, there have been numerous cases of aflatoxicosis reported since 1981 due to the consumption
of maize contaminated with Aspergillus flavus and aflatoxins. In 1981, it was reported that the cause
of the outbreak was drought and the heavy rains that came after during the harvest of homegrown
maize. In 2004, there was worst outbreak ever to be reported in Kenya, where 317 cases and 125
deaths were reported. In 2010, Kenya had about 2.3 million bags (estimated at $69 million) of maize
contaminated with mycotoxins making it unfit for both human and livestock consumption and also for
trade. This was a huge loss to the small-scale farmers who depend on the crop for food and income
(Lewis et al., 2005).
The occurrence of contaminated maize with toxigenic fungi in Kenya is endemic. Maize is the perfect
substrate for the aflatoxin-producing Aspergillus flavus, A. parasiticus, and for the fumonisin
producing Fusarium verticillioides. Aflatoxin B1 (AFB1) and fumonisin B1 (FB1) are known
carcinogens (Shephard, 2008). The aflatoxin problem in Kenya is widely acknowledged. But studies
have also reported the high prevalence of fumonisins (Wagacha et al., 2010; Mutiga et al., 2014)
suggesting that there is an urgent need for surveillance of both Aspergillus spp. and Fusarium spp. and
the establishment of intervention strategies accessible to small-scale farmers.
4
1.4 Research Objectives
1.4.1 Main Objective
The primary objective of the study is to identify mycotoxigenic fungi and assess their potential ability
to produce mycotoxins in maize sampled from agricultural commodity markets in four different agro-
ecological zones of Kenya.
1.4.2 Specific Objectives
a. To isolate fungi in stored maize kernels from the main maize growing zones in Kenya
b. To identify mycotoxigenic fungi in stored maize kernels from main agro-ecological zones of
Kenya
c. To assess fungal isolates for their ability to produce mycotoxins
5
2 CHAPTER TWO: LITERATURE REVIEW
2.1 Global Importance of Maize
Maize is the most important cereal crop in sub-Saharan Africa (SSA) and is an important staple food
in SSA and Latin America. All parts of the crop can be used for food and non-food
products. Worldwide production of maize is approximately 785 million tons, with the largest producer
being the United States, producing 42%. Africa produces 6.5% where the majority of maize
production is rain-fed. Maize is one of the most important staple food and feed crops in the world, in
developing countries it contributes directly to the enhancement of household food and nutrition
security. Maize provides at least 30% of the food calories to more than 4.5 billion people in 94
developing countries. In parts of Africa and Mesoamerica, maize alone contributes over 20% of food
calories (Gitu, 2006).
The nature of demand for maize is also changing, the demand for maize as livestock feed has grown
tremendously. This has largely been driven by rapid economic growth in highly populated regions in
Asia, the Middle East and Latin America leading to increased demand for poultry and livestock
products from more affluent consumers (Delgado, 2003). Maize grain is a crucial component in animal
feed, and this added demand has driven up prices of maize grain and made it less affordable for poor
consumers in several regions of the world. The maize feed market is growing especially in countries
such as China and India, where economic growth is enabling many to afford milk, eggs, and meat.
Rapid development in these countries is also driving up demand for maize as an industrial raw
material while maize is a crucial ingredient in the bioethanol program in the USA (Delgado, 2003).
Maize currently covers 25 million hectares in Sub-Saharan Africa, largely in smallholder systems that
produce 38 million metric tons, primarily for food. Additionally 2.8 million ha is grown in South
Africa, mainly in large-scale commercial production, much of it for animal feed (Smale et al., 2011).
Maize is the foundation for food security in some of the world’s poorest regions in Africa, Asia, and
Latin America, yet yields are often tremendously low, averaging nearly 1.5 tons per hectare,
approximately 20% of the mean yield in developed countries. Yields in low-productivity rain-fed
environments are severely limited by an array of factors, as well as abiotic and biotic stresses. Losses
due to abiotic stresses are frequently compounded by a high occurrence of diseases, insect pests and
weeds, which on an average can reduce yields by more than 30 percent (Oerke, 2006).
6
Maize diseases of global and regional significance include southern corn leaf blight (Bipolaris
maydis), southern rust (Puccinia polysora), northern corn leaf blight (Exserohilum turcicum), common
rust (Puccinia sorghi), gray leaf spot (Cercospora species), stalk and ear rots caused by Diplodia.
Fusarium, and kernel and ear rots caused by several Fusarium and Aspergillus species; which also
contaminate grain with mycotoxins thereby reducing grain quality and safety. An estimated 54 percent
of attainable yield is lost annually to diseases (16%), animals and insects (20%) and weeds (18%) in
Africa. Similar losses have been observed in Central and South America (48%) and Asia (42%; Oerke,
2006).
2.2 Importance of Maize in Kenya
Maize is the most important staple crop in Kenya contributing 3% of Kenya’s Gross Domestic Product
(GDP). 12% of the agricultural GDP and 21% of the total value of primary agricultural commodities
(MOA, 2010). According to Kenya Maize Development Program (KMDP), maize is the primary
staple food crop in the Kenyan diet with an annual per capita consumption rate of 98 kilograms
contributing about 35percent of the daily dietary energy consumption. Maize in Kenya plays an
integral role in national food security. It is the staple food crop in Kenya for both urban and rural areas
with an estimated 1.6 million hectares under cultivation. Small-scale farmers in Kenya contribute 75%
of the total maize produced in the country.
Kenya produces around 3 million tons of maize per year (Table 2-1). The quantity of maize consumed
in Kenya per person per year is high, resulting in greater possibilities of higher doses due to chronic
exposure. Approximately 98 kg translating to about 30–34 million 90 kg bags per year is consumed
per person, and in some families maize may be consumed twice daily. Each family in Kenya has a
garden if not a farm where they grow maize. This is mostly for their consumption and sometimes for
sale signifying the importance of this crop in the country (Golob, 2010).
7
Table 2-1 Average Maize Production 2005-2010
Regions Area Under Production (Ha) Production
(90Kg/bag)
Yielda
(bags/ha)
Population
Rift Valley 644,895 13,225,039 20.5 10,066,805
Nyanza 262,453 3,711,215 14.1 5,442,711
Eastern 462,401 3,903,141 8.4 5,668,123
Western 225,302 4,163,878 18.5 4,334,282
Coast 129,379 1,079,383 8.3 3,325,307
Central 157,063 1,047,879 6.7 4,383,743
North Eastern 2,525 5,520 2.2 2,310,757
Nairobi 1,053 6,420 14.4 3,138,369
a 1 bag = 90kg maize
Source: MOA, Economic Review of Agriculture, (2010)
There are several challenges affecting maize production, including frequent drought, poor extension
services, high post-harvest losses, lack of working capital to purchase yield-enhancing inputs like
fertilizer, seeds, and chemicals. Higher yields though can be achieved through different strategies.
These include the sustained adoption of high yielding varieties; optimal use of fertilizers; improved
seed quality assurance; and the intensification of research on high yielding, drought/ disease resistant
varieties (Gitu, 2006).
8
2.3 Post-Harvest Losses in Maize
Maize produced on the farm undergoes a number of procedures like harvesting, drying, threshing,
winnowing, processing, bagging, storage, transportation, and exchange beforehand then finally to the
consumer. The main role of an efficient post-harvest system is to ensure that the food reaching the
consumer fulfills the needs of the customer in terms of quality, volume, and safety. Post-harvest losses
in the developed countries normally are lower than in the developing countries. This is because of
more efficient farming systems, better transport infrastructure, better farm management, and efficient
storage and processing facilities that ensure a higher percentage of the harvested and processed foods
is delivered to the market in the most preferred quality and safety. For the low-income countries, pre-
harvesting management, processing, storage infrastructure and market facilities are either not available
or are inadequate (Adebayo, 2014).
Post-harvest loss in terms of value and consumer quality characteristics can occur at any stage
between harvest and consumption. The main causes of post-harvest losses may be physiological,
physical and environmental: excessive exposure to high ambient temperature, high crop perishability,
mechanical damage, contamination by spoilage fungal and bacteria relative humidity and rain,
invasion by birds, rodents, and insects and other pests and inappropriate handling, storage and
processing techniques. Poor infrastructure, harvesting techniques, post-harvest handling procedures,
distribution, sales, and marketing policies may aggravate losses (Abass et al., 2014).
According to Tyler (1982), the economic significance of the factors leading to high post-harvest losses
varies; from commodity to commodity, season to season, and the enormous diversity of circumstances
under which commodities are grown, harvested, stored, processed and marketed. Hell, et al., (2010)
reported that post-harvest losses are valued at US dollars ($) 1.6 billion per year. Approximately
13.5% of the US $11 billion total value of grain production in Eastern and Southern Africa alone.
Post-harvest losses in Africa are estimated to be approximate between 20 and 40%. These losses
include those which occur on the field, in storage, during processing and other marketing activities.
9
Gitonga et al., (2015) indicated that traditional storage practices shown in Figure 2-1 in African
countries cannot guarantee protection against primary storage pests and fungi. The non-existence of
suitable storage structures for grain storage and the absence of storage management technologies lead
to significant losses in grain quality. In West Africa, surveys established that farmers store their crops
in homes, on the field, in the open, jute or polypropylene bags, conical structures, raised platforms,
clay structures, and baskets. In East and Southern Africa, farmers store crops in small bags with cow
dung ash, in wood and wire cribs, pits, metal bins, wooden open-air or roofed cribs in raised platform
and roofed iron drums enclosed with mud (Wambugu et al., 2009).
Figure 2-1 Traditional Maize Granary (Gitonga et al., 2015)
Regrettably, farmers and crop handlers, especially women, do not have adequate information on
proper crop harvesting, handling and storage practices, resulting in significant damage by insect pests
and fungi during storage and marketing. Additionally, losses during crop processing are also
significant. Hodges (2012) reported harvesting, drying and threshing losses for different cereal grains
in certain regions of Africa. Losses of 3.5% and 4.5% were documented in Zambia and Zimbabwe
respectively, for maize dried on raised platforms. Threshing and shelling losses in smallholder manual
methods for Zimbabwe were estimated at 1–2.5% and 3.5%, where mechanized shelling was done.
Losses for rice during threshing were 6.5% and 6% in Madagascar and Ethiopia respectively and were
2.5% and 5% respectively during winnowing in these countries.
10
Figure 2-2 Recommended Metal Silos for Maize Storage (Gitonga et al., 2015)
Gitonga et al., (2015) study demonstrated that the adoption of metal silo technology (Figure 2-2)
among small-scale farmers was effective against maize storage pest and fungi. Its adoption also
significantly improved food security among rural households. Hence, it is important to identify best
practices and innovative arrangements for increasing maize quality and safety to improve income and
nutrition of farm households. For this reason, improving post-harvest management systems should be
a priority for farmers and policy-makers (Hodges, 2012).
2.3.1 Postharvest Losses in Maize in Kenya
Kenya had experienced remarkable improvements in maize productivity, rising from 1,530,000 metric
tons in 2002 to 3,420,000 in 2011. Though, postharvest losses of up to 40% of the harvested grain
pose significant challenges to achieving food security, as about 80% of Kenyans live in rural areas and
derive their livelihoods primarily from agricultural activities. Therefore with maize being the main
staple crop and agriculture the foundation of Kenya’s economy accounting for 27% of GDP and
generating over 75% of industrial raw materials, postharvest losses also pose a challenge to the
economic development of the country. Post-harvest losses in the country have previously been
estimated at 30% of all stored produce. However, with the advent of the lager grain borer and
mycotoxins, the loss can be 100% depending on the severity of the outbreak (CIMMYT, 2013).
11
Small-scale farmers in Kenya lack adequate information on proper crop harvesting and handling
methods, resulting in significant damage by insect pests and fungi during storage and marketing. Post-
harvest handling and processing may have a favorable effect on fungal growth and mycotoxin
production. Mechanical damage, during and after harvesting maize provides entry points for fungal
spores that may ultimately result in mycotoxin production. Figure 2-3 shows a common shelling
practice among small-scale farmers in Kenya, resulting in mechanically damaged grain, prone to
fungal contamination and mycotoxin production. Therefore, it is important for the adoption of
appropriate mitigating measures and proper post-harvest practices to reduce losses. These include;
timely harvesting, proper handling and processing, timely dusting with the recommended pesticides
using the right rates and constant inspection during storage (Kimenju et al., 2009).
Figure 2-3 Villagers Shelling Maize in Rural Kenya
12
2.3.2 The Role of Fungi in Postharvest Losses in Maize
The contamination of cereal grains by fungi (Figure 2-5) is often an additive process, which begins in
the field and potentially increases during harvest, drying and storage. Fungal growth is ranked as the
second most significant cause of grain yield loss. In addition to grain yield losses, the fungal infection
of maize has been determined to decrease the processing and nutritional quality of the grain (Miller,
2008). The extent of reduction in grain quality is logically related to the degree of fungal development.
The losses incurred as a result of fungal growth are not only of economic importance but are also of
significant public and animal health concern due to the possible production of mycotoxins by these
fungi (Golob, 2007).
Figure 2-4 Mould Infested Maize Cobs
An important classification has traditionally been made which broadly classifies the fungal
contaminators of corn and other cereals as either field (pathogenic) or storage (saprophytic) fungi.
Field fungi are those that predominate in the field and are assumed to have insignificant consequences
in the post-harvest period. Storage fungi dominate the mycoflora during storage and may also be
present on the crop during the pre-harvest period. The Fusarium spp. is considered as field fungi,
whereas the Penicillium and Aspergillus are considered as storage fungi (Bryden, 2009).
