OPTIC NERVE REGENERATION IN ADULT

RAT

Ying Hu

This thesis is presented for the degree of Doctor of Philosophy

of

The University of Western Australia

School of Anatomy & Human Biology

2006

In Memory of Grandma Zhiqin Zhang

Dedicated to Carla Hu and Chendong Pan

LY injected RGC picture was taken by Eleanor Drummond from normal Fisher 344 rat.

Declaration for thesis containing published work and work prepared for publication

1． Hu, Y., Arulpragasam, A., Plant, G.W., Verhaagen J., Cui, Q., Harvey, A.R. The importance of transgene and cell type on the regeneration of adult retinal ganglion cell axons within reconstituted bridging grafts. (Submitted) (In Chapter 5) (Hu, Y contributed 85% of the experimental work, others contributed 15%)

2． Hu, Y., Cui, Q., Harvey, A.R. Interactive effects of C3, cyclic AMP and ciliary neurotrophic factor on adult retinal ganglion cell survival and axonal regeneration. Mol Cell Neurosci. 2007; 34(1):88-98. (In Chapter 7) (Hu, Y contributed 90% of the experimental work, others contributed 10%)

3． Harvey, A.R., Hu, Y., Leaver, S.G., Mellough CB, Park, K., Plant, G.W., Verhaagen, J. and Cui, Q. Gene therapy and transplantation in CNS repair: the visual system. Prog Retin Eye Res 2006; 25:449-89. (In Chapter 4,6,8) (Hu, Y contributed 10% of the work, others contributed 90%)

4． Hu, Y., Leaver, S.G., Plant, G.W., Hendriks, W.J., Niclou, S.P., Verhaagen, J. Harvey, A.R., Cui, Q. Lentiviral-mediated transfer of CNTF to Schwann cells within reconstructed peripheral nerve grafts enhances adult retinal ganglion cell survival and axonal regeneration. Mol Ther 2005; 11: 906-15. (In Chapter 4) (Hu, Y contributed 85% of the experimental work, others contributed 15%)

5． Harvey, A.R., Park, K., Hu, Y., Leaver, S.G., Plant, G.W., Verhaagen, J. and Cui, Q. New approaches to promote the regeneration of injured adult retinal ganglion cell axons. Proceedings of the 7th International Neurotrauma Symposium. Medimond S.R.L., Monduzzi Editore, Bologna, Italy, (2004) pp 37-42. (In Chapter 4) (Hu, Y contributed 20% of the work, others contributed 80%)

Signature of Candidate: Signature of Coordinating Supervisor:

Declaration

I hereby declare that the work presented in this thesis was carried out in the School of Anatomy and Human Biology, The University of Western Australia. Some of the surgery in Chapter 4 was performed by Dr. Qi Cui; lentiviral vectors (LVs) encoding CNTF, GDNF, BDNF, eGFP were produced by Dr. Qi Cui and members of Dr. Joost Verhaagen’s laboratory at the Netherlands Institute for Brain Research. Some of the BDNF, GDNF lentiviral vectors were produced by Ms Ajanthy Arulpragasam in Dr. Giles Plant’s laboratory. CNTF bioassay in Chapter 4 was performed by Dr. Giles Plant. EM pictures in Chapter 4 were collected by Dr. Michael Archer at School of Animal Biology, University of Western Australia. C3 (C3-11) used in Chapter 7 was provided by Dr. Lisa McKerracher (CONFIDENTIAL data, under IP agreement with Bioaxone Therapeutic, Montreal). Apart from these technical contributions, all experiments are entirely my own, and have not previously been submited for examination.

i

Table of Contents Summary ································································································································i Acknowledgements ·············································································································iii Abbreviation ·······················································································································iv List of Figures ·····················································································································vii List of Tables ························································································································x Publications and Proceedings ·····························································································xi

Chapter One – Axonal injury in the CNS

1.1 Some comments on the molecular pathology in CNS injury 1.1.1 Intrinsic influences

1.1.1.1 Species, strain, gender difference ·······························································2 1.1.1.2 Neuronal age difference ·············································································2 1.1.1.3 Intracellular cAMP levels in normal and injured neurons ······················3

1.1.2 Extrinsic inhibitory influences 1.1.2.1 Axon growth inhibitors in the glial scar ··················································4 1.1.2.2 Axon growth inhibitors in myelin ···························································7 1.1.2.3 Neurite inhibitory signal transduction ··················································10

Chapter Two – Regeneration strategies for CNS injury 2.1 Nerve growth stimulatory factors

2.1.1 Neurotrophins 2.1.1.1 NGF ·········································································································14 2.1.1.2 BDNF ·······································································································15 2.1.1.3 NT-3 ·········································································································16 2.1.1.4 NT-4/5 ····································································································17

2.1.2 Neurocytokines ···································································································18 2.1.3 Glial cell line-derived neurotrophic factor (GDNF) family ·····························21 2.1.4 Other growth factors

2.1.4.1 Basic fibroblast growth factor (bFGF) ···················································22 2.1.4.2 Insulin-like growth factors (IGFs) ··························································22 2.1.4.3 Interleukins (ILs) ······················································································23 2.1.4.4 Lens epithelium-derived growth factor (LEDGF) ·································23

2.1.5 Nucleotides ··········································································································24 2.2 Tissue engineering

2.2.1 PN autografts ······································································································25 2.2.2 Reconstructed acellular PN allografts ································································25 2.2.3 Synthetic channel grafts ······················································································26 2.2.4 Cell/ tissue transplantation ················································································26

2.3 Neutralizing the inhibitory molecules/ pathways 2.3.1 Neutralizing the inhibitors in glia scar ······························································28 2.3.2 Neutralizing the inhibitors in myelin ·······························································29 2.3.3 Inactivation of Rho pathway ·············································································30

2.4 Immunotherapy 2.4.1 Immune suppressors ···························································································31 2.4.2 Therapeutic vaccines ···························································································31

2.5 Regeneration associated genes & guidance cues ······················································32 2.6 Enhancing functional CNS plasticity ······································································35 2.7 Gene therapy

ii

2.7.1 Non-viral methods ······························································································35 2.7.2 RNA viral vectors ·······························································································35 2.7.3 DNA viral vectors ······························································································36

Chapter Three – Literature review of ON injury and RGC reaction after injury 3.1 Normal parameters of RGCs ···················································································38 3.2 Injury models ············································································································41 3.3 Pathophysiology after adult ON transection ··························································44 3.4 Strategies to promote RGC survival and regeneration after injury ·······················45 3.5 RGC quantification ··································································································46

Chapter Four – Lentiviral-mediated transfer of CNTF to Schwann cells in reconstituted peripheral nerve grafts

4.1 Introduction···············································································································50 4.2 Materials and Methods ······························································································51 4.3 Results·························································································································59 4.4 Discussion···················································································································71 4.5 Conclusion··················································································································73

Chapter Five – Lentiviral-mediated transfer of BDNF or GDNF to Schwann cells in reconstructed peripheral nerve grafts 5.1 Introduction················································································································74 5.2 Materials and Methods ·······························································································74 5.3 Results··························································································································77 5.4 Discussion····················································································································86 5.5 Conclusion···················································································································88

Chapter Six – PN grafts containing fibroblasts or mixtures of fibroblasts and Schwann cells 6.1 Introduction················································································································89 6.2 Materials and Methods ·······························································································89 6.3 Results··························································································································90 6.4 Discussion····················································································································93 6.5 Conclusion···················································································································95

Chapter Seven – Synergistic effect of C3, cyclic AMP and CNTF on adult retinal ganglion cell survival and axonal regeneration into PN autografts 7.1 Introduction················································································································96 7.2 Materials and Methods ·······························································································97 7.3 Results··························································································································99 7.4 Discussion··················································································································106 7.5 Conclusion·················································································································111

Chapter Eight – Chondroitinase-ABC treated PN autografts 8.1 Introduction··············································································································112 8.2 Materials and Methods ·····························································································113 8.3 Results························································································································114 8.4 Discussion··················································································································120 8.5 Conclusion·················································································································124

Chapter Nine – General Disscussion···············································································125 References··························································································································127

i

Summary

There is limited intrinsic potential for repair in the adult human central nervous system (CNS). Dysfunction resulting from CNS injury is persistent and requires prolonged medical treatment and rehabilitation. The retina and optic nerve are CNS-derived, and adult retinal ganglion cells (RGCs) and their axons are often used as a model in which to study the mechanisms associated with injury, neuroprotection and regeneration. In this study I investigated the effects of a variety of strategies on promoting RGC survival and axonal regeneration after optic nerve injury, including the use of reconstructed chimeric peripheral nerve (PN) grafts, gene therapy, and intraocular application of pharmacological agents and other factors. Previous work in the lab led to the development of a method for reconstituting cell-free PN sheaths with purified adult Schwann cells (SCs) which resulted in the support of regeneration of CNS axons. In the first part of my study I developed new types of PN bridges that contained genetically modified adult SCs, to determine if increased production of growth factors resulted in greater numbers of RGCs regenerating their axons. The PN grafts were sutured on to the cut optic nerve of adult rats. The in vivo results showed that transducing SCs with lentiviral (LV) vectors encoding a secretable form of ciliary neurotrophic factor (CNTF) led to enhanced RGC survival and increased axonal regrowth in reconstructed PN bridges. Interestingly however, LV transduction of SCs with brain-derived neurotrophic factor (BDNF) or glial cell line-derived neurotrophic factor (GDNF) did not have similar effects on RGCs. However, I obtained evidence that PN containing BDNF engineered SCs attracted many peripheral sensory neural axons from the surrounding environment into the reconstructed nerves. In addition to reconstituting PN with purified adult SCs, I also tested fibroblasts that had been engineered to express CNTF, to examine if these cells also improved RGC viability and axonal regeneration in the rat visual system. Analysis of the data did not reveal any positive effects, either on survival or axonal regrowth. These data suggest that fibroblasts may not be a suitable candidate for reconstituting PN grafts, even when engineered to express relevant growth factors. Incorporation of mixed populations of fibroblasts and SCs was also less effective than using pure SC populations. Previous studies have shown that digestion of chondroitin sulfate proteoglycans (CSPGs) with Chondroitinase-ABC (Ch-ABC) can promote axonal regeneration and functional recovery in after PN or spinal cord injury. Therefore I examined whether degradation of CSPGs inside PNs by Ch-ABC would further enhance RGC survival and/or axonal regeneration into PN autografts. In vivo results shown that (i) CSPG was expressed in PN segments after injury; (ii) Ch-ABC can successfully and temporally digest the side chain of CSPGs; however (iii) this treatment did not improve RGC survival or regeneration. On the contrary, it actually reduced the amount of RGC axon regeneration. This was possibly due to incomplete digestion of CSPGs, compensated upregulation of CSPGs, or the core protein of CSPGs remains, or is even more inhibitory to, the growth cones of regenerating RGC axons.

ii

I also tested the neuroprotective effects of various pharmacological agents injected into the vitreous of the eye, directly targeting retinal ganglion cell bodies. Rho GTPase has been demonstrated to be the final common pathway of growth-inhibitory signals that are initiated by various inhibitory factors including glia scar and myelin associated molecules (OMgp, MAG, and Nogo). C3 transferase is an enzyme derived from Clostridium botulinum that inactivates Rho GTPase. Because SC myelin contains MAG and PN also contains CSPGs, I tested the effects of intraocular injection of a modified form of C3 (C3-11), provided by Dr Lisa McKerracher (CONFIDENTIAL data, under IP agreement with Bioaxone Therapeutic, Montreal) on RGC axonal regeneration into PN autografts. My results showed that there was significantly more RGC survival and axonal regeneration in PN autografts after repeated intraocular injection of C3. I also tested whether intraocular injections of CPT-cAMP and/or CNTF can act in concert with the C3 to further increase RGC survival and/or regeneration. Results showed that the effect of C3 and CPT-cAMP plus CNTF were synergistic and partially additive. The use of combination therapies therefore offers the best hope for robust and substantial regeneration. The overall results from my PhD project will help determine how best to reconstruct nerve pathways and use pharmacological interventions in the clinical treatment of CNS injury, hopefully leading to improved functional outcomes after neurotrauma.

iii

Acknowledgements

The present study was done in the School of Anatomy and Human Biology, UWA, during the time from 2003 to 2006. It is my pleasure to thank the following people, who have given their effort and support to this work. First, I must thank my supervisors, Qi Cui and Alan Harvey, for supervising the whole project. I thank Qi for his surgery skills and his consistent encouragement, direction and support, Alan for his key guidance, enthusiasm, and helpful criticism. Now I have tasted both the modern and traditional ways of research. Second, thanks must go to the rats, more than 200 rats sacrificed their life to help to finish this thesis. Special thanks to lab mates over the years, particularly Giles Plant, Margaret Pollett, Natalie Symons. Many thanks to Eleanor Drummond, Maria Grade Godinho and Jacob Wei Wei Ooi for their advice and giving many valuable suggestions and opinions about the thesis. Also many thanks to Mats Hellstrom, Kirstyn Dixon and Kevin Park, it is really lucky to meet you guys and made this lab a more pleasant place to be. Thanks also go to all the staff and students of the School of Anatomy, who have helped me over the years. Special thanks must go to Susan Hisheh and Greg Cozens for their technical help during my project. I am grateful to the WAIMR Scholarship, Ad Hoc Scholarship, the Australian government for my International Postgraduate Research Scholarship, the University of Western Australia for my University Postgraduate Award, Completion Scholarship without which I could not have attempted this PhD. I would also like to thank Woodside Energy Limited for my PhD Excellence Award, also travel award provided by UWA. I thank Ajanthy Arulpragasam and all the people from Joost Verhaagen’s laboratory at the Netherlands Institute for Brain Research for constructing and providing the lentiviral vectors. Finally, I must express my gratitude to my family, thanks for the support and love of my wife, Chendong Pan and daughter, Carla Hu. I am also very grateful to my parents, Jingong Hu and Xiaoyan Liu, for their love and support during my lengthy study period. Without them I simply couldn’t exist.

iv

Abbreviations

AA..................................................................................................................... amino acid AAV.................................................................................................adeno-associated virus ALS .......................................................................................amyotrophic lateral sclerosis ANOVA ..............................................................................................analysis of variance APCs ..............................................................................................antigen presenting cells AV.................................................................................................................... Adenovirus BDNF ...........................................................................brain-derived neurotrophic factor bFGF................................................................................... basic fibroblast growth factor cAMP .............................................................................cyclic adenosine monophosphate cdk ............................................................................................... cyclin-dependent kinase Cdc ..........................................................................................................cell division cycle CGRP................................................................................. calcitonin gene-related peptide Ch-ABC ........................................................................................... Chondroitinase ABC CNS................................................................................................ central nervous system CNTF ...................................................................................... ciliary neurotrophic factor CNTFR..................................................................... ciliary neurotrophic factor receptor CO2 .............................................................................................................carbon dioxide CPT-cAMP ..................... 8-(4-chlorophenylthio)-adenosine 3’:5”-cyclic monophosphate CREB ............................................................... cAMP response element binding protein CSPGs ...........................................................................chondroitin sulfate proteoglycans CST ........................................................................................................corticospinal tract db-cAMP.................................................................................................. dibutyryl-cAMP DCC........................................................................................ deleted in colorectal cancer DMEM.......................................................................Dulbecco’s modified Eagle medium DNA ................................................................................................deoxyribonucleic acid DRG .................................................................................................. dorsal root ganglion DSPGs...............................................................................dermatan sulfate proteoglycans DsRed........................................................................................................... Discosoma red ECM ................................................................................................... extracellular matrix ELISA.................................................................Enzyme-Linked-Immuno-Sorbant-Assay ER .................................................................................................. endoplasmic reticulum ERK............................................................................ extracellular signal-regulated kinase FB....................................................................................................................... Fibroblast FGF.............................................................................................. fibroblast growth factor FN..................................................................................................................... fibronectin GAG ...................................................................................................glycosaminoglycans GAP ..........................................................................................GTPase-activating protein GDI .........................................................................................GDP dissociation inhibitor GDNF............................................................... glial cell line-derived neurotrophic factor GDS.......................................................................................GDP dissociation stimulator GEF........................................................................... guanine nucleotide exchange factors GFAP.....................................................................................glial fibrillary acidic protein GFP............................................................................................ green fluorescent protein GFRα ...................................................................................GDNF family receptor alpha GPI....................................................................................... glycosylphosphatidylinositol HBSS ....................................................................................Hank’s balanced salt solution HIV ................................................................................. human immunodeficiency virus

v

HSPG.................................................................................. heparin sulfate proteoglycans IGF............................................................................................ Insulin-like growth factor IgG ...................................................................................................... immunoglobulin G INL........................................................................................................inner nuclear layer KSPGs .................................................................................. keratin sulface proteoglycans LIF............................................................................................ leukemia inhibitory factor IL ....................................................................................................................... interleukin LEC......................................................................................................lens epithelium cell LEDGF .................................................................. lens epithelium-derived growth factor LN...........................................................................................................................laminin LV ............................................................................................................. lentiviral vector MAG................................................................................ myelin-associated glycoprotein MAPK........................................................................... mitogen-activated protein kinase MBP .................................................................................................. myelin basic protein MHC............................................................................ major histocompatibility antigens MMP ..............................................................................................matrix metalloprotease MP...................................................................................................... methylprednisolone mRNA .....................................................................................messenger ribonucleic acid NCAM.................................................................................neural cell adhesion molecule NGF....................................................................................................nerve growth factor NgR.............................................................................................................. nogo receptor NMDA.............................................................................................N-methyl-D-aspartate NP...................................................................................................................... neuropilin NRH ...............................................................................neurotrophin receptor homolog NT-3........................................................................................................... neurotrophin-3 NT-4/5 .................................................................................................. neurotrophin-4/5 NT-6 .......................................................................................................... neurotrophin-6 NT-7 .......................................................................................................... neurotrophin-7 O2 ............................................................................................................................ oxygen OEC.................................................................................... olfactory ensheathing glia cell OEG.......................................................................................... olfactory ensheathing glia OMgp......................................................................oligodendrocyte myelin glycoprotein ON....................................................................................................................optic nerve ONL................................................................................................... outer nuclear layber P0 .................................................................................................................... protein zero p75NTR........................................................... low affinity nerve growth factor receptor PBS .............................................................................................phosphate buffered saline PCD ...............................................................................................programmed cell death PKA ......................................................................................................... protein kinase A PLL................................................................................................................. poly-L-lysine PN.............................................................................................................peripheral nerve PNS ...........................................................................................peripheral nervous system RAGs ................................................................................... regeneration associated genes Ret ..................................................................................... rearranged during transfection RGC.................................................................................................... retinal ganglion cell RGM ......................................................................................repulsive guidance molecule RNA.......................................................................................................... ribonucleic acid ROCK................................................................................................................ rho-kinase SC...................................................................................................................Schwann cell

vi

SCI.......................................................................................................... spinal cord injury Sema ................................................................................................................. semaphorin siRNA ............................................................................small interfering ribonucleic acid STAT ...................................................... signal transducer and activator of transcription TBI ................................................................................................. traumatic brain injury TGF.........................................................................................transforming growth factor TH..................................................................................................... tyrosine hydroxylase TN.......................................................................................................................... tenascin TNF ............................................................................................... tumour necrosis factor Trk ............................................................................................................ tyrosine kinases VAChT ....................................................................... vesicular acetylcholine transporter VEGF...........................................................................vascular endothelial growth factor

vii

List of Figures

Figure 1.1 CNS myelin inhibitory signalling scheme. 6 Figure 1.2 Diagram showing Nogo isoforms. 7 Figure 1.3 Schematic diagram showing the neurite inhibitory

signal transduction pathway. 10

Figure 2.1 Diagram of molecular structure of CNTF dimers. 19 Figure 3.1 Possible models of lenticuloretinal interactions after

lens injury. 43

Figure 3.2 The four basic stages of RGC death. 44 Figure 3.3 The retino-tectal projection of the rat: anatomy,

labelling techniques, and ON lesion paradigm. 48

Figure 3.4 Diagram showing anatomy of rat eye and various intraocular approaches.

49

Figure 4.1 Diagram showing overview of experimental protocol. 51 Figure 4.2 Time course diagram showing experimental design. 52 Figure 4.3 Diagram showing branches of the left sciatic nerve. 52 Figure 4.4 Schematic drawing of the LV vectors. 54 Figure 4.5 Gene expression in SCs after transduction and

bioactivity assay of supernatant from transduced SCs. 61

Figure 4.6 RT-PCR of CNTF mRNA from transduced SCs and engineered PN grafts.

62

Figure 4.7 ELISA of CNTF from conditioned media, SCs and engineered PN grafts.

64

Figure 4.8 Immunostained PN grafts reconstituted with LV-GFP and LV-CNTF transduced SCs. Examples of FG-labeled regenerating and βIII-tubulin immunostained viable RGCs in retinal wholemount.

65

Figure 4.9 The number of surviving and regenerating RGCs after genetic manipulation of the reconstituted PN grafts.

67

Figure 4.10 Immunostained axons in the proximal and distal parts of a PN graft repopulated with LV-CNTF transduced SCs.

68

Figure 4.11 The number of pan-neurofilament and CGRP immunostained axons at various distances along the SC reconstructed PN grafts.

69

Figure 4.12 Representative semithin, ultrathin and electron microscopic images of LV-CNTF transduced SC reconstituted PNs.

70

Figure 5.1 Real-time PCR of BDNF mRNA expression from LV-GFP or LV-BDNF transduced SCs.

77

Figure 5.2 ELISA of BDNF protein from SC reconstructed PN grafts.

79

Figure 5.3 Bioactivity assays of supernatant from LV-GFP and LV-BDNF transduced SCs.

