on may 30, 2020 by guest · 144 morphology during growth in supplemented mueller hinton broth...
TRANSCRIPT
FTT0831c/FTL_0325 contributes to Francisella tularensis cell division, maintenance of 1
cell shape, and structural integrity. 2
3
Gregory T. Robertsona, Elizabeth Di Russo Caseb§, Nicole Dobbsa, Christine Inglea, 4
Murat Balabana*, Jean Cellib+, Michael V. Norgarda# 5
6
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, 7
Texas 75390a; Laboratory of Intracellular Parasites, NIAID, National Institutes of Health 8
Rocky Mountain Laboratories, Hamilton, Montana 59840b 9
10
Running title. FTT0831c is required for cell integrity and virulence. 11
12
Key words. Francisella, Tularemia, Outer Membrane, Lipoprotein, Cell Wall, 13
Hypercytoxicity, OmpA, Altered morphology 14
15
# Corresponding author. Mailing address: Department of Microbiology, The 16
University of Texas Southwestern Medical Center, 6000 Harry Hines Boulevard, Dallas, 17
TX, 75390. 18
Phone: 214-633-0015. 19
FAX: 214-648-5905. E-mail: [email protected] 20
21
IAI Accepts, published online ahead of print on 28 April 2014Infect. Immun. doi:10.1128/IAI.00102-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
2
§Present address: Department of Microbial Pathogenesis and Immunology, Texas A & M 22
Health Science Center College of Medicine, Bryan, TX 77807. 23
24
*Present address: Department of Microbiology, Tumor and Cell Biology, Karolinska 25
Institutet, Nobels Vag 16, 171 77, Stockholm, Sweden. 26
27
+Present address: The Paul G. Allen School for Global Animal Health, College of 28
Veterinary Medicine, Washington State University, Pullman, WA 99164. 29
30
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
3
Abstract. 31
The Francisella FTT0831c/FTL_0325 gene encodes amino acid motifs to suggest it is a 32
lipoprotein and that it may interact with the bacterial cell wall as a member of the 33
OmpA-like protein family. Previous studies have suggested that FTT0831c is surface-34
exposed and required for virulence of Francisella tularensis by subverting the host 35
innate immune response (Mahawar et al., 2012. J. Biol. Chem. 287: 25216-29). We 36
also find that FTT0831c is required for murine pathogenesis and intramacrophage 37
growth of Schu S4, but propose a different model to account for the proinflammatory 38
nature of the resultant mutants. First, inactivation of FTL_0325 from LVS or 39
FTT0831c from Schu S4 resulted in temperature-dependent defects in cell viability 40
and morphology. Loss of FTT0831c was also associated with an unusual defect in LPS 41
O-antigen synthesis, but loss of FTL_0325 was not. Full restoration of these properties 42
was observed in complemented strains expressing FTT0831c in trans, but not in strains 43
lacking the OmpA motif, suggesting cell wall contact is required. Finally, growth of the 44
LVS FTL_0325 mutant in Mueller-Hinton broth at 37°C resulted in the appearance of 45
membrane blebs at the poles and midpoint, prior to the formation of enlarged round 46
cells that showed evidence of compromised cellular membranes. Taken together, these 47
data are more consistent with the known structural role of OmpA-like proteins in 48
linking the OM to the cell wall and, as such, maintenance of structural integrity 49
preventing altered surface exposure or release of TLR2 agonists during rapid growth 50
of Francisella in vitro and in vivo. 51
52
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
4
Abbreviations 53
UT Southwestern, University of Texas Southwestern Medical Center; LVS, live vaccine 54
strain; TLR2, Toll-like receptor 2; OMP, outer membrane protein; FPI, Francisella 55
pathogenicity island; PAMPs, pathogen-associated molecular pattern molecules; sMHB, 56
modified Mueller-Hinton broth; sMHA, modified Mueller-Hinton agar; LB, Luria-57
Bertani broth; CFU, colony forming unit; LPS, lipopolysaccharide; BSA, bovine serum 58
albumin; PBS, phosphate-buffered saline; TEM, transmission electron microscope; i.p., 59
intraperitoneally; i.n., intranasally; OD, optical density; FACS, fluorescence-activated 60
cell sorting; NF-κB, nuclear factor kappa-light-chain-enhancer of activated B cells; AIM2, 61
absent in melanoma 2; NLRP3, NLR-pyrin domain containing 3; Pr, Francisella rpsL 62
promoter; FCVs, Francisella-containing vacuoles; SAA, Surface accessibility assays. 63
64
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
5
Introduction 65
Francisella tularensis is a Gram-negative, facultative intracellular pathogen and 66
the causal agent of the lethal zoonotic disease tularemia (1). Two subspecies of F. 67
tularensis are the cause of the majority of human infections. Subspecies holartica is 68
present throughout the northern hemisphere and is responsible for the majority of human 69
infections, which are rarely fatal (1, 2). Subspecies tularensis is geographically restricted 70
to North America, is capable of causing acute disease following pulmonary exposure to 71
as few as 10 colony-forming units (CFU), and exhibits a human mortality rate of 30% 72
when untreated (1, 2). Natural exposure to tularemia is rare and usually is in the form of 73
exposure to infected animals, especially rodents and lagomorphs, or through the bites of 74
blood-feeding arthropods (3). However, because of its low infection dose and high 75
morbidity and mortality, especially following aerosol exposure, F. tularensis has been 76
designated by the Center’s for Disease Control as a Tier 1 biothreat agent with high 77
potential for illegitimate use. 78
It is generally believed that the highly infectious nature of the most virulent forms 79
of F. tularensis results from a combination of successful phagosomal escape and 80
intracellular replication, but also the ability to avoid or limit early innate immune 81
detection by the host (4). The former is dependent on genes contained within the 82
Francisella Pathogenicity Island (FPI), a cluster of 16-19 genes which are postulated to 83
encode a protein delivery system with distant sequence similarities to other known Type 84
VI secretion systems (5). In contrast, the factors that allow this pathogen to avoid early 85
innate immune detection are as yet poorly defined (6-11). This has led many 86
investigators to search for a bacterial factor or factors responsible for this early innate 87
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
6
immunosuppression. In one such study, Weiss and colleagues identified mutants of strain 88
F. tularensis subsp. novicida U112 that were attenuated in vivo and also hypercytotoxic 89
in tissue culture (12). A hypercytotoxic phenotype also results from loss of oppB 90
encoding a putative oligopeptide permease (13) or pepO which may encode a 91
metallopeptidase (13, 14). Similar observations were made for LVS deficient in folate 92
metabolism or pseudouridine synthase genes (15), mviN, a putative lipid flippase (16), 93
ripA, a cytoplasmic protein of unknown function (17), and kdhAB, encoding a Kdo 94
hydrolase (18) or for Schu S4 variants lacking genes involved in LPS O-antigen and 95
capsule biosynthesis (19). One interpretation of these results is that Francisella has the 96
ability to actively limit host cell death, and that modulation of these cell death pathways 97
involves a broad number of Francisella gene products. Another possibility is that each of 98
these individual mutations indirectly increases the overall cytotoxicity of the mutant 99
strain for unrelated reasons. Indeed, recent work by Peng and associates (20) has 100
demonstrated that multiple unrelated F. tularensis subsp. novicida U112 mutants, 101
including those lacking genes whose products are involved in LPS biosynthesis or encode 102
membrane proteins, were hypercytotoxic to macrophages in vitro, not because of loss of 103
immune evasion factors, but instead to increased intracytosolic bacteriolysis (resulting in 104
the heightened release of pathogen-associated molecular pattern molecules (PAMPs)). 105
Examination of these strains in vitro revealed aberrant cell morphology during growth in 106
minimal medium (20) which was similarly reported for wild-type LVS cultivated under 107
certain growth conditions (21). Ulland and associates reported similar morphological 108
abnormalities and hyperinflammasome activation for an LVS strain deficient in a putative 109
lipid flippase, mviN (16). In another example, LVS lacking kdhAB, a putative Kdo 110
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
7
hydrolase, stimulated TNF-α and IL-1β in a TLR2-dependent fashion in vivo, owing to 111
increased accessibility of surface proteins, possibly reflecting altered conformation of the 112
outer membrane (18). Together, these data were interpreted to mean that certain 113
conditions (specific mutations or growth conditions) alter surface characteristics, 114
structural integrity, or increase susceptibility to intracellular bacteriolysis in such a way 115
as to promote heightened exposure of otherwise inaccessible PAMPs to germline 116
encoded innate immune receptors. 117
FTT0831c/FTL_0325 encodes a putative lipoprotein and shares significant 118
homology (E values of 2.27e-3 to 4.10e-25 by BLAST) to orthologous proteins of the 119
OmpA-like protein family (22-25). Proteins bearing OmpA-like structural motifs 120
typically form tight, non-covalent interactions with the bacterial cell wall (26-28), and in 121
some instances contribute directly to bacterial cell division by forming a dynamic 122
molecular cross-bridge between the cell wall and the outer membrane (29). 123
FTT0831c/FTL_0325 is not predicted to adopt a porin-like structure and lacks obvious 124
motifs associated with other membrane spanning proteins such as β-barrels. 125
FTT0831c/FTL_0325 was previously reported to contribute to Francisella immune 126
evasion by interfering with cytosolic AIM2- and NLRP3-based inflammasome activation 127
and nuclear NF-κB signaling (30). However, this conclusion was based principally on 128
observations of hyper TLR2-dependent inflammatory stimulation following infection of 129
host cells with FTT0831c/FTL_0325-deficient bacteria and not on functional studies with 130
FTT0831 protein, per se (30). FTL_0325 was reported to be surface exposed and the 131
authors observed a modest, non-dose-dependent, effect on NF-κB signaling following 132
transfection of FTT0831c DNA into HEK293T cells (30). However, a precise immune 133
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
8
evasion mechanism was not presented. An LVS FTL_0325 mutant was also impaired for 134
virulence in mice and proved efficacious as a live attenuated vaccine to protect mice from 135
Schu S4-mediated death following subsequent intranasal (i.n.) challenge (31); thus 136
suggesting the inflammatory nature of the LVS FTL_0325 mutant has practical 137
implications as well. Herein we sought to re-evaluate the biological roles of 138
FTT0831c/FTL_0325 by first constructing deletion mutants in both the LVS and virulent 139
Schu S4 backgrounds. Our data support a role for FTT0831c in intracellular survival and 140
murine virulence of Schu S4, but we propose a different model to account for its 141
hyperinflammatory nature. We demonstrate that the loss of FTT0831c/FTL_0325 142
promotes profound temperature-dependent defects in cell viability and altered cell 143
morphology during growth in supplemented Mueller Hinton broth (sMHB) medium in 144
vitro and during cytosolic replication in BMDM in vivo. The latter step precedes 145
intracellular destruction in late forming LAMP-1-positive endosomes in vivo. We present 146
evidence that these temperature-dependent growth defects result at least partly from 147