This classification, however, loses its integrity given the numerous cases worldwide where poor post-
harvest practices enable typical field fungi to become important during the storage period (CAST,
2003). Also, some fungi such as A. flavus are considered as both pathogens and saprophytes of corn.
Kenya is one of the few countries that have set regulatory limits on aflatoxins at 20ppm though a
proper regulatory framework that covers the full range of mycotoxins is still lacking (Lewis et al.,
2005).
13
2.4 Important Mycotoxins in Cereal Grain
Mycotoxins are toxic secondary metabolites produced by fungi and contaminate various agricultural
commodities either before harvest or under post-harvest conditions. Figure 2-5 show the most
important fungal species implicated in the production of mycotoxins. These are members of the genera
Aspergillus, Fusarium, and Penicillium. The most important mycotoxins produced include aflatoxin
(AF), ochratoxins (OT), deoxynivalenol (DON), zearalenone (ZEA), fumonisin (FUM) and
trichothecenes (T). Furthermore, DON, ZEA, FUM, and T are all produced by the Fusarium species
(Golob, 2007).
Figure 2-5 Important Mycotoxins in Cereal Grain (Schmidt, 2013)
The predisposing conditions for mycotoxin production relate mainly to poor hygienic practices during
transportation and storage, high temperature and moisture content and heavy rains. These conditions
are typically observed in several African countries. The demand for the storage of food substances has
been increased due to the continued population rise in the African continent. However, improper
storage, transportation, and processing facilities may facilitate fungal growth and subsequently lead to
mycotoxin production and contamination of food and feedstuffs. These food-borne mycotoxins are of
great importance (Lewis et al., 2005).
14
2.4.1 Fusarium Toxins
Many Fusarium species are soil borne and depending on the ecology, may be parasites, endophytes, or
pathogens of healthy host plants. The most important plant pathogens in the genus Fusarium belong to
the Fusarium fujikuroi, F. graminearum, F. oxysporum, and F. solani species complex. Major toxin
producers belong to the Fusarium fujikuroi and F. graminearum species complex, FFSC and FGSC
respectively (Theo et al., 2014). Fusarium fujikuroi species complex (FFSC) strains are known causal
agents for pitch canker of pine, bakanae of rice, ear rot of maize, and several species that contaminate
corn and other cereals with fumonisin mycotoxins. The F. graminearum species complex (FGSC)
strains are the primary causal agents of Fusarium head blight (FHB) of wheat and barley and
contaminate grain with trichothecene mycotoxins. F. oxysporum species complex (FOSC) strains
include vascular wilt agents of over 100 agronomically important crops; and the F. solani species
complex (FSSC) is known to include many economically destructive foot and root rot pathogens of
diverse hosts.
Figure 2-6 illustrates the phylogenetic relationships of Fusarium species based on an analysis of
O’Donell et al., (2013). Within the FGSC at least 16 species have been recognised using multi-locus
sequence typing (MLST) (Starkey et al., 2007; O’Donell et al., 2000, 2004, 2008; Yli-Mattila et al.,
2007). FGSC strains are known to cause one of the most economically devastating diseases of wheat
not only in a reduction in yield but also because they contaminate grain with trichothecene mycotoxins
such as DON and NIV. Studies conducted revealed that these morphologically defined species
comprised of several cryptic strains, the clade consisting 16 FHB species is now known as the FGSC
(FGSC, O’Donell et al., 2004).
Comparative morphological and molecular phylogenetic studies (Geiser et al., 2005; O’Donell et al.,
1998, 2000, 2004) show that the Fusarium fujikuroi species complex (FFSC) comprises of over 50
phylogenetically distinct species structured in biogeographical clades. O’Donnell et al. (1998) defined
the biogeographical origins of the FFSC strain as: As -Asian clade, Af - African clade, Am - American
clade. Members of the FFSC are capable of producing fumonisins, and a range of chemically related
mycotoxins implicated in several diseases in humans and animals. F. verticillioides primarily produce
fumonisin mycotoxin contamination in maize. Fumonisins are associated with high rates of human
oesophageal cancer, equine leuco- encephalomalacia in horses, porcine pulmonary oedema syndrome
in pigs and liver cancer in rats (Proctor et al., 2004; Rheeder et al., 2002; Sydenham et al., 1990; Ross
et al., 1992; Marasas et al., 1984). Fumonisin B1 and B2 originally were isolated from F.
verticillioides , and subsequently different other species within the FFSC and close related species in
other complexes have also been reported to produce fumonisins (Rheeder et al., 2002).
15
Members of the F. oxysporum species complex (FOSC) are widespread plant pathogens of high
economic importance. They are common in soil and plants, causing vascular wilts, damping-off, and
crown and root rots in cereal grain and a broad range of host plants. Fusarium solani species complex
are known to cause foot and root rot in a diverse number of hosts. They have been reported widely as
pathogens of vegetables, fruits and flowers. They also cause fusariosis in humans and animals. It is
estimated that they consist of at least 60 phylogenetically distinct species (O’Donell et al., 2008).
Figure 2-6 Phylogenetic relationships of key Fusarium species (Takayuki et al., 2014)
16
Proctor et al., (2004) established that the FUM gene cluster is distributed within the FFSC and that its
presence and ability to produce fumonisins varies within species. Based on the study by Proctor et al.,
(2004), fumonisin production was mainly found in the species F. verticillioides, F. proliferatum and F.
nygamai. They produce the B series of fumonisins (FB), FB1, FB2, FB3, and FB4. Fusarium head
blight (FHB) is a disease occurring in cereal grain worldwide especially on wheat and barley. It is not
only devastating in terms of yield losses but also because it contaminated food and feed with
trichothecenes such as deoxynivalenol (DON) and nivalenol (NIV). The FGSC is known to induce
FHB, with several species implicated such as F. graminearum, F. poae, F. cerealis, F. culmorum,
F.boothii, F.sporotrichioides and F. crookwellense (Aoki et al., 2012; O’Donell et al., 2000, 2004,
2008; Starkey et al., 2007; Sarver et al., 2011).
The FGSC species produce trichothecenes and estrogenic compounds (ZEA). Trichothecenes
produced by Fusarium spp. are classified as type A or type B depending on the presence or absence of
a keto group and the C-8 position of the trichothecene ring (Kimura et al., 2007). The FGSC species
produce type B trichothecenes (DON, NIV and their acetylated derivatives) (Ward et al., 2002).
Trichothecenes chemotype discovered have been classified as follows: (1) NIV and acetylated
derivatives (NIV chemotype) (2) DON and 3ADON (3ADON chemotype) (3) DON and 15ADON
(15ADON chemotype). The differences between NIV and DON chemotypes are determined by Tri13
(Brown et al., 2002; Lee et al., 2002); the difference between the 3ADON and the 15ADON is based
on Tri3 and Tri8 (Kimura et al., 2007).
Type B trichothecenes have different toxicological properties; NIV is more toxic than DON to humans
and animals with a stricter limit for the temporary tolerable intake of NIV (0.7µg/kg body weight and
for DON 1µg/kg body weight (EFSA CONTAM Panel, 2014).The major type A trichothecenes in
Fusarium species include T-2 toxin (T-2) and HT-2 toxin (HT-2), both of which possess an isovalerate
function at C-8. F. sporotrichiodes and F. poae are some of the major type A trichothecene producers
within the FGSC group. Type A trichothecenes are highly toxic; with T-2 having been reported to be
roughly ten times more toxic to mammals than DON ( Logrieco et al., 2003).
17
Table 2-2 Phytopathogenic Fusarium Species and their Mycotoxins
Species Complex Species Mycotoxins
FGSC
F. poae DAS, T2, HT2, NEO, BEA, NIV, FUS, MAS
F. cerealis NIV, FUS, ZEA, ZOH
F. sambucinum DAS, T2, NEO, ZEA, MAS, BEA
F. sporotrichioides T2, HT2, NEO, MAS, DAS
F. culmorum DON, ZEA, NIV, FUS, ZOH, AcDON
F. acuminatum T2, MON, HT2, DAS, MAS, NEO, BEA
F. cerealis NIV, FUS, ZEA, ZOH
F. tricinctum MON, BEA
F. graminearum DON, ZEA, NIV, FUS, AcDON, DAcDON, DAcNIV
FFSC
F. proliferatum FB1, BEA, MON, FUP, FB2
F. nygamai BEA, FB1, FB2
F. subglutinans BEA, MON, FUP
F. verticillioides FB1, FB2, FB3
FOSC F. oxysporum MON, BEA
AcDON – Mono-acetyldeoxynivalenols (3-AcDON, 15-AcDON); AcNIV – Mono-acetylnivalenol; (15-AcNIV) BEA – Beauvericin; DiAcDON – Di-acetyldeoxynivalenol (3, 15-AcDON); DAcNIV – Diacetylnivalenol (4, 15-AcNIV) DAS – Diacetoxyscirpenol; DON – Deoxynivalenol (Vomitoxin); FB1 –Fumonisin B1; FB2 – Fumonisin B2 FB3 – Fumonisin B3; FUP – Fusaproliferin; FUS – Fusarenone; FUC – Fusarochromanone; HT2 – HT-2 toxin MAS – Monoacetoxyscirpenol; MON – Moniliformin; NEO – Neosolaniol; NIV – Nivalenol; T2 – T-2 toxin ZEA – Zearalenone; ZOH – zearalenols (α and β isomers). Source: Logrieco et al., 2003; O’Donell et al., 2000, 2004, 2008.
Chronic dietary exposure to Fusarium toxins can cause a variety of toxic effects in both humans and
animals. Among the identified FUMs, fumonisin B1 (FB1) is the most prevalent with proven
immunotoxic, hepatotoxic, neurotoxic and nephrotoxic effects (IARC, 1993; 2002). ZEA is an
estrogenic toxin may lead to different changes in the reproductive system while DON is known to
have an immunotoxic effect and may affect changes in brain neurochemicals. When T-2 and HT-2
toxins are ingested, they can influence the incidence of several effects: nausea, abdominal pain,
dizziness, dermal necrosis, inhibition of protein synthesis (CAST, 2003).
18
2.4.2 Aflatoxins
Aflatoxins are organic chemical compound derivatives formed by a polyketide pathway. The fungi
responsible for these toxins are Aspergillus flavus and Aspergillus parasiticus. Aspergillus bombycis,
Aspergillus ochraceoroseus, Aspergillus nomius, and Aspergillus pseudotamari are also aflatoxin
producing species but are encountered less frequently (Richard, 2009; Peterson et al., 2001).
Aflatoxins occur mostly in tropical regions with high humidity and temperature, and they accumulate
post-harvest when food commodities are stored under conditions that promote fungal growth. The hot
and humid tropical climate in SSA provides ideal conditions for growth of toxigenic Aspergillus spp.
Hence, food and feed contamination with aflatoxins is widespread in SSA. Maize and groundnuts
being the most contaminated (Table 2-3). Even when grains are well dried in SSA, wetting due to leak
in stores, insect damage and activity leads to re-humidification, which generates moisture that is a
prerequisite for the growth of aflatoxin-producing fungi (Bankole et al., 2006)
Table 2-3 Examples of food commodities and aflatoxin contamination levels in Africa
Country Commodity Frequency of positive
aflatoxin samples
Contamination
rate/concentration
Source
Kenya Maize Samples from local
markets
Samples from
government warehouses
350 maize products
Up to 46,400 μg/kg
Up to 1800 μg/kg 55% had
levels > 20 ppb; 35% had
levels > 100 ppb;
CDC (2004)
CDC(2004) and Lewis et
al., (2005)
Senegal Peanut Oil Aflatoxin B1 found in
over 85% of samples
Mean Content 40ppb Muleta and Ashenafi
(2001)
South Africa Traditionally
brewed beers
33.3% of commercial
beer samples contained
aflatoxins
200 and 400 mg/l Mensah et al., (1999)
Nigeria Pre-harvest
Maize
Dried Yam
Aspergillus flavus
isolated from 65% of the
samples
Total Aflatoxins ranged 3–138
mg/kg in positive samples
The mean concentration of
aflatoxin B1: 27.1 ppb.
Maxwell et al., (2000)
Chauliac et al., (1998)
Botswana Raw peanut 78% contained aflatoxins Concentrations ranging 12–
329 mg/kg
Barro et al., (2002)
Source: CDC, (2004), Lewis et al. (2005).
19
Aflatoxins have been implicated in acute aflatoxicosis, carcinogenicity, growth retardation, neonatal
jaundice and immunological suppression in humans (Figure 2-7). The toxigenic ability of aflatoxins
differs qualitatively and quantitatively depending on strain within each aflatoxigenic species (Okoth et
al., 2012). The four major aflatoxins are namely B1, B2, G1 and G2 with the classification based on
their fluorescence under UV light and relative chromatographic mobility during thin-layer
chromatography (Bhat et al., 2010). Aflatoxin B1 is reported as the most toxic in the aflatoxins group,
Research indicates that it is the most potent chemical liver carcinogen known to be naturally occurring.
Specific P450 enzymes in the liver metabolize aflatoxin into a reactive oxygen species (aflatoxin-8,9-
epoxide), which can then bind to proteins and cause acute toxicity (aflatoxicosis) or to DNA and
induce liver cancer (Wild and Gong 2010; Wu and Khlangwiset 2010; Hamid et al., 2013).
Figure 2-7 Aflatoxin and disease pathways in humans (Wu, 2010)
20
2.4.3 Ochratoxins
Ochratoxins are nephrotoxins produced by a diverse species of molds and were first described in 1965.