79

Figure 5.4 Examples of surviving and regenerating RGCs from retinas with LV-BDNF SC reconstructed PN grafts.

80

viii

Figure 5.5 The number of surviving and regenerating RGCs in rats with LV-GFP, LV-BDNF or LV-GDNF SC reconstructed PN grafts.

80

Figure 5.6 The number of immunostained axons at various distances along the PN autografts.

81

Figure 5.7 CGRP and pan-neurofilament immunostained axons in LV-BDNF SC reconstructed PNs.

82

Figure 5.8 The number of pan-neurofilament and CGRP immunostained axons along the LV-BDNF SC reconstructed PN grafts.

82

Figure 5.9 Immunostained axons in normal optic nerve. 84 Figure 5.10 Immunostained axons in peroneal nerve. 85 Figure 5.11 Pan-neurofilament immunostained axons, 1 week after

graft. 85

Figure 5.12 The number of pan-neurofilament immnostained axons at various distances along the LV-GDNF PN grafts.

86

Figure 6.1 Immunostaining of CNTF in CON-FBs and CNTF-FBs.

91

Figure 6.2 ELISA of CNTF protein from CNTF-FBs. 91 Figure 6.3 Examples of surviving RGCs in retinal wholemount of

rat received PN grafts reconstituted with CNTF-FBs. 92

Figure 6.4 The number of surviving and regenerating RGCs in retinal wholemount of rats received FB reconstructed PN grafts.

92

Figure 6.5 Pan-neurofilament immunostained axons in FB reconstructed PN grafts.

93

Figure 7.1 Examples of regenerating and surviving RGCs in rats that received saline or C3-11 injections.

100

Figure 7.2 The number of surviving and regenerating RGCs after intraocular injections of saline or C3-11.

100

Figure 7.3 The number of surviving and regenerating RGCs after various double injection protocols.

102

Figure 7.4 The number of pan-neurofilament immunostained axons at various distances along PN autograft in different eye injection groups.

103

Figure 7.5 The number of pan-neurofilament and CGRP immnostained axons at various distances along the PN autografts.

104

Figure 7.6 RGC densities at different eccentricities from the optic nerve head.

105

Figure 7.7 Retinal sections immunostained with ED1. 106 Figure 7.8 Diagram shows the CPT-cAMP and db-cAMP

structures. 107

Figure 8.1 Diagram shows the proteoglycan structure. 112 Figure 8.2 CSPG neoepitope immunofluorescence of sections

from Ch-ABC treated PN grafts. 116

Figure 8.3 CSPG immunostaining and semi-quantification of sections from Ch-ABC treated PN grafts.

117

ix

Figure 8.4 CSPG immunostaining and semi-quantification of sections from PBS treated PN grafts.

118

Figure 8.5 The number of surviving RGCs in control or Ch-ABC treated PN grafts over time.

118

Figure 8.6 Immunostained wholemounted retinas illustrating surviving and regenerating RGCs in Ch-ABC treated PN grafts

119

Figure 8.7 The number of surviving and regenerating RGCs in PBS or Ch-ABC treated PN grafts 4 weeks in vivo.

119

Figure 8.8 The number of pan-neurofilament immnostained axons at various distances along PBS or Ch-ABC treated PN grafts.

120

x

List of Tables

Table 3.1 Examples of RGC number in normal retina in adult rat of different strains.

38

Table 6.1 Experimental cohorts. 90 Table 7.1 RGCs/retina for different experimental groups 99

xi

Publications and Proceedings

Publications Resulting From PhD Candidature

1． Hu, Y., Arulpragasam, A., Plant, G.W., Verhaagen J., Cui, Q., Harvey, A.R. The importance of transgene and cell type on the regeneration of adult retinal ganglion cell axons within reconstituted bridging grafts. (Submitted)

2． Cui, Q., Hodgetts, S.I., Hu, Y., Luo, J.M., Gillon, R.S., Harvey, A.R. Strain-specific differences in the effects of cyclosporin-A and FK506 on the survival and regenerationof axotomized retinal ganglion cells in adult rats. Neuroscience. 2007;146:986-99.

3． Hu, Y., Cui, Q., Harvey, A.R. Interactive effects of C3, cyclic AMP and ciliary neurotrophic factor on adult retinal ganglion cell survival and axonal regeneration. Mol Cell Neurosci. 2007; 34:88-98.

4． Harvey, A.R., Hu, Y., Leaver, S.G., Mellough CB, Park, K., Plant, G.W., Verhaagen, J. and Cui, Q. Gene therapy and transplantation in CNS repair: the visual system. Prog Retin Eye Res 2006; 25:449-89.

5． Hu, Y., Leaver, S.G., Plant, G.W., Hendriks, W.J., Niclou, S.P., Verhaagen, J. Harvey, A.R., Cui, Q. Lentiviral-mediated transfer of CNTF to Schwann cells within reconstructed peripheral nerve grafts enhances adult retinal ganglion cell survival and axonal regeneration. Mol Ther 2005; 11: 906-15.

6． Harvey, A.R., Park, K., Hu, Y., Leaver, S.G., Plant, G.W., Verhaagen, J. and Cui, Q. New approaches to promote the regeneration of injured adult retinal ganglion cell axons. Proceedings of the 7th International Neurotrauma Symposium. Medimond S.R.L., Monduzzi Editore, Bologna, Italy, (2004) pp 37-42.

Abstracts

1． Genetic modification of chimeric peripheral nerve grafts: effects on CNS regeneration. Y. Hu, G.W. Plant, A.R. Harvey, Q. Cui. The 16th Annual Combined Biological Sciences Meeting. Perth, August, 2006. (Best Poster Image Prize)

2． Modification of peripheral nerve grafts and the regeneration of adult retinal ganglion cell axons. Y. Hu, J. Verhaagen, L. McKerracher, Q. Cui , and A. R. Harvey. the 26th Annual Meeting of the Australian Neuroscience Society. Sydney, February, 2006. (Travel Award; Oral Presentation)

3． Genetic modification of chimeric peripheral nerve grafts: effects on CNS regeneration. Y. Hu, G.W. Plant, A.R. Harvey, Q. Cui. Program No. 718.5. 2005 Washington, DC: Society for Neuroscience, 2005.

4． Schwann cells transduced with CNTF enhance retinal ganglion cell survival and axonal regeneration through chimeric peripheral nerve grafts in adult rats. Hu, Y., Leaver, S., Verhaagen, J., Plant, G.W., Harvey, A.R. and Cui, Qi. The 23th Symposium of Western Australian Neuroscience, Perth, 2005. (WAIMR Poster Prize)

5． Schwann cells transduced with CNTF enhance retinal ganglion cell survival and axonal regeneration through chimeric peripheral nerve grafts in adult rats. Hu, Y., Leaver, S., Verhaagen, J., Plant, G.W., Harvey, A.R. and Cui, Qi. 7th International Neurotrauma Symposium. Adelaide, September, 2004.

xii

6． Delivery of ciliary neurotrophic factor via lentiviral-mediated transfer promotes regeneration of adult retinal ganglion cell axons. Hu, Y., Leaver, S., Verhaagen, J., Plant, G.W., Harvey, A.R. and Cui, Qi. The 24th Annual Meeting of the Australian Neuroscience Society. Melbourne, January, 2004. (Travel Award; Oral Presentation)

7． Schwann cells transduced with CNTF enhance retinal ganglion cell survival and axonal regeneration through chimeric peripheral nerve grafts in adult rats. Y. Hu, Joost Verhaagen, Alan Harvey, Qi Cui. The 14th Annual Combined Biological Sciences Meeting. Perth, August, 2003. (ANZSCDBI poster prize)

8． Enhanced Neuronal Survival and Axonal Regeneration in CNS by Lentiviral Vectors Encoding Ciliary Neurotrophic Factor. Y. Hu, Joost Verhaagen, Alan Harvey, Qi Cui. The 5th Congress of Chinese Society for Neuroscience. Qing Dao, P.R..China. 2003.

Oral presentation

7/2006: the Anatomy & Human Biology Student Expo, UWA, Perth WA. 2/2006: the 26th Annual Meeting of the Australian Neuroscience Society.

Sydney, Australia. 9/2004: the Anatomy & Human Biology Student Expo, UWA, Perth WA. 1/2004: the 24th Annual Meeting of the Australian Neuroscience Society.

Melbourne, Australia. 9/2003: the 22th Symposium of Western Australian Neuroscience, Perth WA. 9/2003: the Anatomy & Human Biology Student Expo, UWA, Perth WA.

1

Chapter One

Axonal injury in the CNS

Animals monitor and maintain an internal environment and at the same time monitor and

respond to an external environment. These two functions are coordinated by the the endocrine

system and nervous system. The nervous system basically has three functions: (i) receive

sensory input from internal and external environments; (ii) integrate the input; (iii) respond to

stimuli. The mammalian nervous system is composed of central nervous system (CNS), which

includes the brain and spinal cord, and peripheral nervous system (PNS), which connects the

CNS to other parts of the body. The most common CNS injuries include stroke, traumatic brain

injury (TBI) and spinal cord injury (SCI). CNS injuries remain the leading cause of morbidity and

mortality for young people throughout the world. The ultimate aim in CNS therapy is to repair the

injured pathway, and restore the correct input, thereby leading to return of function.

1.1 Some comments on the molecular pathology in CNS injury Adult mammalian CNS and PNS axons are well known to have different regenerative abilities

after injury. Severed PNS neurons can survive and regenerate their axons to some degree.

However, in CNS, severed axons fail to regenerate and their cell bodies die or atrophy. Cajal

understood the importance of the CNS and PNS environments in axonal regeneration, but it is

only in the last 20 years that neurons in the adult mammalian CNS have conclusively been

shown to be capable of long distance axonal regeneration, if provided with an appropriate glial

environment (David and Aguayo, 1981; Davies et al., 1997). Since then, such a capacity for

regeneration has been found to be widespread among other CNS neuronal populations (Benfey

and Aguayo, 1982; So and Aguayo, 1985; Vidal-Sanz et al., 1987).

This different ability of CNS and PNS neurons to survive and regenerate after injury may be

explained by extrinsic and intrinsic differences. PNS glia (Schwann cells) help to promote

neuronal survival after injury, however, it is uncertain whether CNS glia (astrocytes and

oligodendrocytes) can also do this (Goldberg and Barres, 2000). In addition, PNS glia strongly

promote growth of regenerating axons whereas CNS glia actively inhibit this regrowth (Goldberg

and Barres, 2000). This may be explained from the point of evolution, where CNS is much more

complex and important compared to PNS, normally CNS neurons are well protected behind the

bone structures and not easy to be injured. Once damaged, prohibition of the regrowth of CNS

axons may prevent further functional loss or subsequent large scale miss-wiring. In addition to

glial differences, the inability of CNS axons to regenerate is largely associated with non-

neuronal aspects of the CNS environment that are inhibitory to axonal elongation. A particularly

important step in CNS regeneration research was the discovery of axon growth inhibitors which

contribute significantly to the nonpermissive nature of the mature CNS (Caroni et al., 1988;

Caroni and Schwab, 1988). Following this important finding, many inhibitory molecules in the

2

glial scar have been found (Bovolenta et al., 1992; Davies et al., 1997), including tenascin,

chondroitin sulfate proteoglycans (CSPGs), and the myelin-associated neurite outgrowth

inhibitors, oligodendrocyte myelin glycoprotein (OMgp), myelin-associated glycoprotein (MAG)

and Nogo (Grandpre and Strittmatter, 2001; Chaudhry and Filbin, 2006).

1.1.1 Intrinsic influences 1.1.1.1 Species, strain, gender difference Since Sperry's work in the 1940s (Sperry, 1944, 1950), it is well known that the CNS neurons of

lower vertebrates such as fish and amphibians can regenerate after injury, whereas CNS

neurons of mammals become apoptotic after axotomy (Matsukawa et al., 2004b). For example,

goldfish retinal ganglion cells (RGCs) can regrow axons towards the tectum and completely

restore vision after optic nerve (ON) transection or crush (Stuermer et al., 1992; Kato et al.,

1999; Matsukawa et al., 2004a; Rodger et al., 2004; Rodger et al., 2005). Teleost fish and newt

Cynops pyrrhogaster also exhibit an enormous potential to produce new neurons to replace the

damaged neurons in the adult CNS (Zupanc and Ott, 1999; Zupanc, 2001; Mitsuda et al., 2005).

In Xenopus laevis or lizard Gallotia galloti, transected ON can regrow, and it is not linked

obligatorily to maintained neurogenesis (Taylor et al., 1989). Why do advanced vertebrate

species lose the ability to regenerate? It is still a mystery. However, it seems not because of the

selection pressure from evolution, but more likely to be an unselected by-product of gaining an

increasingly complex nervous system (Harel and Strittmatter, 2006).

In mammals, even in the same species, different responses to injury are also seen in different

gene backgrounds (Lapointe et al., 2006). For example, sensory neuron apoptotic death is more

intense in C57BL/6J mice compared to A/J mice and leads to poorer axonal regeneration after

peripheral nerve (PN) lesion (Pierucci and de Oliveira, 2006). Neurite regeneration ability differs

significantly in two commonly used strains in knock-out studies, C57BL/6 and 129X1/SvJ mice,

this may contribute to the divergent results obtained in Nogo knock-out studies (Dimou et al.,

2006). Gender difference (better recovery in females) has also been reported in animal models

(Bramlett and Dietrich, 2001; Farooque et al., 2006; Nakazawa et al., 2006) and related to

estrogen and progesterone (Garcia-Segura et al., 2001; Labombarda et al., 2003; Nakazawa et

al., 2006) or the differences in autoimmune response in different genders (Hauben et al., 2002).

However, in the clinic the gender contribution to recovery is not evident (Greenwald et al., 2001;

Scivoletto et al., 2004; Sipski et al., 2004; Furlan et al., 2005). This may be partly due to the

difficulty in selecting matched samples in SCI patients of different genders.

1.1.1.2 Neuronal age difference Generally, adult neurons are more resistant to apoptosis than neonatal neurons as has been

shown in RGCs (Perry and Cowey, 1979; Rabacchi et al., 1994; Spalding et al., 2004;

McKernan et al., 2006). However, the regenerative ability is the opposite; embryonic optic axons

can grow through environments that normally block axon regeneration from adult optic fibers

(Bates and Meyer, 1997; Chierzi et al., 2005). This loss of regenerative ability in adult may be

caused by developmentally regulated loss of responsiveness to axon attractive molecular cues,

3

such as changes in cAMP levels with maturation (Cai et al., 2001; Shewan et al., 2002; Spencer

and Filbin, 2004). Regeneration in young animals is usually associated with a characteristic

profile of gene expression that is similar to the profile seen during development (Vogelaar et al.,

2003; Bosse et al., 2006). On the other hand, intra-axonal protein synthesis is lower or absent in

adult or aged neuron axons (Willcox and Scott, 2004; Verma et al., 2005) which may also

contribute to the retarded regeneration ability in adult. In addition, the maturation of nonneuronal

cells in the retina (Goldberg et al., 2002a), within the lesion site (Hafidi et al., 2004) and

increased vascularization with development (Whalley et al., 2006) may also affect the extent of

apoptosis and axonal regeneration after injury in mature animals.

1.1.1.3 Intracellular cAMP levels in normal and injured neurons Many studies have demonstrated that cAMP levels can dictate the response of growing axons

to guidance cues (Song et al., 1998; Hopker et al., 1999), neurotrophic factors (Lohof et al.,

1992; Cui et al., 2003a; Li et al., 2003a; Henley et al., 2004), and myelin derived inhibitors (Qiu

et al., 2002; Snider et al., 2002; Bandtlow, 2003; Gao et al., 2003; Lu et al., 2004b; Spencer and

Filbin, 2004). For example, endogenous cAMP levels are greatly elevated in young neurons and

these levels decrease precipitously after birth, which also correlates with the developmental loss

of regenerative capability (Cai et al., 2001; Domeniconi and Filbin, 2005). In Xenopus, attraction

of retinal growth cones to netrin-1 can be converted to repulsion by laminin-1 by the lowering

cAMP levels within the growth cone (Hopker et al., 1999). A conditioning PN lesion can promote

regeneration of central branches of rat dorsal root ganglion (DRG) neurons through increased

neuronal cAMP levels (Neumann et al., 2002b) and activation of signal transducer and activator

of transcription 3 (STAT3) (Qiu et al., 2005). Correspondingly, cAMP elevation can promote

axonal regeneration and functional recovery after CNS injury. Elevation of cAMP can be

achieved via direct application of cAMP analogs such as dibutyryl-cAMP (db-cAMP) (Pearse et

al., 2004), CPT-cAMP (Shen et al., 1999; Cui et al., 2003a), or by priming with neurotrophins

(Gao et al., 2003), combination of forskolin and IBMX (Chierzi et al., 2005) or inhibition of cAMP

hydrolysis by the phosphodiesterase IV inhibitor, rolipram (Nikulina et al., 2004; Pearse et al.,

2004). Significant advances have been made recently in understanding the mechanisms that

underly increased cAMP levels and the promotion of axonal growth. For example, it has been

shown that altered cAMP levels influence the level of expression of neurotrophic factor

receptors such as CNTFRα (Park et al., 2004a) and TrkB (Meyer-Franke et al., 1998) in the

retina. Downstream pathways of cAMP may include protein kinase A (PKA)-mediated pathways

(Dong et al., 1998), upregulation of metallothionein (MT)-I/II (Siddiq and Filbin, 2005), activation

of the transcription factor cAMP response element binding protein (CREB) and induce

upregulation of Arginase I, increased synthesis of polyamines (Cai et al., 2002; Gao et al.,

2004), elevated activity of cyclin-dependent kinase 5 (cdk5) (Deng et al., 2005) and a

subsequent cleavage of p75NTR (Siddiq and Filbin, 2005), resulting in inhibition of Rho GTPase

pathway and blocking growth cone collapse (Dong et al., 1998; Bandtlow, 2003) (Fig. 1.1, 1.3).

4

1.1.2 Extrinsic inhibitory influences 1.1.2.1 Axon growth inhibitors in the glial scar Glial scaring, also called reactive gliosis, occurs whenever the CNS is damaged (Reier and

Houle, 1988). The main cell types involved are astrocytes, microglia, oligodendrocyte

precursors and meningeal cells (Fawcett and Asher, 1999; Jones and Tuszynski, 2002; Properzi

et al., 2003). A mature scar takes two weeks to be fully formed in adult rats (Berry et al., 1983;

David and Lacroix, 2003). The final glial scar is composed of mainly a dense meshwork of

astrocytic processes bound together by tight and gap junctions (Bovolenta et al., 1992; Properzi

and Fawcett, 2004). It has long been thought to contribute to part of the failure of CNS axon

regeneration (Windle et al., 1952; Bovolenta et al., 1992). This was proved by Davies and

colleagues in 1997. They demonstrated that DRG neurons can extend long processes when

transplanted into adult white matter if there was no damage and no glial scar formation; the

regeneration capability of the transplants correlated well with the extent of injury and scar

formation (Davies et al., 1997). Recent studies have shown that there are several molecules

involved in this glia associated inhibitory effect, including tenascin, keratin, and chondroitin

sulface proteoglycans (CSPGs), keratin sulface proteoglycans (KSPGs) and class III

semaphorins.

Tenascin Tenascin (TN) family is a group of structurally related extracellular matrix (ECM) glycoproteins

(Chiquet-Ehrismann et al., 1994; Tucker et al., 1999) that may interact with RhoA to perform

their function (Wenk et al., 2000). This family includes five members: tenascin-C (TN-C),

tenascin-R (TN-R), tenascin-Y (TN-Y), tenascin-X (TN-X) and tenascin-W (TN-W) (Chiquet-

Ehrismann, 2004). Interestingly, TN was originally discovered in cerebrospinal fluid (CSF) as a

marker for diagnosis of brain tumours (Yoshida et al., 1994). In the normal mature CNS, only

low levels of TN can be detected. TN-R is expressed by oligodendrocytes and small neurons

during postnatal development and in the adult (Woodworth et al., 2004). TN-C is expressed in

the hippocampal complex of developing rats (Ferhat et al., 1996) and Schwann cells (SCs) in

PN regeneration (Fruttiger et al., 1995; Zhang et al., 1995). After CNS injury, reactive astrocytes upregulate the expression of TN in the lesion site

(Probstmeier et al., 2000; Tang et al., 2003) and dramatically increase the transcription of TN

gene (Ajemian et al., 1994; Brodkey et al., 1995), suggesting that TN may contribute to

astroglial scar formation and axon growth inhibition. Knockout study also suggests TN-R is a

molecule restricting motoneuron innervation and functional recovery from SCI (Apostolova et

al., 2006). In the eye, TN is critical for the establishment and maintenance of the restricted

distribution of myelin-forming oligodendrocytes along RGC axons (Bartsch et al., 1994). After

ON transection, TN-like immunoreactivity is localized to the leptomeninges and astrocytes that

border the transection site 24 hours after injury, it increased during the next 2 weeks, and

disappeared after 18-21 days (Ajemian et al., 1994). After ON crush, TN-R is continuously

expressed for at least 63 days, and may contribute to the failure of regeneration of adult RGC

5

axons (Becker et al., 2000). In adult zebrafish, TN-R function as a repellent guidance molecule

for newly growing and regenerating optic axons (Becker et al., 2004).

Proteoglycans Proteoglycans consist of a protein core and long, sulfated polysaccharides

(glycosaminoglycans; GAGs) made of disaccharide unit repeats (Properzi and Fawcett, 2004).

They are classified into four groups according to the molecular nature of the GAG chains

attached to the core protein: heparin sulfate proteoglycans (HSPGs), chondroitin sulface

proteoglycans (CSPGs), dermatan sulfate proteoglycans (DSPGs), and keratin sulfate

proteoglycans (KSPGs) (Bovolenta and Fernaud-Espinosa, 2000; Grimpe and Silver, 2002).