altered cell division, culminating in the formation of highly irregular enlarged cells. 148
These and other properties including an unusual LPS O-antigen profile for the Schu S4-149
based, but not the LVS-based, FTT0831c/FTL_0325 mutants are more consistent with 150
this protein contributing to maintaining structural integrity, rather than acting to subvert 151
the innate immune response directly. 152
153
154
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
9
MATERIALS AND METHODS 155
Bacterial strains and culture conditions. F. tularensis subsp. tularensis strain 156
Schus S4 (CDC1001) was obtained from the Centers for Disease Control and Prevention 157
(Fort Collins, CO), in accordance with all federal and institutional select agent 158
regulations, and was manipulated under strict biosafety level 3 (BSL3) containment 159
conditions. F. tularensis subsp. holarctica strain LVS was obtained from Timothy Sellati 160
(Center for Immunology and Microbial Disease, Albany Medical College, Albany, NY) 161
and manipulated under BSL2 containment conditions. For routine cultivation, F. 162
tularensis was grown in sMHB, or on supplemented Mueller-Hinton agar (sMHA) (32). 163
A modified chocolate agar (CA+) agar was employed for initial recovery of 164
transconjugates (32) Brain Heart Infusion broth (BHI) was prepared as previously 165
described (33). E. coli DH5α was used for routine plasmid manipulation. E. coli S17.1 166
was used as a host for bacterial conjugation. Where needed, Francisella growth media 167
were supplemented with 200 mg/L hygromycin, 10 mg/L kanamycin, 100 mg/L 168
polymixin B, 25 mg/L ampicillin, or 16 mg/L vancomycin or 8 % (w/v) sucrose. E. coli 169
was grown using Luria-Bertani broth or agar further supplemented with 200 mg/L 170
hygromycin, 30 mg/L kanamycin, or 100 mg/L ampicillin, as required. Owing to a 171
marked growth restriction of Francisella strains lacking a functional FTT0831c gene, all 172
Francisella strains prepared in this work were routinely propagated at 30°C, except 173
where indicated. 174
Gene knockout and genetic complementation. Splicing-overlap extension 175
(SOE) PCR (34) was used to generate an FTT0831c or FTL_0325 deletion-insertion 176
cassette in which the majority of the coding region of the FTT0831c (FTL_0325 in LVS) 177
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
10
open reading frame (ORF) (encompassing nucleotides 2 to 1,168 of the 1,254 bp ORF) 178
was replaced with the FRT-flanked kanamycin resistance cassette (FRT-Pfn-kan-FRT) 179
from pLG66a (35). Details on the primer pairs used for this construction are available in 180
supplementary materials. Methods for SacB-based sucrose-assisted allelic replacement 181
and subsequent FLP-based excision of the FRT-flanked kanamycin-resistance cassette to 182
generate markerless FTT0831c or FTL_0325 deletion mutations (henceforth Δ0831 in 183
Schu S4 and Δ0325 in LVS) were as described previously (32). 184
For genetic complementation, the FTT0831c ORF was placed under control of the 185
Francisella rpsL promoter (Pr) by SOE PCR (34). PstI and BamHI sites, engineered into 186
the flanking primers, allowed directional cloning of the resultant Pr-FTT0831c into 187
plasmid pUC18T-mini-Tn7T (36) cut with the same enzymes to yield pTP414. Addition 188
of a BamHI-restricted kanamycin-resistance marker from pTP86 allowed selection for 189
integration of the Pr-FTT0831c mini-Tn7 transposon at attTn7 (37) following 190
electroporation into the LVS- and SchuS4-based Δ0831::FRT mutants carrying the 191
unstable helper plasmid pTP181 (32). The FTT0831c variant lacking the OmpA motif 192
was constructed by inverse PCR of plasmid pTP414 with primer pair GP276 193
TCCCCCGGGTGTTTCGATTAGATCAGGTCCTGTTTGTT and GP277 194
AAAAGTAGACTTATAGAGCAAATTGATAATATT. GP276 was designed to also 195
carry an engineered SmaI site (underlined) to facilitate religation after PCR amplification 196
and purification. This results in the addition of a single non-templated proline residue at 197
the site of the Asn67-Leu180 deletion. Addition of the kanamycin selection marker and 198
integration into attTn7 was otherwise as described above. 199
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
11
mCherry expressing Francisella were generated by placing a copy of the mCherry 200
ORFs under control of the Francisella rpsL promoter (PrpsL) in a derivative of the stable 201
hygromycin-resistant shuttle vector pMP831 (38) designated pTP266 (see supplementary 202
materials). The resultant vector (pTP388) was introduced into LVS Δ0325 by 203
electroporation followed by selection on sMHA supplemented with hygromycin. 204
Animal care and use. All procedures involving animals were approved by the 205
UT Southwestern Medical Center Institutional Animal Care and Use Committee and the 206
Biological and Chemical Safety Advisory Committee. Animals were housed in 207
microisolator cages at the UT Southwestern Animal Resource Center and fed irradiated 208
food and water ad libitum. 209
Infection of C3H/HeN mice. Female 7- to 8-week old C3H/HeN mice were used. 210
All animals were housed in ABSL-3 facilities. Mice were anesthetized with ketamine 211
plus xylazine and infected, drop-wise, with 0.02 mL (0.01 mL per naris) for intranasal 212
(i.n.) infections or by injection with 0.1 mL for intraperitoneal (i.p.) infections. Actual 213
infection doses were determined by plating in triplicate onto sMHA and mice were 214
monitored daily for signs of morbidity and mortality. Statistical comparisons were made 215
using the Log-rank (Mantel-Cox) test function of Graph Pad Prism. For experiments 216
requiring tissue harvest, lungs, spleens, and the left lateral lobe of the liver were 217
aseptically harvested from mice and placed in Whirl-pack bags (Nasco, Fort Atkinson, 218
WI) and processed essentially as described previously (32), except all plates were 219
incubated at 30°C in an atmosphere of 5% CO2. This lower recovery temperature was 220
used for all strains to account for the temperature sensitive phenotype of the Schu S4 221
Δ0831 mutant. 222
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
12
Cytokine quantitation. Sterile filtered tissue homogenate and sera samples (day 223
5 post-infection) were analyzed for cytokine concentrations using the Bio-Plex Pro 224
mouse cytokine 32-plex assay (BioRad). Bio-Plex assay conditions were performed as 225
indicated in the manufacturer’s instructions. Mouse cytokines G-CSF, Eotaxin, GM-CSF, 226
INFγ, IL-1α, IL-1β, IL-2, IL-4, IL-3, IL-5, IL-6, IL-7, IL-9, IL-10, IL-12(p40), IL-227
12(p70), LIF, IL-13, LIX, IL-15, IL-17, IP-10, KC, MCP-1, MIP-1α, MIP-1β , M-CSF, 228
MIP-2, MIG, RANTES, VEGF, and TNF-α were analyzed for each sample. 229
Growth curves, temperature sensitivity screens and phase microscopy. 230
Growth of the strains constructed herein was evaluated in sMHB with moderate aeration 231
or on sMHA in an atmosphere of 5% CO2. For the former, cells were harvested from the 232
surface of a sMHA plate grown at 30°C in an atmosphere of 5% CO2 for 72 h and back 233
diluted in sMHB to give a routine starting OD600 of ~ 0.02-0.05. Cultures were either 234
loosely capped (LVS-based) or grown with 0.22 uM filter tops to allow free air exchange. 235
For growth curve analysis, samples were grown as above, but samples were also 236
recovered at indicated times, serially diluted 10-fold in PBS, and spread on sMHA for 237
parallel CFU enumeration. For agar based temperature sensitivity assays, cells were 238
grown and prepared as above to give a starting OD at 600 nm of 0.01. This was serially 239
diluted 10-fold in PBS and 0.005 mL of the 10-2 through 10-4 was spotted and allowed to 240
dry onto the surface of a sMHA plate. Duplicate plates were incubated at 30°C or 37°C in 241
an atmosphere of 5% CO2, for 72-96 h. For broth recovery assays, cells were grown in 242
sMHB as above at 30 or 37°C with aeration and then back-diluted 40-fold in fresh 243
prewarmed sMHB medium to assess re-growth potential. Growth was monitored 244
spectrophotometrically at an OD of 600 nm. 245
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
13
Fixation procedures and microscopy. Bacterial cells were collected by 246
centrifugation at 16,000 × g for 5 min at room temperature, fixed in 10% BNF, and stored 247
at 4°C until use. For phase and fluorescent microscopy, cells were immobilized by 248
placing them on a microscope slide with a thin pad of 1% (w/v) agarose. Bacteria were 249
observed with a Zeiss axiovert 200 microscope with a 63× objective. The images were 250
acquired with the AxioCam MRm camera and processed with AxioVision Rel. 4.8 251
software (Carl Zeiss MicroImaging GmbH). In some cases, fixed cells were stained at 252
room temperature with 4',6-diamidino-2-phenylindole (DAPI) at 1 mg/L. For Live/Dead 253
BacLight staining (L7012, Molecular Probes), unfixed cells were recovered by 254
centrifugation, washed in 0.85% saline and stained according to the manufacturer’s 255
instructions. Processed images were false colored and merged using ImageJ software 256
(39). The relative viability of LVS Δ0325 bacteria by live/dead staining was determined 257
in a fluorescence microplate reader relative to that of suspensions of live and isopropyl 258
alcohol-killed versions of the Tn7 transcomplemented LVS clone (Pr-0325+). 259
For transmission electron microscopy (TEM), sMHB grown stationary phase cells, 260
prepared and fixed in 10% BNF as above, were washed twice by centrifugation in PBS 261
and the pellets were suspended in 0.01 mL of fixative solution (2.5 % [w/v] 262
glutaraldehyde, 0.1 M sodium cacodylate). This preparation was applied to positively 263
charged formvar-coated copper (200 mesh) grids (Electron Microscopy Sciences, 264
Hatfield, PA) for 5 min. Excess liquid was blotted to cellulose filter paper (Whatman, 265
Piscataway, NJ) and the samples were stained with 2% (w/v) uranyl acetate solution. 266
Visualization was performed with a Tecnai G2 Spirit BioTWIN (FEI Company, Hillsboro, 267
OR) transmission electron microscope. 268
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
14
Flow cytometry. 0.25 mL aliquots of sMHB grown stationary phase cells, 269
prepared and fixed in 10% BNF as above, were further diluted in 10 mL PBS and stained 270
with 10 mg/L ethidium bromide for 5 min at room temperature or left unstained. 271
Samples were washed twice by centrifugation, as above, in 10 mL PBS and suspended in 272
10 mL PBS for flow cytometry. For each experiment, DNA content in a population of 273
200,000 cells was measured in a BD FACSCalibur flow cytometer at the UTSW flow 274
cytometry core. The data were collected and analyzed using FlowJo software (Tree Star 275
Inc., San Carlos, Calif.). 276
Macrophage culture and infection. Bone marrow cells were isolated and 277
differentiated essentially as described previously (40). Immediately prior to infection, a 278
few colonies from a freshly streaked sMHA plate were suspended in sMHB and the OD 279
at 600 nm was measured to estimate bacterial numbers. Bacterial suspensions were then 280
diluted in 1g/L glucose Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen) 281
supplemented with 10% fetal bovine serum (FBS, Invitrogen), 10% L-conditioned 282
medium, and 2 mM L-glutamine and 0.5 ml was added to chilled BMMs at a multiplicity 283
of infection (MOI) of 50. Bacteria were centrifuged onto macrophages at 400 x g for 10 284
min at 4°C, and infected BMMs incubated for 20 min at 37°C under 7% CO2 atmosphere 285
including an initial, rapid warm up in a 37°C water bath to synchronize bacterial uptake. 286