Ochratoxins ingestion through dietary exposure represents a serious health issue and is associated with
several human and animal diseases including porcine nephropathy, Human Endemic Nephropathies
and urinary tract tumors in humans. OTA exposure causes a disease known ochratoxicosis, whose
primary target is the kidney. As evidenced by epidemiological studies, OTA may be involved in the
pathogenesis of different forms of human nephropathies, including kidney cancer (Marquardt &
Frohlich 1992; Ringot et al. 2006; Pfohl-Leszkowicz & Manderville 2007).
Tumour incidence data from long-term animal studies also provide reasons for concern about the
effect of OTA exposure on the human population. Due to these reasons, OTA was classified as a
possible carcinogen (Group 2B) to humans by The International Agency for Research on Cancer
(IARC 1993). They are immune-suppressive nature, teratogenic and have fertility inhibition,
mutagenic and carcinogenic effects. Ochratoxins are common in cereals, and other starch rich foods
and also can be found in coffee, spices and dried fruits (Zinedine et al., 2007). This toxic compound It
is produced by fungi namely Aspergillus and Penicillium genera which occurs in wide range of
products (Ruadrew et al., 2013), and they grow in wide range of conditions i.e. substrate, pH,
temperature, and moisture. Some crops contaminated by Ochratoxin A are medical herbs, coffee,
cocoa, oats, wheat, and nuts. Also, fresh produce like tomatoes and animal products such as cheese,
and meat from animals feed on contaminated grains (Haighton et al., 2012).
21
2.5 Mycotoxin Problem in Africa
Worldwide, crops are affected by fungal growth, and this not only does it have serious economic
consequences, but also enormous health effects for both human and animals due to the contamination
of food and feed with mycotoxins. Mycotoxin formation may begin in pre-harvest infected in the field
and be continued or commence postharvest due to improper postharvest practices (Logrieco et al.,
2003; Wagacha and Muthomi, 2008). Environmental conditions leading to fungal proliferation include
high temperature and humidity, monsoons, unseasonal rains during harvest and floods. Also, poor
harvesting and storage practices and improper transportation, marketing, and processing also
contribute to fungal growth. These climatic conditions, as well as the improper postharvest practices,
are characteristic in most parts of Africa. Hence, exposure to mycotoxins is high as the diets in these
countries consist mainly of crops (maize) susceptible to toxigenic fungi and consequently their
produced mycotoxins (Lewis et al., 2005).
Losses from rejected shipments and lower prices for inferior quality can be devastating for developing
countries export markets. Direct costs to farmers include reduced income as a result of losses in yield,
low prices for poor quality products, increased livestock mortality and reduced livestock productivity,
fertility and immunity (Wagacha and Muthomi, 2008). An important additional effect could be the
cost of reduced labor force due to illness and costs from hospitalization or other health care services as
a consequence of acute exposure to the toxins. Hence, strategies that will lower mycotoxins levels in
foods will not only reduce costs in health care but also provide better income and international export
opportunities for low and middle-income countries (Bryden, 2007).
Management of mycotoxins contamination usually will include good agricultural practices during
production, harvest, and storage. These constitute of practices like crop rotation, pest control,
irrigation, proper drying and removal of damaged kernels. Mycotoxins are relatively very stable;
although certain processing practices have been in practice to reduce the level of contamination. Long-
term strategies like breeding for resistance to toxigenic fungi are also very promising (Bryden, 2007;
Wagacha and Muthomi, 2008).
22
The knowledge that mycotoxins have serious effects on humans, animals and countries’ economies
has not only led to strategies for reducing mycotoxins contamination, but also to the establishment of
regulations on mycotoxins levels in food and feed. Worldwide, approximately 100 countries had
developed specific limits for mycotoxins in food and feed by the end of 2003, which represent
approximately 87% of world inhabitants (FAOSTAT, 2007). In Africa, the majority of the countries
have no specific mycotoxins regulations, although the problem is undeniable. However, mycotoxins
issues in Africa can only be effectively addressed when regarded in the overall context of local food
safety, health, and agricultural issues. The establishment of mycotoxins regulations will have limited
effects in terms of health protection for subsistent farmers reliant on their crops. In addition, adequate
resources to afford improved varieties, fertilizers and insecticides and information on good agricultural
practices and resistance of plant cultivars to fungal infection for small farmers need to be addressed
through appropriate strategies and policies (Golob, 2007; Shepard, 2004).
2.5.1 Fusarium in Africa
Mycotoxins from Fusarium species in the past have usually been associated with temperate cereals.
This is because these fungi require slightly lower temperatures for growth and mycotoxin production
than the aflatoxigenic Aspergillus species. Though, extensive data now exists to indicate that
contamination of cereal grains with a number of Fusarium mycotoxins is on a global scale (Muller and
Schwadorf, 1993; Chulze et al., 1996; Viquez et al., 1996). Despite the prevalence of fumonisins in
maize and the importance of maize as a food staple, there is inadequate information available on the
natural occurrence of fumonisins in maize consumed by rural populations in sub-Saharan Africa, with
the exception of South Africa. Surveys of maize from rural smallholder farms in the Transkei region
of South Africa were conducted in 1985 and 1989. High incidences and levels of fumonisin B1 were
found in both good-quality and mouldy maize (Rheeder et al., 1992). A study in Benin indicated a
high prevalence of F. verticillioides strains, which are high fumonisin producers (Fandohan et al.,
2005). Doko et al. (1995) , in their study comparing fumonisin contamination in different African
countries, already noted Benin as a high occurrence area since they found high total fumonisin levels
(3 mg/kg) in maize samples. The highest FB1 levels produced by isolates of F. verticillioides reported
so far are 17,900 mg/kg from South Africa (Alberts et al., 1990).
23
Adejumo et al., (2007) reported that F. verticillioides were the most commonly fungi in Nigerian
maize, other Fusarium species isolated included F. sporotrichioides, F. graminearum , F.
pallidoroseum , F. compactum , F. equiseti, F. acuminatum , F. subglutinans and F. oxysporum .
Gamanya et al., (2001) conducted a survey to determine the levels of fumonisins in maize in
Zimbabwe.The study carried out in Zimbabwe’s different ecological zones (wet Region I, moderately
wet Region II and dry Region III) observed that the incidence of fungal contamination can be clearly
linked to high rainfall and high relative humidities. A general comparison between cereals and peanuts
shows that the distribution of F. moniliform in maize was significantly higher than in other crops.
The study showed that the incidence of F. moniliforme and other Fusarium species and levels of FB1
decreased from regions with high rainfall and annual moderate temperatures to low rainfall regions.
This corresponds with studies previously carried out in tropical regions such as Transkei, South Africa,
where F. moniliforme and FB incidences were correlated and the relationship of its distribution to
climatic conditions established (Sydenham et al., 1990). This implies that for effective control of
Fusarium infection in crops and mycotoxin production may indeed require focusing on particular
agricultural regions.
Wagacha et al., (2010) reported the occurrence of 19 different Fusarium species in wheat in Kenya
with F. boothii, F. poae, F scirpi, F. chlamydosporum, F. graminearum, and F. anthrosporioides
accounting for 80% of contamination. Major Fusarium-related mycotoxins such as deoxynivalenol
(DON), nivalenol (NIV), zearalenone (ZEA), T2-toxin and HT2-toxin have been reported in wheat
kernels sampled from fields in different wheat-growing regions of Kenya (Muthomi et al. 2002, 2007a,
2008). O’Donnell et al., (2008) identified a new species in Ethiopia (F. aethiopicum) which produce
15ADON.
Multi-locus sequence typing (MLST) suggests that this species with the closely related Fusarium
acaciae-mearnsii may be endemic to Africa and Australia. Boutigny et al., (2011) conducted a more
recent extensive study in South Africa where only F. boothii was found in maize (15ADON). In wheat
and barley, 85% of the isolates were F. graminearum 15ADON type. However, it is important to note
that a majority of the research studies mainly based on random surveys of farmers’ stores and retail
markets, mostly basing data measurements on a relatively small number of samples.
24
The number of investigations on FFSC and FGSC diversity in Africa is still limited. Fusarium and
their mycotoxins in maize have been conducted in numerous parts of the world, namely in the USA,
South America, Europe and South Africa. There is still limited research on the occurrence of Fusarium
and its toxins in maize in Africa with the exception of South Africa (Gamanya and Sibanda, 2001;
Ngoko et al., 2001; Kpodo et al., 2000; Doko et al., 1995; Kedera et al., 1999). There is a great need
for additional investigations on the continent, at least where maize production and consumption are
predominant.
2.6 Food Safety and Health Hazard Implications Associated with Mycotoxins
The occurrence of mycotoxins in food and feed includes potential risks for the health of both humans
and animals. Mycotoxins are potential carcinogenic, mutagenic and teratogenic compounds (Wagacha
and Muthomi, 2008). Chronic exposure to mycotoxins has also been associated with impaired growth
in children (Gong et al., 2002; Gong et al., 2004; Kimanya et al., 2010), neural tube defects in unborn
children (Marasas et al., 2004) and immunosuppression (Turner et al., 2009), which results in
vulnerability to other infectious diseases.
Aflatoxins have been implicated in acute aflatoxicosis, carcinogenicity, growth retardation, neonatal
jaundice and immunological suppression in SSA. Acute aflatoxicosis usually associated with
extremely high doses of aflatoxin is characterized by hemorrhage, acute liver damage, edema, and
death in humans. Several reported cases of acute aflatoxicosis in Africa and Asia are mainly associated
with consumption of contaminated home-grown maize as indicated in Table 2-4. According to Miller
(2008), 40% of the productivity lost to diseases in developing countries is due to diseases aggravated
by aflatoxins. Unfortunately, many of the people in the region are not even aware of the effect of
consuming moldy products. Due to the low literacy levels and other socio-economic factors, even if
steps were taken to make food products safe, the consumers might be unwilling to pay extra costs, and
may still prefer to buy the cheap commodities.
25
Table 2-4 Aflatoxicosis in Maize consuming countries
Population Fatalities Samples Estimated Intakea References
397 Patients in
Western India, >180
villages (1974)
106 dead
27% Fatality
Maize from affected
households contained
aflatoxin(type
unspecified) levels
between 6250-15,600
ppb
6.25-15.6 ppm
aflatoxins and 350g
maize/day equates to
2.19-5.46 mg
aflatoxins/kg/day
Krishnamachari, K..
A. et al. (1975)
20 cases in Machakos
district, Kenya (1981)
12 dead
60% Fatality;
Maize from homes
with fatalities had
AFB1levels 3200 –
12,000 ppb.
3.2-12 ppm AFB1 and
350g maize/day
equates to 1.12-4.2 mg
AFB1/kg/day
Ngindu, A. et al.
(1982)
317 case in Eastern
Kenya (Makueni,
Kitui, Machakos, and
Thika) and a case-
control study of 40
cases with acute
jaundice and 80
village controls
125 dead
39% Fatality
Case-control
Study- 29 cases
alive at time of
blood sampling,
an additional 7
dead by August
2004
GM of Total AF in
stored maize; 354.53
ppb in case and 44.14
ppb in control
households
Intakes 5-20 ppm were
associated with
fatality and 350g
maize/day equates to
1.75-7mg
Aflatoxins/kg/day
PROMEC Unit.
(2001)
GM, Geometrical Mean aAssumed body weight of 60kg
b Blood samples collected after an average of 33 days of onset of symptoms c Household maize collected after an average of 33 days of onset of symptoms (9-112 days)
Epidemiological studies of human populations exposed to diets naturally contaminated with aflatoxins
revealed an association between the high incidence of liver cancer in Africa and dietary intake of
aflatoxins. Hepatitis B and C infections coupled with aflatoxin exposure; which are common in sub-
Saharan Africa has shown to raises the risk of liver cancer by more than ten-fold as compared to either
chronic exposure alone (Turner et al., 2005). In addition, preliminary evidence suggests that there may
be an interaction between chronic mycotoxin exposure and malnutrition, immunosuppression,
impaired growth, and diseases such as malaria and HIV/AIDS (Gong et al., 2003, 2004). A recent
study in Ghana indicated that higher levels of aflatoxin B1-albumin adducts in plasma were associated
with lower percentages of certain leukocyte immunophenotypes (Jiang et al., 2005) while another
research study in Gambian children found an association between serum aflatoxin albumin levels and
reduced salivary secretory IgA levels (Turner et al., 2005).
26
Studies on mycotoxins-linked diseases in animals show equine leuko- encephalomalacia in horses and
pulmonary oedema in pigs (Kellerman et al., 1990), liver and kidney cancer in mice and rats and
immunosuppression (Oswald et al., 2005). In 1993, the International Agency for Research on Cancer
(IARC) had also categorized mycotoxins into different groups with respect to their carcinogenicity as
shown in Table 2-5 for Fusarium toxins (IARC, 2002).
Table 2-5 Carcinogenicity Risk evaluated by IARC for Fusarium Mycotoxins
Toxins Degree of evidence of
carcinogenicity
Overall evaluation
In human In animals
Toxins derived from
F. graminearum,
F. culmorum,
F. crookwellense
I
Group 3
Zearalenone ND L
Nivalenol I
Fusarenone X I
Deoxynivalenol I
Toxins derived from
F. sporotrichioides
ND
Group 3
T-2 toxin L
Toxins derived from
F. moniliforme
I
S
Group 2B
Fumonisin B1 L
Fumonisin B2 I
Fusarin C L
*Source IARC, (1993, 2002)
I, insufficient evidence; L, limited evidence; ND, no adequate data; S, sufficient evidence.
Group 2B=possibly carcinogenic to humans; Group 3= not classifiable as to its carcinogenicity to humans.