HSPGs have a primary role in the development of CNS, especially in axon guidance (Bandtlow

and Zimmermann, 2000; Hartmann and Maurer, 2001; Bulow and Hobert, 2004). CSPGs are

ECM molecules with a varied complex structural composition comprising transmembrane and

secreted forms. They are diversified by variations in the core protein with the addition of N- and

O-linked oligosaccharides; number, length, and sulfation patterns of chondroitin sulfate GAG

side chains; and proteolysis of translation products (Sandvig et al., 2004). The CSPG family

includes versican (Thomas et al., 1994; Yao et al., 1994), neurocan (Matsui et al., 1994; Katoh-

Semba et al., 1995; Miller et al., 1995), brevican (Morgenstern et al., 2002; Davies et al., 2004),

NG2 (Dou and Levine, 1994; Miller et al., 1995; Jones et al., 2002) and phosphacan (David et

al., 1998; Jones et al., 2003). Neurocan and phosphacan are nervous tissue-specific

proteoglycans and are two major constituents of CSPG found in the postnatal CNS (Margolis et

al., 1996).

Many studies have demonstrated that CSPGs are inhibitory to neuron regeneration, either in

vitro (Hynds and Snow, 1999; Monnier et al., 2003), or in vivo (Asher et al., 2000; Jones et al.,

2002; Morgenstern et al., 2002; Properzi et al., 2003). After SCI, neurocan, brevican, and

versican immunostaining increased within days in parenchyma surrounding the lesion site,

peaking at 2 weeks. Neurocan and versican expression were persistently elevated for 4 weeks,

while brevican expression persisted for at least 2 months (Jones and Tuszynski, 2002; Jones et

al., 2003). NG2 expression was upregulated within 24 h after injury, peaking at 1 week, and

remained for at least 7 weeks (Jones et al., 2002). In the mouse dorsal root entry zone,

brevican, neurocan and versican are abundant at the time when regenerating sensory fibers

reach the PNS/CNS border and participate in growth inhibition in this region (Beggah et al.,

2005).

The mechanisms of signal transduction of CSPGs have not been fully worked out (Laabs et al.,

2005) (Fig. 1.1). Cell surface receptors for the extracellular secreted proteoglycans have not

been identified. Recent research suggests Rho/ROCK pathway is involved (Dergham et al.,

2002; Monnier et al., 2003; Jain et al., 2004). Either activation of Cdc42 and Rac or inhibition of

Rho GTPase by C3 transferase can significantly increase the number of neurites crossing into

the CSPG lanes in culture (Jain et al., 2004). Furthermore, Schweigreiter et al. (2004) showed

the existence of neuronal receptors for versican and myelin inhibitors which is independent of

6

p75NTR/NgR receptor complex but also converge to Rho GTPases as a common point of signal

pathways (Fig. 1.1) (Schweigreiter et al., 2004; Schweigreiter and Bandtlow, 2006). More

recently, both protein kinase C (PKC) (Sivasankaran et al., 2004) and EGFR (Koprivica et al.,

2005) have been found to be a key component involved in myelin and CSPG inhibitory

pathways (Chaudhry and Filbin, 2006; Schweigreiter and Bandtlow, 2006)(Fig.1.1, 1.3).

Figure 1.1 CNS myelin inhibitory signalling scheme. A scheme summarizing current knowledge about

myelin inhibitors in oligodendrocytes and their neuronal receptor complexes. Nogo-A displays a bimodal

inhibitory signalling pattern by engaging the NgR/p75NTR/Lingo-1 receptor complex, and a so far

unidentified receptor with its two domains Nogo-66 and NiG, respectively. Note that the signaling

pathways of all inhibitors investigated so far converge at the Rho GTPases RhoA and Rac1. The activity

status of these proteins determines the neuron’s capability to extend neurites. Arrows, activation; bars,

inhibition; straight lines, direct interactions; dashed lines, indirect interactions. Adapted from

Schweigreiter and Bandtlow, (2006).

7

1.1.2.2 Axon growth inhibitors in myelin Nogo

Figure 1.2 Three Nogo isoforms. The Nogo gene gives rise to three protein isoforms-Nogo-A, Nogo-B,

and Nogo-C—via alternative splicing and promoter usage. Nogo-A harbors at least two inhibitory

domains: Nogo-66 (which is common to all Nogo isoforms) and NiG (which is unique to Nogo-A).

Adapted from Schweigreiter and Bandtlow, (2006).

Nogo was the first myelin-associated inhibitor identified. In 1988, Caroni, P. and Schwab

showed that two monoclonal antibodies IN-1 and IN-2 raised against neurite growth inhibitors

can bind to both the 35 kDa (NI-35) and 250 kDa (NI-250; later named Nogo) glycoproteins and

to the surface of differentiated cultured oligodendrocytes (Caroni and Schwab, 1988). They

further showed that intracerebrally delivery of IN-1 could promote axon regeneration after

complete transection of the corticospinal tract (Schnell and Schwab, 1990). Three forms of

Nogo have been identified. They are Nogo-A 1,162 amino acids (AA), -B (373 AA), and -C (199

AA). They have a common C-terminus of 188 AA and share a 172 AA N-terminus and are

predominantly localized to the endoplasmic reticulum (ER) (Schweigreiter and Bandtlow, 2006)

(Fig. 1.2). Nogo is a transmembraneous protein, the 66-AA extracellular loop is termed Nogo-

66, and a high affinity Nogo receptor (NgR) for Nogo-66 has been cloned (Fournier et al., 2001).

Nogo-A protein is strongly expressed by oligodendrocytes, and is abundant in motor, DRG, and

sympathetic neurons, RGCs, and Purkinje cells (Hunt et al., 2003). Furthermore, numerous

populations of neurons in the brain and spinal cord express Nogo-A in their cell bodies and

neurites, suggesting additional, as-yet-unknown, functions of this protein (Meier et al., 2003;

Buss et al., 2004). Nogo-B has a widespread expression in the CNS, PNS and other peripheral

tissues (Huber et al., 2002). Nogo-C is mainly found in skeletal muscle, but brain and heart also

express this isoform. The widespread expression of Nogo-B and -C, suggest that the Nogo

family of proteins might have functions additional to the neurite growth-inhibitory activity (Huber

et al., 2002). For example, Nogo-B may have effect on regulation of vascular homeostasis and

remodelling (Acevedo et al., 2004).

Most of the neural studies have been focused on Nogo-A. There are three inhibitory domains in

Nogo-A: the C-terminal region (Nogo-66), the N-terminal region (Amino-Nogo) and a stretch

8

region (Oertle et al., 2003). Nogo-66 receptor (NgR or NgR1) is an 85 kDa (473 AA) protein that

is linked to the cell membrane via a glycosylphosphatidylinositol (GPI) anchor (Fournier et al.,

2001). It has two structurally related molecules NgR2 and NgR3, which do not bind with Nogo

or OMgp (Barton et al., 2003). Recently, NgR2 was found to bind to MAG with greater affinity

than NgR1 and seems to act selectively to mediate MAG inhibitory responses (Venkatesh et al.,

2005). NgR1 is predominantly expressed in CNS neurons and their axons, less strongly in white

matter (Hunt et al., 2002; Wang et al., 2002c). NgR1 and NgR2 have overlapping but distinct

distributions in the mature CNS (Venkatesh et al., 2005). Because NgR is a GPI-anchored

protein it requires a transmembrane interacting partner to transduce the inhibitory signal. In this

regard, p75NTR has been shown to interact with NgR as a co-receptor for Nogo, MAG and

OMgp (Wang et al., 2002b; Wong et al., 2002). Recently, Lingo-1 (also known as LERN1) was

identified as an essential component of this p75NTR/NgR receptor complex (Mi et al., 2004),

treatment with Lingo-1-Fc can improve recovery after SCI (Ji et al., 2006). More recently, a TNF

receptor family member, TROY (also known as TAJ) was also added to the NgR/Lingo-1

receptor complex (Park et al., 2005; Shao et al., 2005). TROY is broadly expressed in postnatal

and adult neurons, binds to NgR and can replace p75NTR in the p75NTR/NgR1/Lingo-1

complex to activate RhoA in the presence of myelin inhibitors (Fig. 1.1,1.3) (Park et al., 2005;

Shao et al., 2005; Chaudhry and Filbin, 2006). Animal studies using Nogo antibodies to

neutralize the inhibitory effects of Nogo are reviewed in Chapter 2.3.

Myelin-associated glycoprotein (MAG) MAG is a member of the immunoglobulin (Ig) superfamily and contains five Ig-like domains

(Schnaar et al., 1998). It has both adhesive and inhibitory properties (David and Lacroix, 2003).

MAG is widely distributed in oligodendrocytes in the cortex, hippocampus and spinal cord

(Kuramoto et al., 1997). Schwann cells (SCs) in the peripheral myelin sheath and satellite cells

in the spinal ganglia are also immunoreactive for MAG (Filbin, 1995; Kuramoto et al., 1997). In

1994, two groups identified MAG as an inhibitor for axon regeneration (McKerracher et al.,

1994; Mukhopadhyay et al., 1994). It has different effects on immature and mature neurons. It

strongly inhibits neurite outgrowth from developing cerebellar, P3 or adult DRG neurons

(DeBellard et al., 1996) and postnatal RGCs (Mukhopadhyay et al., 1994; Cai et al., 2001), but

promotes neurite outgrowth from embryonic mouse spinal cord neurons (Turnley and Bartlett,

1998) and newborn DRG neurons (DeBellard et al., 1996). This suggests that the receptors for

its inhibitory domain are expressed as the neurons mature (David and Lacroix, 2003).

Ganglioside GT1a and GT1b were first identified to be receptors for MAG (Vinson et al., 2001;

McKerracher, 2002; Vyas et al., 2002). Later NgR was found to be the receptor both for Nogo

and MAG (Domeniconi et al., 2002; Liu et al., 2002a). Furthermore, NgR2 is more specific

receptor for MAG than NgR1 (Venkatesh et al., 2005). p75NTR has also been shown to be

signal transducing element for MAG (Wang et al., 2002a; Wong et al., 2002; Yamashita et al.,

2002). The inhibitory effects of MAG also converge to the Rho GTPase pathway (Niederost et

al., 2002; Mimura et al., 2006) (Fig. 1.1,1.3). Blocking of MAG binding to its receptor

gangliosides GD1a and GT1b can reverse MAG inhibition effects (Vyas et al., 2005; Yang et al.,

2006). Daily intraperitoneal injection of antibodies to MAG also accelerates rat preferential

9

motor reinnervation (Mears et al., 2003). However, the extent of axonal regrowth in lesioned ON

or corticospinal tract in MAG knockout mice is not enhanced compared with wild type,

suggesting that MAG may not be a major inhibitor for axon growth (Bartsch et al., 1995).

OMgp The oligodendrocyte myelin glycoprotein (OMgp) is a GDI-anchored protein expressed on the

surface of neurons and oligodendrocytes in the CNS (Li et al., 2002a; Vourc'h and Andres,

2004). Mikol and Stefansson first reported the isolation and initial biochemical characterization

of a 120-kD peanut agglutinin-binding glycoprotein from the adult human CNS. This protein was

found only in CNS myelin preparations and on ovine oligodendrocytes in culture and was

named OMgp (Mikol and Stefansson, 1988). In the CNS, it is particularly prominent in the

pyramidal cells of the hippocampus, the Purkinje cells of the cerebellum, motoneurons in the

brainstem, and anterior horn cells of the spinal cord (Habib et al., 1998). The concentration

gradually increases from birth until about P20 (Habib et al., 1998), suggesting that OMgp may

act as a late marker of myelination, implicated in the arrest of oligodendrocyte proliferation,

myelination or in the compaction of myelin (Vourc'h et al., 2003). Recently, OMgp was also

found in the processes of oligodendroglia-like cells which may stabilize the node of Ranvier and

prevent axonal sprouting (Huang et al., 2005). OMgp has been demonstrated to be a NgR

ligand and neurite growth inhibitor both in vivo and in vitro (Kottis et al., 2002; Wang et al.,

2002b). It is now known that OMgp signals through the same receptor complex including NgR

(Wang et al., 2002b), p75NTR and Lingo-1 to activate RhoA (Wang et al., 2002a; Mi et al.,

2004; Mimura et al., 2006) (Fig. 1.1,1.3).

10

1.1.2.3 Neurite inhibitory signal transduction

Figure 1.3 Schematic diagram showing the neurite inhibitory signal transduction pathways elicited by

growth-inhibitory molecules such as Nogo, MAG, OMgp and growth repulsive molecules such as

repulsive guidance molecule (RGM), Ephrin, semaphorin and CSPGs, including the binding of different

kinds of neurite inhibitors with NgR, p75NTR, Lingo-1, TROY, and following pathways (most still not

clear). All seem to converge to activate Rho GTPase, ROCK with subsequent induction of growth cone

collapse. CRMP-2: collapsing response mediator protein-2. Arrows, activation; bars, inhibition; straight

lines, direct interactions; dashed lines, indirect interactions.

Rho GTPase Most axon growth inhibitory ligands either repel or collapse growth cones via the Rho GTPase

signaling pathway (Borisoff et al., 2003; Fournier et al., 2003; Monnier et al., 2003; Sandvig et

al., 2004). Small GTPases are monomeric guanine nucleotide-binding proteins of 20-25 kDa

(Exton, 1998). There are five major families including Rho, Ras, Rab, Ran and ADP-ribosylation

factors (Arf) (Exton, 1998). The Rho family is composed of eight subgroups with at least 22

members and their isoforms including: Rho subfamily (A-C); Rac (Ras-related C3 botulinum

toxin substrate) subfamily (1-3, RhoG); Cdc42 (cell division cycle 42) subfamily (Cdc42, TC10,

TCL, Chp, Wrch-1); Rnd subfamily (Rnd1, Rnd2, Rnd3 isoforms); RhoD (RhoD and Rif);

RhoH/TTF; RhoBTB (RhoBTB1 and RhoBTB2); and Miro (Miro-1 and Miro-2) (Sorokina and

Chernoff, 2005). Rho GTPases were initially observed to regulate the formation of specialized

actin structures (Machesky and Hall, 1996). They also control diverse cellular events such as

11

transcription, cell growth, development, cell cycle (Billadeau, 2002; Sahai and Marshall, 2002;

Welsh, 2004), exocytosis (Abdel-Latif et al., 2004; Covian-Nares et al., 2004; Gasman et al.,

2004) and multiple forms of internalization including phagocytosis (Scott et al., 2003),

macropinocytosis (Kruth et al., 2004), and endocytosis (Rivero and Somesh, 2002; de Toledo et

al., 2003; deHart et al., 2003; Sakakibara et al., 2004). Rho family members like all small

GTPases, cycle between an inactive GDP-bound form and an active GTP-bound form, i.e. when

GDP is bound, the GTPases are inactive, and activation occurs when GDP is released and GTP

is bound (Machesky and Hall, 1996) (Fig. 1.3). This change is modulated by several proteins

including p75NTR, guanine nucleotide exchange factors (GEFs), GTPase-activating proteins

(GAPs) and GDP dissociation inhibitors (GDIs). GEFs stimulate the exchange of GDP for GTP

to activate GTPase (Fig. 1.3). GAPs stimulate the Rho GTPase to hydrolyze its bound GTP,

returning the Rho protein to its inactive GDP-bound state (Fig. 1.3). GDIs preferentially bind

Rho-GDP and modulate the activation and targeting of Rho-GDP to the membrane, while

p75NTR acts as a displacement factor that releases Rho from Rho-GDI (Machesky and Hall,

1996; Yamashita and Tohyama, 2003). This then allows GEFs to activate Rho GTPase. Upon

activation, Rho GTPases interact with a plethora of downstream effector molecules including

Rho-kinase (also termed ROK or ROCK), citron kinase, LIM kinase, Slingshot (SHH)

phosphatase, protein kinase N and mDia that modulate cellular function (Exton, 1998; Bishop

and Hall, 2000; Ishizaki, 2003; Ng and Luo, 2004; Hsieh et al., 2006) (Fig. 1.3).

Rho GTPases are important for regulating the formation of stress fibers and focal adhesions,

whereas Rac and Cdc42 regulate the formation of lamellipodia and filopodia in fibroblasts

respectively (Aspenstrom et al., 2004; Begum et al., 2004). In neuronal growth cones, the

structures that lead and direct the growth of neuronal processes, have filopodia and lamellipodia

that are structurally analogous to those in fibroblasts (Gordon-Weeks, 2004; Ng and Luo, 2004).

After CNS injury, neurite growth inhibition which is mediated by the CSPGs, OMgp, MAG, and

Nogo (Grandpre and Strittmatter, 2001), all converge to Rho GTPases pathway (Yiu and He,

2006). NgR binds to each of the myelin derived growth inhibitors and mediates their inhibitory

signals by complexing with the neurotrophin receptor p75NTR in the absence of Trk signaling

(Yamashita et al., 2002; Schweigreiter et al., 2004). Both myelin derived growth inhibitors and

TNF can also directly activate Rho GTPases (Neumann et al., 2002a; Niederost et al., 2002).

Rho-GDP is changed to its activated form by GEFs, and activates ROCK to induce growth cone

collapse (Alabed et al., 2006). This Rho-ROCK pathway has also been reported to be involved

in Schwann cell myelination (Melendez-Vasquez et al., 2004), long term spatial memory (Dash

et al., 2004), signaling pathways of Ephrin (Cheng et al., 2003; Huot, 2004), RGM (repulsive

guidance molecule) (Hata et al., 2006), and CSPGs (Monnier et al., 2003) (Fig. 1.3). On the

other hand, Cdc42 and Rac1 act differently to RhoA, and induce the formation of the growth

cone (Matsuura et al., 2004). It is not known yet exactly how these Rho GTPases family

members work in synchrony to regulate neurite outgrowth. It is hypothesized that guidance

decisions, either attractive or repulsive, could be based on localized activation of different

subsets of Rho GTPases by specific extracellular guidance signals, the resulting intracellular

asymmetry of GTPase activity could regulate the cytoskeleton re-organization (Jain et al., 2004;

12

Bryan et al., 2005; Woo and Gomez, 2006). Molecules controlling in the formation of growth

cones and the assembly of microtubules therefore are important targets for further investigation

(Watabe-Uchida et al., 2006).

13

Chapter Two

Regeneration strategies for CNS injury

2.1 Nerve growth stimulatory factors The first strategy to promote CNS regeneration is to use nerve growth stimulatory factors.

Recent researches have identified large numbers of neurotrophic factors, whose expression

may be increased as self-protection against neural injury (Mattson and Scheff, 1994). Such

factors include 3 major families: (i) Neurotrophins, including nerve growth factor (NGF), brain-

derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4/5 (NT-4/5),

neurotrophin-6 (NT-6) and neurotrophin-7 (NT-7); (ii) Neurocytokines, including ciliary

neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6, 11 (IL6, 11),

oncostatin M, cardiotrophin-1 (CT1), cardiotrophin-like cytokine (CLC) (Elson et al., 2000) and

neuropoietin (Derouet et al., 2004); (iii) Glial cell line-derived neurotrophic factor (GDNF) family.

2.1.1 Neurotrophins Neurotrophins (NTs) are generated as pre-pro-neurotrophin precursors (approximately 30-35

kDa; 240-260 AA). The pre-sequence is cleaved off immediately after sequestration into the

endoplasmic reticulum (ER). The mature protein is excised from the pro-sequence by specific

protein convertases (Lessmann et al., 2003). Pro-NTs are also secreted by cells and have

biological activities (Fahnestock et al., 2001; Lee et al., 2001; Hempstead, 2006). NT receptors

include low-affinity receptor-p75NTR and the receptor tyrosine kinases (Trk) A, TrkB and C.

TrkA preferentially interacts with NGF, TrkB with BDNF and NT4/5, while NT3 interacts mainly

with TrkC and also at lower affinity with TrkA and TrkB (Meakin and Shooter, 1992). Pro-NTs

can bind to p75NTR with higher affinity than mature NTs, but bind weakly to Trk receptors (Lee

et al., 2001; Pedraza et al., 2005). Until the late 1990s, schemes for the biological actions of

NTs emphasized that their cell survival effect was mediated by Trk receptors and their cell death

activity was promoted by p75NTR (Yoon et al., 1998; Majdan and Miller, 1999). Now it seems

that this is overly simplistic and the life-death decision does not neatly segregate with one

receptor or the other (Kalb, 2005; Nykjaer et al., 2005). Both receptors can engage survival- and

death-promoting signaling pathways (Kalb, 2005). p75NTR can promote neuron survival

(DeFreitas et al., 2001) and Trk receptor can also cause cell death (Hu and Kalb, 2003). For

example, BDNF heightens the sensitivity of motor neurons to excitotoxic insults through

activation of TrkB (Hu and Kalb, 2003). p75NTR also has multiple roles in myelination (Cosgaya

et al., 2002), surface binding and endocytosis of NTs (Saxena et al., 2004). There is also

crosstalk between p75NTR and Trk receptors (He and Garcia, 2004). For example, the cellular

response to NGF is strongly dependent on the trafficking of TrkA, which regulates the

subcellular localization of p75NTR, specific stimulation of p75NTR by NGF also activates TrkA

and the MAPK pathway (Perrone et al., 2005). Dendritic arbor development of subventricular

zone-derived cells may be regulated by NTs through the activation of p75NTR and the TrkB

14

receptor signaling pathways in a sequentially pattern (Gascon et al., 2005). Furthermore, as

described earlier, in addition to function as the receptor for NTs, p75NTR has been found to act

as a co-receptor for axon growth inhibitors (Wang et al., 2002a; Wong et al., 2002; Yamashita et

al., 2002), and displacement factor to release Rho GTPase from Rho-GDI (Yamashita and

Tohyama, 2003).