Infected BMMs were then washed 5 times with DMEM to remove extracellular bacteria, 287
incubated for 40 min in complete medium, and then for an additional 60 min in complete 288
medium containing 100 mg/L gentamicin to kill extracellular bacteria. Thereafter 289
infected BMMs were incubated in gentamicin-free medium until processing. The number 290
of viable intracellular bacteria per well was determined in triplicate for each time point. 291
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
15
Infected BMMs were washed 3 times with sterile PBS then lysed with 1 ml of sterile 1% 292
saponin for 3 min at room temperature, followed by repeated pipetting to complete lysis. 293
Serial dilutions of the lysates were rapidly plated onto sMHA, and incubated for 3 days at 294
37°C under 7% CO2 before enumeration of colony forming units (CFUs). Infection of 295
J774A.1 macrophages with LVS and derivatives was as described previously (32). 296
Immunofluorescence microscopy. BMMs grown on 12 mm glass coverslips in 297
24-well plates were infected, washed 3 times with PBS, fixed with 3% paraformaldehyde, 298
pH 7.4, at 37°C for 20 min, washed 3 times with PBS, then incubated for 10 min in 50 299
mM NH4Cl in PBS in order to quench free aldehyde groups. Samples were blocked and 300
permeabilized in blocking buffer (10% horse serum, 0.1% saponin in PBS) for 30 min at 301
room temperature. Cells were labeled by incubating inverted coverslips onto drops of 302
primary antibodies diluted in blocking buffer for 45 min at room temperature. Primary 303
antibodies used were mouse anti-F. tularensis LPS (US Biological, Swampscott, MA) 304
and rat anti-mouse LAMP-1 (clone 1D4B, developed by J. T. August and obtained from 305
the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD 306
and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, 307
IA 52242). Bound antibodies were detected by incubation with 1:500 dilutions in 308
blocking buffer of Alexa Fluor™ 488-donkey anti-mouse and Alexa Fluor™ 568-donkey 309
anti rat antibodies for 45 min at room temperature. Cells were washed twice with 0.1% 310
saponin in PBS, once in PBS, once in H2O, then mounted in Mowiol 4-88 mounting 311
medium (Calbiochem, Gibbstown, NJ). Samples were observed on a Carl Zeiss LSM 710 312
confocal laser scanning microscope for image acquisition. Confocal images of 313
1024x1024 pixels were acquired and assembled using Adobe Photoshop CS3. To 314
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
16
quantify escape of Francisella from its initial phagosome, phagosomal integrity assays 315
were performed as described previously (40). Briefly, infected BMMs on 12 mm glass 316
coverslips were selectively permeabilized by incubation with 50 μg/ml digitonin (Sigma) 317
for 1 min at room temperature. Rabbit polyclonal anti-calnexin (Stressgen 318
Biotechnologies), and Alexa Fluor 488-conjugated mouse monoclonal anti-F. tularensis 319
LPS antibodies (US Biological) were delivered to the macrophage cytosol for 12 min at 320
37°C to label the endoplasmic reticulum of permeabilized cells and accessible 321
intracellular bacteria, respectively. The coverslips were then washed, fixed and processed 322
for microscopy as described above. Bound anti-calnexin antibodies were detected using 323
cyanin 5-conjugated donkey anti-rabbit antibodies (Jackson Immuno-Research 324
Laboratories), and all intracellular bacteria were labeled using Alexa Fluor 568-325
conjugated anti-Francisella antibodies. Samples were observed using a Nikon Eclipse 326
E800 epifluorescence microscope equipped with a Plan Apo ×60/1.4 objective for 327
quantitative analysis.328
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
17
RESULTS 329
Genetic inactivation and complementation of FTT0831c/FTL_0325. To gain 330
more insight into the role of FTT0831c/FTL_0325 in the biology and pathogenesis of F. 331
tularensis, we inactivated FTL_0325 from the LVS and FTT0831c from the Schu S4 332
backgrounds using homologous recombination with a FRT-flanked kanamycin resistance 333
cassette and SacB-assisted allelic replacement, followed by FLP-based excision of the 334
antibiotic resistance marker as described previously (32). This results in a markerless 335
deletion of FTL_0325 or FTT0831c, respectively, leaving only a short FRT scar behind, 336
which is diagnostic for gene inactivation. To verify that any phenotype resulting from 337
loss of FTT0831c/FTL_0325 was due to absence of the protein and not other unrelated 338
mutations, a modified Tn7-delivery system (32) was next used to insert a wild-type copy 339
of FTT0831c or a variant lacking the canonical OmpA motif (FTT0831c Δ(Asn67-340
Leu180)) (Fig. 1A) under control of the Francisella rpsL promoter (Pr) in attTn7 near the 341
glmS gene (32, 37). Loss of FTT0831c expression was confirmed by immunoblot of the 342
Δ0831 and Δ0325 mutants and restoration of FTT0831c/FTL_0325 expression to slightly 343
elevated levels was observed for the Tn7 transcomplemented clone (hereafter, Pr-0831+ 344
and Pr-0325+, respectively) and to levels equivalent to that of wild-type for the variant 345
lacking the ompA motif (Pr-Δ(OmpA)) (See Fig. 5A). 346
FTL_0325 encodes a bacterial lipoprotein. Although FTT0831c/FTL_0325 is 347
highly conserved among sequenced Francisella species (> 75% identity, non-virulent 348
subspecies; > 99% identity virulent subspecies) and bears a highly conserved OmpA 349
structural motif (22-25), the remainder of this protein shares much lower overall 350
sequence identity to other proteins in the non-redundant database (data not shown). 351
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
18
FTT0831c/FTL_0325 was localized to the outer membrane by sucrose density gradient 352
fractionation and immunoblot ((30) and G.T. Robertson, unpublished observations) and is 353
predicted to encode a lipoprotein based on the presence of a putative signal peptidase II 354
(SPII) cleavage site and conserved cysteine residue at position 20 in the 355
FTT0831c/FTL_0325 coding sequence (Fig. 1B). Consistent with this proposal, 356
FTL_0325 was found to partition into the detergent phase of the non-ionic detergent 357
triton X-114 (TX-114) (data not shown), which is thought to solubilize bacterial 358
lipoproteins owing to the amphipathic properties imparted by the covalently attached 359
long-chain fatty acids (41). To confirm these phase partitioning results, LVS or LVS 360
Δ0325 were grown in CDM medium and then pulsed for ~ 18 h with the radiolabelled 361
long chain fatty acid precursor, [3H]palmitic acid. Growth in the presence of 362
[3H]palmitate resulted in the appearance of labeled proteins, but none that obviously 363
correlated with the predicted size (~ 42 kDa) of mature FTL_0325 (Fig. 1C). We 364
therefore performed an immunoprecipitation of these labeled whole cell lysates using 365
anti-FTT0831c sera (α8), or with control pre-immune sera as was previously described 366
(32). As is shown in Fig. 1C, we observed specific enrichment of a protein 367
corresponding to the predicted size of FTL_0325 in LVS following immunoprecipitation 368
with α8, but not control pre-immune sera (Fig. 1C). As expected, no such band was seen 369
for the LVS Δ0325 null mutant (Fig. 1C), which does not produce FTL_0325 protein (Fig. 370
5A). Parallel immunoblots using these same sera confirmed the identity of the 371
precipitated [3H]palmitate labeled protein as FTL_0325 (data not shown). Taken together, 372
these data are consistent with the in silico analyses identifying FTT0831c/FTL_0325 as a 373
lipoprotein. 374
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
19
FTT0831c is a required for full lethality and dissemination of Schu S4 in 375
mice. Because FTL_0325 was previously shown to be required for in vivo virulence of 376
LVS in mice (31) and FTT0831c and FTL_0325 were required for intracellular survival 377
of Schu S4 and LVS in vitro (30), we next sought to confirm the role of FTT0831c in F. 378
tularensis pathogenesis by performing i.n. infections of C3H/HeN mice with our Schu S4 379
Δ0831 null mutant. Mice were infected drop-wise via the i.n. route with the indicated 380
infection dose and monitored for signs of illness or death for up to 3 weeks post-infection 381
(Fig. 2A). These time-to-death assays revealed significant attenuation of the Schu S4 382
Δ0831 null mutant, which was attenuated at 11,200 CFU (4 of 7 mice survived; P < 383
0.001 versus Schu S4) and avirulent at 163 CFU (8 of 8 mice survived; P < 0.001 versus 384
Schu S4). The wild-type Schu S4 parent was lethal at 120 CFU (0 of 8 mice survived, 385
median survival time, 5 days), which is > 5× the minimum i.n. lethal dose for Schu S4 in 386
our hands (see Fig. 2A). Restoration of full virulence was observed for the 387
complemented strain (Pr-0831+) at 350 CFU (0 of 7 mice survived, median survival time, 388
5 days; no difference versus Schu S4 and P < 0.001 versus Δ0831), but not in an 389
otherwise identical strain expressing a derivative of FTT0831c (Pr-Δ(OmpA)) lacking the 390
putative OmpA motif when administered at 1,017 CFU (5 of 6 mice survived; P < 0.001 391
versus Schu S4 and no difference versus Δ0831) (see Fig. 2A). These data are interpreted 392
to mean that FTT0831c is required for lethal pulmonary infection of Type A Schu S4 in 393
C3H/HeN mice and that the OmpA motif is required for FTT0831c to function in this 394
capacity. 395
Organ CFU burdens in the lungs, livers and spleens of parallel groups of mice 396
infected with similar infection doses of ~ 102 CFU revealed marked differences in the 397
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
20
colonization patterns of the tested strains. Whereas increasing concentrations of bacteria 398
were recovered from the lungs, spleens, and livers of Schu S4 infected mice at day 3 and 399
5 p.i., the Schu S4 Δ0831 mutant was found at significantly lower levels in the lungs of 400
mice and was cleared by day 35 p.i. (Fig. 2B). In contrast, little to no detectable Schu S4 401
Δ0831 bacteria were detected in the livers and spleens of these animals at day 3 or 5 (Fig. 402
2B), indicating an appreciable defect in either dissemination from the lung, or replication 403
in these more distal tissues. To distinguish between these two possibilities, we performed 404
a second experiment in which eight mice each were infected systemically by the 405
intraperitoneal (i.p.) route with 209 CFU Schu S4, 205 CFU Δ0831, or 112 CFU Pr-0831+. 406
Infection by this route bypasses the lung barrier and is highly lethal for mice. Indeed, all 407
of the Schu S4 or Pr-0831+ infected mice rapidly succumbed to disease (median survival 408
time, 4 days; no statistical difference between Schu S4 and Pr-0831+); whereas, none of 409
those infected with the Schu S4 Δ0831 null mutant died (P < 0.001 versus Schu S4 or Pr-410
0831+) or showed any outward signs of illness (Fig. 3A). To this end, whereas Schu S4 411
and Pr-0831+ showed extensive replication and were recovered at equivalent levels to one 412
another in the lungs, livers and spleens of infected animals on day 3 p.i., the Schu S4 413
Δ0831 mutant was detected at low levels in the spleen and was present at, or below, the 414
limit of detection in the lung or liver (Fig. 3B). Importantly, no net replication was 415
observed in any of these tissues between day 3 and day 5 for the Schu S4 Δ0831 mutant 416
(Fig. 3B). These data indicate that the defect in systemic colonization of mice by the 417
Schu S4 Δ0831 null mutant was not the due to an inability to escape the lung per se, but 418