27
2.7 Mitigation Strategies for Mycotoxins
Stored and processed food commodities such as maize, sorghum, millet, and barley carry a broad
range of microorganisms. The different species of microorganisms will depend on field climatic
conditions and harvesting procedures. Extrinsic and intrinsic factors influence mycotoxins production.
Extrinsic factors include factors such as temperature, water availability and gas compositions (Magan
et al., 2003). Since mycotoxins are known to have detrimental effects on post-harvest food losses as
well as to the health of consumers, a number of mitigation strategies have been developed to prevent
growth of fungi as well as to decontaminate and detoxify food, which contaminated by mycotoxin
(Kabak et al., 2006).
To mitigate and reduce impact of mycotoxins in food and feed chain needs comprehensive research in
order to understand crop biology, agronomy, fungal ecology, harvesting methods, storage conditions
and detoxification methods of mycotoxin (Bryden, 2009), importantly the hazard analysis critical
control point systems (HACCP) is the key element in reduction of mycotoxins (Aldred et al., 2004).
Grain with high moisture should not be held in wagon or trucks for more than six hours instead should
be dried to moisture content level of 12-13% to stop production of aflatoxin (Sumner & Lee, 2009).
Mould, fungi, and aflatoxins are usually at higher levels in the fine material, thus by removing fine
material will reduce aflatoxin levels by 50%.
Different preparation methods of cereal before milling show significance reduction of contamination
of mycotoxins in flour, such methods are like hand sorting of maize and washing play vital part in
reducing mycotoxins during preparation of complementary food (Van der Westhuizen et al., 2011).
Sorting has proven that it can remove a large percentage of aflatoxin contaminated grain, but reduction
may also be through food processing procedures such as washing, wet and dry milling, grain clearing,
dehulling, roasting, baking, frying and extrusion cooking. Other possible methods used to mitigate
mycotoxin production in cereals includes avoiding prolonged harvesting, and long drying period on
the field have been linked with higher aflatoxin levels in corn in Benin (Hell et al., 2003).
Other potential methods includes application of antifungal such as synthetic antioxidants (Farnochi et
al., 2005), educating population on risk of mycotoxin contaminated diet, Sanitation, smoking (Bankole
& Adebanjo, 2003), use of essential oils (Nguefack et al., 2004), natural phenolic compounds (Bakan
et al.,2003) or the use of modified atmospheres (Ellis et al., 1993; Ellis et al.,1994). Changing degrees
of efficiency have in mitigation of mycotoxins have been achieved, which have not necessarily
resulted in commercial success. Besides, a majority of these studies have been carried out on artificial
media, and their effects would still need to be validated on corn (Samapundo et al., 2006).
28
2.7.1 Reducing Mycotoxin Exposure
Fundamental to developing prevention strategies, it is crucial to have an understanding of the
interaction between the fungus and the host plant. For instance, Aspergillus spp. will infect the maize
crop in the field but aflatoxins continue to accumulate post-harvest under poor storage conditions,
which favor fungal growth and toxin production. Therefore, post-harvest interventions may contribute
significantly to controlling aflatoxin. The majority of the toxin is present at the time of harvest. Thus,
control of FB requires more attention to pre-harvest practices and the subsequent effects of processing
and preparation of foodstuffs (Humpf. et al., 2004).
Recommendations to shift the traditional diet away from commodities prone to contamination can
reduce chronic exposure. For instance, in China economic developments resulted in reduced maize
consumption (IIASA, 2009) formerly the primary source of aflatoxin exposure in regions such as
Qidong County. Populations in some of the poorest countries facing the highest risk of mycotoxin
exposure due to consumption of contaminated staple foods are trapped by poverty and the lack of
alternatives, making it virtually impossible to replace the contaminated food with that of good quality
(Shephard, 2008). The lack of established regulatory mechanisms in these countries makes the
situation worse, the reliance on staple foods highly contaminated with mycotoxins exposes them to
high doses beyond established toxicological safe limits (Table 2-6).
Table 2-6 Toxicological Safe Limits for Mycotoxins
Mycotoxin Safe Limit Reference
FB1 2.0 µg/kgbodyweight/day WHO, 2002; Creppy, 2002
FB2 2.0 µg/kgbodyweight/day WHO, 2002; Creppy, 2002
Total FBS 2.0 µg/kgbodyweight/day Kuiper-Goodman T., 1998
AFB1 1.0 ng/kgbodyweight/day WHO, 1998
AFB2 1.0 ng/kgbodyweight/day WHO, 1998
AFG2 1.0 ng/kgbodyweight/day WHO, 1998
DON 1.0 ng/kgbodyweight/day Tamura et al. 2011
HT-2 0.06 µg/kgbodyweight/day Creppy, 2002
T-2 0.06 µg/kgbodyweight/day Creppy, 2002
OTA 5.0 ng/kg body weight/day The Nordic Working Group on Food
Toxicology and Risk Evaluation
ZEN 05 µg/kgbodyweight/day WHO, 2010
29
Pre-harvest mycotoxin prevention methods include the use of proper agricultural practices reduce
stress to the crops (e.g. use of strains resistant to fungal colonization, biocontrol and genetically
modified crops that inhibit fungal colonization, improved irrigation, early sowing, low plant density,
balanced fertilization, use of fungicides, pesticides and insecticides). These approaches sometimes are
expensive and are generally of limited applicability at present at the subsistence or small farm level.
Aflatoxins accumulation during food storage is usually in significant amounts, the control of post-
harvest storage conditions hence is vital in limiting levels of these toxins (Wild et al. 2000).
In a primary prevention study in Guinea, aimed at reducing aflatoxin accumulation during groundnut
storage, 60% reduction in aflatoxin–albumin adducts was seen in subjects consuming groundnuts in
the intervention villages compared with controls at 5 months post-harvest (Turner et al. 2005). This
study is a clear indication that simple, inexpensive strategies can offer significant benefits at the small
farm level. Equivalent approaches to primary prevention might be considered in terms of FB. Simple
sorting procedures, for example, led to a 10-fold reduction of FB level in maize in Tanzania
Processing and cooking of crops can contribute to limiting the levels of mycotoxins in foods.
Aflatoxins are very resistant to destruction through processing and cooking. In the case of FB, the
effects of processing and cooking on toxin can be of significance. This is important because the
majority of maize consumed worldwide is in the form of processed products and ingredients (Kimanya
et al. 2008)
Humpf et al. summarized the evidence showing that the milling and cleaning processes can remove a
proportion FB. FB are relatively heat stable, up to temperatures of 100–120C. Research shows that
heat treatment during cooking leads to decreased FB levels depending on the duration, pH, water,
sugar content and temperature, The process of nixtamalization or alkali cooking, as in the preparation
of maize-based tortillas showed that FB was partially degraded (Humpf et al., 2004). There is need to
investigated in greater detail the effects of local communities ways of maize preparation by on FB
levels since even simple combinations of sorting and washing in relation to the preparation of
traditional foods can lead to significant reductions (Palencia. et al., 2003; Fandohan. et al., 2005).
30
A recent study conducted in South Africa in collaboration with the Programme on Mycotoxins and
Experimental Carcinogenesis of the South African Medical Research Council (PROMEC) the order of
reported that a 65% reduction in FB contamination of maize porridge due to simple hand sorting and
washing procedures. Alternative strategies have tried modify the effects of toxins once ingested, either
by reducing absorption rates or by modifying metabolism. Incorporation of clays into feeds and foods
has so far been successful in reducing absorption levels of aflatoxin. (Williams, J.H. et al., 2004).
This method has been demonstrated in animals and recently extended to trials in exposed people
(Wang, P. et al., 2008) with reductions in both aflatoxin– albumin adducts and urinary AFM1 in
Ghanaian subjects taking the clay-filled capsules over a 3 month period. In terms of changed
metabolism mechanisms, a number of various compounds have been explored mainly in a series of
elegant studies by Kensler (Groopman. et al., 2008) in China. Chlorophyllin may act both to reduce
absorption and to modify aflatoxin metabolism. Caims-Fuller (2004) study indicated that essential oils
and antioxidants had inhibitory effects on growth and production of ochratoxins. This gives way to
further studies on how these components interact with the pathogen and if the inhibitory effects can be
translated into effective dietary strategies.
Table 2-7 Concentrations of some essential oils and the antioxidant resveratrol (ppm) needed for 50%
inhibition of (a) growth and ochratoxin production by Aspergillus ochraceus at different environmental
conditions
Temperature (0C ) 15 25
Water Activity 0.90 0.95 0.995 0.90 0.95 0.995
(a) For control of colonization of grain
Treatment
Clove 210 310 280 365 260 160
Cinnamon 210 270 190 325 220 155
Thyme 190 210 190 260 215 140
Resveratrol 60 180 190 150 110 140
(a) For control of Ochratoxin production
Treatment
Clove 225 150 275 215 200 150
Cinnamon 105 200 185 200 180 160
Thyme 60 145 120 140 150 160
Resveratrol 10 100 110 30 130 130
Source: Caims- Fuller (2004)
31
Chlorophyllin led to a 55% reduction in urinary AFB1-N7-Gua compared with those taking placebo
during a chemoprevention trial in China. However, a chemoprevention trial using a broccoli sprout
extract did not show a reduction in urinary AFB1-N7-Gua excretion, this was probably due to
unexpected variation in bioavailability of dithiocarbamates from the broccoli among individuals. But
when a comparison was made at the individual level between bioavailable dithiocarbamate and AFB1-
N7-Gua, a strong inverse association was found (Groopman. et al., 2008). Additionally, Oltipraz has
shown that it can modify both detoxification and bioactivation of aflatoxins and lead to increased
urinary excretion of the aflatoxin–mercapturic acid conjugate and a decrease in urinary AFM1
(Groopman. et al., 2008). Comparable modulation of aflatoxin biomarkers was observed with green
tea polyphenols (Tang. et al., 2008).
2.7.2 Biological Control Strategies- The Aflasafe Project
Biological control of aflatoxin producing A. flavus with the atoxigenic isolates of A. flavus had been in
practice for over a decade in commercial agriculture in several regions of the USA (Dorner 2004;
Cotty 2006; Cotty et al. 2008). The biological control (atoxigenic isolates of A. flavus) competitively
excludes aflatoxin producers from the crop environment leading to the achievement of single-season
influences on the aflatoxin content of the crop and a lasting decrease in the average aflatoxin
producing potential of fungal communities typically growing in the prone areas (Figure 2-8). Long-
term influences eventually lead to cumulative benefits from applications across multiple years and can
provide additional benefits by changing the fungal community to which both untreated rotation crops
and nearby residents are exposed. To achieve such advantages, atoxigenic isolates must be adapted to
both target crops rotations and the target environments (Atehnkeng et al., 2008).
Biological control has proven to be a practical and efficient strategy reduction of aflatoxin producing
A. flavus and aflatoxins in the field. IITA, in partnership with the Department of Agriculture in the
United States USDA-ARS) together with the African Agriculture Technology Foundation (AATF)
developed aflasafe. This method uses native strains of A. flavus that do not produce aflatoxins. These
atoxigenic strains are applied to ‘push out’ their toxic cousins, so crops are less contaminated, in a
process called ‘competitive exclusion (IITA 2011; 2012).
32
Nigeria field testing of aflasafe produced extremely positive results with aflatoxin contamination
levels in of maize and groundnut consistently reduced by 80-90 percent. In 2011, the aflasafe project
was extended to Kenya and Zambia with the purpose of providing farmers with a safe, cost-effective
and natural solution to aflatoxin contamination in maize and groundnut. In Kenya, IITA identified four
competitive atoxigenic strains isolated from locally-grown maize to constitute a biocontrol product
called aflasafe-KE01(IITA, 2012).
Currently, IITA researchers are gathering efficacy data in areas where the technology will be deployed
in the Kenya. Zambia’s aflasafe project intends to develop a country-specific biocontrol product, in
addition to mapping the incidence of aflatoxin in maize. On-farm trials (having begun in 2010), with
aflasafe, are currently ongoing in Kenya, Burkina Faso, and Senegal and in 2013, Mozambique was
included as a target country for biocontrol product development (IITA 2011; 2012).
Figure 2-8 How Aflasafe Works (IITA, 2012)
33
3 CHAPTER THREE: MATERIALS AND METHODS
3.1 Sampling Strategy
Surveys were conducted between July 2014 and September 2014 in four agroecological zones of
Kenya where maize is predominantly produced. A total of 50 samples, 100g each of maize kernels was
collected from the different rural agricultural commodity markets from the key identified. The maize
kernels were sampled from where vendors confirmed they obtained the maize locally.
Table 3-1 Maize Growing Regions Sampled
Agro-Ecological Zone
Humid Sub Humid Semi-arid to Semi
Humid
Semi-arid
Rainfall(mm/PA) 1,100 – 2,700 1,000 – 1,600 600 – 1,100 450 - 900
Soil Moisture Availability Index (%) >80 65 - 80 40 – 50 25 – 40
Markets Sampled 2 2 1 6
Town (No of Samples)1
Nyeri 5 - - -
Kisumu - 5 - -
Bungoma - 5 - -
Tala - - - 5
Kagundo - - - 10
Matungulu - - - 10
Ithanga - - - 5
Laikipia - - 5 -
Total No of Samples Collected 50 1Number of Samples collected per AEZ within the towns
The humid zones in Kenya are mostly the highlands with altitudes of over 1500m. As indicated in
Table 3-1, this zone receives an annual rainfall of over 1000mm. The Sub-humid zones receive
slightly less rainfall than the humid areas. They lie between 1000 to 2000m. Rainfall is up to 1,000 -
1,600mm per year and soils are red clay while on average Semi-arid regions receive 450 - 900mm of
rainfall per year, and the soils are shallow and infertile, but variable. The Semi-arid to Semi-humid
receive on average 600 – 1,100mm of rainfall per year (Okoth et al., 2012).The different AEZs
comprise of both high-risk and low-risk areas for previously reported cases of acute aflatoxin
exposures (Lewis et al., 2005).