The neurotrophic hypothesis

Its principal tenet is that the survival of neurons depends on the supply of one or multiple

neurotrophic factors that are synthesized in their target (Heumann, 1987; Davies, 1988, 1996).

Extended from this, the signalling endosome hypothesis provides a mechanism for long-

distance communication between the synapse and the cell body (Howe and Mobley, 2004). For

example, NGF-TrkA complexes are internalized at the axon terminal and are retrogradely

transported to the cell body (Howe et al., 2001; Howe and Mobley, 2005).

2.1.1.1 NGF NGF was discovered in the early 1950s by Rita Levi-Montalcini and Viktor Hamburger (Levi-

Montalcini and Hamburger, 1951; Levi-Montalcini et al., 1954; Cohen and Levi-Montalcini,

1957). The discovery of NGF represents an important milestone in the processes that lead to

modern cell biology (Levi-Montalcini, 1987). Now, the biological functions of NGF have been

found not only as a classical target-derived neurotrophic factor, but also beyond the

developmental period, beyond neuronal cells, even beyond the nervous system (Sofroniew et

al., 2001; Villoslada and Genain, 2004; Molliver et al., 2005; Rost et al., 2005).

NGF precursor, pro-NGF protein can create a signaling complex by simultaneously binding to

p75NTR and sortilin to induce cell death, even Trk receptors are activated (Beattie et al., 2002;

Ibanez, 2002; Harrington et al., 2004; Nykjaer et al., 2004; Pedraza et al., 2005; Volosin et al.,

2006). pro-NGF can also act as a folding enhancer of the mature NGF (Rattenholl et al., 2001).

Apart from p75NTR and TrkA (Glass and Yancopoulos, 1993), closely related genes to p75NTR

called neurotrophin receptor homolog-1,2 (NRH1,2) were also recently shown to regulate NGF

signaling (Hutson and Bothwell, 2001; Frankowski et al., 2002; Bromley et al., 2004). NRH1

coexists with p75NTR in fish, amphibians, and birds but is absent in mammals, whereas NRH2

exists only in mammals (Kanning et al., 2003).

Both NGF and its receptors are expressed during development (Ernfors et al., 1992) and

throughout adulthood by different cells in the brain (Quartu et al., 2003), immune, inflammatory

system (Marinova et al., 2003; Villoslada and Genain, 2004), also in other systems or tissues

(Bothwell, 1997; Nosrat et al., 1997; Apfel et al., 1998; Castellano et al., 1998). CNS injury

triggers rapid and substantial upregulation of NGF expression in many cell types including glia,

neurons, meningeal cells and SCs (Brown et al., 2004). Increased intraspinal NGF after SCI

induces sprouting of primary nociceptive axons (Merighi et al., 2004). Exogenous or genetic

application of NGF also induces robust axonal plasticity of adult primary sensory neurons and

causes chronic pain after injury (Romero et al., 2000; Tuszynski et al., 2002). The signaling

15

mechanism for this effect has not been fully understood, but evidence suggests it may involve

activation of p75NTR (Zhang and Nicol, 2004), PI3K, PKC and CaMK II (calcium-calmodulin-

dependent protein kinase II) (Bonnington and McNaughton, 2003).

Plasticity induced by NGF

Plasticity refers to a capacity of adult nervous system that it is able to alter both its structure

and function in response to stimuli or injury (Sofroniew et al., 2001). NGF and BDNF are

involved in neuronal survival and plasticity of dopaminergic, cholinergic, nociceptive and

serotonergic neurons (Sofroniew et al., 2001; Csillik et al., 2003; Ramirez et al., 2003). They

have also been shown to regulate developmental plasticity in the visual cortex (Berardi et al.,

1999; Huang et al., 1999b; Rossi et al., 2002).

2.1.1.2 BDNF BDNF was first identified by Barde (Johnson et al., 1986; Barde et al., 1987; Hohn et al., 1990).

It is synthesized as a precursor, pro-BDNF, which then undergoes posttranslational

modifications and proteolytic processing involving furin, convertases (Marcinkiewicz et al., 1996;

Seidah et al., 1996), and metalloproteinases (Hwang et al., 2005). pro-BDNF, like mature

BDNF, binds to TrkB, can also be secreted and anterogradely transported to nerve terminals

(Zhou et al., 2004; Fayard et al., 2005). TrkB is widely distributed in both glia and neurons (Zhou

et al., 1993; Fryer et al., 1996). There are three TrkB receptor isoforms in the mammalian CNS

including the full-length isoform (TrkB.FL) and two truncated isoforms (TrkB.T: TrkB.T1,

TrkB.T2) (Middlemas et al., 1991; Baxter et al., 1997). Different TrkB isoforms are formed by

alternative splicing of TrkB mRNA (Klein et al., 1990; Middlemas et al., 1991; Baxter et al.,

1997). TrkB.FL is highly expressed in neurons of the CNS. At later stages in postnatal

development, TrkB.T become abundant (Ohira et al., 1999). The physiological function of the

TrkB.T receptors involves: axonal remodelling and act as negative effector of TrkB.FL (Ohira et

al., 1999); regulate the local availability of NTs (Biffo et al., 1995; Fryer et al., 1997); a direct

signalling role in mediating inositol-1,4,5-trisphosphate (IP3)-dependent calcium release (Rose

et al., 2003); induce hippocampal neurons’ outgrowth of dendritic filopodia through p75NTR

(Hartmann et al., 2004); regulate glial cell morphology via regulation of Rho GTPase activity

(Ohira et al., 2005). The disturbed balance of TrkB.FL and TrkB.T may also be involved in motor

neuron degenerative disease (De Wit et al., 2006).

BDNF is expressed at low levels in the PNS, and at much higher levels in the CNS (Wetmore et

al., 1991; Kawamoto et al., 1996; Kawamoto et al., 1999). The hypothalamus contains the

highest BDNF protein levels (Katoh-Semba et al., 1997). The concentration of BDNF increases

in all regions of the brain with postnatal development (Katoh-Semba et al., 1997). Moreover,

BDNF expression is rapidly and potently regulated by synaptic activity (Lou et al., 2005).

BDNF can be transported both anterogradely and retrogradely (Tonra et al., 1998; Tonra, 1999;

Spalding et al., 2002). It plays an important role in growth, development, differentiation,

maintenance and regeneration of various types of neurons in the CNS (Liu and Chen, 2000;

16

Monteggia et al., 2004). It has been tested in the treatment of various neurodegenerative

diseases including Alzheimer's disease (Fahnestock et al., 2002), Parkinson's disease (Porritt et

al., 2005; Sun et al., 2005), Huntington's disease (Kells et al., 2004; Mattson et al., 2004) but

this NT has no effect in amyotrophic lateral sclerosis (ALS) (Kalra et al., 2003). After CNS injury,

BDNF mRNA expression increased rapidly, perhaps functioning as a protective role (Yang et

al., 1996), followed by a later phase of expression of BDNF in macrophages and/or microglia,

functioning in a restorative capacity (Ikeda et al., 2001). Locally acute application of BDNF has

both anti-inflammatory and anti-oxidant effects (Joosten and Houweling, 2004). Delivery of

BDNF through gene engineered fibroblasts or bone marrow stromal cells can accelerate axon

growth from traumatic SCI (Kim et al., 1996; Zhao et al., 2004a; Lu et al., 2005). AAV-BDNF

gene transfer into the red nucleus following spinal axotomy resulted in counteraction of atrophy

in both the acute and chronic stage after SCI (Ruitenberg et al., 2004).

In the retina, BDNF expression in RGCs is upregulated during postnatal development in an

activity-dependent manner (Seki et al., 2003). It is expressed in a gradient of attractant or

branching signal in the superior colliculus during development of the retinocollicular projection

(Marotte et al., 2004). BDNF has been implicated in stimulating RGC survival and axonal

regeneration in rodent (Nakazawa et al., 2002; Takahata et al., 2003), cat (Chen and Weber,

2001), and pig (Bonnet et al., 2004), in injury models including ON transection (Mo et al., 2002),

crush (Huang et al., 2000; Chen and Weber, 2001) or glaucoma (Martin et al., 2003). However,

its effect is limited; higher doses do not yield increased cell survival, multiple applications are

not additive, and long-term delivery does not reverse RGC death (Chen and Weber, 2004). This

limitation, in part, may be due to BDNF induced down-regulation of the TrkB.FL receptor (Chen

and Weber, 2004), which is needed to activate its intracellular pathways that involves activation

of MAPK and PI3K/Akt (Nakazawa et al., 2002). Other studies also have shown that BDNF has

more impact on optic axon arborization (Cohen-Cory and Fraser, 1995) and branching (Sawai et

al., 1996), but fails to promote long-distance RGC axonal regeneration (Cui et al., 1999; Leaver

et al., 2006c; Pernet and Di Polo, 2006).

2.1.1.3 NT-3 NT-3 was identified and cloned on the basis of its sequence homology to BDNF and NGF (50%

AA identities) (Barde, 1990; Maisonpierre et al., 1990). In addition to its homology to all NTs,

NT-3 is highly conserved across species (fishes to mammals) (Hallbook et al., 1991). NT-3

binds to p75NTR and may initiate programmed cell death (PCD) (Casaccia-Bonnefil et al.,

1999). It also activates signal transduction by dimerization and autophosphorylation of the TrkC

receptor, and at lower affinity with TrkA or B receptor (Squinto et al., 1991; Ryden and Ibanez,

1996).

NT-3 protein can be found in both glia and neurons in the CNS (Zhou and Rush, 1994). It is a

target derived neurotrophic factor for sympathetic (Elshamy and Ernfors, 1996; Brodski et al.,

2000), sensory neurons in the PNS (Elshamy and Ernfors, 1996; Zhou and Rush, 1996; Groves

et al., 1999; Krimm et al., 2000; Agerman et al., 2003; Kuo et al., 2005), basal forebrain

17

cholinergic neurons (Nonner et al., 1996) and interneurons (Bechade et al., 2002) in the CNS. It

plays a complementary and overlapping role with NGF in the development and maturation of

sympathetic neurons (Brodski et al., 2000; Oakley et al., 2000; Orike et al., 2001), and has the

opposite role with NGF in sensory neuron axon sprouting, suppressing of thermal hyperalgesia

associated with chronic constriction injury (Wilson-Gerwing et al., 2005). NT-3 has been tested

in different CNS injury models. For example, intrathecally delivery of NT-3 supports ingrowth of

axonal fibers into the dorsal horn after injury to dorsal roots (Priestley et al., 2002; Ramer et al.,

2002). Sustained expression of NT-3 in motoneurons by adenovirus can induce axonal plasticity

of intact cortical spinal tract axons after trauma induced denervation (Zhou et al., 2003b).

Similarly, use of NT-3 genetically modified fibroblasts (Shumsky et al., 2003; Tobias et al., 2003;

Tuszynski et al., 2003) or olfactory ensheathing glia cells (OECs) (Ruitenberg et al., 2003;

Ruitenberg et al., 2005) can promote axonal regrowth after SCI.

2.1.1.4 NT-4/5 NT-4 is structurally related to NGF and BDNF. It was originally found abundantly expressed in

the Xenopus laevis ovary (Hallbook et al., 1991; Ibanez et al., 1992). NT-5 was first isolated

from rat (Berkemeier et al., 1991). NT-4 and NT-5 are orthologues (Ip et al., 1992; Ip et al.,

1993). Therefore, mammalian NT is known as NT-4, NT-5 or as NT-4/5, to denote it as the

mammalian counterpart of Xenopus NT-4 (Ebendal, 1992; Ip et al., 1992). The cleaving enzyme

for pro-NT-4/5 to mature NT-4/5 is still unknown. TrkB is the receptor for NT-4/5 (Klein et al.,

1992), there exists an analogous region on the surface of NT-4/5 and BDNF that is likely to be

involved in TrkB receptor binding. Variations in sequence of this common region serve to confer

TrkB receptor specificity (Robinson et al., 1999). NT-4/5 also binds to p75NTR with low affinity.

The highest level of NT-4/5 in adult rat is found in the brain stem (Katoh-Semba et al., 2003).

After TBI, expression of NT-4/5 was increased in cortex and hippocampus, may act as a

neuroprotective response (Royo et al., 2006). NT-4/5 gene modified fibroblasts can achieve the

same degree of substantial axonal growth in the injured spinal cord as BDNF (Blesch et al.,

2004). In the retina, NT-4/5 is involved in the survival of retinal neurons during development and

injury (Cui and Harvey, 1994; Watanabe et al., 1997; Gillespie et al., 2000; Cui et al., 2003a;

Spalding et al., 2004; Harada et al., 2005). NT-4/5 can also promote the outgrowth of early

embryonic and adult regenerating RGC axons when provided with a supportive substrate in vitro

(Avwenagha et al., 2003). Interestingly, different neurite patterns from RGCs were observed in

the presence of BDNF and NT-4/5. Compared with BDNF, NT-4/5 induced more branched

symmetrical arbors from cultured neonatal RGCs (Bosco and Linden, 1999).

Summary

NTs, in general, are capable of promoting sprouting, reinnervation, and plasticity, but are unable

to completely overcome the inhibitory influences associated with degenerating white matter and

achieve long-distance axon growth (McKerracher, 2001). Therefore, NTs can be considered as

additional therapeutic approaches combined with other strategies such as neutralizing the

inhibitory environment and promoting the intrinsic growth ability of mature neurons (David and

18

Lacroix, 2003). The possibility that NTs may induce excessive axonal sprouting, dystrophy and

abnormal connectivity should also be considered when combined with other approaches

(Harvey et al., 2006; Pernet and Di Polo, 2006).

2.1.2 Neurocytokines This family comprises CNTF, LIF, IL-6, -11, oncostatin M, CT1, CLC (Elson et al., 2000) and

neuropoietin (Derouet et al., 2004). Neurocytokines activate multi subunit receptor complexes

including gp130 signal transducer, and mainly signal via the JAK/STAT3, Ras/MAPK and

PI3K/Akt pathways (Davis et al., 1991; Stahl et al., 1994; Stahl and Yancopoulos, 1994). CNTF

can enhance the survival of neuronal cells, it is also recognized as a major protective factor in

demyelinating CNS diseases (Webster, 1997; Linker et al., 2002) or CNS injury (Oyesiku and

Wigston, 1996; Cui et al., 1999; Cui et al., 2003a; Ye et al., 2004). In addition to its neuronal

actions, CNTF has recently been found to have a role in the treatment of obesity and diabetes

(Sleeman et al., 2003), perhaps via activation of STAT3 in the hypothalamus where food intake

is regulated (Kokoeva et al., 2005), also perhaps through an influence on insulin resistance

(Watt et al., 2006b; Watt et al., 2006a).

CNTF CNTF was first identified as a trophic factor in chicken eye and nerve extracts that supported

the survival of chicken ciliary ganglionic neurons. Mammalian CNTF has subsequently been

purified and cloned (Varon et al., 1979; Manthorpe et al., 1980; Barbin et al., 1984; Manthorpe

et al., 1985; Ip and Yancopoulos, 1996). Human CNTF gene encodes a protein of 200 AA,

shares about 80% sequence identity with rat, mouse or rabbit, and like these homologues, lacks

a secretion signal sequence. CNTF mRNA and protein are localized within the SCs of the sciatic

nerve, and the rodent olfactory bulb (Lee et al., 1995; Ohta et al., 1995; Asan et al., 2003; Hu et

al., 2005; Langenhan, 2006). CNTF protein levels are higher in the adult sciatic nerve (3171

ng/g) and spinal cord (118 ng/g) than in other tissues (Ohta et al., 1995; Ohta et al., 1996).

CNTF is a dimeric protein, each subunit adopts a double crossover four-helix bundle fold four

helical bundle (Fig. 2.1) (Lin et al., 1989; McDonald et al., 1995). It dimerizes at concentrations

higher than 40 µM (McDonald et al., 1995). Such dimers are likely to be relevant for the storage

of CNTF in the PN tissue (McDonald et al., 1995). As CNTF is a cytosolic protein (Stockli et al.,

1989), it is apparently released as a consequence of injury. For example, mechanical lesions in

the brain result in a dramatic increase in CNTF mRNA and protein bordering the wound site (Hu

et al., 1997; Kirsch et al., 2003; Ye et al., 2004). However, cellular secretion of CNTF in chicken

is possible, and maybe via non-classical secretion pathways (Reiness et al., 2001).

19

Figure 2.1 Diagram of molecular structure of CNTF dimers, produced by Cn3D 4.1 software.

Signal transduction of CNTF

The signal transduction pathways utilized by CNTF include CNTFRα (Squinto et al., 1990; Davis

et al., 1991), gp130 and LIFRβ. CNTFRα expression is largely restricted to neural tissues,

including all known peripheral targets of CNTF, such as sympathetic, sensory, and

parasympathetic ganglia (Ito et al., 2001; Fuhrmann et al., 2003; Valter et al., 2003). CNTFRα

lacks transmembrane and cytoplasmic domains, and is instead anchored to the cell surface via

a GPI linkage (Sleeman et al., 2000). Signal transduction by CNTF requires binding to CNTFRα,

recruitment and heterodimerization of gp130 and LIFRβ, forming a tripartite receptor complex

(Stahl and Yancopoulos, 1994; Sleeman et al., 2000). CNTF-induced heterodimerization of the

β receptor subunits leads to tyrosine phosphorylation (through constitutively associated JAKs)

(Stahl et al., 1994; Stahl and Yancopoulos, 1994), the activated receptor provides docking sites

for SH2-containing signaling molecules (Boulton et al., 1994), such as STAT proteins (Stahl et

al., 1995; Rajan et al., 1996; Wishingrad et al., 1997). Activated STATs dimerize and then

translocate to the nucleus to bind specific DNA sequences, resulting in transcription of

responsive genes and consequent functions (Sleeman et al., 2000).

CNTF acts as a survival factor

A wide range of neurons have been found to respond to CNTF, such as sympathetic precursors

(Ernsberger et al., 1989), developing sympathetic neurons (Doering et al., 1995), preganglionic

sympathetic neurons (Blottner et al., 1989), neuronal cell lines (Wong et al., 1995; Weinelt et al.,

2003), embryonic motor neurons (Arakawa et al., 1990; Oppenheim et al., 1991), and sensory

neurons (Hartnick et al., 1996). In the CNS, CNTF protects hippocampal neurons from

excitotoxic damage (Semkova et al., 1999), RGCs from axotomy (Mey and Thanos, 1993; Cui et

al., 1999; van Adel et al., 2005) or ocular hypertension (Ji et al., 2004). It can also prevent

degeneration of specific neuronal populations in Huntington’s disease (Mittoux et al., 2000;

Regulier et al., 2002; Alberch et al., 2004; Bloch et al., 2004; Emerich and Winn, 2004; Zala et

al., 2004). However, clinical trials using CNTF have yielded contradictory results (Aebischer et

al., 1996; Miller et al., 1996a; Miller et al., 1996b; Anand et al., 1997; Penn et al., 1997;

Kasarskis et al., 1999; Bachoud-Levi et al., 2000). One of the major challenges to its clinical use

is the difficulty of delivering CNTF to the CNS. Nonneuronal cells are also found to respond to

CNTF. For example, CNTF can cause weight loss in rodent and humans (Duff and Baile, 2003;

20

Zvonic et al., 2003), induce astroglial activation (Monville et al., 2002), generation of

differentiated oligodendrocytes (Marmur et al., 1998), differentiation of neurospheres

(Lachyankar et al., 1997). Recently, CNTF has been demonstrated to affect neurogenesis in the

subventricular zone (Emsley and Hagg, 2003).

CNTF and Eye

In normal retina, CNTF is observed in astrocytes and a few Müller cells (Sarup et al., 2004).

LIFR is found on RGCs and Müller cells (Sarup et al., 2004). CNTFRα is localized in multiple

layers (Ju et al., 2000; Beltran et al., 2005). CNTF is upregulated in retinas in conditions of

cellular stress such as ON transection, mechanical injury, ischemia insult, N-methyl-D-aspartate

(NMDA)- or kainic acid induced retinal damage and light-induced damage (Wen et al., 1998; Ji

et al., 2004; Sarup et al., 2004) suggesting that changes in CNTF expression are early events in

self-repair mechanisms following injury. CNTF levels increase in astrocytes and Müller cells

(Honjo et al., 2000), while CNTFRα is localized and upregulated in RGCs after injury (Ju et al.,

2000; Sarup et al., 2004). This different expression pattern of CNTF and its receptors could help

delay RGC death in a stressful environment (Ju et al., 2000; Sarup et al., 2004).

CNTF has been widely proved to be effective in rescuing photoreceptors (Cayouette and

Gravel, 1997; Liang et al., 2001; Huang et al., 2004; Beltran et al., 2005), promoting RGC

survival and regeneration in vitro (Jo et al., 1999) and in vivo (Mey and Thanos, 1993; Cui et al.,

1999; Weise et al., 2000; Ji et al., 2004; Leaver et al., 2006c). However, CNTF has also been

shown to have deleterious effects on the retina especially on photoreceptors and caution is

therefore needed in potential use in the clinic (Bok et al., 2002; Schlichtenbrede et al., 2003;

Bush et al., 2004; Buch et al., 2006; Elliott et al., 2006; Maclaren et al., 2006). The

neuroprotective effect of CNTF may result from a shift of retinal glial cells to a more

neuroprotective phenotype. This modulation of astrocytes may buffer high concentrations of

glutamate that have been shown to contribute to RGC death after ON transection (van Adel et

al., 2005). Similarly, CNTF may act through Müller cells to exert its effect on photoreceptors

(Wahlin et al., 2000). A recent study also suggested the involvement of stathmin-related

proteins, RB3/stathmin4, in CNTF induced regenerative and/or protective effect after ON injury

(Nakazawa et al., 2005).