instead reflected an inability of this mutant to thrive in these more distal tissues. 419
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
21
The Schu S4 FTT0831c mutant hyper-stimulates proinflammatory cytokines in 420
lungs of mice. Infection of macrophages in vitro with LVS or Schu S4 lacking FTT0831c 421
was shown previously to result in hyper-proinflamatory cytokine release in a manner that 422
was dependent on TLR2 (30). To investigate whether similar responses were observed with 423
our mutant in vivo, we examined cytokine levels in filtered lung homogenates from 424
C3H/HeN mice by Bio-Plex Pro mouse cytokine 32-plex assay 5 days following i.n. 425
infection with Schu S4 Δ0831 or the wild type parent Schu S4 (Fig. 4). We elected to 426
examine the cytokine response in lungs at this time because (i) the lung is the site of initial 427
colonization following i.n. infection and (ii) unlike the liver or spleen, CFU differences 428
between these strains were less dramatic by day 5 p.i. in these tissues (See Fig. 2B). 429
Cytokine quantitation revealed a bipolar response in the lungs of mice 5 days p.i. with Schu 430
S4 or Schu S4 Δ0831; heightened production of IL-17, IFN-γ, IL-1α, IL-1β, TNF-α, LIF, 431
RANTES, and IP-10 was disproportionately observed for the Schu S4 Δ0831 mutant 432
compared to the Schu S4 parent, whereas higher levels of G-CSF, MCP-1, IL-10, and IL-5 433
were detected for the virulent parent versus the attenuated Schu S4 Δ0831 mutant (Fig. 4). 434
The complete cytokine profile, including what appears to be a Schu S4-induced ‘cytokine 435
storm’ in the livers, spleens, and sera of these same animals (which were severely ill at this 436
time), is available in Supplementary Material. These data are interpreted to mean that i.n. 437
infection of mice with Schu S4 0831 promotes hyper-induction of a unique set of 438
proinflammatory cytokines in lung tissues in vivo, and is consistent with limited in vitro 439
and in vivo data published elsewhere (30, 31, 42). 440
Altered surface properties of the Schu S4, but not LVS-based, 441
FTT0831c/FTL_0325 null mutants. Hyper-proinflammatory cytokine production 442
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
22
following infection with FTT0831c/FTL_0325-deficient LVS or Schu S4 variants were 443
previously proposed to result from loss of surface-exposed protein and not heightened 444
release of TLR2 agonists owing to surface changes or loss of structural integrity (30). 445
Curiously, however, our immunoblots revealed an unexpected loss of high molecular 446
weight O-antigen production for our Schu S4-derived Δ0831 strain, but not the otherwise 447
identical LVS-derived Δ0325 mutant (Fig. 5A). This is noteworthy, inasmuch as mutants 448
of F. novicida and F. tularensis lacking key O-antigen biosynthetic genes were 449
previously shown to be hypercytotoxic to BMDMs (19, 20). In our study, the lack of O-450
antigen biosynthesis in the Schu S4 Δ0831 background was fully reversed in the 451
complemented clone (Pr-0831+), or in a second complemented clone isolated through a 452
separate, wholly independent, transformation experiment (Fig. 5A, left panel). Further, 453
expression of a mutant form of FTT0831c lacking the OmpA motif, or the empty vector 454
alone, failed to reverse this defect in O-antigen production. Therefore, although it is 455
presently unclear why loss of FTT0831c/FTL_0325 affects LPS synthesis differently in 456
these two closely related strain backgrounds, the genetic complementation data indicate 457
that it is the loss of FTT0831c, and not a secondary spontaneous mutation, that results in 458
this LPS O-antigen defect in the Schu S4 background. Importantly, this unusual LPS 459
defect did not impart increased sensitivity to complement-mediated killing to the Schu S4 460
Δ0831 mutant; control strains (i.e., E. coli DH5α or a spontaneous deep rough Schu S4 461
isolate) were readily killed by complement-preserved, but not heat-inactivated, human 462
serum (Fig. 5B). 463
Deletion of FTT0831c/FTL_0325 alters cell growth and morphology of F. 464
tularensis at physiologic temperatures. Previous studies failed to detect any growth 465
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
23
defects of LVS FTL_0325 mutants grown in a variety of liquid media at physiologic 466
temperatures (30, 31). We elected to investigate this in more detail, since in our hands, 467
passage of either the LVS Δ0325 or Schu S4 Δ0831 null mutants on sMHA in an 468
atmosphere 5% CO2 at 37°C consistently resulted in the appearance of smaller colonies 469
relative to that of the parent or the complemented mutant (data not shown). This 470
phenotype was even more striking for LVS Δ0325 cells were first diluted in PBS (or 471
sMHB) and spotted onto the surface of sMHA at 37°C in an atmosphere of 5 % CO2, 472
which resulted in a 2-3 log reduction in viability (Fig. 6A). The Schu S4 Δ0831 mutant 473
also showed a strong growth restriction and a significant (P < 0.05, student’s t-test) 474
reduction in plating efficiency (i.e., 30%) at 37°C (data not shown). The basis for the 475
difference in apparent magnitude of this effect between the LVS and Schu S4 strain 476
backgrounds is at present unknown. However, the effect in both cases was reversed by 477
growth at 30°C or by genetic complementation (Fig. 6A and data not shown), thus 478
indicating that the growth restriction phenotype is temperature-dependent and results 479
from loss of FTT0831c/FTL_0325 and not polar effects on downstream genes. The 480
presence of the OmpA motif was also required to rescue the temperature sensitive growth 481
of both the Schu S4 Δ0831 and LVS Δ0325 mutants in vitro, which is interpreted to mean 482
that contact with the peptidoglycan cell wall is required for FTT0831c/FTL_0325 activity 483
in vitro as well (Fig. 6A and data not shown). 484
Surprisingly, no such growth defect was initially evident when LVS Δ0325 485
cultures were examined for increases in optical density (OD) during a single round of 486
aerobic cultivation in sMHB liquid medium at 37°C (Fig. 6B). This result is in agreement 487
with that reported previously (30, 31) and may partially explain the discrepancy between 488
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
24
these two studies. However, in striking contrast to the parent strain or the complemented 489
strain, the LVS Δ0325 mutant showed no corresponding increase in CFU during peak log 490
phase growth in sMHB (Fig. 6C). Similarly, both the Schu S4 Δ0831 mutant and a strain 491
lacking the putative OmpA motif showed a substantial, but somewhat lower, ~ 90% (1-492
log) reduction in in viability during growth to saturation in broth culture relative to the 493
complemented clone or the Schu S4 parent (data not shown). These findings are at odds 494
with that reported previously (30), where disproportionately elevated Log10 CFU values 495
were reported per OD equivalent when growth was assayed in microtiter plate format and 496
not under typical aerobic broth conditions as employed herein. Microscopic examination 497
of these cells after growth to saturation in sMHB under permissive (aerobic growth, 498
30°C) and non-permissive (aerobic growth, 37°C) conditions also revealed strikingly 499
different cell morphologies. Whereas wild-type LVS or the complemented mutant were 500
found to exhibit characteristic pleiomorphic rod shaped morphology by TEM (Fig. 6E 501
and 6I), the LVS Δ0325 cells grown at 37°C were spherical in nature and ~ 3-5× the size 502
of the parent or the complemented clone (Fig. 6F). The spherical forms of the LVS 503
Δ0325 mutant were often phase bright by standard phase contrast microscopy (data not 504
shown). No such irregularities were seen for the LVS Δ0325 cells when cultivated at 505
30°C (permissive growth conditions) (Fig. 6G), and importantly, the transition to the 506
larger spherical shape occurred concomitantly with active growth in broth, since these 507
cells were essentially indistinguishable from that of the parent upon initial inoculation or 508
during early log phase growth (i.e., < 3 doublings) (Fig. 6H and Fig 8A). Finally, this 509
defect was not unique to LVS, since similar alterations in cell morphology were observed 510
for the Schu S4 Δ0831 strain (Fig. 6K) or this same strain expressing an allele of 511
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
25
FTT0831c lacking the OmpA motif (Pr-Δ(OmpA)) when cultivated at 37°C in sMHB 512
(Fig. 6M and data not shown). Hence, in two different strain backgrounds, loss of 513
functional FTT0831c/FTL_0325 protein results in highly irregular cell morphology 514
following growth at physiologic temperature in vitro. 515
Given that cell mass (OD) increased linearly during log phase growth (see Fig. 516
6B), but viable CFU did not (Fig. 6C), we hypothesized that loss of FTT0831c/FTL_0325 517
was promoting a defect in normal cell division under these non-permissive growth 518
conditions. Similar results have been reported for mutants lacking other OmpA motif 519
containing bacterial lipoproteins (i.e., Pal) (29). To assess this directly, we next 520
examined the relative number of genome equivalents (i.e., DNA content) of the LVS 521
parent or the LVS Δ0325 mutant cultivated under permissive (aerobic growth, 30°C) or 522
non-permissive (aerobic growth, 37°C) temperatures. If our hypothesis was correct, we 523
would predict a corresponding increase in ethidium bromide fluorescence (i.e., nucleic 524
acid content) equivalent to the overall cell mass increase for an individual LVS Δ0325 525
bacterial cell. Indeed, using flow cytometry we observed a ~3.7-fold shift in mean 526
fluorescence values for LVS Δ0325 grown under non-permissive temperatures, relative to 527
that of the wild type parent or the LVS Δ0325 mutant grown under permissive conditions 528
(Fig. 6D). This observed ~ 3.7 fold-increase in genome equivalents is, in general, in 529
good agreement with the ~ 3-5-fold increase in cell surface area observed in TEM, thus 530
supporting our hypothesis that the disconnect in cell mass and cell viability can be at least 531
partly attributed to cell division defects at 37°C resulting from loss of FTL_0325. 532
Similar increases in ethidium bromide staining (i.e., genomic DNA content) were 533
observed for the Schu S4 Δ0831 mutant or a strain lacking the OmpA structural motif 534
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
26
(Δ(OmpA)), but were restored to wild-type levels in the complemented clone (0831+) 535
(Fig. 6D). 536
Intracytosolic growth of the Schu S4 Δ0831c mutant promotes altered 537
bacterial morphology and eventual killing in LAMP-1 positive vacuoles. To 538
determine the intracellular fate of Schu S4 lacking FTT0831c, we infected BMDM and 539
measured intracellular growth by a gentamicin protection assay and endosomal 540
trafficking using a previously described phagosomal integrity assay coupled to confocal 541
immunofluorescence microscopy of bacterial colocalization with LAMP-1- positive 542
membranes (as a measure of vacuolar versus cytosolic location) (43). Consistent with 543
previous reports (30), we observed appreciable defects in intracellular replication of the 544
Schu S4 Δ0831 strain in BMDMs (Fig. 7A). These defects manifested as a reduced 545
apparent intracellular growth rate, and an appreciable loss of viability between 16 and 24 546
h.p.i.. Similar intracellular growth defects were observed for the LVS Δ0325 strain at 22 547
hours in J774A.1 macrophages (5.9 % intracellular survival relative to the LVS parent; 548