34
Specific maize variety was not indicated during sampling, and markets were chosen on the basis of
proximity and ease of access. Both moldy maize and normal looking maize was sampled. The maize
samples were stored at room temperature in envelopes and brought to Belgium for the research study.
Figure 3-1 Agro-Ecological Zones sampled
3.2 Media Preparation
Potato dextrose agar (PDA) and Potato dextrose broth (PDB) were used for growth and isolation of the
fungal species. The following components for each medium were measured and mixed thoroughly in
1000ml distilled water in a glass bottle and autoclaved for 21 minutes at 121 °C. Agarose gel (2%)
was also used for gel electrophoresis.
Potato Dextrose Agar (PDA, Difco) medium – PDA (39g)
Potato Dextrose Broth (PDB) medium – PDB (24g)
35
3.3 Isolation and Identification of Fungal Pathogens
From each region, 3(100g) bags of maize kernels were sub-sampled. Ten (10) kernels from the sub-
sample were first with NaOCl (2 %) for 2 min and left to dry on sterile filter paper. Subsequently, the
dry kernels were directly plated (three kernels per plate) on potato dextrose agar (PDA) plates. The
PDA plates were incubated at room temperature (21 -25 °C) for seven days. In total 27 bags out of the
fifty bags collected from the markets were sampled.
The plates were inspected visually for fungal growth. Subsequently, these fungal genera were
continually transferred to new PDA plates to ensure pure isolates. The pure isolates were then
transferred to PDB well plates and incubated at 25 °C for seven days, and the resultant pure cultures of
fungi were used for further molecular analysis.
(a) (b)
(c) (d)
Figure 3-2 (a)Plated maize kernels on PDA; (b) Fungal growth on PDA plates after 3 days of incubation at
room temperature; (c) Fungal growth after 6 days of incubation on new PDA plates; (d) PDB well plates
after 7days of incubation at 25 °C
36
3.4 Molecular Analysis
3.4.1 DNA Extraction
Fifteen isolates representing each group and region were then selected, from the isolate collection for
further molecular analysis. After 7 days of incubation, the mycelial mats of the isolates were pat dry
with sterile filter paper. They were then ground into a fine powder with liquid nitrogen using a mortar
and pestle, and the ground powder was collected into a 2-ml Eppendorf tube. Further extraction
procedures were carried out with the commercially available DNeasy Plant Mini Kit (QIAGEN)
protocol. The DNA samples were quantified using a Nanodrop spectrophotometer and then stored at
−20 °C until use as a template for PCR amplification.
3.4.2 PCR Amplification
The PCR reaction mixture consisted 5μl 5×PCR buffer (Promega), 5μl Q-solution (QIAGEN), 0.5μl
dNTPs (10nM, Fermentas GmbH), 1.75μl ITS4 primer, 1.75μl ITS5 primer, 0.15 μl Taq Polymerase,
8.85μl sterile milliQ water and 2μl genomic DNA to give a total PCR reaction volume of 25μl. The
amplification program used was: 1 denaturation cycle of 10 min at 94 °C, 35 cycles of 1 min at 94 °C,
1min at 55°C and 1min at 72 °C, and a final extension cycle of 5 minutes at 72 °C.
Table 3-2 Sequence of Primers used in the PCR Amplification
Primer Name Primer sequence (5’ - 3’) Species Specificity
ITS4 TCCTCCGCTTATTGATATGC All fungia
ITS5 TCCTCCGCTTATTGATATGC
EF1 ATGGGTAAGGA(A/G)GACAAGAC All Fusarium Speciesb
EF2 GGA(G/A)GTACCAGT(G/C)ATCATGTT
a White et al., 1990; bO’Donnell et al.,1998
37
To verify if the amplification of the rDNA was successful, gel electrophoresis was carried out which
separated the fragments. Agarose gel electrophoresis is the separation of DNA or proteins in a matrix
of stained agarose gel. The PCR products were separated on a 2.0% agarose gel in the electrophoresis
machine containing 0.5% Tri-Acetate/ EDTA (TAE) buffer. The agarose gel was then stained with
Ethidium bromide and visualized, a 100bp DNA ladder mix (M) was used.
(M) DNA Ladder
Figure 3-3 Fragments from the PCR of the rDNA ITS region
PCR PRODUCTS PURIFICATION
Before sequencing, the PCR products were purified. This was carried out using the DNA purification
protocol based on the commercially available EZNA Cycle Pure Kit. The DNA yields were measured
again with the Nanodrop Spectrophotometer. The purified PCR products were then sent to LGC
Genomics (Berlin, Germany) for sequencing. Sequencing was for both strands with the respective
primers ITS4 and ITS5. Labelled 2-ml Eppendorf tubes containing a total volume of 10μl of the
purified DNA and 4μl for each set of primers for a resulting 13 successful samples were prepared,
closed tightly and sent for sequencing. Consensus sequences were then created using the software,
BioEdit 7 version and a nucleotide blast performed by the National Centre for Biotechnology
Information database (NCBI, 2015) for identification of the isolates
M 2 4 5 6 7 8 9 10 11 12 13
38
The PCR amplification process was then repeated for the Fusarium species identified in the first PCR.
Using a standard PCR reaction to amplify the TEF gene region; the primer pair ef1 and ef2
(O’Donnell et al., 1998) was used with an annealing temperature of 53ºC (Geiser et al., 2004). The
PCR products were purified using the EZNA Cycle Pure Kit, quantified and sent for sequencing at
LGC Genomics, Berlin-Germany. Sequences of TEF gene were then used to search for matches of the
isolates using available information in two genebanks (FUSARIUM–ID database, National Centre for
Biotechnology Information database).
(M) DNA Ladder
Figure 3-4 Fragments from PCR Amplification of the TEF region
3.5 Screening for the ability to produce Mycotoxins
3.5.1 PCR Diagnosis for Chemotypes
Standard PCRs with a single primer set were performed for 40 cycles (1 min denaturation at 94ºC, 30 s
annealing at 60ºC and 1 min extension at 72ºC) followed by a final extension of 5 min at 72ºC and
storage at 4ºC until harvest of the samples. The PCR reaction mixture consisted 5μl 5×PCR buffer
(Promega), 5μl Q-solution (QIAGEN), 0.5μl dNTPs (10nM, Fermentas GmbH), 0.15 μl Taq
Polymerase, 8.85μl sterile milliQ water and 2μl genomic DNA and 1.75μl of the species-specific
primers was added. The resultant amplicons were then separated on 2.0% agarose.
M 4 13 4 5 10 11 12
39
The primer pair tri13F/R was designed by comparing the published sequences for this gene from
known NIV- and DON-producers (Accession# AF336365, AF366366, and AY057841–AY057844).
They generate a 415bp fragment in NIV-producers and a fragment of 234bp in DON-producers
(Waalwijk et al., 2003).
Table 3-3 Primer designations, anticipated sizes of the PCR fragments
Primer Name Sequence Size
Tri13F TACGTGAAACATTGTTGGC
234 or 415bp Tri13R GGTGTCCCAGGATCTGCG
Source: Waalwijk et al., 2003
3.5.2 FGSC synthesis of Trichothecenes
Liquid culture experiments were carried out in triplicate for the Fusarium poae and Fusarium boothii
isolates well plates in defined media as described by Correll et al. (1987) but 0.03% Phytagel (Sigma,
St. Louis, MO, USA) was included and Fe(NH4)2(SO4)2·6H2O was omitted from the trace elements
(Hamer et al., 2001). Per liter, the medium contained, 30g sucrose, 2g NaNO3, 1g KH2PO4, 0.5g
MgSO4·7H2O, 0.5g KCl, 10mg FeSO4·7H2O, 0.03% Phytagel and 200µL of trace element solution
(per 100mL, 5g citric acid, 5g ZnSO4·7H2O, 0.25g CuSO4·5H2O, 50 mg MnSO4·H2O, 50 mgH3BO3,
50mg NaMoO4·2H2O) pH 6.5 with NaOH.
For profiling the nitrogen sources, NaNO3 was replaced with arginine. Gardiner et al., (2009)
established that arginine and agmatine act as a cue for toxin synthesis or as preferred feedstock.
Cultures were incubated in the dark without shaking at 28ºC for seven days. The mycelium from the
well plates was carefully removed, and the remaining liquid culture was transferred into a 2-ml
Eppendorf tube. This was centrifuged at 10,000rpm; the resultant solution was then stored at -20ºC
until analyzed. The samples were sent for analysis where toxin assays will be conducted by the
Laboratory of Food Analysis at the Faculty of Pharmaceutical Sciences; University of Ghent.
40
3.5.3 Fumonisin B, A, C Production in Fusarium verticillioides
The isolates of Fusarium verticillioides were screened for their ability to produce mycotoxins on a
solid substrate of rice (Greenhalgh et al., 1983). For each of the isolates; the fungus was cultured on
50g of Uncle Ben’s Rice in a 500ml Erlenmeyer flask capped with aluminum foil. The moisture
content of the rice was 9.9 ± 0.4%, and this adjusted by the addition of 20ml of distilled water before
autoclaving at 121ºC for 30minutes. No attempt was made to ensure an even distribution of water as
earlier attempts showed that a moisture gradient provided better results. The inoculum for each flask
was a PDA plug, 8mm in diameter containing mycelium from the actively growing edge of the culture.
The plug was placed in the center of the flask and pushed deep enough to ensure that it was in contact
with moist rice. The cultures were incubated in the dark for 21 days at 28 ºC and were then frozen
until analysed. The samples were sent for analysis where toxin assays will be conducted by the
Laboratory of Food Analysis at the Faculty of Pharmaceutical Sciences; University of Ghent.
41
4 CHAPTER FOUR: RESULTS
4.1 Distribution of Pathogenic Fungi in Kenya
In this study, maize kernel samples (n = 50) were collected from agricultural informal markets (n =
11). Maize kernels from a subset of the samples were analyzed for fungal infection. All towns and
AEZs had samples contaminated with fungi. Fungal species identified included: Fusarium
verticillioides, Fusarium poae, Fusarium boothii, Lasiodiplodia theobromae, Nigrospora oryzae,
Mucor nidicola and Phoma herbarum. The semi-arid zones had a high infection rate of the
mycotoxigenic fungi (74%) followed by the subhumid region (14%). In the humid and semi-arid to
semihumid regions, Fusarium infections were not observed. Phoma herbarum was isolated only in the
semi-arid region; M. nidicola was also only isolated in the sub-humid zones (Figure 4-2).
Figure 4-1 Distribution of Fungi species identified
Fusarium verticillioides was the predominant mycotoxigenic fungi isolated from the semi-arid region
and was not found to be in other AEZs. The order of abundance of fungal infection observed in the
maize kernels from the four AEZs is as follows: Fusarium verticillioides > Nigrospora oryzae >
Fusarium boothii > Fusarium poae >Lasiodiplodia theobromae > Phoma herbarum>Mucor
nidicola.s
0
2
4
6
8
10
12
14
16
No
of b
ags (
+ve
fung
al g
row
th)
Fungi isolated from maize kernels
Semi arid -Semihumid
Semi Arid
Subhumid
Humid
42
Figure 4-2 Maps showing (a) Markets sampled (b) Distribution of Fusarium species identified in the sub-humid and semi-arid regions
(a)
(b)
LEGEND
Towns Sampled
43
4.2 Isolates and Morphological Characteristics
Thirty-five isolates from the 27 bags of maize sampled were successfully classified into different
groups according to the colony and morphological characteristics. The fungal morphological studies
consisted of mycelium growth and color. Microscopic characterization of the fungal isolates was also
done by making the slides of different fungal isolates. Identification was done by comparing the data
with published guide on imperfect fungi by Barnett & Hunter (1998). The majority of the isolate
colonies were pink in color with white aerial mycelia that had a powdery appearance. Abundant
conidia were observed, oval in shape, slightly flattened at the end. After two weeks of further
incubation at room temperature, they formed a slight curve. These were classified as fungi from the
Fusarium species.
The Lasiodipodia theobromae isolates were greyish white in early growth stages, but at later growth
stages (2 weeks of incubation), all the isolates had turned black as a result of enormous spore
production and dark brown conidia with typical striations was observed. The Nigrospora oryzae
isolate was later confirmed through molecular analysis, as the microscopic classical features alone
were difficult to characterize the isolates. The colonies were white and shiny, later turning black after
further incubation.
The rest of the isolates too were difficult to characterize microscopically but were grouped according
to visual features. The molecular analysis confirmed their identification as Mucor nidicola and Phoma
herbarum. Based on visual colony characteristics, isolates were classified into different groups;
Fusarium spp., Lasiodiplodia theobromae, Mucor nidicola, Phoma spp. and Nigrospora spp. groups.