Gene knockout studies of CNTF and CNTFRα

Surprisingly, CNTF gene mutations do not result in notable abnormalities of the developing

nervous system (DeChiara et al., 1995). There is no difference in the age of onset, clinical

presentation, rate of progression, disease duration or CNTF levels in sciatic nerve samples

(Takahashi et al., 1996) from those with one or two copies of the null allele, excluding CNTF as

a major disease modifier in ALS (Takahashi, 1995; Al-Chalabi et al., 2003). Null mutation in the

CNTF gene is also not associated with early onset of multiple sclerosis, ALS or schizophrenia

(Orrell et al., 1995; Arinami and Toru, 1996; Thome et al., 1996; Hoffmann and Hardt, 2002;

Hoffmann et al., 2002). These findings, together with the striking observation that a substantial

proportion (2.3%) of the Japanese population is homozygous for a null mutation of CNTF and

21

yet appears quite normal (Takahashi, 1995), all suggest that CNTF is not crucial for

development and it may not even be absolutely required later in life.

In contrast to lacking CNTF, mice lacking CNTFRα die perinatally and display severe motor

neuron deficits (DeChiara et al., 1995). Taken together with the results from null CNTF

mutations in mice and humans, the phenotype of mice lacking CNTFRα strongly indicates that

there exists undiscovered CNTF-related factor that also utilizes the CNTFRα in vivo (DeChiara

et al., 1995; Pennica et al., 1995). The potential existence of more, undiscovered, members of

this neurocytokine family, especially most related to CNTF deserves further study (Ip and

Yancopoulos, 1996; Shelton, 1996).

2.1.3 GDNF family GDNF family includes GDNF, neurturin (NRTN), artemin (ARTN) and persephin (PSPN) (Baloh

et al., 2000; Airaksinen and Saarma, 2002). They are retrogradely transported (Coulpier and

Ibanez, 2004), bind to GDNF family receptors (GFRα1-4) and signal through rearranged during

transfection (Ret) receptor tyrosine kinase (Airaksinen and Saarma, 2002). GDNF was originally

identified as a survival factor for midbrain dopaminergic neurons (Lin et al., 1993). GDNF family

ligands maintain several neuronal populations in the CNS, including midbrain dopamine

neurons (Broome et al., 1999) and motoneurons (Henderson et al., 1994).

GDNF GDNF mRNA can be detected in substantia nigra neurons, astrocytes and SCs. Postnatal

striatum contains the highest GDNF mRNA level in vivo (Schaar et al., 1993; Springer et al.,

1994). Oligodendrocytes also release GDNF to promote neuronal survival (Wilkins et al., 2003).

The biological action of GDNF is mediated by a two-receptor complex consisting GFRα(1-4),

and Ret (Jing et al., 1997; Masure et al., 1998; Thompson et al., 1998). Recently, NCAM was

also identified as a receptor for GDNF (Zhou et al., 2003a). In cells lacking Ret, GDNF binds

with high affinity to the NCAM and GFRα1 complex (Sariola and Saarma, 2003; Iwase et al.,

2005). GFRα is widely expressed in neurons of both CNS and PNS (Cacalano et al., 1998;

Golden et al., 1998; Sarabi et al., 2003; Iwase et al., 2005). In normal rat retina, Ret and GFRα1

are expressed in 13-14% of the RGCs. GFRα expression is increased in the retina after ON

transection. However, GDNF expression in superior colliculus is low, which questions GDNF as

a target-derived survival factor for RGCs (Lindqvist et al., 2004; Kretz et al., 2006).

GDNF plays a critical role in neurodevelopment (Yan et al., 2003), survival of midbrain

dopaminergic (Eslamboli et al., 2003; Krieglstein, 2004) and motoneurons either in vitro

(Rakowicz et al., 2002) or in vivo (Saito et al., 2003; Sakamoto et al., 2003; Bohn, 2004; Lu et

al., 2004a). GDNF has been shown to confer neuroprotective effects on motoneurons (Dolbeare

and Houle, 2003; Storer et al., 2003; Tai et al., 2003; Wu et al., 2003b; Tang et al., 2004), and

dopaminergic neurons (Do Thi et al., 2004; Duan et al., 2004; Patel et al., 2005; Yasuhara et al.,

2005). It can promote dopaminergic development of mouse mesencephalic neurospheres

(Roussa and Krieglstein, 2004), protects against excitotoxicity in the rat hippocampus through

22

scavenge of free radicals (Cheng et al., 2004; Wong et al., 2005) or preventing delayed cell

death following cerebral ischemia (Jin et al., 2003; Shirakura et al., 2003; Wang et al., 2004). In

the retina, GDNF can moderately protect retina from ischemia-reperfusion injury or ON

transection (Klocker et al., 1997), by preventing apoptosis (Wu et al., 2004b; Ishikawa et al.,

2005). It can also preserve photoreceptors from cell death (Harada et al., 2003; Lawrence et al.,

2004). However, clinical trials using GDNF have not resulted in significant improvements

(Kotzbauer and Holtzman, 2006).

2.1.4 Other growth factors 2.1.4.1 Basic fibroblast growth factor (bFGF) The FGF family has more than twenty members (Yamashita, 2005). bFGF (also named FGF-2)

was first purified from the bovine pituitary and was named by its biological activity of promoting

the growth of fibroblast (Gospodarowicz et al., 1984). It is found in 18-, 21- and 23kDa

molecular weight isoforms from a single mRNA (Florkiewicz and Sommer, 1989; Florkiewicz et

al., 1991). The high molecular weight isoform seems to induce better reinnervation and survival

of dopaminergic micrografts in rat Parkinson's disease model (Timmer et al., 2004).

Effects of bFGF are mediated mainly through the tyrosine kinase FGF receptor type 1 (FGFR1),

which is expressed in adult rat RGCs (Sapieha et al., 2003), neural stem cells (Maric et al.,

2003), superior cervical ganglion (Klimaschewski et al., 1999), substantia nigra (Walker et al.,

1998). There is widespread expression of bFGF and FGFR1 in the brain. Astrocytes contain the

highest levels of bFGF and FGFR1 mRNAs (Gonzalez et al., 1995). bFGF has been shown to

play an important role in neurite and axonal growth during development of Xenopus or chicken

RGCs (Park and Hollenberg, 1989; McFarlane et al., 1995; Desire et al., 1998; Lom et al.,

1998), in protection of RGCs in frog (Blanco et al., 2000; Soto et al., 2003) or adult rat (Sapieha

et al., 2003) after ON injury. The protective effect on photoreceptors of bFGF may be through

activation of signaling pathways in Müller cells and other nonphotoreceptor cells (Wahlin et al.,

2000). In transected spinal cord, addition of bFGF increases neural survival but not functional

recovery (Meijs et al., 2004). The signaling pathway of bFGF involves at least activation of

ERK1/2 (Shin et al., 2002; Soto et al., 2005; Sapieha et al., 2006) and Rho GTPases (Lee and

Kay, 2006).

2.1.4.2 Insulin-like growth factors (IGFs) IGFs play an important role in brain growth and development, acting through their receptors

(IGF-R) and binding proteins (IGFBPs) (Werther et al., 1998). IGF-1, IGF-1R and IGFBPs are

widely expressed in the retina (Danias and Stylianopoulou, 1990; Burren et al., 1996). IGF-1

also circulates at high levels in the blood and can be taken up by neurons to mediate

activational effects of exercise in the brain (Carro et al., 2000; Carro et al., 2003). The

pleiotropic effects of IGF-1 include classical trophic actions on neurons such as anti-

apoptotic/pro-survival effects through the PI3K/Akt and ERK/MAPK pathway (Alessi et al., 1996;

Miller et al., 1997; Kermer et al., 2000; Ozdinler and Macklis, 2006), modulation of brain-barrier

permeability, neuronal excitability, axonal growth and neurogenesis (Raizada, 1991; Arsenijevic

23

and Weiss, 1998; Werther et al., 1998; Anderson et al., 2002; Bondy and Cheng, 2002; Carro et

al., 2003; Guan et al., 2003; Ozdinler and Macklis, 2006). Recombinant human IGF-1 has been

tested in clinical trials for the treatment of ALS (Lange et al., 1996; Lai et al., 1997; Borasio et

al., 1998). Interestingly, in the CNS there is abundant co-expression of estrogen receptors and

IGF-1R in the same cells. Therefore, it has been suggested that estrogen effects in the brain

may be mediated in part through the activation of the signaling pathways of IGF-1R (Cardona-

Gomez et al., 2001, 2002). Furthermore, the estrogen receptor may also form part of the

signalling of IGF-1 (Mendez et al., 2006).

2.1.4.3 Interleukins (ILs) ILs are a group of cytokines secreted by white blood cells. Repair of insult to the CNS has been

increasingly attributed to immune responses, which depends largely on ILs. For example, IL-6

can act as a survival factor for RGCs in vitro (Mendonca Torres and de Araujo, 2001;

Sappington et al., 2006), protective factor in brain injury (Penkowa et al., 2000), or retinal

ischemia reperfusion injury (Sanchez et al., 2003). It can mimic the effect of conditional lesion or

cAMP analogue to enhance neurite regeneration of rat DRGs (Cao et al., 2006), perhaps

through up-regulation of CNTF in DRGs (Shuto et al., 2001). Consistent with this, in IL-6

knockout mice, conditioning injury fails to induce spinal axon regeneration (Cafferty et al., 2004).

IL-1β also has been shown to promote remyelination and repair in the adult CNS, presumably

through an IL-1 receptor-mediated Akt pathway (Diem et al., 2003), induction of MMP9 (Zhang

and Chintala, 2004) and IGF-1 (Mason et al., 2001). Conditioning sciatic nerve lesion also

upregulated IL-1β and TGF-β1 expression and significantly shortened initial delay of axonal

regeneration (Ryoke et al., 2000). Similarly, IL-12 can promote neurite outgrowth in mouse

superior cervical ganglion neurons (Lin et al., 2000). A recent study showed that white matter

injury was significantly decreased in IL-18 deficient mice compared with wide type following

hypoxia-ischemia. Therefore, IL-18 may be a potential target for pharmacological therapies

aiming at protection of the cerebral white matter (Hedtjarn et al., 2005).

2.1.4.4 Lens epithelium-derived growth factor (LEDGF) LEDGF, belongs to the hepatoma-derived growth factor (HDGF) family which includes HRP1-4,

HDGF and p52/75/LEDGF (Dietz et al., 2002). p75/LEDGF and p52 are derived from a single

gene by alternative splicing (Singh et al., 2000a). In the adult human brain, LEDGF may be

involved in neuroepithelial stem cell differentiation and neurogenesis (Chylack et al., 2004). It

enhances the survival and growth of lens epithelium cells (LECs), keratinocytes, fibroblasts

(Singh et al., 2000b), embryonic retinal photoreceptor cells (Nakamura et al., 2000b) and protect

LECs from insult (Singh et al., 1999; Sharma et al., 2000). The protective mechanisms of

LEDGF include activation of PKCγ (Nguyen et al., 2003; Nguyen et al., 2004), binding to cis-

stress response ((A/T)GGGG(T/A)), heat shock (HSE; nGAAn) elements (Singh et al., 2001)

and activation of their transcriptions (Sharma et al., 2003; Fatma et al., 2004). In the retina,

intravitreal injection of LEDGF can protect retinal cell from apoptosis induced by N-methyl-D-

aspartate (NMDA) (Inomata et al., 2003), promotes photoreceptor survival in light damage

(Machida et al., 2001) and delays photoreceptor degeneration in retinal explants (Ahuja et al.,

24

2001). Studies also suggest that LEDGF may be a downstream transcription factor involved in

the oncogene Bcl-2 signal pathway (Feng et al., 2004a).

2.1.5 Nucleotides Cyclic AMP As described earlier, endogenous cAMP levels can determine neuronal responsiveness to

diffusible growth factors (Cui et al., 2003a; Li et al., 2003a) and myelin-associated neurite

growth inhibitory molecules (Qiu et al., 2002; Snider et al., 2002; Bandtlow, 2003; Gao et al.,

2003). Elevation of cAMP can promote axonal regeneration (Monsul et al., 2004) and functional

recovery after CNS injury (Bhatt et al., 2004; Pearse et al., 2004). However, use of cGMP (cyclic

guanosine monophosphate) analogues can elicit contradictory results, such as changing the

Xenopus spinal neuronal growth cone response from repulsion to attraction (Song et al., 1998)

or Xenopus retinal growth cone response to semaphorin 3A (Campbell et al., 2001), but does

not have significant effects on growth cone turning of embryonic Xenopus neurons (Lohof et al.,

1992) or neurite growth from P7 rat cerebellar granule cells (Bandtlow, 2003).

Purine nucleoside Purine nucleosides include adenosine, guanine. Inosine is a naturally occurring product of

adenosine hydrolysis (MacDonald et al., 1979). In both goldfish and rat RGC cultures, the

purine analog 6-thioguanine (6-TG) can completely block outgrowth induced by other growth

factors, however this inhibition can be reversed with inosine (Benowitz et al., 1998; Petrausch et

al., 2000b). Axon outgrowth in CNS neurons may also involve an intracellular purine sensitive

mechanism (Benowitz et al., 1998). For example, inosine can stimulate extensive axon

collateral growth in the rat corticospinal tract after injury (Benowitz et al., 1999) and RGC axonal

regeneration into PN grafts after ON transection (Wu et al., 2003a). Inosine also inhibits

glutamate postsynaptic responses and reduces cerebral infarction (Shen et al., 2005). However,

more evidence is needed to prove this naturally occurring product has genuine useful beneficial

effects in CNS injury.

2.2 Tissue engineering Tissue engineering has been especially developed for use in the treatment of PNS injury

(Schmidt and Leach, 2003). For detailed review please see Schmidt et al., (2003) and Nomura

et al., (2006). Clinical strategies to repair injured PN still concentrate on efforts to attain primary

connection of the cut nerve ends without causing tension (Battiston et al., 2005). If this is

impossible, autografts (e.g. sural nerve, saphenous nerve) are used as the “gold standard” in

spite of the donor-site morbidity associated with the tissue harvesting (Battiston et al., 2005). If

autograft is unavailable, isografts (also called isogeneic or syngeneic grafts) or allografts (also

called allogeneic or homografts) will be the next choice. Cadaveric nerve allograft could provide

unlimited supply of nerve material. However, allografts are vulnerable to immune rejection.

Therefore, it is necessary either to use immune suppressors or remove the immunogenic

components. Structures proposed to be antigenic components in the nerve grafts include myelin

and cells. The critical cell components are antigen presenting cells (APCs) such as SCs,

25

endothelial cells and perivascular macrophage-like cells that can express MHC (Gulati and

Cole, 1990; Gulati, 1995; Evans et al., 1999). Many pretreatment methods have been

established such as thermal (Evans et al., 1999), radiation (Genden et al., 2001; Brenner et al.,

2005), or chemical processes (Dumont and Hentz, 1997; Hudson et al., 2004; Kim et al.,

2004a). Thermal method i.e. repeated deep freezing and thawing was first described by

Sanders (Sanders, 1959) and it is still of current interest. Repeated freeze-thaw kills all the cells

within the nerve, but leaves the perineurial and endoneurial connective tissue structures and at

least laminin intact (Berry et al., 1988; Gulati et al., 1995; Cui et al., 2003b). Laminin is very

important in axon regeneration (Fukuda et al., 1990; Wang et al., 1992).

In PN injury, pretreatment by freeze-thawing has been found to allow regeneration similar to

autografts (Accioli-De-Vaconcellos et al., 1999; Evans et al., 1999). However, in CNS, the

transplantation of acellular PN sheaths does not support similar axonal regrowth compared to

cellular autografts (Berry et al., 1988; Smith and Stevenson, 1988; Cui et al., 2003b). This is

almost certainly due to the lack of viable SCs (Berry et al., 1988; Gulati, 1988; Smith and

Stevenson, 1988; Cui et al., 2003b). If PN sheaths are reconstructed with SCs, the grafts will

partially regain their ability to promote neural survival and regeneration (Cui et al., 2003b).

Therefore, artificially produced nerve bridges or synthetic guidance channels reconstructed with

autologous or allogeneic SCs could be used to accelerate CNS regeneration. Some successful

attempts to graft reconstructed PNs into gaps within the spinal cord (Xu et al., 1997; Xu et al.,

1999) or ON (Cui et al., 2003b; Hu et al., 2005) have been reported.

2.2.1 PN autografts The use of PN autografts to promote regeneration in the CNS was first described by Tello and

Cajal at the turn of the 20th century. Later this approach was revived by Aguayo and colleagues

in Montreal. It is also the first method used in ON injury that can achieve long distance axonal

regeneration. More importantly, these studies showed that CNS neurons have the ability to

regenerate if provided with a permissive environment (Richardson et al., 1980; David and

Aguayo, 1981). PN autografts have been shown to promote RGC survival and under optimal

conditions 20-30% survived RGCs can regrow axons into the graft. Some axons can even re-

enter the superior colliculus and form functional synapses (Bray et al., 1987; Vidal-Sanz et al.,

1987; Kittlerova and Valouskova, 2000; Sauve et al., 2001). Multiple intercostal nerve grafts

were also tested in a SCI model. PN grafts were implanted into 5 mm gap in the thoracic spinal

cord. Hind limb function improved progressively during the first 6 months. Some axons of the

corticospinal tract regenerated through the grafted area to the lumbar enlargement (Cheng et

al., 1996).

2.2.2 Reconstructed acellular PN allografts As described earlier, acellular tissues prepared from fresh nerves are non-antigenic, incapable

of degeneration and can be stored for a long time. These are the advantages of acellular tissue

compared to fresh nerve. SCs and inflammatory cells from the host nerve can migrate into and

remodel the acellular grafts and promote PN regeneration. This may explain why in short gap or

26

long term PN injury, addition of SCs to the acellular grafts did not further enhance PN

regeneration (Accioli-De-Vaconcellos et al., 1999; Frerichs et al., 2002; Fox et al., 2005a; Fox et

al., 2005b). However in CNS injury, repopulation of the acellular grafts with SCs (Gulati et al.,

1995) is necessary but has not been widely tested (Dezawa, 2002; Cui et al., 2003b).

2.2.3 Synthetic channel grafts Various synthetic implants have been developed in attempt to promote regeneration after CNS

injury (Nomura et al., 2006). For example, synthetic hydrogel tubular devices that are composed

of poly (2-hydroxyethyl methacrylate-co-methyl methacrylate) (PHEMA-MMA) (Tsai et al.,

2004), SC seeded channels (Xu et al., 1999; Iannotti et al., 2003; Chau et al., 2004) and

polymerized collagen rolls enclosing SCs (Paino and Bunge, 1991) have been tested in SCI

injury; artificial graft made by SCs, ECM and trophic factors tested in ON injury (Negishi et al.,

2001); polymer/neonatal SCs/matrix has been tested in lesioned rat optic tract (Plant and

Harvey, 2000).

Summary

Results to date from these various PN graft studies give hope for the therapeutic reconstruction

of neural pathways after injury. However, the major challenges ahead include the growth of the

injured nerve fibers back into the central neurons correctly and the functional integration with

host synaptic pathways (English, 2005).

2.2.4 Cell/ tissue transplantation Cell transplantation has been widely used in experimental and clinical trials of CNS injury. Glial

cells (i.e. SCs, olfactory ensheathing cells, astrocytes and oligodendrocytes) and macrophages

can all provide some degree of support for regeneration by clearing debris and secreting

different sorts of neurotrophic factors. Fetal tissues may even act as a relay with host axons

connecting to grafted neurons, and then sending their axons to connect with host neurons

(Fawcett, 2002).

Schwann cells (SCs) Since axons from PNS can successfully regenerate, but not axons in the CNS, it makes sense

to introduce SCs into CNS in attempts to promote regeneration. SCs can secret various

regeneration promoting molecules (Ide, 1996) such as NCAM (Martini et al., 1994; Iwase et al.,

2005), L1 (Martini et al., 1994; Weidner et al., 1999) and various neurotrophic factors. In

addition, SC alignment can direct neurite outgrowth in the absence of other guidance cues

(Thompson and Buettner, 2006). However, SCs also express MAG (Shen et al., 1998),

tenascin-R (Probstmeier et al., 2001), CSPGs (Muir et al., 1989) that may balance the

permissive effects by inhibiting outgrowth and branching (Shen et al., 1998). Highly purified SCs

have been successfully cultured from animal and human tissues (Morrissey et al., 1991;

Calderon-Martinez et al., 2002), allowing for transplantation of autologous SCs (Haastert et al.,

2006) and reconstruction. Acute transplantation of SCs alone can promote recovery in rat SCI

(Garcia-Alias et al., 2004). SC transplantation has also been tested in combination with other

27

cells, tissues, agents or treatments, such as cAMP (Pearse et al., 2004), Chondroitinase ABC

(Chau et al., 2004), demyelination treatment (Azanchi et al., 2004), OECs (Fouad et al., 2005),

fetal spinal cord cells (Feng et al., 2004b, 2005), matrigel (Xu et al., 1997), or

methylprednisolone (Chen et al., 1996). SC-seeded mini-channels can guide axonal growth into

distal spinal cord in hemisected adult rat spinal cord (Xu et al., 1999), NGF or BDNF secreting

SCs can guide spinal cord axonal growth and remyelinate axons (Menei et al., 1998; Tuszynski

et al., 1998; Weidner et al., 1999). In the eye, intravitreal injection of SCs can promote the

survival of axotomized RGCs (Li et al., 2004a). Artificial grafts made by SCs, ECM (Plant and

Harvey, 2000) and trophic factors can significantly increase the regeneration of RGC axons

(Negishi et al., 2001).