data not shown). Hence, our results from both LVS and Schu S4 are wholly consistent 549
with that reported elsewhere (30). Importantly, these defects were fully reversed in the 550
complemented mutants (Fig. 7A and data not shown). We also show that this defect did 551
not correlate with an inability to escape the phagosome, since the Schu S4 Δ0831 strain 552
was found free in the cytosol with kinetics that were indistinguishable from that of the 553
virulent parent or the complemented mutant (Fig. 7B). Consistent with our previous in 554
vitro findings, however, intracytosolic growth of the Schu S4 Δ0831 strain also resulted 555
in the formation of enlarged irregular cells that stained poorly with anti-O-antigen LPS 556
antibody (Fig. 7C, middle panels, see insets). This suggests that like the situation in vitro, 557
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
27
rapid growth of Schu S4 during intracytosolic residence at 37°C was also associated with 558
alterations in cell morphology in vivo and the altered LPS profile affected intracellular 559
staining with anti-LPS antibody. Strikingly, by 16 h.p.i. the Schu S4 Δ0831 cells were 560
observed in association with LAMP-1 positive vacuoles where active bacterial 561
destruction was observed (Fig. 7C, far right panel). The association of Schu S4 Δ0831 562
bacteria with LAMP-1 positive vacuoles corresponded well with the appreciable loss of 563
cell viability observed in gentamicin protection assays (compare Fig. 7A and 7C, far right 564
panel) and since these same bacteria were previously cytosolic, must mean that the cells 565
had re-entered the endocytic pathway, possibly by autophagy (44), to be destroyed in 566
association with LAMP-1 positive vacuoles. Taken as a whole, these results further 567
substantiate the role of FTT0831c in the pathogenesis of virulent F. tularensis by 568
suggesting an unusual intracellular fate resulting not from failure to escape the 569
phagosome, but rather, altered growth and morphology and subsequent destruction of 570
otherwise replicating intracystosolic bacteria by late-forming LAMP-1 positive vacuoles. 571
Progressive changes in cell morphology and loss of membrane integrity. 572
Alterations in cell morphology were observed for bacteria lacking FTT0831c/FTL_0325 in 573
vitro in rich media and in vivo in BMDMs at physiologic temperatures. Overall, these 574
changes appeared to result from altered cell division at 37°C that was not similarly apparent 575
at lower growth temperatures in vitro. The most logical explanation would be that these 576
morphologic abnormalities were progressive in nature, and not the result of a singular cell 577
wall defect. To determine if this was true, we examined LVS Δ0325 cells expressing 578
mCherry for morphological changes over time during active aerobic growth at 37°C in 579
sMHB in vitro. Consistent with our previous studies (see Fig. 6H), the LVS Δ0325 mutant 580
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
28
initially presented as short, pleiomorphic rods (through approximately 3-doublings) (Fig. 581
8A), typical of wild-type LVS bacteria (see Fig. 6E). After 5 doublings, however, cellular 582
abnormalities became apparent and ~ 33 % of the surveyed cells were irregular in nature, 583
which included the appearance of cells with enlarged ends and perpendicular blebs near the 584
cellular midpoint (Fig. 8A). These changes were progressive, as more than 45% of 585
surveyed cells were irregular after 7 doublings with the initial appearance of large spherical 586
cells at this point (i.e., ~ 9% of cells counted) (Fig. 8A). Following overnight growth (~ 13 587
doublings), the majority of the cells were irregular, or more often (i.e., 91% of cells), large 588
and spherical in nature (Fig. 8A). Taken together, these data indicate that the changes in 589
LVS Δ0325 morphology are progressive in nature and result in at least two distinct 590
morphotypes during different stages of rapid growth in sMHB medium in vitro. 591
We next sought to determine if the LVS Δ0325 cells grown to saturation were 592
capable of renewed replication upon dilution in fresh medium, or if instead, the spherical 593
cells represented a terminal form of aborted division. Whereas all strains grew normally and 594
were not impacted in further growth upon serial passage at 30°C (Fig. 8B, upper panel), the 595
LVS Δ0325 mutant showed negligible increases in optical density (i.e., cell mass) upon 596
serial passage at 37°C in two independent experiments (Fig. 8B and C, lower panels). No 597
such defect was observed for the LVS parent or the complemented mutant at 37°C (Fig. 8B, 598
lower panel). To ensure that this defect was not simply due to loss of viability upon growth 599
to saturation in sMHB under non-permissive growth temperatures, we repeated the serial 600
passage studies and recovered cells for CFU enumeration after serial dilution and plating at 601
30°C. Consistent with our earlier observation (Fig. 6B and C), we observed an inverse 602
correlation between OD increases and viable CFU counts following growth of the LVS 603
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
29
Δ0325 mutant to saturation at 37°C, but not 30°C (Fig. 8C). Although similar morphological 604
abnormalities are seen during growth of the Schu S4 Δ0831 strain in vitro and within 605
macrophages (see Figs. 6K and 7C), it is not yet known if the Schu S4 Δ0831-deficient 606
bacteria exhibit a similar fate during serial passage in vitro. However, given the similarities 607
in altered cell division observed between these two closely related species, this seems likely 608
to be the case. 609
Because these cells appeared morphologically intact, we next employed the 610
Live/Dead BacLight bacterial viability staining kit (Molecular Probes) to assess cell 611
viability, and hence, membrane integrity of individual cells. As is shown in Fig. 8D, we 612
observed appreciable decreases in viability (i.e., green cells) for individual LVS Δ0325 613
cells (50.3 % viable) relative to the complemented mutant (Fig. 8D). The LVS Δ0325 614
bacteria were not, however, more susceptible to hydrophobic compounds and detergents 615
(i.e., sodium dodecyl sulfate, ethidium bromide, vancomycin, deoxycholate, gentamicin, 616
and bacitracin) as using 5x105 CFU/mL in microtiter plate based minimum inhibitory 617
concentration (MIC) assays in vitro (data not shown). To investigate this further, we next 618
evaluated the ability of Tul4A antibodies to bind to normally occluded Tul4A at the cell 619
surface of live cells in vitro using a previously described surface antigen binding assay 620
(18). Whereas, LPS was readily detected at the cell surface by mouse anti-LPS (FB11) 621
antibody and western blotting, neither FTL_0325, FopA nor Ef-Tu was detected in any 622
strain tested (Fig. 5C). In contrast, and consistent with the proposal that loss of 623
FTL_0325 alters surface-exposed constituents, antibodies to Tul4A reproducibly detected 624
sufficient quantities of this OM anchored lipoprotein in the LVS Δ0325 mutant, but not in 625
the LVS parent or the complemented clone (Fig. 5C). This indicates that loss of 626
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
30
FTL_0325 promotes altered cell morphology and loss of viability without obviously 627
compromising cell membrane integrity, but instead alters outer membrane envelope 628
structure sufficiently to allow surface exposure (or release) of some normally occluded 629
protein constituents including those likely to stimulate innate immune receptors (i.e., 630
PAMPs) (see Fig. 9). 631
632
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
31
DISCUSSION 633
F. tularensis is considered a ‘stealth’ pathogen, owing to its ability to establish 634
infection without significant early host detection. F. tularensis modifies its Lipid A to 635
avoid immunodetection by pattern recognition receptors (PRRs) such as TLRs (45). 636
However, the mechanisms by which F. tularensis avoids and suppresses other aspects of 637
the host innate immune response are poorly defined (6-11). Surveys for F. tularensis 638
mutants that show heightened cytoxicity or TLR2-dependent inflammatory responses has 639
lead to the identification of multiple unrelated gene products that contribute to this 640
response (15-19). Although it is possible that some of the gene products identified are 641
directly involved in subverting host innate immune response, the prevailing model is that 642
these mutations alter the structural integrity of the cell resulting in either increased 643
bacteriolysis during intracytosolic residence (20) or altered cell properties culminating in 644
increased access of PRRs to otherwise inaccessible TLR-ligands (18). One common 645
feature of such mutants is an increase in early host recognition and proinflammatory 646
cytokine response (e.g., TNF-α and IL-1β), but also decreased pathogenesis and reduced 647
bacterial dissemination (16, 18). 648
FTT0831c/FTL_0325 was previously reported as a virulence factor for F. 649
tularensis, contributing to intracellular survival and murine pathogenesis (30, 31, 42). 650
Our studies support and extend these findings by demonstrating that loss of FTT0831c 651
severely impairs murine pathogenesis of Schu S4 and promotes a strong proinflammatory 652
response (i.e., IL-17, IFN-γ, IL-1α, IL-1β, TNF-α, LIF, RANTES, and IP-10) in the lungs 653
of mice following primary pulmonary infection (see Figs. 2A and 4). We further show 654
that Schu S4 Δ0831 bacteria show reduced, but significant, replication in the lungs of 655
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
32
mice following i.n. infection, but with little to no dissemination or replication in more 656
distal tissues (Fig. 2B). This may suggest that the early innate immune response to 657
Δ0831 bacteria is critical in controlling further systemic spread. Indeed, similar results 658
were observed for LVS bacteria lacking the Kdo hydrolase genes kdhAB which elicits a 659
similar strong early inflammatory response in the lung following i.n. infection (18). Other 660
studies have shown that prior administration of known TLR-agonists reduces overall 661
organ burdens and increases survival following subsequent F. tularensis infection (46-48). 662
However, other properties likely also contribute to the limited systemic replication of the 663
Δ0831 bacteria, since the Schu S4 Δ0831 strain also failed to replicate in the spleens and 664
livers of mice when administered systemically via i.p. injection, which bypasses the lung 665
barrier. This defect is not due to increased susceptibility to complement-mediated killing, 666
inasmuch as the Schu S4 Δ0831 bacteria were fully resistant to the action of preserved 667
human serum in vitro, despite possessing an altered LPS profile (Fig. 5A). The basis for 668
the latter difference between the LVS Δ0325 and Schu S4 Δ0831 mutants is at present 669
unknown, but our genetic data strongly suggests that the defect is due to loss of 670
FTT0831c, and dependent on the OmpA-sequence motif, and therefore not due to a 671
secondary spontaneous mutation(s). As such, we favor another model that the elevated 672
temperature of the mouse (~37-39°C) promotes cell division and growth defects similar 673
to that observed during in vitro passage of this mutant at physiologic temperatures in 674
vitro (see Fig. 6K). Indeed, it is anticipated that the lung growth environment, wherein 675
significant replication of the mutant is observed in vivo (see Fig. 2B), would be closer to 676
the permissive temperature for the mutant in vitro owing to the cooling effects of ambient 677