44
Table 4-1 Isolates Collection from agro- ecological zones in Kenya
Isolate code Town
(Region)
Fungi species Total
Isolates
Ekk.001, Ekk.002
Ekm.001, Ekm.002
Et.Katine
Kagundo (SA) Fusarium verticillioides 7
MG.001, MG.002,
MG.001, MG.002L
Matungulu
(SA)
Fusarium verticillioides 4
Mg.001, Mg.002 Matungulu
(SA)
Fusarium poae 2
MG.Ithanga Matungulu
(SA)
Lasiodiplodia
theobromae
1
E.Tala001,
E.Tala002
ET.T001, ET.T002
Tala
(SA)
Fusarium verticillioides 4
E.Tala001a Tala
(SA)
Nigrospora oryzae 1
ET.Katine1
ET.Katine2
ET.Katine3
Tala
(SA)
Phoma herbarum 3
Ekm.001, Ekm.002
Ekm.003H
Kagundo
(SA)
Fusarium poae 3
Ekm.001
Ek.002
Kagundo (SA) Fusarium boothii 4
Isolate code Town
(Region)
Fungi species Total
Isolates
WBm.001b
WBm.002
Bungoma
(SH)
Fusarium boothii 2
WBm.001
WBm.002
Bungoma
(SH)
Nigrospora oryzae 2
WBm.001a,
WBm.002a
WBm.003a
Bungoma
(SH)
Mucor nidicola 3
NKT.001 Kisumu
(SH)
Nigrospora oryzae 1
CN.T001 Nyeri
(H)
Nigrospora oryzae 1
CN. Tetu Nyeri
(H)
Lasiodiplodia
theobromae
1
Rlk.002 Laikipia
(SaSh)
Lasiodiplodia
theobromae
1
Total No of Isolates 35
45
4.3 Molecular Analysis
4.3.1 PCR Amplification
To confirm the morphometric identifications of the isolates collected (Table 4-3), PCR amplification
was done. The resultant query length of amplified products of ITS and EF ranged from approximately
520 – 678 (Table 4-1).Sequences of these amplified products were compared with those deposited in
the NCBI GenBank and Fusarium-ID database. Sequences from isolates of these species showed an
identity ranging from 99% to 100%; Table 4-1 shows the tabulated results. The distribution of
Fusarium species was observed to be mostly in the Semi-arid and sub-humid regions.
The results also identified Fusarium verticillioides as the major contaminant of the infected maize
kernels. Fusarium verticillioides was distributed across the various towns in the semiarid regions,
indicating that it may be an endemic contaminant in maize grown in these regions. Fusarium poae and
Fusarium boothii were also isolated from the maize kernels. The F. boothii was isolated from samples
collected both in the semi-arid and sub-humid region in Bungoma while the F. poae was isolated from
maize kernels collected in the semi-arid regions.
46
Table 4-2 Pathogenic Fungi Species Identified
AEZ Region Town Code Pathogen Identity (ITS) Identity
(TEF 1- alpha)
Humid (H) Central Nyeri CN.Tetu
CN.Tetu1
Nigrospora oryzae
Lasiodiplodia theobromae
99%
100%
-
-
Sub Humid (SH) Western Bungoma WB.Makhonge
WB.Makhonge1
Mucor nidicola
Fusarium boothii
99%
99%
-
100%
Kisumu Nigrospora oryzae 99% -
Semi-Arid (SA) Eastern Tala ET.Tala1
ET.Tala
Fusarium verticillioides
Giberrella moniliformis
99%
99%
99%
99%
Kagundo EK.Mbilini
EK.Mbilini1
EK.Kitwii
Fusarium poae
Fusarium boothii
Fusarium verticillioides
100%
99%
99%
100%
99%
100%
Matungulu ET. Matungulu Phoma herbarum
Fusarium poae
100%
100%
-
100%
Ithanga MG.Ithanga
MG.Ithanga1
Lasiodiplodia theobromae
Fusarium verticillioides
100%
100%
-
99%
SemiArid-SemiHumid (SaSh) Central Laikipia RL.Kieni Nigrospora oryzae 100% -
47
Table 4-3 Distribution of Fungi identified from sampled bags
Pathogen
Regions Sampleda
Nyeri
(H)
Bungoma
(SH)
Kisumu
(SH)
Kagundo
(Mbilini)
(SA)
Kagundo
(Kitwii)
(SA)
Matungulu
(SA)
Ithanga
(SA)
Tala
(SA)
Laikipia
(SaSh)
Total Samples
Fusarium verticillioides - - - 2 3 3 3 3 3 14
Fusarium poae - 1 - 4 - 3 - - - 5
Fusarium boothii - 3 - 2 - - 2 - - 7
Lasiodilpodia theobromae 2 - - - - - 2 - - 4
Mucor nidicola - 1 - - - - - - - 1
Nigrospora oryzae 3 - 3 - - - - - 2 8
Phoma herbarum - - - - - 3 - - - 3
Total Bags Sampledb 3 3 3 3 3 3 3 3 3 27 a Towns maize kernels were collected according to the different AEZs b From each town a sub-sample of maize kernels were plated from 3/5 bags collected
48
4.3.2 Screening for the ability to produce Mycotoxins
The primer pairs tri13F/R used were designed by comparing the published sequences for this gene
from known NIV and DON-producers (Accession# AF336365, AF366366, and AY057841–
AY057844). Tri13 and Tri17 genes are responsible for oxygenation and acetylation of the C-4 residue
of the trichothecene backbone respectively. They are used to identify the putative chemotype of each
of the isolates. DNA from isolates were subjected to PCRs with the primer pairs, and each of these
DNAs generated amplicons with fragments of sizes 415bp and 234bp (Waalwijk et al., 2003).
The isolates Fusarium poae and Fusarium boothii generated a 415bp fragment (NIV-producers) and a
fragment of 234bp (DON-producers) respectively.
Figure 4-3 Chemotypes for Fusarium boothii (rep1) Ekm.001, (rep2) WBm.001b and Fusarium poae (rep1)
Mg.001, (rep2) Ekm.003H
The Fusarium isolates were identified as B-Type trichothecenes producers’; Fusarium boothii
classified as 15ADON chemotype; the Fusarium poae isolates were both from the semi-arid regions,
and only one isolate was successfully identified as a NIV chemotype. This suggests that maize in the
semi-arid and humid regions is most likely to be contaminated with B-Type trichothecenes particularly
NIV + acetylated derivatives and DON+15ADON. Fusarium boothii and Fusarium poae are members
of the FGSC species which are known to produce B-Type trichothecenes such as deoxynivalenol
(DON, known as vomitoxin), nivalenol (NIV) and their acetylated derivatives (Ward et al., 2002).
49
5 CHAPTER FIVE: DISCUSSION
The maize samples from the semi-arid and sub-humid zones were highly contaminated with members
of Fusarium graminearum species complex (FGSC) and the Fusarium fujikuroi species complex
(FFSC). The study successfully identified Fusarium poae, Fusarium verticillioides, Fusarium boothii
as the major mycotoxin producing fungi from the collected maize samples. Fusarium verticillioides
(FFSC strain) was predominant (33%), followed by FGSC strains: Fusarium boothii (17%) and
Fusarium poae (12%). The results correspond with findings of Muthomi and Mutitu (2003); Fusarium
spp. was isolated at high frequencies in cereal grain (wheat). In addition, a field survey conducted for
Fusarium spp. in the major maize-growing areas of Kenya in 1993 found F. moniliforme to be
predominant (82% of isolates from maize), followed by F. graminearum (9% of isolates) and F.
subglutinans which was 7% of isolates (Kedera, 1994).
Wagacha et al., (2010) reported the occurrence of 19 different Fusarium species in wheat in Kenya
with F. boothii, F. poae, F scirpi, F. chlamydosporum, F. graminearum, and F. anthrosporioides
accounting for 80% of contamination. MacDonald and Chapman (1997) also reported a high incidence
of F. graminearum (9% of the kernels tested) and of F. moniliforme (14% of the kernels tested), in a
survey of maize grain purchased from market stalls and roadside traders in central and western Kenya.
Studies hence indicate that Fusarium spp. is a predominant pathogen in Kenyan maize.In addition,
they suggest that the FGSC and FFSC strains are endemic in Kenya. Futhermore, O’Donell et al.,
(2008) identified a new species in Ethiopia (F. aethiopicum) which produce 15ADON.
Pathogenic and mycotoxin-producing Fusarium species isolated from the maize kernels: F.
verticillioides, F.boothii, and F. poae suggests that infection in the sampled regions is due to a
complex of Fusarium species. According to Marasas (1991), F. graminearum, F. poae, and F.
verticillioides are considered the most toxic Fusarium species. F. graminearum complex which
includes Fusarium boothii is the most significant producer of DON and ZEA. The multiple
contaminations of maize with different mycotoxigenic fungi indicate a potential risk of contamination
of the grain with various mycotoxins like trichothecenes, T-2 toxin, zearalenone, fumonisins,
moniliformin.
50
The major mycotoxins that contaminate small-grain cereals are the typeA trichothecenes T-2 and HT-
2, primarily produced by F. poae and the typeB trichothecenes DON (or vomitoxin) and NIV
produced mainly by F. graminearum. Comparative analysis of the gene clusters associated with the
biosynthesis, in DON-producers and NIV-producer, identify the genes tri13 and tri7 as vital in the
synthesis of either NIV or DON. Gene sequences from both genes were used to develop primers that
were utilized to screen Fusarium boothii and Fusarium poae chemotypes, characterizing them as
DON- and NIV-producers respectively. (Waalwijk et al., 2003)
Harvested maize grains in the tropical zones are infected and invaded by mycelium and spores of
diverse group of pathogenic fungal species including mainly Fusarium, Aspergillus and Penicillium
that can come into contact, grow and compete for food when the environmental conditions are
favorable. Many research studies have highlighted the interaction of Fusarium species with other
fungi. Findings from Velluti et al. (2000) showed that populations of F. verticillioides and F.
proliferatum, the most important fumonisin producers, are markedly reduced by the presence of F.
graminearum , and that fumonisin B1(FB1) production by them can be significantly inhibited as well
in the presence of F. graminearum.
On the other hand, Marin et al. (1998) found that F. verticillioides and F. proliferatum are generally
very competitive and dominant against Aspergillus flavus and Penicillium spp. especially at a water
activity of more than 0.96. This inhibition can lead to significantly reduced aflatoxin contamination in
infected grains (Zummo and Scott, 1992). This may be indicated by the higher incidence of Fusarium
verticillioides in the maize samples and lack of Aspergillus flavus and Penicillium spp in the isolates.
Though this too could be explained by the size of the samples collected.
Fusarium verticillioides is an endophyte of maize that has long-term associations with the host plant.
Therefore, the symptomless infection can exist throughout the plant in leaves, stems, roots, grains, and
its presence as in many cases ignored since it does not cause visible damage to the plant. Hence, this
indicates that some strains of F. verticillioides may produce disease in maize while others do not. The
strain infects corn at all stages of development, either via infected seeds, the silk channel or wounds,
causing grain rot during both the pre- and postharvest periods. F. verticillioides strains are high
fumonisin, producers. This appeals for more attention and suggests that farmers should adopt adequate
postharvest management procedures to assure satisfactory quality of the stored maize.
51
The Fusarium trichothecenes have been divided into type A trichothecenes, characterized by a
functional group other than a ketone at C-8, and type B- trichothecenes with only the carbonyl at C-8.
The type A trichothecenes include T2 and HT2, mainly produced by strains of F. sporotrichioides, F.
acuminatum, and F. poae (Logrieco et al., 2002). Fusarium graminearum species complex comprised
of at least nine distinct, cryptic species including Fusarium acaciae-mearnsii, F. asiaticum, F.
austroameri-canum, F. boothii, F. meridonale, F. mesoamericanum. Members of this complex are
known to produce mycotoxins including the trichothecenes deoxynivalenol (DON) along with its
acetylated derivatives and nivalenol (Goswami et al., 2005).
The co-occurrence of the different Fusarium mycotoxins may result in additive and synergistic effects.
Multiple mycotoxins may lead to synergistic toxicity which is greater than the total of the toxicities of
each mycotoxin (Speijers, 2004). The number and type of mycotoxins in a sample depends on
Fusarium strains present and their toxigenicity as well as environmental factors. The legislative limits
for Fusarium mycotoxins range from 500μg/kg-2000μg/kg for deoxynivalenol, 30-1000μg/kg for
zearalenone and 100μg/kg for T-2 toxin. This implies that the Kenyan maize products could be
contaminated with low but significant levels of the Fusarium mycotoxins.
.
52
6 CHAPTER SIX: CONCLUSIONS AND RECOMMENDATIONS
This research study suggests that Fusarium graminearum species complex (FGSC) and the Fusarium
fujikuroi species complex (FFSC) are the principal contaminants of maize grain in Kenya. More than
50% of the samples tested were infected with Fusarium species which usually produce a broad range
of toxins specifically trichothecenes (Type A and Type B), zearalenone and fumonisins. This
underscores the need for more vigilance and implementation of preventive measures that reduce the
risk of toxin accumulation in the field and contaminated maize. There is still insufficient information
available on the occurrence of Fusarium spp. and its toxins in Kenya; focus has been mainly on
aflatoxin control.
Few African countries with the exception of South Africa, have conducted research studies on FGSC
and FFSC diversity in cereal grains. Most of these studies mainly are based on random surveys of
farmers’ stores and informal markets with data measurements based on small numbers of samples
(Shephard et al., 1996). This too is a limitation in this research study. However to be saluted are efforts
investigating fumonisins contamination in maize and maize-based foods in some African countries:
Benin, Cameroon, Ghana, Kenya, Zambia and Zimbabwe, Tanzania (Shephard et al., 1996; Kimanya
et al.2010; Doko et al., 1995; Hell et al., 1995; Kedera et al., 1999; Ngoko et al., 2001). Though, there
is still a great need for more investigations on the continent, mainly in the maize production and
consumption zones.