Fibroblasts (FBs) FBs are one of the connective tissue cells which act as protein-synthesizing factory in

connective tissue, secrete an ECM rich in collagen and other macromolecules. FBs and SCs

are two major cell components of the PN. Many studies have demonstrated FBs to be a

remarkable source of trophic factors with potential clinical applications. Intravitreal transplants of

FBs can promote the survival of axotomized RGCs probably by secreting neurotrophic factors

(Li et al., 2004a). Transplantation of genetically modified FBs has been tested widely in animal

models as means to deliver a continuous supply of neurotrophic factors. For example, GDNF

gene modified FBs promote motor axonal growth, increase the expression of trophic peptide

CGRP (calcitonin gene-related peptide) in adult rats underwent unilateral transection of the

hypoglossal nerve (Blesch and Tuszynski, 2001). BDNF, NT3, CNTF or NGF gene modified

FBs can promote regeneration of axons and recovery of functions when placed into the injured

spinal cord (Tuszynski et al., 1994; Liu et al., 1999; Jin et al., 2000; Himes et al., 2001; Liu et al.,

2002b; Murray et al., 2002) or into the lesioned optic tract (Loh et al., 2001). However,

transplantation of FBs engineered to secret GDNF into the eye after ON transection can only

promote RGC regeneration the same level as normal FBs do (Lindqvist et al., 2004). FBs may

also have deleterious effects on axons remyelination comparing with SCs (Brierley et al., 2001).

Activated macrophages Early and robust invasion by macrophages may be one of the reasons why axonal regeneration

is more successful in PNS than in CNS (Franzen et al., 1998). Michal Schwartz et al. have

shown that macrophage phagocytic activity can be stimulated by pre-incubation with sciatic

nerve segments but inhibited by pre-incubation with ON segments. Transplantation of this

activated macrophages into transected ON can promote axon regeneration (Lazarov-Spiegler et

al., 1996). Lens injury or intravitreal injections of Zymosan, a yeast cell wall preparation which

induce macrophage activation, also promotes RGC survival after axotomy and induce axon

regenerate into the distal ON (Fischer et al., 2000; Leon et al., 2000; Fischer et al., 2001; Yin et

al., 2003). Similarly, stimulation of macrophages by a group B-streptococcus exotoxin will

increase phagocytosis of inhibitory debris, result in a less dense reactive gliosis, and

corresponding regrowth of axons through the glial scar in the injured ON (Ohlsson et al.,

2004b). In the injured adult rat spinal cord, transplantation of activated macrophage can also

28

stimulate tissue repair and partial functional recovery (Rapalino et al., 1998). Until now, no

evidence for a direct synthesis of neurotrophic factors except oncomodulin (Yin et al., 2006) by

the activated macrophages has been found. Resident glial cells may secrete neurotrophic

factors stimulated by macrophage released cytokines (Franzen et al., 1998). Moreover,

inflammation contributes to the lesion pathogenesis and may exert a negative effect (Hirschberg

et al., 1994). Clinical trial using incubated macrophage for complete SCI is currently undergoing

(Knoller et al., 2005).

2.3 Neutralizing inhibitory molecules/ pathways As described in Chapter 1, the inability of adult CNS axons to regenerate is significantly

associated with the hostile CNS environment that is inhibitory to axonal elongation. This

inhibition is mediated by the inhibitors in the glial scar, as well as by oligodendrocyte and

myelin-associated neurite outgrowth inhibitors such as OMgp, MAG and Nogo (Grandpre and

Strittmatter, 2001). These inhibitors act through NgR/p75NTR/Lingo/TROY receptor complex

with activation of PKC (Sivasankaran et al., 2004), EGFR (Koprivica et al., 2005; Ahmed et al.,

2006) and converge to the Rho GTPase pathway (Fig.1.3). Increasing knowledge of this

inhibitory pathway has led to the development of a range of studies aimed at neutralizing these

growth inhibitors in order to promote axon regeneration after CNS injury.

2.3.1 Neutralizing the inhibitors in glia scar CSPGs are upregulated after injury (Morgenstern et al., 2002; Jones et al., 2003) and axon

regrowth stops where CSPGs are deposited (Fawcett and Asher, 1999; Inatani et al., 2001).

Therefore an obvious strategy to enhance axonal regrowth is to neutralize CSPGs.

Chondroitinase ABC (Ch-ABC) can remove the chondroitin sulfate GAG chains and break down

the glia scar and promote nerve fiber growth in the lesion area. For example, axonal

regeneration in the spinal cord (Zuo et al., 1998b; Bradbury et al., 2002; Yick et al., 2003; Houle

et al., 2006), PN (Krekoski et al., 2001; Zuo et al., 2002; Yang et al., 2006) and SC-seeded

channels (Chau et al., 2004) is promoted by Ch-ABC. Ch-ABC and BDNF have synergistic

effects on retinal fiber sprouting after denervation of the superior colliculus in adult rats (Tropea

et al., 2003). However, Ch-ABC does not reduce the inhibitory effect of some proteoglycans

such as NG2, perhaps because the inhibitory activity of NG2 resides in its core protein (Inatani

et al., 2001). In addition to Ch-ABC, other strategies to suppress GAG chain synthesis include

the use of DNA enzymes (Grimpe and Silver, 2004), X ray-irradiation (Zhang et al., 2005), NG2

antibody (Tan et al., 2006), decorin (Davies et al., 2004); metalloproteases (MMPs) (Zuo et al.,

1998c; Ferguson and Muir, 2000; Winberg et al., 2003; Pastrana et al., 2006) or

xylosyltransferase-1 (Grimpe and Silver, 2004). All of these methods have been shown to

minimize the formation of lesion scars and attenuate CSPG inhibitory activity (Dou and Levine,

1994; Zuo et al., 1998b; Bradbury et al., 2002; Morgenstern et al., 2002; Zuo et al., 2002).

29

2.3.2 Neutralizing the inhibitors in myelin Antibodies/antagonist to Nogo Following the early study using IN-1 (Schnell and Schwab, 1990), blockade of Nogo-A with

Nogo-A specific antibodies or fragments (Brosamle et al., 2000; Fiedler et al., 2002;

Papadopoulos et al., 2002) have been shown to improve regeneration in different injury models

(Emerick et al., 2003; Emerick and Kartje, 2004; Fouad et al., 2004; Freund et al., 2006).

Intraventricular or intrathecal delivery of Nogo-A antibody has better penetration and distribution

in brain and spinal cord (Weinmann et al., 2006). IN-1 also has synergistic effects with CNTF

(Cui et al., 2004), BDNF (Weibel et al., 1994), bFGF (Weibel et al., 1994) and NT-3 (Schnell et

al., 1994). In addition to the actions on axon regeneration, IN-1 also induces sprouting of

various intact axons and reorganization of undamaged motor tracts and cortex; this may

contribute to some return of function (Raineteau et al., 2002; Emerick et al., 2003; Emerick and

Kartje, 2004). However, direct transplantation of mouse hybridoma cells that secrete IN-1

antibody into the CNS can only be done in animal models, other less invasive methods and

humanized antibody still need to be developed before it can go to clinical trials. Further in 2003,

three independent labs observed quite unexpectedly, different regeneration phenotypes from

Nogo knockout mice (Woolf, 2003). The regeneration of corticospinal tract (CST) axons were

seen in two groups (Kim et al., 2003; Simonen et al., 2003), but not in the third lab (Zheng et al.,

2003). The exact reasons still need to be clarified, but seem to relate to the strain differences

(Dimou et al., 2006).

Antibodies/antagonist to NgR Similar beneficial effects are seen when NgR is blocked. For example, blocking of NgR by

transfection growth-sensitized RGCs with adeno-associated viruses expressing a dominant-

negative form of NgR can increase axon regeneration several-fold in ON crush (Fischer et al.,

2004a). In a mouse stroke model, both the recovery of motor skills and corticofugal axonal

plasticity are promoted by intracerebroventricular administration of a function-blocking NgR

fragment (Lee et al., 2004). Blockade of NgR by soluble NgR(310) ecto-Fc protein or antagonist

peptide NEP1-40 promotes axonal sprouting and recovery after SCI in rat (GrandPre et al.,

2002; Li and Strittmatter, 2003; Li et al., 2004b; Wang et al., 2006). In NgR knockout mouse,

motor function after dorsal hemisection or complete transection of the spinal cord is improved

(Kim et al., 2004b). Interestingly, corticospinal fibers do not regenerate (Zheng et al., 2005), but

there is some regeneration of raphespinal and rubrospinal fibers (Kim et al., 2004b).

Knockout of p75NTR p75NTR has been demonstrated to be the coreceptor for NgR, mediating growth cone collapse

by MAG, OMgp, and Nogo (Wang et al., 2002a; Wong et al., 2002; Kaplan and Miller, 2003).

Removal of p75NTR by siRNA significantly enhances the RGC neurite growth response to

CNTF and promotes RGC survival in vitro (Ahmed et al., 2006). However in p75NTR knockout

mice, depletion of the functional p75NTR does not promote the regeneration of the descending

CST and ascending sensory neurons after injury (Song et al., 2004; Zheng et al., 2005) nor

protect photoreceptors from light-induced cell death (Rohrer et al., 2003) and even exacerbates

30

experimental allergic encephalomyelitis (EAE) (Copray et al., 2004). p75NTR is involved in

diverse neuronal responses include differentiation, survival, inhibition of regeneration and

initiation of apoptotic cell death, therefore knockout of p75NTR has complex outcomes and does

not necessarily improve axon regeneration (Bandtlow and Dechant, 2004; Bronfman and

Fainzilber, 2004). Local administration of p75NTR-Fc fusion molecule does not improve

regeneration of ascending sensory neurons in the injured spinal cord neither (Song et al., 2004).

All these observations suggest that p75NTR may not be a critical molecule mediating the

function of inhibitory molecules but only plays a significant role in inflammation and preservation

of blood-brain barrier integrity (Copray et al., 2004). In addition, the reason for this lack of effect

in SCI maybe due to the fact that p75NTR expression is not restricted to CST axons (Song et

al., 2004), there may be other inhibitory pathways independent of the p75NTR/NgR receptor

complex (Schweigreiter et al., 2004; Koprivica et al., 2005; Ahmed et al., 2006), or because

p75NTR has complex relationship with membrane proteins such as sortilin, NgR and Lingo-1.

2.3.3 Inactivation of Rho pathway For review about inhibition of the Rho GTPase pathway please see McKerracher and Higuchi,

(2006). Rho GTPases act as a common point of signal convergence of diverse regeneration

inhibitory pathways (Yiu and He, 2006). Animal studies have demonstrated the important role of

Rho GTPases. Activation of Rho was observed after TBI (Brabeck et al., 2004; Dubreuil et al.,

2006) or SCI (Dubreuil et al., 2003; Madura et al., 2004; Erschbamer et al., 2005; Mimura et al.,

2006). Inactivation of either Rho or downstream effectors can promote neural regeneration in

vitro and in vivo (McKerracher and Higuchi, 2006). C3 transferase is a toxin from Clostridium

botulinum, can inactivate Rho (Saito, 1997). It has been tested in ON and spinal cord lesion site

with some success (Lehmann et al., 1999; Dergham et al., 2002; Fournier et al., 2003; Monnier

et al., 2003; Bertrand et al., 2005; Bertrand et al., 2007). In tissue culture, inactivation of the

Rho signaling pathway is effective in promoting neurite growth on inhibitory CNS substrates with

C3 transferase, or by dominant negative mutation of Rho (Ellezam et al., 2002). Because of the

poor membrane permeability of C3 transferase, different strategies such as microinjection,

trituration, scrape-loading or protein delivery agent have been tested to help C3 to penetrate

into neuronal cell bodies and promote neurite outgrowth (Lehmann et al., 1999; Winton et al.,

2002; Jain et al., 2004). New recombinant C3-like chimeric proteins have been designed to

cross the cell membrane by receptor-independent mechanisms. These proteins were

constructed by the addition of short transport peptides to the carboxyl-terminal of C3. They have

been tested in numerous animal models (Winton et al., 2002; Bertrand et al., 2005; Bertrand et

al., 2007; Hu et al., 2007) and are currently in a phase I/IIA clinical trial (McKerracher and

Higuchi, 2006). The inhibitory effects of Rho GTPases also depend on the growth state of the

neuron. For example, RhoA inactivation by itself results only in moderate regeneration, but

strongly potentates axonal regeneration in crushed ON when the growth state of RGCs is

activated (Fischer et al., 2004b). Y27632, a specific inhibitor of ROCK, can also enhance RGC

axon growth on glial scar tissue (Monnier et al., 2003). Fasudil, is another ROCK inhibitor but

has no effect if delivered 4 weeks after SCI (Nishio et al., 2006). Furthermore, activation of

31

Cdc42 and Rac, as well as inhibition of Rho, can also help to overcome CSPG-dependent

inhibition of neurite extension (Jain et al., 2004).

2.4 Immunotherapy 2.4.1 Immune suppressors Methylprednisolone Until now, methylprednisolone (MP) is the only agent with clinically proven beneficial effects on

functional outcome if administered within 8 hours after SCI (Pan et al., 2004; Bernhard et al.,

2005a; Bernhard et al., 2005b). However, a recent literature review also challenged the effect of

MP (Sayer et al., 2006). In rat, MP improves axonal regeneration from both spinal cord and

brain stem neurons into thoracic SC grafts, possibly by reducing secondary host tissue loss

(Chen et al., 1996) or inhibits production of IL-1β and IL-6 (Fu and Saporta, 2005). Combined

with OECs, MP can improve axonal regrowth up to 13 mm caudal to the lesion 6 weeks after

injury (Nash et al., 2002). However, in the retina, there are divergent results. MP does not

influence or may even exacerbate retinal neuron survival, macrophage activity at the site of

injury, axonal degeneration/regeneration, or visual function following ON crush (Steinsapir et al.,

2000; Ohlsson et al., 2004a). On the other hand, Sheng et al. (2004) found MP can reduce

apoptosis of RGCs after ON crush (Sheng et al., 2004). After ON transection, intravitreal

injection of MP or cortisol can delay the RGC death through inhibition of microglia, up-regulation

of glutamine synthetase, or heat shock protein induction (Heiduschka et al., 2004; Heiduschka

and Thanos, 2006). In summary, clinical application of MP or cortisol in ON injury should be

done with care with awareness of the possible adverse effects.

2.4.2 Therapeutic vaccines Recent studies have indicated that both cell-mediated and antibody-mediated immune

responses are involved in CNS injury (David, 2002; David and Ousman, 2002). Immune activity

and specifically autoimmune activity which is evoked by the insult can be beneficial if properly

regulated (Hauben and Schwartz, 2003). For example, active or passive immunization of CNS

injured animals with myelin-associated peptides induces a T-cell-mediated protective

autoimmune response, and promotes recovery by reducing posttraumatic degeneration

(Hauben et al., 2001). Immunization with myelin, Nogo A, or MAG promote recovery after SCI

(Huang et al., 1999a; Sicotte et al., 2003). Moreover, neonatal tolerance to myelin antigens will

abolish the spontaneous neuroprotection response after ON crush injury and spinal cord

contusion (Kipnis et al., 2002). On the other hand, vaccination with dendritic cells pulsed with

peptides of myelin basic protein (MBP) could promote functional recovery following SCI

(Hauben et al., 2003). Vaccination of adult rats with spinal cord homogenate can also promote

regeneration of RGCs after ON microcrush lesion (Ellezam et al., 2003). However, no significant

immune reaction to growth inhibitory proteins was detected, suggesting alternative mechanisms

are involved (Ellezam et al., 2003).

32

2.5 Regeneration associated genes & guidance cues GAP-43 GAP-43 (also known as neuromodulin or B50) is a membrane-anchored neuronal protein

implicated in axonal growth and synaptic plasticity. It is highly expressed during development

(Mahalik et al., 1992; Reh et al., 1993; Holgert, 1995; Donovan et al., 2002), in neurons with

regeneration potential (Doster et al., 1991; Schaden et al., 1994). However it is also expressed

by “reinnervated” Schwann cell (Tetzlaff et al., 1989; Hall et al., 1992). It has generally been

associated with beneficial effects on neurons. However GAP-43 overexpression in transgenic

mice or through AAV results in decreased resistance to injury (Buffo et al., 1997) and by itself

does not seem to enhance regeneration through growth permissive transplants (Buffo et al.,

1997; Mason et al., 2000; Wehrle et al., 2001; Leaver et al., 2006c). Moreover, the CNS of adult

GAP-43 deficient mice is grossly normal (Strittmatter et al., 1995). There is no evidence for

interference with nerve growth rate, except retinal axons are trapped in the chiasm for 1 week

(Strittmatter et al., 1995). Neurons extend neurites and growth cones in a fashion

indistinguishable from controls in culture (Strittmatter et al., 1995). Similarly, in olfactory bulb,

lesioning of a class of CNS neurons, the olfactory bulb mitral cells lead to enhanced GAP-43

expression, without regeneration of their transected axons i.e. lateral olfactory tract (Verhaagen

et al., 1993). In NGF-dependent sensory neurons, GAP-43 can modulate guidance signals

emanating from Sema3, and absence of GAP-43 can protect neurons from cell death induced

by trophic factor deprivation (Gagliardini et al., 2000).

Bcl-2 family In the retina, expression of Bcl-2 is increased in Müller cells after neonatal optic tract lesion or

ON transection in adult rat (Chen et al., 1994). Axotomized RGCs can be significantly rescued

in Bcl-2 transgenic mice (Cenni et al., 1996; Porciatti et al., 1996; Leaver et al., 2006b).

However, whether Bcl-2 affects axonal regeneration is still controversial. Optic tract

regeneration after tectal lesion is promoted in P4 Bcl-2 transgenic mice (Chen et al., 1997),

while ON regeneration following intracranial ON crush in P5 Bcl-2 transgenic mice (Lodovichi et

al., 2001) or ON transection with PN graft in adult Bcl-2 transgenic mice is not improved (Inoue

et al., 2002). This mystery could be explained partly due to the maturation of astrocytes after P4

in the CNS (Cho et al., 2005). On the other hand, in Bcl-2 gene knockout adult mice there is still

regenerative growth potential of transected RGCs into PN grafts (Kotulska et al., 2003) and

RGCs remain viable after ON axotomy (Dietz et al., 2001). Furthermore, AAV mediated transfer

of Bcl-2 into RGCs increases ganglion cell susceptibility to both axonal injury and intravitreal

NMDA (Simon et al., 1999). Bcl-2 affects the release of cytochrome c from mitochondria and

apoptosome formation (Kluck et al., 1997; Yang et al., 1997), supports axonal growth by

enhancing intracellular Ca(2+) signaling and activating CREB and ERK (Jiao et al., 2005). Bcl-

XL is the predominant member of the Bcl-2 family in the adult retina, and its level decreases

after ON crush (Levin et al., 1997). Overexpression of Bcl-XL in RGCs induces both neuronal

survival (Liu et al., 2001; Malik et al., 2005) and axonal regeneration, but these two processes

appear to be differentially modified by distinct pathways (Kretz et al., 2004). However, in vitro

33

adenovirus mediated transfer Bcl-XL to RGCs reduced apoptosis but impeded axon

regeneration (Oshitari et al., 2003), or increased the axonal number but not axonal elongation

(Dietz et al., 2006).

Semaphorins The semaphorin (Sema) family contains more than 30 members (Neufeld et al., 2005). Plexins

function as binding and signal transducing receptors for all semaphorins except for the class-3

semaphorins which bind to neuropilins (NP) then subsequently activate signaling through

associated plexins (Neufeld et al., 2005). NP-1 and -2 are transmembrane glycoproteins that

have been characterized as receptors for both semaphorins and vascular endothelial growth

factor (VEGF) (Fujisawa, 2004; Chen et al., 2005). Sema3A (previously designated semD/III or

collapsin-1) is a chemorepulsive protein whose role is to guide growth cones by a motility-

inhibiting mechanism was the first discovered Sema (Luo et al., 1993). It is expressed in normal

adult spinal motoneuron and neurons in brain (Hashimoto et al., 2004). Sema3A/NP-1 plays a

role in guiding axons in the optic tract and stimulating terminal branching in the tectum

(Campbell et al., 2001). The signaling pathway following NP and plexin involves Rac, the

collapsing response mediator protein (CRMP) (Liu and Strittmatter, 2001; Deo et al., 2004) and

Rho GTPase (Nakamura et al., 2000a; Rohm et al., 2000; Vikis et al., 2000; Driessens et al.,

2001; Liu and Strittmatter, 2001) (Fig. 1.3).

Semaphorins have been suggested to contribute to the inhibitory nature of the scar tissue and

involved in inhibiting regeneration (Pasterkamp et al., 2001; De Winter et al., 2002). In the

retina, all five members of Sema3, NPs and Plexins are expressed in adult RGCs (de Winter et

al., 2004). Sema3A is only expressed at low level (de Winter et al., 2004). ON axotomy induce

transient upregulation of Sema3A in the retina, (Shirvan et al., 2002; Nitzan et al., 2006) and ON

(Nitzan et al., 2006). Intravitreal injection of function-blocking antibodies against the Sema3A-

derived peptide can temporally rescue RGCs from cell death after ON transection (Shirvan et

al., 2002).