room temperature air exchange and respiration. This is further supported by the 678
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
33
observation that the mutant is not pathogenic, and fails to replicate, when administered to 679
mice via the i.p. route (see Fig. 3). Further studies would be necessary to fully test this 680
proposal. 681
One curious difference between our work and that reported elsewhere (30, 31) for an 682
LVS FTL_325 transposon mutant, is the apparent lack of acellular growth defects in the 683
latter. In those studies, cell growth was measured during incubation for 36 h in rich or 684
defined medium in microtiter plates at 37°C (30, 31). In our hands, FTT0831c/FTL_0325 685
is essential for normal cell growth, division, and viability of Schu S4 and LVS during 686
growth at physiologic temperatures in vitro (Figs. 6 and 8) and during intracytosolic 687
residence in vivo (Fig. 7). This loss of viability correlated with the appearance of obvious 688
morphological changes, which were both progressive in nature and identical between 689
FTT0831c/FTL_0325 null mutants and variants lacking only the OmpA structural motif. 690
Thus, the OmpA motif is required for normal cellular activity and virulence, leading us to 691
propose that FTT0831c/FTL_0325 activity requires contact with the peptidoglycan cell wall. 692
In contrast, these defects were not observed when these cells were grown at 30°C, possibly 693
reflecting the slower growth rate of cells under these conditions. Although our CFU data 694
clearly indicate some heightened loss of viability with growth of the LVS Δ0325 mutant 695
to saturation in sMHB at 37°C in vitro, these data are not sufficient to account for the 696
negligible increase in OD observed upon secondary cultivation of these same cells after 697
initial passage at 37°C (see Fig. 8B and C). Indeed, saturated sMHB LVS Δ0325 cells 698
passaged once at 37°C, could not be recovered by secondary passage at 30°C (i.e., 699
permissive temperature) in sMHB (data not shown). This is instead interpreted to mean that 700
the growth defect resulting from loss of FTL_0325 in vitro leads to a form of terminal cell 701
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
34
division block, from which further cell growth is inhibited even under otherwise permissive 702
growth conditions. Similar growth defects are observed for E. coli and other Gram-negative 703
bacteria entering into SulA-mediated ‘SOS’-type DNA repair (reviewed in (49)). 704
The role of FTT0831c in the virulence of Schu S4 was confirmed in these studies, as 705
was the hyperinduction of a strong proinflammatory response in the lungs of mice following 706
i.n. infection. This response was not due to differences in bacterial burden, as the numbers of 707
Schu S4 and the Δ0831 bacteria were similar at that time. In a model presented by 708
Mahawar and colleagues (30), it was proposed that the basis for the TLR2-dependent 709
proinflammatory cytokine response from BMDMs following infection with attenuated 710
LVS FTL_0325 or Schu S4 FTT0831c mutants was not due to altered host response to 711
these attenuated pathogens, but instead to the physical loss of surface-exposed 712
FTT0831c/FTL_0325 protein, which in some manner, is proposed to act as a specific 713
innate immune evasion factor. This notion, in and of itself, is difficult to reconcile given 714
that FTT0831c/FTL_0325 would be required to broadly inhibit both nuclear NF-κB 715
signaling (30) and cytosolic AIM2 and NLRP3-inflammasome signaling (42) for 716
FTT0831c/FTL_0325 to exert its proposed effects. Further, although 717
FTT0831c/FTL_0325 clearly is outer membrane-associated, it likely is tethered via its 718
long-chain fatty acids to the inner leaflet of the outer membrane (see Fig. 9); lipoproteins 719
are not commonly surface-exposed in Gram-negative bacteria, inasmuch as the 720
translocation of lipoproteins to the outer leaflet is not thermodynamically favorable, and 721
thus likely requires a highly specialized pathway that is yet to be characterized. To this 722
end, we failed to detect surface-exposed FTL_0325 in our surface accessibility assays 723
(see Fig. 5C). Our data thus suggest a different model to account for the 724
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
35
hyperinflammatory nature of FTT0831c/FTL_0325 mutants. First, rescue of in vitro 725
growth at 37°C or in vivo growth in mice, requires the OmpA structural motif, which is 726
highly conserved in FTT0831c/FTL_0325 and typically required for non-covalent 727
interactions with the peptidoglycan cell wall. Based on these data alone, it is difficult to 728
understand how these features might contribute to the proposed biological role (30) of 729
FTT0831c/FTL_0325 as a surface-bound (or secreted) innate immune evasion factor, 730
unless some as yet unknown, alternate processing event results in release of membrane-731
bound protein for transport or translocation to the bacterial cell surface. Second, 732
inactivation of FTT0831c in the Schu S4 background results in prominent defect in LPS 733
O-antigen synthesis, which is fully restored when wild-type FTT0831c is expressed in 734
trans. Lastly, FTT0831c/FTL_0325 was required for normal growth at physiologic 735
temperature in rich medium or during intracytosolic residence in BMDMs. These growth 736
defects were accompanied by prominent morphological irregularities that were found to 737
correlate with heightened defects in structural (i.e., membrane-) integrity based on failure 738
to exclude propidium iodide in Live-Dead staining (see Fig. 8D) or surface accessibility 739
assays (Fig 5C) following growth of the LVS-based Δ0325 mutant to saturation at 740
physiologic temperatures in vitro. Similar structural changes resulting in increased 741
inflammatory properties can arise during growth of Francisella under certain in vitro 742
cultivation conditions (21) or in the presence of a number of genetic mutations (20). 743
Further, we propose that these growth defects arise due to loss of molecular interactions 744
between the OmpA structural motif and peptidoglycan since mutants lacking this motif 745
phenocopy that of a null mutant. As such, we suggest that FTT0831c/FTL_0325, like 746
other well characterized OmpA motif-containing proteins (i.e., Pal), acts principally as a 747
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
36
structural protein, serving to tether the OM to the peptidoglycan during rapid cell growth 748
conditions in vitro and in vivo (Fig. 9). Physical contact between OM-anchored 749
FTT0831c/FTL_0325 and the peptidoglycan cell wall would serve to link the two layers 750
together and facilitate normal OM invagination during active cell cytokinesis (Fig. 9). 751
Without such interactions, FTT0831c/FTL_0325-deficient bacteria undergo cell division 752
defects and exhibit altered structural properties that are prominent at cell midpoles and 753
termini (the sites of active or recent cell constriction events) and the eventual formation 754
of large round cells during rapid log growth, resulting in release or enhanced presentation 755
of PAMPs (Fig. 9) such as Tul4A (see Fig. 5C). This in turn gives rise to the heightened 756
induction of an inflammatory cytokine response observed in vivo during active bacterial 757
growth conditions (see Fig. 4). In contrast, this proposed OM-PG interaction may prove 758
less critical during slow growth conditions (e.g., 30°C) when alternate cell wall contacts 759
possibly via other OmpA motif-containing proteins (i.e., Pal, FopA) might suffice. 760
Further, given that growth in macrophages resulted in similar altered bacterial morphology 761
followed by subsequent intracellular destruction in late forming LAMP-1 positive vacuoles, 762
it is possible that autophagy maybe the principal clearance and or detection mechanism for 763
structurally compromised F. tularensis Schu S4. This proposal is consistent with recent 764
observations that non-viable mutants are captured within LAMP-1-positive autophagosomes, 765
as a clearance mechanism for damaged cytosolic Francisella (44). However, based on our 766
data alone, we cannot exclude the possibility that this instead results from hypercytotoxicity 767
of the Schu S4 Δ0831 mutant toward macrophages in vitro and the release and subsequent 768
secondary engulfment of gentamicin-killed bacteria. Further studies will seek to define the 769
role of autophagy and TLR2 in this response, and also, the mechanistic basis for the cell 770
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
37
division defects associated with loss of FTT0831c/FTL_0325 at physiologic, but not lower, 771
growth temperatures. Such studies will be particularly informative in understanding the role 772
of this protein in biology and cell cytokinesis of this intracellular pathogen. 773
774
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
38
ACKNOWLEDGEMENTS 775
We thank Felix Yarovinsky (UT Southwestern, Department of Immunology) for helpful 776
discussions and for technical assistance with flow cytometery and Neal Alto (UT 777
Southwestern, Department of Microbiology) for the gift of mCherry. This work was 778
supported by grant number U54 AI057156 from National Institute of Allergy and 779
Infectious Diseases (NIAID)/NIH). The contents are solely the responsibility of the 780
authors and do not necessarily represent the official views of the RCE Programs Office, 781
NIAID, or NIH. 782
783
784
785
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
39
REFERENCES 786
1. Foley JE, Nieto NC. 2009. Tularemia. Vet Microbiol 140:332-338. 787
2. McLendon MK, Apicella MA, Allen LA. 2006. Francisella tularensis: 788
taxonomy, genetics, and Immunopathogenesis of a potential agent of biowarfare. 789
Annu Rev Microbiol 60:167-185. 790
3. Ellis J, Oyston PC, Green M, Titball RW. 2002. Tularemia. Clin Microbiol Rev 791
15:631-646. 792
4. Celli J, Zahrt TC. 2013. Mechanisms of Francisella tularensis intracellular 793
pathogenesis. Cold Spring Harb Perspect Med 3:a010314. 794
5. Broms JE, Sjostedt A, Lavander M. 2010. The Role of the Francisella 795
tularensis Pathogenicity Island in Type VI Secretion, Intracellular Survival, and 796
Modulation of Host Cell Signaling. Front Microbiol 1:136. 797
6. Jones CL, Napier BA, Sampson TR, Llewellyn AC, Schroeder MR, Weiss DS. 798
2012. Subversion of host recognition and defense systems by Francisella spp. 799
Microbiol Mol Biol Rev 76:383-404. 800
7. Bosio CM, Bielefeldt-Ohmann H, Belisle JT. 2007. Active suppression of the 801
pulmonary immune response by Francisella tularensis Schu4. J Immunol 802
178:4538-4547. 803
8. Crane DD, Ireland R, Alinger JB, Small P, Bosio CM. 2013. Lipids derived 804
from virulent Francisella tularensis broadly inhibit pulmonary inflammation via 805
toll-like receptor 2 and peroxisome proliferator-activated receptor alpha. Clin 806
Vaccine Immunol 20:1531-1540. 807
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
40
9. Hall JD, Woolard MD, Gunn BM, Craven RR, Taft-Benz S, Frelinger JA, 808
Kawula TH. 2008. Infected-host-cell repertoire and cellular response in the lung 809
following inhalation of Francisella tularensis Schu S4, LVS, or U112. Infect 810
Immun 76:5843-5852. 811
10. Malik M, Bakshi CS, Sahay B, Shah A, Lotz SA, Sellati TJ. 2006. Toll-like 812
receptor 2 is required for control of pulmonary infection with Francisella 813
tularensis. Infect Immun 74:3657-3662. 814
11. Mares CA, Ojeda SS, Morris EG, Li Q, Teale JM. 2008. Initial delay in the 815
immune response to Francisella tularensis is followed by hypercytokinemia 816