Planting improved maize cultivars, combined with good crop management and post-harvest handling
practices should be explored to deter the proliferation of fungal species and reduce the risk of
mycotoxins contamination. Novel control strategies should be further investigated and applied in the
field rather than in artificial media. The use of an endophytic bacterium (Bacillus mojavensis) as a
biological control agent on maize seed (Bacon and Hinton, 2000) and the use of non-mycotoxin
producing strains of F. verticillioides aiming to minimise fumonisin levels in maize (Plattner et al.,
2000) has been reported. Additional investigations are however needed to render some of those
technologies more applicable and feasible for use by farmers in the field.
53
Recently essential oils (Table 2-7) have been proposed for application post-harvest to prevent both
fungal growth and mycotoxin production after positive evaluation of their effects on artificial media.
These effects, however, may not be translated to the same extent on the actual food product owing to
interactions that may occur in the more complex food matrix compared to those in artificial media. But
could they be an option as a dietary strategy?
PCR-based detection and identification provides qualitative information about the presence or absence
of a certain fungus and provides a cheaper option. This can be used for food and feed quality control
as the technology has the power to provide insight into the mycotoxigenic potential of samples
analysed. This information can then be used to decide whether a lot should go further down the
process of production or should be retained for further analysis of mycotoxins. The emerging topic of
conjugated mycotoxins is also of great interest especially with the current technologies in plant
breeding resistant varieties. Host plant for fungi is constantly changing as plants are being bred for
fungi/toxin resistance and different nutrient profile; hence continually new masked toxins are being
discovered. It is essential to investigate infection pathways of pathogenic fungi, as this is the basis of
good management and postharvest handling practices.
Biocontrol, resistance breeding still remain as important strategies to minimize chronic exposure to
mycotoxins in the developing world. The aflasafe biocontrol method can reduce aflatoxin
contamination in corn and groundnuts by 80–90%, in some cases even as much as 99% (IITA, 2011).
Further investigation on the biocontrol potential of atoxigenic Fusaria strains is recommended.
A significant challenge is the lack of consistent standards in African countries and elsewhere in the
world, it is important that governments support the development of harmonized standards in the region.
Dietary diversification by the Kenyan population, reducing reliance on the maize crop has been
suggested. This is not a realistic mitigation measure in the communities whose maize cultivation and
consumption is heavily embedded in their cultural norms.
54
LIST OF REFERENCES
Abass, A. B., Ndunguru, G., Mamiro, P., Alenkhe, B., Mlingi, N., & Bekunda, M. (2014). Post-harvest
food losses in a maize-based farming system of semi-arid savannah area of Tanzania. Journal of
Stored Products Research, 57, 49-57
Adejumo, T. O., Hettwer, U., & Karlovsky, P. (2007). Occurrence of Fusarium species and
trichothecenes in Nigerian maize. International journal of food microbiology, 116(3), 350-357.
Aldred, D., Magan, N., & Olsen, M. (2004). The use of HACCP in the control of mycotoxins: the case
of cereals. Mycotoxins in food: detection and control. Boca Raton, Fla.: CRC Press. p, 139-73.
Aoki, T., Ward, T. J., Kistler, H. C., & O’Donnell, K. (2012). Systematics, phylogeny and
trichothecene mycotoxin potential of Fusarium head blight cereal pathogens. Mycotoxins, 62(2), 91-
102.
Atehnkeng, J., Ojiambo, P. S., Ikotun, T., Sikora, R. A., Cotty, P. J., & Bandyopadhyay, R. (2008).
Evaluation of atoxigenic isolates of Aspergillus flavus as potential biocontrol agents for aflatoxin in
maize. Food Additives and Contaminants, 25(10), 1264-1271.
Bakan, B., Bily, A. C., Melcion, D., Cahagnier, B., Regnault-Roger, C., Philogène, B. J., & Richard-
Molard, D. (2003). Possible role of plant phenolics in the production of trichothecenes by Fusarium
graminearum strains on different fractions of maize kernels. Journal of agricultural and food
chemistry, 51(9), 2826-2831.
Bankole, S., Schollenberger, M., & Drochner, W. (2006). Mycotoxins in food systems in Sub-Saharan
Africa: A review. Mycotoxin Research, 22(3), 163-169.
Bankole, S. A., & Adebanjo, A. (2004). Mycotoxins in food in West Africa: current situation and
possibilities of controlling it. African Journal of Biotechnology, 2(9), 254-263.
Barnett H. L., Barry B., Hunter F. (1998). Illustrated Genera of Imperfect Fungi (4th Ed.). American
Pathology Society. USA
Bhat R.V, Shetty P.H, Rao P.A, Rao VS. (2010). A foodborne disease outbreak due to the
consumption of moldy sorghum and maize containing fumonisin mycotoxins. Journal of Clinical
Toxicology. 1997; 35: 249–55.
55
Bryden, L.W. (2009). Mycotoxins and mycotoxicosis, significance, occurrence and mitigation in the
food chain. General, Applied and Systems Toxicology, 3:6
Cairns-Fuller, V. (2004). Dynamics and control of ochratoxigenic strains of Penicillium verrucosum
and Aspergillus ochraceus in the stored grain ecosystem (Doctoral Dissertation, Cranfield University).
CDC (Centers for Disease Control and Prevention) 2004. Outbreak of aflatoxin poisoning—eastern
and central provinces, Kenya, January–July 2004.
CIMMYT, International Maize and Wheat Improvement Center, (2009). Effective Grain Storage for
Better Livelihoods of African Farmers Project. http://www.cimmyt.org/fr/programs-and-units/global-
maize-program/projects/effective grain-storage-project (accessed 12th June 2015)
Creppy, E.E. (2002). Update of the survey, regulation and toxic effects of mycotoxins in Europe.
Toxicology Letters, 127, 1–3, 19–28
Daniel, J. H., Lewis, L. W., Redwood, Y. A., Kieszak, S., Breiman, R. F., Flanders, W. D. &
McGeehin, M. A. (2011). Comprehensive Assessment of Maize Aflatoxin Levels in Eastern Kenya.
Environmental health perspectives, 119(12), 1795.
De Boevre, M., Jacxsens, L., Lachat, C., Eeckhout, M., Di Mavungu, J. D., Audenaert, K. & De
Saeger, S. (2013). Human exposure to mycotoxins and their masked forms through cereal-based foods
in Belgium. Toxicology letters, 218(3), 281-292.
Delgado, J.E., & Wolt, J.D. (2010). Fumonisin B1 and implications in nursery swine productivity: A
quantitative exposure assessment. Journal of Animal Science, 88(11) 3767-3777.
Doko, M.B., Canet, C., Brown, N., Sydenham, E.W., Mpuchane, S., & Siame., A.B. (1996).Natural
co-occurrence of fumonisins and zearalenone in cereals and cereal-based foods from Eastern and
Southern Africa. Journal of Agriculture and Food Chemistry, 44, 3240–3243.
EFSA CONTAM Panel (EFSA Panel on Contaminants in the Food Chain), 2014. Scientific Opinion
on the risks to human and animal health related to the presence of modified forms of certain
mycotoxins in food and feed. Europen Food Safety Authority.
56
Ellis, W.O., Smith, J.P., Simpson, B.K., Khanizadeh, S., & Oldham, J.H. (1993). Control of growth
and aflatoxin production by Aspergillus flavus under modified atmosphere packaging (MAP)
conditions. Food Microbiology, 10(1), 9-21.
Ellis, W.O., Smith, J.P., Simpson, B.K., Ramswamy, H., Doyon, G. (1994). Growth of and aflatoxin
production by Aspergillus flavus in peanuts stored under modified atmosphere packaging (MAP)
conditions. International Journal of Food Microbiology, 22(2), 173-187.
Fandohan, P., Gnonlonfin, B., Hell, K., Marasas, W. F. O., & Wingfield, M. J. (2005). Natural
occurrence of Fusarium and subsequent fumonisin contamination in pre-harvest and stored maize in
Benin, West Africa. International journal of food microbiology, 99(2), 173-183.
Gamanya, R., & Sibanda, L. (2001). Survey of Fusarium moniliforme (F. verticillioides) and
production of fumonisin B 1 in cereal grains and oilseeds in Zimbabwe. International journal of food
microbiology, 71(2), 145-149.
Gitonga, Z., De Groote, H., & Tefera, T. (2015). Metal silo grain storage technology and household
food security in Kenya. Journal of Development and Agricultural Economics, 7(6), 222-230.
Gitu K. W. (2006).Agricultural Development and Food Security in sub-Saharan Africa (SSA).
Building a case for more Public Support. The Case of Kenya. Working Paper No.03.Rome.
Golob, P. (2007). On-farm mycotoxin control in food and feed grain (Vol. 1). Food & Agriculture
Org.
Gong, Y. Y., Torres-Sanchez, L., Lopez-Carrillo, L., Peng, J. H., Sutcliffe, A. E., White, K. L., ... &
Wild, C. P. (2008). Association between tortilla consumption and human urinary fumonisin B1 levels
in a Mexican population. Cancer Epidemiology Biomarkers & Prevention, 17(3), 688-694.
Gong, Y., Hounsa, A., Egal, S., Turner, P. C., Sutcliffe, A. E., Hall, A. J., ... & Wild, C. P. (2004).
Postweaning exposure to aflatoxin results in impaired child growth: a longitudinal study in Benin,
West Africa. Environmental Health Perspectives, 1334-1338.
Gong, Y. Y., Cardwell, K., Hounsa, A., Egal, S., Turner, P. C., Hall, A. J., & Wild, C. P. (2002).
Dietary aflatoxin exposure and impaired growth in young children from Benin and Togo: cross
sectional study. Bmj, 325(7354), 20-21.
57
Goswami, R. S., and Kistler, H. C. (2005). Pathogenicity and in planta mycotoxin accumulation
among members of the Fusarium graminearum species complex on wheat and rice. Phytopathology
95:1397-1404
Groopman, J. D., Kensler, T. W., & Wild, C. P. (2008). Protective interventions to prevent aflatoxin-
induced carcinogenesis in developing countries. Annu. Rev. Public Health, 29, 187-203.
Haighton, L.A., Lynch, B.S., Magnuson, B.A., & Nestmann, E.R. (2012).A reassessment of risk
associated with dietary intake of ochratoxin A based on a lifetime exposure model. Critical Review in
Toxicology, 42(2), 147-68
Hamid, A.S., Tesfamariam, I.G., Zhang, Y., & Zhang, Z.G. (2013). Aflatoxin B1-induced
hepatocellular carcinoma in developing countries: Geographical distribution, mechanism of action and
prevention (Review). Oncology Letters, 5(4), 1087-1092.
Hell, K., Cardwell, K.F., & Poehling, H –M. (2003). Relationship between management practices
fungal infection and aflatoxin for stored maize in Benin. Journal of Phytopathology, 151(11-12), 690-
698.
Hell, K., Mutengi, C., & Fandohan, P. (2010). Aflatoxin control and prevention strategies in maize for
sub- Saharan Africa. Julius-Kühn-Archiv, (425), S-534.
Hodges, R. J., & Maritime, C. (2012). Post-harvest Weight Losses of Cereal Grains in Sub-Saharan
Africa.
Humpf, H., & Voss, A.K. (2004). Effects of thermal food processing on the chemical structure and
toxicity of fumonisin mycotoxins. Molecular Nutrition and Food Research,48 (4), 255–269.
International Agency for Research on Cancer (IACRC), (1993). Monographs on the evaluation of
carcinogenic risks to humans. Some naturally occurring substances: food items and constituents.
Heterocyclic Aromatic Amines and Mycotoxins, 56, 445-466.
International Agency for Research on Cancer (IARC), (2002), Fumonisin B1. Some Traditional
Herbal Medicines, Some Mycotoxins, Naphthalene, and Styrene. IARC Monographs on the
Evaluation of Carcinogenic Risks to Humans, 82,301–366.
58
IITA. Annual Report 2011. Croydon, UK: International Institute of Tropical Agriculture (2011).
Available: http://goo.gl/Oax5fI (accessed 2nd August 2015).
IITA Report (2013).Tackling killer aflatoxins in African food crops. www.iita.org aflasafe. Available:
www.aflasafe.com. (accessed 18th August 2015).
Jiang, Y. I., Jolly, P. E., Ellis, W. O., Wang, J. S., Phillips, T. D., & Williams, J. H. (2005). Aflatoxin
B1 albumin adduct levels and cellular immune status in Ghanaians. International Immunology, 17(6),
807-814.
Kabak, B., Dobson, A.D. & Var, I.I.L. (2006). Strategies to prevent mycotoxin contamination of food
and animal feed: a review. Critical Reviews in Food Science and Nutrition, 46(8), 593-619.
Kellerman, T. S., Marasas, W. F., Pienaar, J. G., & Naude, T. W. (1972). A mycotoxicosis of equidae
caused by Fusarium moniliforme sheldon. A preliminary communication. The Onderstepoort journal
of veterinary research, 39(4), 205-208.
Kimanya, M., De Meulenaer, B., Tiisekwa, B., Ndomondo-Sigonda, M., & Kolsteren, P. (2008).
Human exposure to fumonisins from homegrown maize in Tanzania. World Mycotoxin Journal, 1(3),
307-313
Kimanya, M.E., De Meulenaere, B., Roberfoid, D., Lachat, C., & Kolsteren, P. (2010). Fumonisin
exposure through maize in complementary foods is inversely associated with linear growth of infant in
Tanzania. Molecular Nutrition and Food Research, 54, 1659-1667.