Ephrin Ephrins and Eph receptors have captured the interest recently for their pleiotropic functions

during embryogenesis including segmentation, neural crest cells migration, angiogenesis, and

axon guidance (Davy and Soriano, 2005). An essential property of this signaling pathway is the

ability of both Ephs and Ephrins to behave as receptors or ligands and their consequent cell

autonomous and non autonomous modes of action (Davy and Soriano, 2005). Eph receptors

comprise the largest group of receptor tyrosine kinases and are found in a wide range of cell

types in developing and mature nervous tissues (Flanagan and Vanderhaeghen, 1998; Murai

and Pasquale, 2003). 13 Eph receptors and 8 Ephrins have been identified in mammals (Davy

and Soriano, 2005). EphrinAs and EphrinBs bind to their respective tyrosine kinase receptors

EphA or EphB (Wilkinson, 2001). In the visual system Eph receptors and Ephrins are expressed

as retinal and tectal gradients, which are required for the development of retino-tectal

topography (Brown et al., 2000; Nakagawa et al., 2000; Yates et al., 2001; Williams et al., 2003;

34

Mann et al., 2004; Oster et al., 2004; O'Leary and McLaughlin, 2005) and can be restored after

ON injury in goldfish (King et al., 2004; Rodger et al., 2004) or adult mouse superior colliculus

deafferentation (Knoll et al., 2001). Overexpression of EphrinA2 or EphrinA5 in the retina will

lead to topographic targeting errors (Dutting et al., 1999). A recent paper showed that EphB3

reappears in the mouse ON after crush injury and is involved in RGC axon sprouting and

remodeling (Liu et al., 2006). All of these observations suggest that - if robust regeneration of

RGC axons can be achieved - topographic guidance information as a requirement for

functionally successful re-establishment of the retinocollicular projection is available (Knoll et al.,

2001; Rodger et al., 2004). In corticospinal tract, EphB and their ligands also function as a

midline repellant for axons (Imondi et al., 2000; Kullander et al., 2001). EphrinB3 is also

expressed in the adult spinal cord and retains inhibitory activity equivalent to three myelin-based

inhibitors (Benson et al., 2005).

Netrins Netrins and their classical receptors - deleted in colorectal cancer (DCC), neogenin and

mammalian homologues (UNC5H1-3) of the C.elegans UNC-5 protein - play key roles in

neuronal guidance and also function as angiogenic factor to attract blood vessels (Park et al.,

2004b). Netrins are diffusible bifunctional molecules that can act as chemoattractants or

chemorellents for developing axons (Alcantara et al., 2000). DCC mediates the chemoattractive

response to netrin (Forcet et al., 2002), while UNC-5 acts as chemorepellent signals (Leonardo

et al., 1997). Netrin-1-induced growth cone expansion requires Cdc42, Rac1, Pak1 (p21-

activated kinase), and N-WASP (neuronal Wiskott-Aldrich syndrome protein) but not RhoA or

ROCK activities (Li et al., 2002b; Shekarabi and Kennedy, 2002; Shekarabi et al., 2005). DCC

influences growth cone morphology through an adhesive interaction with substrate-bound

netrin-1 or netrin-1 binding to DCC recruits an intracellular signaling complex that directs the

organization of actin (Shekarabi et al., 2005). DCC mediated netrin signaling pathway involves

focal adhesion kinase (FAK), tyrosine kinases Src (Li et al., 2004c), MAPK signaling (Forcet et

al., 2002) or MAP1B (Del Rio et al., 2004).

Netrin-1 is expressed in different types of neurons and myelinating glia including

oligodendrocytes in the CNS and SCs in the PNS (Madison et al., 2000; Manitt et al., 2001;

Manitt and Kennedy, 2002), and is involved in the dispersal and development of

oligodendrocyte precursors (Tsai et al., 2006). During development, netrins and their receptors

are involved in RGC axon pathfinding from the eyecup to the ON (Gad et al., 2000; Stuermer

and Bastmeyer, 2000; Oster et al., 2004). Contact with netrin-1 at the ONH encourages growth

cones to turn into the ON. This response requires the axonal netrin receptor DCC, laminin-1, β-

integrin and most likely the UNC5H netrin receptors which convert the growth encouraging

signal into a repulsive one therefore drives growth cones into the ON (Stuermer and Bastmeyer,

2000; Oster and Sretavan, 2003). Furthermore, this attraction/repulsion function of netrin-1 is

modulated by intracellular cAMP levels (Shewan et al., 2002). In netrin-1 and DCC-deficient

embryos, RGC axon pathfinding to the disc was unaffected. However, axons failed to exit into

the ON, resulting in ON hypoplasia (Deiner et al., 1997).

35

In the adult animal, netrin-1 is expressed in both RGCs, ONs and PNs that were grafted into

transected ON end, but not in ONH (Petrausch et al., 2000a; Ellezam et al., 2001). It is

constitutively expressed by RGCs following ON transection (Ellezam et al., 2001). Netrin

receptors are expressed in normal adult rat RGCs and down-regulated from surviving RGCs

regardless of whether there is axonal regeneration into PN grafts (Petrausch et al., 2000a;

Ellezam et al., 2001).

2.6 Enhancing functional CNS plasticity Evidence suggests that following injury the brain has the capacity for some degree of local self-

repair that can be promoted in a variety of ways such as by motor activity (Smith and Zigmond,

2003), and electromechanical gait training with functional electrical stimulation (FES) (Hesse et

al., 2004; Jezernik et al., 2004). FES has been shown to be able to achieve selective stimulation

of key weakened muscles for augmented walking. It had both direct and carryover effects

(Johnston et al., 2003). In the eye, environmental light stimulation has been found to be an

important factor to RGC survival and regeneration in cat (Watanabe et al., 1999) or hamster (So

et al., 2005). Studies from lizard also suggest that visual training improves ON regeneration and

restores vision presumably by stabilizing and refining retinal-tectal projections (Beazley et al.,

2003).

2.7 Gene therapy

2.7.1 Non-viral methods Non-viral vector methods consist of delivery of naked DNA by direct injection, liposomes,

nanoparticles, electroporation (Trezise et al., 2003; Leclere et al., 2005) or other means.

Administration of genes to neurons using these methods is however relatively inefficient,

because of the restriction by an intact nuclear membrane in G0 cells (Berry et al., 2001a).

Transgene expression is usually transient. There have been reports using non-viral methods in

neuron regeneration, such as repeated intrathecal administration of plasmid DNA complexed

with polyethylenimine (PEI) (Shi et al., 2003). Liposomes are lipid bilayers entrapping a fraction

of aqueous fluid. DNA will spontaneously associate to the external surface of cationic liposomes

(Felgner et al., 1994). Cationic liposome-mediated GDNF gene expression is observed at least

4 weeks after injection, and can promote axonal regeneration and locomotor function recovery

after SCI in adult rats (Lu et al., 2002; Lu et al., 2004a). Electroporation with a contact lens-type

electrode electrointroduces 40% of all RGCs with the GFP gene in vivo (Dezawa et al., 2002)

and can protect RGCs from injury using Hsp27 protein (Yokoyama et al., 2001), BDNF (Mo et

al., 2002) or GDNF genes (Ishikawa et al., 2005).

2.7.2 RNA viral vectors RNA viral vectors are the most commonly used and the first delivery system developed for gene

therapy. They include oncoretroviruses, lentiviruses, and spumaviruses (Kay et al., 2001).

Oncoretroviral vectors have been widely used to transduce cells to express reporter genes like

eGFP or Lac-Z (Dezawa et al., 2001; Boyd et al., 2004), to produce immortalised cell lines

36

(Trotter et al., 1991), or to secrete neurotrophic factors such as BDNF (Menei et al., 1998; Liu et

al., 1999), GDNF (Cao et al., 2004), NT-3 (Himes et al., 2001) and NGF (Tuszynski et al.,

1998). However, oncoretroviral vectors can only transduce dividing cells, and the transgene is

often switched off in transduced cells. Modified, replication deficient lentivirus was developed in

1996 (Naldini et al., 1996a), with the ability to integrate into the genome of slowly or non-dividing

cells (Naldini et al., 1996b), therefore, received more attention and has been tested in CNS

(Jakobsson and Lundberg, 2006). For example, GDNF delivery using a lentiviral vector system

can prevent nigrostriatal degeneration and induce regeneration in primate models of

Parkinson's disease (Kordower et al., 2000). CNTF using lentiviral-mediated gene transfer to

the retina can effectively rescue axotomized RGCs (van Adel et al., 2003). In purified cultures of

primary OECs infected by lentiviral vector, transgene expression persisted for at least four

months after implantation into the injured rat spinal cord (Ruitenberg et al., 2002).

2.7.3 DNA viral vectors Adenovirus (Ad) Many studies have used Ad vectors. For example, intraventricular injection of adenovirus

expressing heparin-binding EGF-like growth factor in focal cerebral ischemia (Sugiura et al.,

2005). Adenovirus vector mediated gene transfer of BDNF (Koda et al., 2004), NT3 (Zhang et

al., 1998; Blits et al., 2000; Ruitenberg et al., 2005), VEGF (Facchiano et al., 2002), bFGF or

NGF (Romero et al., 2001), cardiotrophin-1 (Zhang et al., 2003) or major growth factor receptor

downstream cascades such as MEK1 (which constitutively activate ERK pathway) (Miura et al.,

2000) and Akt (Namikawa et al., 2000) all can promote axonal regeneration and achieve some

degree of functional recovery after SCI. Ad-Bcl-xL transduction can protect RGCs against

apoptotic cell death in vitro (Oshitari et al., 2003), while intravitreal injection of adenoviral vector

expressing the GDNF (Schmeer et al., 2002; Straten et al., 2002) or CNTF (Weise et al., 2000)

could enhance axotomized RGC survival in vivo. Many of the protective effects of such Ad

vectors are only transient, perhaps due to host immune responses to these viruses. However, a

recent report suggested that repeated adenovector administration into the eye is feasible, and

does not necessarily lead to increased neutralizing anti-Ad antibody titer (Hamilton et al., 2006).

Adeno-associated virus (AAV) AAV is a small human parvovirus, which needs a helper virus to replicate. The recombinant

modified version of AAV genome mainly persists in an episomal form in the cell (McCarty et al.,

2004; Schnepp et al., 2005; Mandel et al., 2006), although it still can integrate into host active

genes (Kay and Nakai, 2003; Nakai et al., 2003). The cellular tropism of rAAV-mediated gene

transfer in the CNS varies depending on the serotype used (Burger et al., 2004). Only minimal

signs of inflammatory response have been described following rAAV2 administration to the brain

(McPhee et al., 2006). In contrast, antibodies to AAV2 capsid and transgene product are elicited

but no reduction of transgene expression is observed. Re-administration of vectors without loss

of efficiency is also possible from 3 months after the first injection (Tenenbaum et al., 2004).

However, 80% of the people maintain antibodies to wild-type AAV2, with 30% expressing

neutralizing antibody (Peden et al., 2004; McPhee et al., 2006), which can reduce rAAV-2

37

mediated transduction in the brain and should be taken into account in future experiments

utilizing this vector (Peden et al., 2004). Studies using AAV vectors in various injury models in

the eye are summarized in Chapter 3.4.

Summary

Worldwide, over 600 clinical trials using gene therapy have been conducted or are underway

(Verma and Weitzman, 2004). Most are in phase I and II, less than 1% in phase III, and

presently there are no commercially approved gene therapy treatments (Verma and Weitzman,

2004). One of the major concerns of gene therapy is its safety. Insertional mutagenesis has long

been recognized as a potential hazard, and recent clinical trials have highlighted this risk

(Hacein-Bey-Abina et al., 2003a; Hacein-Bey-Abina et al., 2003b). Long-term (more than 2-3

years in large animals) follow up should be considered before entering clinical trials (Wood et

al., 2006). The exact molecular mechanism for determine the integration site is still unknown.

Until now, it was thought that retroviral integration is random. Lentivirus strongly favors active

genes (Verma and Weitzman, 2004). A recently paper showed a high incidence of LV vector

associated tumorigenesis following in utero and neonatal gene transfer in mice (Themis et al.,

2005). It is important to note that the same LV vector used in present study is also tested in this

paper, and did not show high incidence of tumorigenesis in vivo (Themis et al., 2005). Recent

development in integration-deficient LV vectors has also shown the possibility of using LV to

achieve efficient and sustained (up to 9 months) transgene expression at the same time without

the risk of insertional mutagenesis (Yanez-Munoz et al., 2006). In addition, more advanced

studies have introduced a molecular switch to control genetically modified expression of

neurotrophic factors (Blesch et al., 2001). Such methods include muristerone A-inducible

expression and tetracycline-responsive promoters (Blesch et al., 2001). These may represent

the future direction of viral vectors. Another important issue is the impact of viral vectors on the

normal function of transduced or nontransduced cells. For example, a recent paper showed that

retroviral mediated gene transfer of hematopoietic stem cells may comprise their homing

potential and result in poor engraftment (Hall et al., 2006).

38

Chapter Three

Literature review of ON injury and RGC

reaction after injury

Because of their anatomical location within the retina, and outside the skull, RGCs are much

more easily accessible both to targeted manipulation and to quantitative assessment than

almost all other CNS neuron populations. Therefore, rodent models of RGC injuries have

become increasingly attractive to study and quantify neuroprotective and regeneration-

enhancing techniques for CNS injury (Chierzi and Fawcett, 2001; Harvey et al., 2006).

3.1 Normal parameters of RGCs in rat Normal RGC number As shown in Table 3.1, in normal adult rat there are some differences in estimated total RGC

number due to strain varieties and perhaps also to the observation methods used.

Table 3.1 Examples of RGC number from normal adult rat.*

Rat strain RGC

(cells/mm2)

RGC (cells/retina)

Counting methods

Reference

3016±149 174,928± 8642 3%FG label SC (Lindqvist et

al., 2004) Fisher 344

1806 ± 54 104,748±3132 0.5% FG label

SC

(Leon et al.,

2000)

1710±73 99,180±4234 5% Di-I label

both SC

(Klocker et

al., 2001) Long-Evans

2533±104 146,914±4234 FG retrograde

label right SC

(Kikuchi et

al., 2000)

2547±404 147,726±23432

Methylene blue

stained >80µm2

cells

(Villegas-

Perez et al.,

1988)

2116±94 122,728±5452 Fast blue label

both SC

(Villegas-

Perez et al.,

1988)

2084±59 120,872±3422 5%FG label cut

ON stump

(Schmeer et

al., 2002;

Kretz et al.,

2005)

Sprague

Dawley

2481±121 143,898±7018 2% FG label SC

(Koeberle

and Ball,

39

2002)

2511±20 145,638±1160 3% FG label SC (Lindqvist et

al., 2004)

2046±47 118,668±2726 Di-I label SC (Klocker et

al., 1997)

1446±376 83,868±21,808 4Di-10ASP label

SC

(Thanos et

al., 1992)

1935±78 112,230±4524 4Di-10ASP label

SC

(Fischer et

al., 2000)

1948±46 113,000±2700 30% HRP label

both SC

(Potts et al.,

1982)

1759±291 102,022±16878 4Di-10ASP label

ON

(Shirvan et

al., 2002)

2209±42 128,122±2436 2% FG label SC (Bertrand et

al., 2007)

2144±176 124,352±10,208 2% FG label

both SC

(Berkelaar et

al., 1994)

1683±68 97,609 ± 3930

5% FG label

both SC,

counted with

Image-Tool

(Danias et al.,

2002) Wistar

2068±16 119,973±939 Axon number in

ON

(Sievers et

al., 1989)

* HRP: horseradish peroxidase; FG: flurogold; Di-l: F1,1'-dioctadecyl-3,3,3',3'-

tetramethylindocarbocyanine percholorate; 4Di-10ASP: (4-didecylaminostyryl)-N-methylpyridinium

iodide; SC: superior colliculus. Highlighted number is the original data in the publication; other numbers

are estimated by an average retinal area of 58 mm2.

How many RGCs needed to get vision back in rat? Studies showed that 2-3 weeks after partial crush injury of ON, 11% RGCs were left however,

recovery of vision was close to normal levels (Sautter and Sabel, 1993; Sabel, 1999; Rousseau

and Sabel, 2001; Hanke, 2002). In PN autograft model, a few thousand RGC fibres were

thought to be enough to mediate functional responses (Thanos et al., 1997).

Parameters about rat RGCs and retina The average retinal area for adult Wistar rats is 57.54±1.56 mm2 (Danias et al., 2002) or

59.4±0.486 mm2 (n=100) (Gellrich et al., 2002), in F344 rat it is about 60 mm2 (Yin et al., 2003).

The vitreous volume of an adult rat eye is approximately 56 µl (Berkowitz et al., 1998; Chen and

Weber, 2001). There are 5 different major classes of neuronal cells (RGCs, amacrine cells,

bipolar cells, rods and cones) and 4 types of non-neuronal cells including astrocytes, Müller

cells, microglia (Kohno et al., 1982) and pigment epithelial cells in the retina. RGCs represent

only about 0.57%, while photoreceptors represent 70% of the total cell population (Simon and

40

Thanos, 1998). In the RGC layer in rat, half of the total number of neurons are RGCs which

project an axon into the ON, whereas the other half are displaced amacrine cells that do not

project an axon into the ON (Perry and Walker, 1980; Perry, 1981; Sievers et al., 1989; Klocker

et al., 2001). The rat RGC axons are not myelinated until they enter the ON (Perry and Hayes,

1985). The ON is approximately 0.64 mm in diameter (Gellrich et al., 2002). Within the ON,

there are about 100,000 axons (1:1 to RGCs) (Fukuda et al., 1982; Fawcett et al., 1984; Sefton

et al., 1985; Sievers et al., 1989; Brooks et al., 1999), all are myelinated, with a mean diameter

of 0.77 μm (Foster et al., 1982; Fukuda et al., 1982) and 0.5 mm/d slow transport rate of

neurofilament (McQuarrie et al., 1986). In rat, only a small population of RGCs (5%-10%) do not

project to the superior colliculus (Jeffery, 1984; Dreher et al., 1985). In the retina of the newborn

rat there are approximately twice as many ganglion cells as in the adult. The excess ganglion

cells are lost over the first 10 postnatal days (Potts et al., 1982; Dreher et al., 1983; Perry et al.,

1983). Migration of amacrine cells into the ganglion cell layer occurs in the first 5 postnatal days

(Perry et al., 1983). In adult rat, most RGC somata are between 7 and 21.5 µm in diameter

(Danias et al., 2002). They can be classified into 3 groups by morphology. They are RGA, cells

with a large soma and a large dendritic field; RGB, cells with a small- to medium-sized soma and

a small- to medium-sized dendritic field; RGC, cells with a small- to medium-sized soma but a

medium- to large dendritic field (Huxlin and Goodchild, 1997; Sun et al., 2002). Different types

of RGCs are evenly distributed in the retina (Sun et al., 2002). ON injury results in the transient

loss of large sized RGCs in the first few weeks post injury, partly because of shrinkage of large

RGCs into medium or small categories (Misantone et al., 1984; Ota et al., 2002). Four weeks

after injury, there is an increase in cell size, especially evident in crush injury (Moore and

Thanos, 1996). large RGCs also seem to have better response to neurotrophic factors (Mey and

Thanos, 1993) and PN grafts (Cui and Harvey, 2000). However, further study is needed to

investigate if this is due to selective loss of smaller sized RGCs or simply changes of RGC size.

RGC distribution in the retina The rat retina does not exhibit strict radial symmetry (Danias et al., 2002), and the location of

highest RGC density area does not always localize in any particular quadrant (Danias et al.,

2002). However, in general there is a centro-peripheral density gradient, with almost 2 times the

number in central compared to peripheral area. The highest density locus close to the ON head

(Klocker et al., 1997; Isenmann et al., 1998; Klocker et al., 1998; Weise et al., 2000; Danias et

al., 2002; Ota et al., 2002; Hou et al., 2004a). RGCs in the central area are more vulnerable to

ON injury (Klocker et al., 1997; Weise et al., 2000; Hou et al., 2004a). This correlates well with

the fact that the distance of the lesion from the cell body influences the extent of cell death

(Villegas-Perez et al., 1993; Berkelaar et al., 1994; You et al., 2000), which can be explained by

the neurotrophic theory that the shorter the axonal stump that remains the worse the retrograde

effect on the neuron. Intravitreal injection of rescue molecules has different effects on RGCs in

different parts of the retina. For example, inosine and Ad-BDNF exhibited better effect in central

part (Isenmann et al., 1998; Hou et al., 2004a), BDNF or GDNF had more effect on peripheral

(Klocker et al., 1997; Klocker et al., 1998), while Ad-CNTF effect was independent from retinal

eccentricity (Weise et al., 2000). This discrepancy could be due to the differences in counting

41

methods, doses and methods of analysis. RGCs in other models without ON injury, such as

glaucoma do not seem to have specific vulnerable areas (Urcola et al., 2006). More discussion

on this issue is given in Chapter 7.

3.2 Injury models RGC death and associated visual loss occur in various eye diseases such as glaucoma,

anterior ischemic optic neuropathy, and traumatic ON injury (Harvey et al., 2006). The present

study will focus on traumatic injury to the ON. Therefore, some commonly used ON injury

models are described as below.

Crush model ON crush is a method that simulates trauma to the ON caused by fractures of the midface

and/or skull base. Several types of injury models (using forceps, micro clips, micro sling, and

suture) have been established. The major drawback of this model is that the injury cannot be

directly quantified at the lesion site, but is rather semi quantitatively referred to as forces (Chen

and Weber, 2001; Klocker et al., 2001), distance between branches of a forcep, crush period

(Gellrich et al., 2002) or suture time. These may result in spared axons and difficulties in

comparison between results.