characteristic of severe sepsis and correlating with upregulation and release of 817
damage-associated molecular patterns. Infect Immun 76:3001-3010. 818
12. Weiss DS, Brotcke A, Henry T, Margolis JJ, Chan K, Monack DM. 2007. In 819
vivo negative selection screen identifies genes required for Francisella virulence. 820
Proc Natl Acad Sci U S A 104:6037-6042. 821
13. Brotcke A, Weiss DS, Kim CC, Chain P, Malfatti S, Garcia E, Monack DM. 822
2006. Identification of MglA-regulated genes reveals novel virulence factors in 823
Francisella tularensis. Infect Immun 74:6642-6655. 824
14. Hager AJ, Bolton DL, Pelletier MR, Brittnacher MJ, Gallagher LA, Kaul R, 825
Skerrett SJ, Miller SI, Guina T. 2006. Type IV pili-mediated secretion 826
modulates Francisella virulence. Mol Microbiol 62:227-237. 827
15. Ulland TK, Janowski AM, Buchan BW, Faron M, Cassel SL, Jones BD, 828
Sutterwala FS. 2013. Francisella tularensis live vaccine strain folate metabolism 829
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
41
and pseudouridine synthase gene mutants modulate macrophage caspase-1 830
activation. Infect Immun 81:201-208. 831
16. Ulland TK, Buchan BW, Ketterer MR, Fernandes-Alnemri T, Meyerholz DK, 832
Apicella MA, Alnemri ES, Jones BD, Nauseef WM, Sutterwala FS. 2010. 833
Cutting edge: mutation of Francisella tularensis mviN leads to increased 834
macrophage absent in melanoma 2 inflammasome activation and a loss of 835
virulence. J Immunol 185:2670-2674. 836
17. Huang MT, Mortensen BL, Taxman DJ, Craven RR, Taft-Benz S, Kijek TM, 837
Fuller JR, Davis BK, Allen IC, Brickey WJ, Gris D, Wen H, Kawula TH, 838
Ting JP. 2010. Deletion of ripA alleviates suppression of the inflammasome and 839
MAPK by Francisella tularensis. J Immunol 185:5476-5485. 840
18. Okan NA, Chalabaev S, Kim TH, Fink A, Ross RA, Kasper DL. 2013. Kdo 841
hydrolase is required for Francisella tularensis virulence and evasion of TLR2-842
mediated innate immunity. MBio 4:e00638-00612. 843
19. Lindemann SR, Peng K, Long ME, Hunt JR, Apicella MA, Monack DM, 844
Allen LA, Jones BD. 2011. Francisella tularensis Schu S4 O-antigen and capsule 845
biosynthesis gene mutants induce early cell death in human macrophages. Infect 846
Immun 79:581-594. 847
20. Peng K, Broz P, Jones J, Joubert LM, Monack D. 2011. Elevated AIM2-848
mediated pyroptosis triggered by hypercytotoxic Francisella mutant strains is 849
attributed to increased intracellular bacteriolysis. Cell Microbiol 13:1586-1600. 850
21. Singh A, Rahman T, Malik M, Hickey AJ, Leifer CA, Hazlett KR, Sellati TJ. 851
2013. Discordant results obtained with Francisella tularensis during in vitro and 852
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
42
in vivo immunological studies are attributable to compromised bacterial structural 853
integrity. PLoS One 8:e58513. 854
22. Dabo SM, Confer AW, Quijano-Blas RA. 2003. Molecular and immunological 855
characterization of Pasteurella multocida serotype A:3 OmpA: evidence of its 856
role in P. multocida interaction with extracellular matrix molecules. Microb 857
Pathog 35:147-157. 858
23. Ristow P, Bourhy P, da Cruz McBride FW, Figueira CP, Huerre M, Ave P, 859
Girons IS, Ko AI, Picardeau M. 2007. The OmpA-like protein Loa22 is 860
essential for leptospiral virulence. PLoS Pathog 3:e97. 861
24. Serino L, Nesta B, Leuzzi R, Fontana MR, Monaci E, Mocca BT, Cartocci E, 862
Masignani V, Jerse AE, Rappuoli R, Pizza M. 2007. Identification of a new 863
OmpA-like protein in Neisseria gonorrhoeae involved in the binding to human 864
epithelial cells and in vivo colonization. Mol Microbiol 64:1391-1403. 865
25. Wang Y. 2002. The function of OmpA in Escherichia coli. Biochem Biophys Res 866
Commun 292:396-401. 867
26. Bouveret E, Benedetti H, Rigal A, Loret E, Lazdunski C. 1999. In vitro 868
characterization of peptidoglycan-associated lipoprotein (PAL)-peptidoglycan and 869
PAL-TolB interactions. J Bacteriol 181:6306-6311. 870
27. Cascales E, Lloubes R. 2004. Deletion analyses of the peptidoglycan-associated 871
lipoprotein Pal reveals three independent binding sequences including a TolA box. 872
Mol Microbiol 51:873-885. 873
28. Parsons LM, Lin F, Orban J. 2006. Peptidoglycan recognition by Pal, an outer 874
membrane lipoprotein. Biochemistry 45:2122-2128. 875
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
43
29. Gerding MA, Ogata Y, Pecora ND, Niki H, de Boer PA. 2007. The trans-876
envelope Tol-Pal complex is part of the cell division machinery and required for 877
proper outer-membrane invagination during cell constriction in E. coli. Mol 878
Microbiol 63:1008-1025. 879
30. Mahawar M, Atianand MK, Dotson RJ, Mora V, Rabadi SM, Metzger DW, 880
Huntley JF, Harton JA, Malik M, Bakshi CS. 2012. Identification of a novel 881
Francisella tularensis factor required for intramacrophage survival and 882
subversion of innate immune response. J Biol Chem 287:25216-25229. 883
31. Mahawar M, Rabadi SM, Banik S, Catlett SV, Metzger DW, Malik M, 884
Bakshi CS. 2013. Identification of a live attenuated vaccine candidate for 885
tularemia prophylaxis. PLoS One 8:e61539. 886
32. Robertson GT, Child R, Ingle C, Celli J, Norgard MV. 2013. IglE is an outer 887
membrane-associated lipoprotein essential for intracellular survival and murine 888
virulence of type A Francisella tularensis. Infect Immun 81:4026-4040. 889
33. Hazlett KR, Caldon SD, McArthur DG, Cirillo KA, Kirimanjeswara GS, 890
Magguilli ML, Malik M, Shah A, Broderick S, Golovliov I, Metzger DW, 891
Rajan K, Sellati TJ, Loegering DJ. 2008. Adaptation of Francisella tularensis 892
to the mammalian environment is governed by cues which can be mimicked in 893
vitro. Infect Immun 76:4479-4488. 894
34. Horton RM. 1995. PCR-mediated recombination and mutagenesis. SOEing 895
together tailor-made genes. Mol Biotechnol 3:93-99. 896
35. Gallagher LA, McKevitt M, Ramage ER, Manoil C. 2008. Genetic dissection 897
of the Francisella novicida restriction barrier. J Bacteriol 190:7830-7837. 898
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
44
36. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer 899
RR, Schweizer HP. 2005. A Tn7-based broad-range bacterial cloning and 900
expression system. Nat Methods 2:443-448. 901
37. LoVullo ED, Molins-Schneekloth CR, Schweizer HP, Pavelka MS, Jr. 2009. 902
Single-copy chromosomal integration systems for Francisella tularensis. 903
Microbiology 155:1152-1163. 904
38. LoVullo ED, Sherrill LA, Pavelka MS, Jr. 2009. Improved shuttle vectors for 905
Francisella tularensis genetics. FEMS Microbiol Lett 291:95-102. 906
39. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 907
years of image analysis. Nat Methods 9:671-675. 908
40. Chong A, Wehrly TD, Nair V, Fischer ER, Barker JR, Klose KE, Celli J. 909
2008. The early phagosomal stage of Francisella tularensis determines optimal 910
phagosomal escape and Francisella pathogenicity island protein expression. 911
Infect Immun 76:5488-5499. 912
41. Radolf JD, Chamberlain NR, Clausell A, Norgard MV. 1988. Identification 913
and localization of integral membrane proteins of virulent Treponema pallidum 914
subsp. pallidum by phase partitioning with the nonionic detergent triton X-114. 915
Infect Immun 56:490-498. 916
42. Dotson RJ, Rabadi SM, Westcott EL, Bradley S, Catlett SV, Banik S, Harton 917
JA, Bakshi CS, Malik M. 2013. Repression of inflammasome by Francisella 918
tularensis during early stages of infection. J Biol Chem 288:23844-23857. 919
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
45
43. Checroun C, Wehrly TD, Fischer ER, Hayes SF, Celli J. 2006. Autophagy-920
mediated reentry of Francisella tularensis into the endocytic compartment after 921
cytoplasmic replication. Proc Natl Acad Sci U S A 103:14578-14583. 922
44. Chong A, Wehrly TD, Child R, Hansen B, Hwang S, Virgin HW, Celli J. 923
2012. Cytosolic clearance of replication-deficient mutants reveals Francisella 924
tularensis interactions with the autophagic pathway. Autophagy 8:1342-1356. 925
45. Kanistanon D, Hajjar AM, Pelletier MR, Gallagher LA, Kalhorn T, Shaffer 926
SA, Goodlett DR, Rohmer L, Brittnacher MJ, Skerrett SJ, Ernst RK. 2008. 927
A Francisella mutant in lipid A carbohydrate modification elicits protective 928
immunity. PLoS Pathog 4:e24. 929
46. Pyles RB, Jezek GE, Eaves-Pyles TD. 2010. Toll-like receptor 3 agonist 930
protection against experimental Francisella tularensis respiratory tract infection. 931
Infect Immun 78:1700-1710. 932
47. Rozak DA, Gelhaus HC, Smith M, Zadeh M, Huzella L, Waag D, Adamovicz 933
JJ. 2010. CpG oligodeoxyribonucleotides protect mice from Burkholderia 934
pseudomallei but not Francisella tularensis Schu S4 aerosols. J Immune Based 935
Ther Vaccines 8:2. 936
48. West TE, Pelletier MR, Majure MC, Lembo A, Hajjar AM, Skerrett SJ. 2008. 937
Inhalation of Francisella novicida Delta mglA causes replicative infection that 938
elicits innate and adaptive responses but is not protective against invasive 939
pneumonic tularemia. Microbes Infect 10:773-780. 940
49. Lewis K. 2000. Programmed death in bacteria. Microbiol Mol Biol Rev 64:503-941
514. 942
943
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
46
FIGURE LEGENDS 944
FIG. 1. FTL_0325 encodes a lipoprotein. (A) Schematic depiction of 945
FTT0831c/FTL_0325 and flanking genes (based on Schu S4 nomenclature). The OmpA 946
motif (encompassing asparagine 67 to leucine 180) is marked with a black bar. Putative 947
pseudogenes are indicated with parentheses. (B) The N-terminus of FTT0831c/FTL_0325 948
contains a lipobox motif (bold) including a canonical cysteine (underlined) at position 20. 949
(C) Autoradiograph demonstrating in vivo incorporation of [3H]palmitic acid into 950
polypeptides in the LVS or the FTL_0325 null mutant (Δ0325). FTL_0325 (0325) is 951
indicated with an arrow. The asterisk signifies an unrelated radiolabelled protein present 952
in whole cell lysates and serves as an internal label incorporation control. Abbreviations; 953
WCL, whole cell lysate; IP-α8, immunoprecipitate using rat anti-FTT0831c antisera 954
coupled dynabeads; IP-NS, immunoprecipitate using naïve rat sera coupled dynabeads. 955
956
FIG. 2. Attenuation of the Schu S4 FTT0831c null strain in time-to-death and 957
dissemination assays following intranasal administration to mice. (A) Groups of 6 to 8 958
C3H/HeN mice were infected intranasally with the indicated dose of Schu S4 or mutant 959
bacteria and monitored for signs of morbidity for up to three weeks post-infection (p.i.). 960
The data are representative of two independent experiments. (B) Groups of mice were 961
infected intranasally with ~102 CFU Schu S4 or mutant bacteria. Bacterial burdens were 962
determined by serial dilution and plating of organ homogenates for CFU on days 3 and 5 963
p.i.. Absence of any remaining bacteria for Δ0831was determined on day 35 p.i.. The 964
horizontal line indicates the mean result. The limit of detection (LOD) was 150 965
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
47
CFU/organ for spleens and lungs and 446 CFU/organ for livers. ns, not significant; **, P 966
< 0.01; ***, P < 0.001 (Two way ANOVA). 967
968
FIG. 3. Attenuation of the Schu S4 FTT0831c null strain in time-to-death and 969
dissemination assays following intraperitoneal administration to mice. (A) Groups of 8 970
C3H/HeN mice were infected intraperitoneally with the indicated dose of Schu S4 or 971
mutant bacteria and monitored for signs of morbidity for up to two weeks post-infection 972
(p.i.). (B) Bacterial burdens were determined by serial dilution and plating of organ 973
homogenates for CFU from two mice each on day 3 (all groups) and day 5 p.i. for the 974