Kimanya, M.E., De Meulenaere, B., Tiisekwa B., Ugullum C., Devlieghere, F., Van Camp, J.,
Sampundo, S., & Kolsteren, P. (2009). Fumonisins exposure from freshly harvested and stored maize
and its relationship with traditional agronomic practices in Rombo district, Tanzania. Food Additive
and Contamination: Part A, 26 ( 8) 1199–1208.
Kimura, M., Tokai, T., Takahashi-Ando, N., Ohsato, S., & Fujimura, M. (2007). Molecular and
genetic studies of Fusarium trichothecene biosynthesis: pathways, genes, and evolution. Bioscience,
biotechnology, and biochemistry, 71(9), 2105-2123.
Kimura, M., Tokai, T., O’Donnell, K., Ward, T. J., Fujimura, M., Hamamoto, H., ... & Yamaguchi, I.
(2003). The trichothecene biosynthesis gene cluster of Fusarium graminearum F15 contains a limited
number of essential pathway genes and expressed non-essential genes. FEBS letters, 539(1), 105-110.
59
Krishnamachari, K. A. V. R., Nagarajan, V., Bhat, R., & Tilak, T. B. G. (1975). Hepatitis due to
aflatoxicosis: an outbreak in western India. The Lancet, 305(7915), 1061-1063.
Kimenju, S. C., De Groote, H., & Hellin, H. (2009). Preliminary Economic Analysis: Cost-
effectiveness of the use of improved storage methods by small-scale farmers in east and southern
Africa countries. International Maize and Wheat Improvement Center (CIMMYT), 17.
Lewis, L., Onsongo, M., Njapau, H., Schurz-Rogers, H., Luber, G., Kieszak, S., ... & Kenya
Aflatoxicosis Investigation Group. (2005). Aflatoxin contamination of commercial maize products
during an outbreak of acute aflatoxicosis in eastern and central Kenya. Environmental Health
Perspectives, 1763-1767.
Logrieco A., G. Mulè, A. Moretti, (2002) Toxigenic Fusarium Species and Mycotoxins Associated
with Maize Ear Rot in Europe. European Journal of Plant Pathology, 2002, Volume 108, Number 7,
Page 597.
MacDonald, M. V., & Chapman, R. (1997). The incidence of Fusarium moniliforme on maize from
Central America, Africa, and Asia during 1992–1995. Plant Pathology, 46(1), 112-125.
Magan, N., Hope, R., Cairns, V., & Aldred, D. (2003). Post-harvest fungal ecology: Impact of fungal
growth and mycotoxin accumulation in stored grain. European Journal of Plant Pathology, 109: 723–
730.
Marasas, W. F., Kellerman, T. S., Gelderblom, W. C., Coetzer, J. A., Thiel, P. G., & Van der Lugt, J.
J. (1988). Leukoencephalomalacia in a horse induced by fumonisin B1 isolated from Fusarium
moniliforme. The Onderstepoort journal of veterinary research, 55(4), 197-203.
Marasas, W.F.O., Nelson, P. E., & Toussoun, T.A. Toxigenic Fusarium species, Identity, and
Mycotoxicology, (1984).
Marin, S., Companys, E., Sanchis, V., Ramos, A. J., & Magan, N. (1998). Effect of water activity and
temperature on competing abilities of common maize fungi. Mycological Research, 102(08), 959-964.
Miller, J.D. (2008). Mycotoxins in small grains and maize: old problems, new challenges. Food
Additives and Contaminants, 25(2), 219-230.
60
Muthama J, Muthomi W, Njenga LN, Gathumbi JK, Chemining wa G.N. (2009). The occurrence of
aflatoxins in maize and distribution of mycotoxin-producing fungi in Eastern Kenya. Plant Pathol. J.,
8(3): 113-119.
Muriuki, G. K., & Siboe, G. M. (1995). Maize flour contaminated with toxigenic fungi and
mycotoxins in Kenya. African journal of health sciences, 2(1), 236-241.
Muthomi, J. W., Ndung’u, J. K., Gathumbi, J. K., Mutitu, E. W., & Wagacha, J. M. (2008). The
occurrence of Fusarium species and mycotoxins in Kenyan wheat. Crop Protection, 27(8), 1215-1219.
National Center for Biotechnology Information database (2015).
http://blast.ncbi.nlm.nih.gov/blast/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome
Ngindu, A., Kenya, P., Ocheng, D., Omondi, T., Ngare, W., Gatei, D., ... & Siongok, T. A. (1982).
Outbreak of acute hepatitis caused by aflatoxin poisoning in Kenya. The Lancet, 319(8285), 1346-
1348.
Nguefack, J., Leth, V., Amvam Zollo, P.H., Mathur, S.B. ( 2004). Evaluation of five essential oils
from aromatic plants of Cameroon for controlling food spoilage and mycotoxin producing fungi.
International Journal of Food Microbiology, 94(3), 329-334.
O’Donnell, K., Nirenberg, H. I., Aoki, T., & Cigelnik, E. (2000). A multigene phylogeny of the
Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species.
Mycoscience, 41(1), 61-78.
O’Donnell, K., Ward, T. J., Geiser, D. M., Kistler, H. C., & Aoki, T. (2004). Genealogical
concordance between the mating type locus and seven other nuclear genes supports formal recognition
of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal genetics and
biology, 41(6), 600-623.
O’Donnell, K., Rooney, A. P., Proctor, R. H., Brown, D. W., McCormick, S. P., Ward, T. J., ... &
Geiser, D. M. (2013). Phylogenetic analysis of RPB1 and RPB2 support a middle Cretaceous origin
for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology,
52, 20-31.
61
O'Donnell, K., Sutton, D. A., Fothergill, A., McCarthy, D., Rinaldi, M. G., Brandt, M. E., ... & Geiser,
D. M. (2008). Molecular phylogenetic diversity, multilocus haplotype nomenclature, and in vitro
antifungal resistance within the Fusarium solani species complex. Journal of Clinical Microbiology,
46(8), 2477-2490.
Okoth, S., Nyongesa, B., Ayugi, V., Kang'ethe, E., Korhonen, H., & Joutsjoki, V. (2012). Toxigenic
Potential of Aspergillus species occurring on maize kernels from two agroecological zones in Kenya.
Toxins, 4(11), 991-1007.
Oswald, I. P., Marin, D. E., Bouhet, S., Pinton, P., Taranu, I., & Accensi, F. (2005).
Immunotoxicological risk of mycotoxins for domestic animals. Food additives and contaminants,
22(4), 354-360.
Palencia, E., Torres, O., Hagler, W., Meredith, F. I., Williams, L. D., & Riley, R. T. (2003). Total
fumonisins are reduced in tortillas using the traditional nixtamalization method of Mayan
communities. The Journal of nutrition, 133(10), 3200-3203.
Peterson, S. W., Ito, Y., Horn, B. W., & Goto, T. (2001). Aspergillus bombycis, a new aflatoxigenic
species and genetic variation in its sibling species, A. nomius. Mycologia, 689-703.
PROMEC; Programme on Mycotoxins and Experimental Carcinogenesis (2001) Aflatoxin in Peanut
Butter. Policy Brief No. 3 May 2001. http://www.mrc.ac.za/policybriefs/polbrief3.htm. (7 July 2015,
date last accessed). South African Medical Research Council, Tygerberg, South Africa.
Proctor, R. H., Plattner, R. D., Brown, D. W., Seo, J. A., & Lee, Y. W. (2004). Discontinuous
distribution of fumonisin biosynthetic genes in the Gibberella fujikuroi species complex. Mycological
Research, 108(07), 815-822.
Reddy, K. R. N., Abbas, H. K., Abel, C. A., Shier, W. T., Oliveira, C. A. F., & Raghavender, C. R.
(2009). Mycotoxin contamination of commercially important agricultural commodities. Toxin
Reviews, 28(2-3), 154-168.
Richard, E., Heutte, N., Bouchart, V., & Garon, D. (2009). Evaluation of fungal contamination and
mycotoxin production in maize silage: Short communication. Animal Feed Science and Technology,
148,309-320.
62
Ruadrew, S., Craft, J., & Aidoo, K. (2013).Occurrence of toxigenic Aspergillus spp. and aflatoxins in
selected food commodities of Asian origin sourced in the West of Scotland. Food and Chemical
Toxicology, 55, 653-658.
Samapundo, S., Devlieghere, F., & De Meulenaer, B. (2006). Post-harvest strategies for the prevention
of fungal growth and mycotoxin production in corn; Thesis submitted in fulfillment of the
requirements for the degree of doctor (Ph.D.) in Applied Biological Sciences. Faculty of Bioscience
Engineering, University of Ghent.
Sarver, B. A., Ward, T. J., Gale, L. R., Broz, K., Kistler, H. C., Aoki, T., ... & O’Donnell, K. (2011).
Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical
concordance. Fungal Genetics and Biology, 48(12), 1096-1107.
Starkey, D. E., Ward, T. J., Aoki, T., Gale, L. R., Kistler, H. C., Geiser, D. M., ... & O’Donnell, K.
(2007). Global molecular surveillance reveals novel Fusarium head blight species and trichothecene
toxin diversity. Fungal genetics and biology, 44(11), 1191-1204.
Shephard, G. S. (2008). Risk assessment of aflatoxins in food in Africa. Food Additives and
Contaminants, 25(10), 1246-1256.
Schmidt, C. W. (2013). Breaking the Mold: New Strategies for Fighting Aflatoxins. Environmental
health perspectives, 121(9), A270.
Speijers, G. J. A., & Speijers, M. H. M. (2004). Combined toxic effects of mycotoxins. Toxicology
letters, 153(1), 91-98.
Sydenham, E. W., Thiel, P. G., Marasas, W. F., Shephard, G. S., Van Schalkwyk, D. J., & Koch, K. R.
(1990). Natural occurrence of some Fusarium mycotoxins in corn from low and high esophageal
cancer prevalence areas of the Transkei, Southern Africa. Journal of Agricultural and Food Chemistry,
38(10), 1900-1903.
Sumner, E.P. & Lee, D. (2009). Reducing Aflatoxin in Corn during Harvest and Storage. College of
Agricultural and Environmental Sciences, B1231.
Tang, L., Tang, M., Xu, L., Luo, H., Huang, T., Yu, J., ... & Wang, J. S. (2008). Modulation of
aflatoxin biomarkers in human blood and urine by green tea polyphenols intervention. Carcinogenesis,
29(2), 411-417.
63
Turner, N. W., Subrahmanyam, S., & Piletsky, S.A. (2009). Analytical methods for determination of
mycotoxins: a review. Analytica Chimica Acta, 632(2),168-180.
Turner, P. C., Sylla, A., Gong, Y. Y., Diallo, M. S., Sutcliffe, A. E., Hall, A. J., & Wild, C. P. (2005).
Reduction in exposure to carcinogenic aflatoxins by postharvest intervention measures in West Africa:
a community-based intervention study. The Lancet, 365(9475), 1950-1956.
Van Der Westhuizen, L., Shephard, G. S., Gelderblom, W. C. A., Torres, O., & Riley, R. T. (2013).
Fumonisin biomarkers in maize eaters and implications for human disease. World Mycotoxin Journal,
6(3), 223-232.
Velluti A., Marin S., Bettucci L., Ramos A.J, Sanchis V. (2000). The effect of fungal competition of
maize grain by Fusarium moniliforme, F.proliferatum and F. graminearum and on fumonisin B and
zearalenone formation. Int. J. Food Microbiol. 59: 59-66.
Waalwijk, C., Kastelein, P., de Vries, I., Kerényi, Z., van der Lee, T., Hesselink, T., ... & Kema, G.
(2003). Major changes in Fusarium spp. in wheat in the Netherlands. In Epidemiology of Mycotoxin
Producing Fungi (pp. 743-754). Springer Netherlands.
Wagacha, J. M., & Muthomi, J. W. (2008). Mycotoxin problem in Africa: current status, implications
to food safety and health and possible management strategies. International journal of food
microbiology, 124(1), 1-12.
Wagacha, J. M., Steiner, U., Dehne, H. W., Zuehlke, S., Spiteller, M., Muthomi, J., & Oerke, E. C.
(2010). Diversity in mycotoxins and fungal species infecting wheat in Nakuru District, Kenya. Journal
of Phytopathology, 158(7-8), 527-535.
Wambugu, P. W., Mathenge, P. W., Auma, E. O., & Van Rheenen, H. A. (2009). Efficacy of
traditional maize (Zea mays L.) seed storage methods in western Kenya. African Journal of Food,
Agriculture, Nutrition and Development, 9(4).
Wild, C. P., & Hall, A. J. (2000). Primary prevention of hepatocellular carcinoma in developing
countries. Mutation Research/Reviews in Mutation Research, 462(2), 381-393.
Williams, H.J., Phillips, D.T., Jolly, E.P., Stiles, K.J., Jolly, M.C., & Aggarwal, D. (2004). Human
aflatoxicosis in developing countries: a review of toxicology, exposure, potential health consequences,
and interventions1, 2, 3. American Journal of Clinical Nutrition, 80(5), 1106-1122.
64
Wu, F., & Khlangwiset, P. (2010). Health economic impacts and cost-effectiveness of aflatoxin-
reduction strategies in Africa: case studies in biocontrol and post-harvest interventions. Food Additives
and Contaminants, 27(4), 496-509.
Zinedine, A., Juan, C., Idrissi, L., & Mañes, J. (2007). Occurrence of ochratoxin A in bread consumed
in Morocco. Microchemical Journal, 87(2), 154-158.
Zummo N, Scott GE (1992). Interaction of Fusarium moniliforme and Aspergillus flavus on kernel
infection and aflatoxin contamination in maize ears. Plant Dis. 76: 771–773.