Schu S4 Δ0831 mutant. The horizontal line indicates the mean result. *, P < 0.05 (Two 975
way ANOVA). 976
977
FIG. 4. The Schu S4 Δ0831 strain hyper-stimulates proinflammatory cytokine production 978
in the lungs of mice. Cytokine production at day 5 p.i. in lungs of infected mice was 979
measured by Bio-Plex Pro mouse cytokine 32-plex assay. Data are presented as a ratio of 980
cytokine levels stimulated by the Schu S4 Δ0831 mutant over that stimulated by the Schu 981
S4 parent. Dashed lines indicate an arbitrary 1.7-fold difference cut off. 982
983
FIG. 5. Altered surface properties of Schu S4 Δ0831 or LVS Δ0325. (A) Immuoblot 984
demonstrating altered LPS O-antigen production in the Schu S4 Δ0831 variant. Anti-F. 985
tularensis LPS O-antigen monoclonal antibody (FB11) or monospecific, polyclonal 986
antibodies to FTT0831c (α8) or FTT0825c (α0825) were used to assay LPS O-antigen 987
production, or FTT0831c/FTL_0325 levels, or FTT0825 levels (loading control), 988
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
48
respectively, in Schu S4, Schu S4 lacking FTT0831c (Δ0831), the complemented clone 989
(Pr-0831+), a variant lacking only the putative OmpA motif (Pr-Δ(OmpA)), the Δ0831 990
variant expressing the kanamycin-resistance gene (Pg-aphA), or an independently isolated 991
complemented clone (Pr-0831+ #8) (left panels) or LVS, LVS lacking FTL_0325 (Δ0325), 992
the complemented clone (Pr-0325+), or a variant lacking only the putative OmpA motif 993
(Pr-Δ(OmpA)) (right panels). (B) Resistance of Schu S4 or derivative bacteria to killing 994
by human serum. Bacteria were incubated for 60 min at 37°C in RPMI containing 10% 995
(v/v) fresh human serum (hatched bars) or human serum heat inactivated (solid bars) at 996
56°C for 30 min prior to use. E. coli DH5α and a spontaneous deep rough variant of Schu 997
S4 (rough S4) were used as positive controls for complement-mediated killing. (C) 998
Mutation of FTL_0325 in LVS leads to enhanced accessibility of the bacterial cell 999
surface. F. tularensis LVS, the Δ0325 mutant, and the complemented clone (Pr-0325+) 1000
were tested for surface binding of anti-F. tularensis LPS monoclonal antibody (LPS) or 1001
polyclonal anti-FTT0831c (0831), anti-FopA (FopA), anti-EfTu (EfTu) antibodies (ab) in 1002
surface accessibility assays (SAA). Bacteria with surface bound antibodies were lysed 1003
and the proteins were resolved by 12.5 % SDS PAGE and transferred to nitrocellulose. 1004
Immunoblots were performed using peroxidase-conjugated secondary antibodies to 1005
mouse (Mo) IgG or rat (Rt) IgG. Reactions with the heavy chain of IgG (IgG HC) and 1006
total Tul4A protein levels (loading control) are shown. 1007
1008
1009
FIG. 6. Loss of FTT0831c/FTL_0325 imparts growth defects at physiologic temperatures, 1010
aberrant morphology and altered cell division. (A) Ten-fold serial dilutions 1011
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
49
corresponding to the 10-2 (-2) the 10-3 (-3) and 10-4 (-4) of LVS, LVS lacking FTL_0325 1012
(Δ0325), the complemented clone (Pr-0325+), or a variant lacking only the putative 1013
OmpA motif (Pr-Δ(OmpA)) grown previously on sMHA at 30°C were spotted for growth 1014
at 30°C or 37°C on duplicate sMHA plates. (B-C) Disconnect between increases in cell 1015
mass (OD) and cell viability (CFU) in the LVS Δ0325 variant. Aerobic growth of LVS or 1016
mutant bacteria in sMHB was monitored spectrophotometrically by direct observation of 1017
OD at 600 nm in 1.5 cm tubes (B). Cell viability was determined in parallel by serial 1018
dilution in PBS and plating of samples onto sMHA at 30°C for CFU determinations (C). 1019
(D) Flow cytometric analysis showing the increase in ethidium bromide staining (DNA 1020
content) of the LVS Δ0325 and Schu S4 Δ0831 mutants or Schu S4 expressing a variant 1021
of FTT0831c lacking the putative OmpA motif (Δ(OmpA)) relative to wild type or a 1022
complemented mutant (0831+) when grown at 37°C. Relative numbers of genome 1023
equivalents were calculated as the ratio of the mean fluorescence peak of each sample 1024
over that observed for the parent grown at 37°C. The LVS Δ0325 mutant grown at 30°C 1025
(permissive temperature) was included as a control. (E-I) Bacterial morphology of LVS 1026
and derivatives visualized via transmission electron microscopy. (E) LVS parent at 1027
stationary phase at 37°C, (F) LVS Δ0325 at stationary phase at 37°C, (G) LVS Δ0325 at 1028
stationary phase at 30°C, (H) LVS Δ0325 at early log phase at 37°C, (I) the 1029
complemented LVS Δ0325 strain (Pr-0325+) at stationary phase at 37°C. All TEM images 1030
were scaled to the same extent. A scale bar is included for reference. (J-M) Bacterial 1031
morphology of Schu S4 and derivatives visualized by fluorescence microscopy of 4',6-1032
diamidino-2-phenylindole (DAPI)-stained cells fixed previously in 10% buffered neutral 1033
formalin. (J) Schu S4 parent at stationary phase at 37°C, (K) Schu S4 Δ0831 at stationary 1034
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
50
phase at 37°C, (L) the complemented Schu S4 Δ0831 strain (Pr-0831+) at stationary phase 1035
at 37°C, (M) Schu S4 (Δ(OmpA) at stationary phase at 37°C. All fluorescent microscopy 1036
images were scaled to the same extent. 1037
1038
FIG. 7. Aberrant cell morphology accompanies intracytosolic replication of the Schu S4 1039
Δ0831 strain and eventual lysis in late forming LAMP-1 positive endosomes. (A) Schu 1040
S4, the Δ0831 null mutant, or the Δ0831 null mutant complemented in trans from attTn7 1041
were used to infect BMM seeded in 24-well plates at a MOI of 50. Intracellular CFU 1042
were enumerated at various times p.i.. Data are presented as the means ± SD from a 1043
representative experiment performed at least twice. (B) Intracellular trafficking of Schu 1044
S4 and derivatives in BMM. At various times p.i., infected macrophages were subjected 1045
to a phagosomal integrity assay to enumerate the percentage of cytosolic bacteria. Data 1046
are the means ± SD of three independent experiments. (C) Representative confocal 1047
micrographs of BMM infected for 1 h or 10 h with Schu S4 and derivatives or 16 h with 1048
the Δ0831 null strain. Samples were processed for immunofluorescence labeling of 1049
bacteria (green) and LAMP-1-positive vacuoles (red). Single channel images of the 1050
boxed areas are shown in the magnified insets. White arrow indicates bacteria of interest. 1051
1052
FIG. 8. Progressive changes in morphology and reduced membrane integrity and cell 1053
death are associated with rapid growth of the LVS Δ0325 null mutant at physiologic 1054
temperatures. (A) LVS Δ0325 cells constitutively expressing mCherry were visualized by 1055
immunoflurescence microscopy during growth in sMHB at 37°C. Growth (i.e., 1056
doublings) was monitored spectorphotometrically by direct observation of OD at 600 nm 1057
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
51
in 1.5 cm tubes and samples were removed and fixed in 10% buffered neutral formalin 1058
prior to microscopic examination. Averages of bacteria exhibiting normal, irregular, or 1059
spherical morphology were determined by counting > 100 bacteria in at least two 1060
different fields. (B) Behavior of LVS (black circles), the LVS Δ0325 mutant (blue 1061
circles) or the complemented clone (Pr-0325+) (red circles) during serial passage in 1062
sMHB at 30°C (upper panel) or 37°C (lower panel). (C) Differences in OD (closed 1063
circles, dashed lines) at 600 nm and viable counts (open circles, solid lines) for the LVS 1064
Δ0325 mutant with serial passage at 30°C (upper panel) or 37°C (lower panel). (D) Live-1065
Dead staining of LVS, the LVS Δ0325 (Δ0325) mutant or the complemented clone (Pr-1066
0325+) grown to saturation at 37°C in sMHB. The percentage of viable LVS Δ0325 1067
bacteria relative to the Tn7 complemented clone (Pr-0325+) is shown. 1068
1069
FIG. 9. Model for FTT0831c/FTL_0325 contribution to cell division and inflammatory 1070
immune responses in vivo. FTT0831c/FTL_0325 (0831) encodes a bacterial lipoprotein 1071
that likely forms non-covalent interactions between the outer membrane (OM) and the 1072
peptidoglycan cell wall (PG). The inner membrane is shown (IM). Deletion of 1073
FTT0831c/FTL_0325 results in loss of critical OM and cell wall contacts promoting the 1074
formation of OM perturbations (especially at the midpoint or cell poles; where active or 1075
recent cell constriction has occurred) that may allow release of pathogen-associated 1076
molecular pattern molecules (PAMPs) directly or increase host access to these molecules. 1077
Diagrammatic representations of the various cell morphotypes associated with rapid 1078
growth of the F. tularensis FTT0831c/FTL_0325-deficient bacteria are shown. 1079
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
OmpAA
BFTT0831c(FTL 0325)
p
fkpB (FTT0830c) FTT0829c (FTT0828c)
CB
FTT0831c/FTL_0325 N-terminus
0325+ Δ0325
WC
LIP
-α8
IP-N
S
WC
LIP
-α8
IP-N
S
(FTL_0325) C
50* *1-MKKLLKLCLMTSLITTLSACQ-2150
370325 * *
Robertson et al. Fig.1
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.2A
Surv
ival
(%)
S
B
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.3
0 5 1 0 1 5 2 0
0
2 5
5 0
7 5
1 0 0
0 8 3 1 2 0 5 C F U (N = 8 )
P r -0 8 3 1+ 1 1 2 C F U (N = 8 )
S c h u S 4 2 0 9 C F U (N = 8 )
D a ys (p .i.)
Su
rviv
al
(%)
3 50
2
4
6
8
1 0
1 2L u n g
L O D
D a y s (p .i. )
CF
U/o
rga
n (
log
10)
S c h u S 4
0 8 3 1
P r-0 8 3 1+
n s
*
3 50
2
4
6
8
1 0
1 2L iv e r
L O D
D a y s (p .i. )
CF
U/o
rga
n (
log
10)
n s
*
3 50
2
4
6
8
1 0
1 2S p le e n
L O D
D a y s (p .i. )
CF
U/o
rga
n (
log
10)
n s
*
A
B
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.4
Ra
tio
lu
ng
cy
tok
ine
co
nc
.
(08
31
/ W
T)
IL-1
7
IFN
IL-1
IL-1
ß
TN
F
LIF
RA
NT
ES
IP-1
0
MIP
-1ß
IL-1
2(p
70
)
MIP
-1
LIX
VE
GF
IL-6
GM
-CS
F
IL-9
IL-1
2(p
40
)
IL-4
IL-1
5
IL-3
Eo
tax
in
IL-2
MIG
M-C
SF
IL-7
IL-1
3
MIP
-2
KC
IL-5
IL-1
0
MC
P-1
G-C
SF
0 .1
1
1 0
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
A
u S4
831+
31 phA
831+
#8
25 325+
(Om
pA)
(Om
pA)
5 25+C
FB11
Sch
u
P r-0
8Δ
083
P g-a
pP r
-08
LVS
Δ03
2P r
-03
P r-Δ
(
375075
150
P r-Δ
(
LVS
Δ03
25P r
-032
LPS
0831
SAA ab
(αO-Ag)
15
2025
Tul4A
EfTu
IgG HC
FopA
Bα825
α8(0831)
20
5037
EfTu
Tul4A-
B
mL
(Log
)
103
104
105
106
107
CFU
/m
DH
5 α
chu
S4
Δ08
31
0831
+
ugh
S4
100
101
102
103
Robertson et al. Fig. 5Sc Δ
Pr -
rou
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.6
LVS Schu S4ALVS
-2 -3 -4 -2 -3 -4
EPr-0325+
Δ0325
Pr-Δ(OmpA)
30°C 37°C
E J
BK
GF
C
LI
HC
D 2 μM
MMean fluorescence values (relative number of genome eq.)
LVS-based Schu S4-based
WT Δ0325 Δ0325(30°C) WT Δ0831 0831+ Δ(OmpA)
23.5 (1.0)
87.3 (3.7)
26.1 (1.1)
44.5 (1.0)
109.0 (2.5)
48.0 (1.1)
123.0 (2.8)
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.7
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
A B C
Robertson et al. Fig.8
1 1 10 C
3 doublings OD
600
0.01
0.10.1
6
8
OD
600
CFU
/mL (Log
10
5 doublings0 24 48
0.00130°C
0 0 1
1
0 24 480.01 4
0 )30°C
1
8
10
0
CFU
/m
7 doublings OD
60
0 24 480.001
0.01
0.1
37°C
0 24 480.01
0.1
4
6
8
OD
60
mL (Log
10 )37°C
D13 doublings
doublings% of cells
Time (h) Time (h)
doublingsnormal irregular spherical
3 95 5 0
5 65 33 2
7 45 46 9 50.3%
LVS Pr-0325+Δ032513 3 6 91
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from
Robertson et al. Fig.9
↑ Access↑ PAMP
37°C(early log)
?
↑ AccessPAMP
↑ PAMPrelease
?
OM
0831
37°C(late log)
OM
PG
Schu S4 (wild-type)or complemented mutant Δ0831 (Schu S4) F. tularensis Δ0831
IM
or complemented mutant
on August 7, 2020 by guest
http://iai.asm.org/
Dow
nloaded from