Suture crush In the suture crush model, a 10/0 suture is used to hold a tight knot around the ON for 60 s

(Selles-Navarro et al., 2001; Bertrand et al., 2005; Bertrand et al., 2007). The suture completely

transects the ON. 6 h after injury all RGC axons retract back from the lesion site. An adjacent

GFAP-negative zone develops in the lesion site early after injury, disappearing by 1 week

(Selles-Navarro et al., 2001). By 1 week, 40-60% of RGCs remained alive (Selles-Navarro et al.,

2001; Bertrand et al., 2005), axons regrow toward the lesion, but most stop at the injury scar

tissue (Selles-Navarro et al., 2001). 2 weeks after lesion, 5% (Bertrand et al., 2005; Bertrand et

al., 2007) to 28% (Selles-Navarro et al., 2001) of RGCs remain, the lesion site is

immunoreactive for CSPGs (Selles-Navarro et al., 2001). The few axons that are able to cross

the injury site grow about 100 μm but do not extend further in the ON white matter (Selles-

Navarro et al., 2001).

Forceps crush Usually, a standardized ON crush injury is made using a fine pair of jeweller’s forceps for 5 to 20

sec (Berkelaar et al., 1994; Yin et al., 2003; Bertrand et al., 2005; Kurimoto et al., 2006),

resulting in a degenerative pattern including a pronounced astroglial and microglial proliferation

2-7 days post injury. Degenerative axons distal to the lesion site exhibit a gradual decrease in

neurofilament immunoreactivity. Regeneration is sometimes observed proximal to the lesion in

sprouts (Ohlsson et al., 2004b).

42

Partial ON transection As described by Levkovitch-Verbin et al, (2003) a modified diamond knife is used to transect the

superior one third of the orbital ON. This partial ON transection leads to rapid loss of directly

injured RGCs in the superior retina (4 days -30%; 8 days -63% compared with fellow eye) and

delayed, but significant secondary loss of RGCs in the inferior retina (9 weeks -34%), whose

axons are not severed (Levkovitch-Verbin et al., 2003).

Complete ON transection This model is used most often, and the time-course and mode of RGC cell death has been well

described. Intraorbital transection of rat ON lead to RGC death within a few days; virtually all

RGCs are still alive and looks normal in 3 days (Thanos, 1988), after 5 days they begin to die,

peaking at about 7 days post injury (Berkelaar et al., 1994; Garcia-Valenzuela et al., 1994). 85%

of RGCs are lost by 14 days, 90% in 30 days after lesion (Sievers et al., 1989). This RGC death

appears to be primarily apoptotic (Nickells, 2004)(see below).

Superior colliculus lesion The superior colliculus is the major central target for RGC axon in the rodent brain. Ablation of

the superior colliculus in neonatal rats results in a rapid increase in RGC death (Harvey and

Robertson, 1992; Cui and Harvey, 1995; Spalding et al., 2005a) which appears not to be

primarily related to caspase activation (Spalding et al., 2005b). In adult rat, no significant RGC

loss was observed even 5 months after superior colliculus lesion (Perry and Cowey, 1979,

1982; Murphy and Clarke, 2006).

Lens lesion It was first described by Mansour-Robaey et al. (1994) who found that anterior eye punctures

(Fig.3.4) without injection had more neurotrophic effect compared with posterior injections

(Mansour-Robaey et al., 1994). Later, Leon et al. (2000) found that, in the ON crush model, a

small puncture wound to the lens leads to an 8 fold increase in RGC survival and a 100 fold

increase in the number of axons regenerating beyond the crush site (Leon et al., 2000). It has

been reported that lens lesion is sufficient to induce RGC axons to override inhibitors at the

lesion site, grow through the white matter of the ON, pass through the optic chiasm, and make

synaptic connections within the brain 5 weeks after lesion (Fischer et al., 2001). However the

regenerated axons were associated predominantly with astrocytes, remained of small diameter

(0.1-0.5 μm) and unmyelinated for more than 2 months compared to axons regenerated into PN

graft (Campbell et al., 2003). Recently, it has been shown that lens lesion also has synergetic

effects with C3 ribosyltransferase or BDNF (Fischer et al., 2004b; Pernet and Di Polo, 2006). It

is thought that macrophage activation plays a major role in lens lesion (Fischer et al., 2000;

Leon et al., 2000; Yin et al., 2003; Lorber et al., 2005). What and where exactly these beneficial

factors associated with the lesioned lens come from are still not clear. There are several

possibilities (Fig 3.1). These factors seem not belong to either the NT or the neurocytokine

family (Leon et al., 2000; Lorber et al., 2002), they may be come from lens epithelium cells

(Stupp et al., 2005; Stupp and Thanos, 2005; Wong et al., 2006) or maybe proteins secreted by

43

macrophages with molecular weight <30 kDa (Yin et al., 2003), possibly oncomodulin (Yin et al.,

2006).

Figure 3.1 Possible models of lenticuloretinal interactions after lens injury. Lens injury induced an

inflammatory reaction within the eye leading to activation of macrophages, which results in an increase in

axonal regeneration by a small peptide (A). In parallel with the accumulation of macrophages, activation

of neuroglia could be observed that was correlated with neurite outgrowth. This may be due to

upregulation of unknown trophic factors (B). The stimulating effect of lens injury on dissociated RGC

cultures suggested the existence of factors that stimulate neurite outgrowth directly and independently

from the existence of macrophages (C). Adapted from Stupp and Thanos (2005).

In vitro RGC culture or retinal explant Explants are suitable for continuous observation of the response of retinal neurons to agents

whose concentration can be precisely controlled, or for screening studies looking for potential

therapeutic agents (Schlieve et al., 2006). Retinas with or without ON preconditioning injury can

be chopped, cut into pieces, usually cultured on laminin, collagen, fibronectin coated dishes, or

fibrin gel feed with neurobasal or serum free medium (Bahr et al., 1988; Koprivica et al., 2005;

Dietz et al., 2006; Leaver et al., 2006a). Isolated RGC cell culture is more valuable when the

impact from other cells in the retina needs to be ruled out. Postnatal RGCs can be isolated

using marker Thy1.1 (CD90) by two-step immunopanning, magnetic bead procedure and

cultured on PLL coated plates (Meyer-Franke et al., 1995; Shoge et al., 1999; Inatani et al.,

2001; Goldberg et al., 2002b; Ahmed et al., 2006; Sappington et al., 2006).

44

3.3 Pathophysiology after adult ON transection After adult ON injury, a cascade of inflammatory events is initiated, leading to degeneration of

ganglion cell terminals and phagocytosis of somata in the retina. Apoptosis can be broken down

into four stages (Nickells, 2004) as shown in Figure 3.2.

Figure 3.2 The four basic stages of RGC death. Above each of the four stages are the names of genes that

have been described in the process of RGC death. They are loosely placed at the point of the cell death

pathway where they are thought to act. Adapted from Nickells, (2004).

These stages include early changes in gene expression marked by the up-regulation of different

genes (Isenmann et al., 2003) such as c-jun (Herdegen et al., 1993; Hull and Bahr, 1994b, a;

Kreutz et al., 1999; Lu et al., 2003), p53 (Levkovitch-Verbin et al., 2006), bcl-2 (Chen et al.,

1994), Bax (Bahr, 2000; Qin et al., 2004) and poly(ADP-ribose) polymerase (PARP) (Weise et

al., 2001). The most critical stage of RGC death is the dysfunction of mitochondria (Nickells,

2004). This stage is characterized by a loss in the electrochemical proton gradient across the

inner membrane, a reduction in ATP synthesis, the production of oxygen free radicals,

superoxide anion (Geiger et al., 2002; Lieven et al., 2006). This then activate apoptosis, which

is dominated by the sequential activation of caspases (Bahr, 2000; He et al., 2004) and DNA

endonucleases, that attack the cell nucleus and create DNA fragments (Berkelaar et al., 1994;

Garcia-Valenzuela et al., 1994; Nickells, 2004).

Glutamate is a major neurotransmitter in the retina and other parts of the CNS. ON axotomy or

crush leads to elevated levels of extracellular glutamate, while partial ON crush leads to an

increase in vitreal glutamate (Yoles and Schwartz, 1998; Vorwerk et al., 2004). Glutamate

neurotoxicity is mediated through NMDA receptor with influx of extracellular Ca2+ (Sucher et al.,

1997), activation of p38 MAP kinase (Kikuchi et al., 2000). Although RGCs themselves may be

45

relatively resistant to glutamate toxicity (Ullian et al., 2004), there is evidence that buffering of

extracellular glutamate by retinal glutamate transporters such as GLAST (EAAT-1) and GLT-1

(EAAT-2) or inhibition of NMDA, AMPA-kainate receptors is protective (Sucher et al., 1991;

Schuettauf et al., 2000; Barnett et al., 2001; Guo et al., 2006). The protective effect of CNTF is

also partly due to activation of astrocytes which can buffer high concentrations of glutamate

(van Adel et al., 2005).

3.4 Strategies to promote RGC survival and regeneration after injury Similar to injury elsewhere in the CNS, several steps have to be achieved for successful

treatment of ON injury (Harvey et al., 2006). First, the death of RGCs must be prevented or

decreased. Second, axons from surviving RGCs must be induced to extend toward their targets

(LGN and superior colliculus). Finally, a process of synaptic connection and refinement must

occur so that appropriate RGCs are connected to the appropriate target. Prevention of the

death of RGCs is usually referred to as neuroprotection, whereas restoration of ON function is

called neurorepair (Miller, 2001).

Generally, four types of methods have been tested in RGC protection and repair.

(a). Use of neurotrophic factors and/or build a better neuron growth environment. BDNF, GDNF,

bFGF and CNTF have been shown to have survival and regeneration promoting effects on

RGCs in vivo and in vitro (Turner et al., 1980; Mey and Thanos, 1993; Weise et al., 2000;

Schmeer et al., 2002; Oshitari et al., 2003; Sapieha et al., 2003; van Adel et al., 2003; Bonnet et

al., 2004; Lorber et al., 2005). However, repeated injections of these molecules into the CNS

remain an unsolved problem and have proven a major obstacle for designing feasible treatment

strategies in patients. The application of viral vectors for gene delivery therefore offers a new

tool to ensure continuous availability of the encoded gene product for a prolonged time span

(Jones et al., 2001). GFP can persist at least 6 months in ON and brain of mice and dogs after

intravitreal delivery of rAAV-GFP (Dudus et al., 1999). Different viral vectors have been tried in

the retina:

Adenoviral vector: Ad-GDNF (Schmeer et al., 2002; Straten et al., 2002); Ad-CNTF (Cayouette

and Gravel, 1997; Weise et al., 2000; Huang et al., 2004; van Adel et al., 2005); Ad-BDNF

(Isenmann et al., 1998; Isenmann et al., 1999; Hou et al., 2004b); Ad-Bcl-XL(Oshitari et al.,

2003). AAV vector: AAV-GDNF (McGee Sanftner et al., 2001; Kells et al., 2004); AAV-NGF (Wu

et al., 2004a); AAV-BDNF (Martin et al., 2003; Kells et al., 2004); AAV-CNTF (Liang et al., 2001;

Schlichtenbrede et al., 2003; Leaver et al., 2006c; Maclaren et al., 2006); AAV-bFGF (Sapieha

et al., 2003); AAV-NgR (DN) (Fischer et al., 2004a); AAV-C3 ribosyltransferase (Fischer et al.,

2004b); AAV-Bcl-XL (Malik et al., 2005); AAV-mitogen-activated protein kinase kinase 1 (MEK1)

(Pernet et al., 2005); LV vector: LV-CNTF (van Adel et al., 2003). Recent results have indicated

that RGC death after axotomy is not only because of deprivation of trophic factors, but also

because they lose trophic responsiveness (Shen et al., 1999). Simply delivery of exogenous

survival factors is not enough unless trophic responsiveness to such factors is simultaneously

enhanced (Goldberg and Barres, 2000; Goldberg et al., 2002b; Goldberg, 2004).

46

(b). Removing inhibitory factors. Block the inhibitory action of myelin-associated molecules

and/or other glial elements (Wong et al., 2003; Cui et al., 2004; Fischer et al., 2004a), block the

downstream inhibitory pathways (Fischer et al., 2004b; Monsul et al., 2004; Bertrand et al.,

2005; Bertrand et al., 2007; Hu et al., 2007).

(c). Surgical interventions to provide a permissive bridge across the injury site. PN autografts

(Richardson et al., 1980; David and Aguayo, 1981; Vidal-Sanz et al., 1987), artificial PN

containing SCs (Plant and Harvey, 2000; Negishi et al., 2001; Cui et al., 2003b; Hu et al., 2005),

FBs, OECs (Li et al., 2003b), gene activated matrices (Berry et al., 2001b) have all been used

as bridges in the visual system. All can achieve some degree of regeneration. In PN autografts,

the fastest regrowing axons extend at 2 mm/day after an initial of 4-5 days delay in adult

hamster (Cho and So, 1987). In the transitional zone, GFAP positive astrocytes co-migrate with

growing axons (Hall and Berry, 1989), SCs can also migrate into this transitional zone, both cell

types facilitate RGC axons entry into the PN grafts (Hall and Berry, 1989; Dezawa et al., 1999).

ED-1 positive macrophages accumulated at the regenerating stump 1 week after PN graft, and

decreased 3 weeks post operation (Dezawa et al., 1999). PN autografts are still the most

efficient means of inducing RGC regeneration at present (Chierzi and Fawcett, 2001).

Furthermore, RGC axons guided by PN autograft that was inserted into the superior colliculus,

can form synapses in superior colliculus (Vidal-Sanz et al., 1987; Carter et al., 1989; Carter et

al., 1991; Vidal-Sanz et al., 1991; Carter et al., 1994; Sauve et al., 1995; Carter et al., 1998)

with some degree of topological organization (Sauve et al., 2001) resulting in visual evoked

cortical potentials (Keirstead et al., 1989; Thanos et al., 1997) and responses to light (Keirstead

et al., 1985; Thanos, 1992; Sasaki et al., 1993; Thanos et al., 1997; Vidal-Sanz et al., 2002).

(d). Other methods. Cell transplantation of stem cells (Kicic et al., 2003; Mellough et al., 2004),

SCs, FBs (Li et al., 2004a), and PN-stimulated macrophages (Lazarov-Spiegler et al., 1998)

have all been tested. In addition, intravitreal PN grafts (Berry et al., 1996; Su et al., 2001; Su

and Cho, 2003; Ahmed et al., 2006), intraocular administration of inosine (Wu et al., 2003a; Hou

et al., 2004a), latanoprost (Kudo et al., 2006), nipradilol (Watanabe et al., 2006) have alll been

shown to be able to rescue RGCs. Anti-apoptosis therapy using siRNAs (Lingor et al., 2005),

lithium (Huang et al., 2003; Schuettauf et al., 2006) or caspase inhibitors (Oshitari and Adachi-

Usami, 2003; Patil and Sharma, 2004). Immunotherapy such as application of immunophilin-

ligands (Gillon et al., 2003; Rosenstiel et al., 2003) or self antigen vaccination (Ellezam et al.,

2003) is also able to inhibit RGC death in vivo.

3.5 RGC quantification Several strategies have been established to estimate RGC number: (1) by counting the RGC

axons in cross-sections of the ON (Sievers et al., 1989; Cenni et al., 1996; Martin et al., 2003;

Chauhan et al., 2006); (2) retrograde labeling with markers (most commonly used methods; Fig.

3.3) (Isenmann et al., 2003); (3) labeling of RGCs with antibodies, and morphologic

identification. None of the above counting methods is perfect. In mammalian ON there are no

47

fibers other than RGC axons; therefore axon counting provides a representation of the number

of RGCs. However, counting of regenerated axons after injury is difficult, because axons can

branch, alter course, turn back on themselves etc. The backfilling method is also easy to have

bias. Degenerated RGCs could be phagocytosed by microglia and other cells producing

inaccurate counting (Thanos, 1991; Thanos et al., 1992; Thanos et al., 1994; Nicole Bodeutsch,

2000), although microglia may be distinguished from RGCs by their fluorescence and multiple,

thin processes (Fischer et al., 2000; Leon et al., 2000). Therefore it is better to wait to backfill

RGCs with dye just before sacrifice (Martin et al., 2003). Antibodies (such as βIII-tubulin, Thy-1,

RT97) to identify RGCs have not been widely accepted and recognize all the RGC subtypes.

One of the problem using antibodies is the staining of axons can overlay with RGCs especially

in areas close to optic nerve head, this will cause underestimate of counting. Another problem

with immunostaining is that it is not possible to determine the viability of RGCs. This is may be a

problem when the RGCs have died and only left the cytoskeletal structures, leading to the

counting of “ghost” RGCs. Counting RGCs by morphology is also imperfect, as the marginal

difference between small RGCs and amacrine cells can be problematic (Martin et al., 2003).

Recently, using RT-PCR to compare the expression of Thy-1 has been shown to be an

alternative way if RGCs are too difficult to count directly (Schlamp et al., 2001; Chidlow et al.,

2005). However, possible changes of the level of gene expression can occur before actual

detectable RGC death (Schlamp et al., 2001; Chidlow and Osborne, 2003; Chidlow et al., 2005;

Huang et al., 2006). Furthermore, Müller cells may also express Thy1 (Dabin and Barnstable,

1995). Studies using real-time PCR technique should also consider the changes of

housekeeping genes (Kim et al., 2006b). Taken together, it is better to combine different

methods together to reveal accurate changes in RGC number after experimental interventions.

48

Figure.3.3 The retino-tectal projection of the rat: anatomy, labelling techniques, and ON lesion paradigm.

RGC axons project through the ON, cross to the contralateral side at the optic chiasm, travel along the

optic tract, and terminate at the superior colliculus, with some 30% of RGCs sending collaterals to the

lateral geniculate nucleus. In the albino rat, more than 99% of RGC axons cross the midline at the optic

chiasm to the contralateral side. RGCs can be retrogradely labelled with fluorescent dyes (e.g., DiI,

fluorogold, fast blue) from the superior colliculus or, following ON transection, from the transected ON

stump. Adapted from Isenmann et al., (2003).

49

Figure 3.4 Graph shows the anatomic relations within the adult rat eye and the various methods of

perforation to approach and interfere with intraocular compartments. In addition, it schematically shows

the projection of the retina to the superior colliculus and the procedure of labeling and ON crush. The

intraocular distances and sizes of the different compartments are given in millimeters; the ON and its

connection are not drawn to size. Adapted from Fischer et al., (2000).

50

Chapter Four

Lentiviral-mediated transfer of ciliary neurotrophic

factor to Schwann cells in reconstituted peripheral

nerve grafts

4.1 Introduction As reviewed in Chapters 1, 2 and 3, neurons of the adult mammalian CNS exhibit poor

spontaneous regenerative growth after injury unless provided with an appropriate

microenvironment. Such an environment can be created by addition of exogenous trophic

factors (Xu et al., 1995; Ye and Houle, 1997) and/or by implantation of cellular substrates or

tissue bridges such as PN grafts (Bray et al., 1987). In the visual system and spinal cord of adult

rodents, damaged axons have been shown to regrow through autologous PN grafts or into

various types of Schwann cell (SC) implant (So and Aguayo, 1985; Harvey and Plant, 1995; Xu

et al., 1995; Cheng et al., 1996; Thanos, 1997; Plant and Harvey, 2000; Sauve et al., 2001).

The clinical use of multiple PN autografts after SCI has been reported (Cheng, 2000), however

this therapeutic approach may generally be impractical due to problems in obtaining sufficient

host material and the additional functional deficits that occur from harvesting autologous PNs.

To test an alternative to autologous PN grafts, in a previous experiment reconstituted allogeneic

PN sheaths reconstituted with autologous or congeneic SCs were transplanted onto the

transected ON (Cui et al., 2003b). The reconstituted grafts supported the regrowth of adult RGC

axons. However, compared to PN autografts the number of RGCs regenerating axons into the

chimeric PNs was relatively low. Further improvements are thus needed in order to achieve a

greater and more consistent level of regrowth.

RGCs express receptors to CNTF (Kirsch et al., 1997; Ju et al., 2000) and become increasingly

responsive to this cytokine as they mature (Meyer-Franke et al., 1995; Jo et al., 1999).

Intravitreal injections of CNTF, but not neurotrophins (BDNF, NT-4/5 or NT-3), significantly

increase long-distance axonal regeneration of adult RGCs into PN grafts (Cui et al., 1999; Cui

and Harvey, 2000; Cui et al., 2003a). Previous studies have successfully used viral vectors to

transfer BDNF, NT-3 or GDNF genes directly to injury sites, or into fibroblasts or PN

segments/glial cells that were later applied to injury sites (Ruitenberg et al., 2002; Ruitenberg et

al., 2003). In the present study, lentiviral vectors encoding CNTF (LV-CNTF) or green

fluorescent protein (LV-GFP) were used to transduce purified adult SCs ex vivo prior to PN

reconstruction (Fig 4.1, 4.2). It was examined whether long-term expression of CNTF around

axonal growth cones within the reconstituted PN grafts (Cui et al., 2003b) would increase long-

distance regeneration of adult RGC axons. The results showed that both the viability and axonal

regeneration of injured adult RGCs were significantly enhanced 4 weeks after LV-CNTF

51

intervention, associated with increased levels of CNTF in the chimeric PN grafts. These

reconstituted grafts were even more effective than autografts in promoting RGC axonal

regeneration. This approach thus provides a new and potentially important therapeutic

alternative for CNS or PNS repair that increases axonal regeneration and at the same time

reduces the need for obtaining autologous PN tissues from injured patients.

4.2 Materials and Methods

Adult (8-10 week old) Fischer 344 (F344) and Sprague Dawley (SD) rats were used in this study

SD rats were used as PN sheath donors. Cui et al (2003a) previously showed that allogenic PN

sheaths alone do not elicit an immunogenic reaction from the hosts (see also Gulati et al 1995)

and when repopulated with SCs they can support the regeneration of at least some adult RGC

axons (Cui et al., 2003b). Therefore, the allogeneic PN sheath approach was applied in the

present study to prove the principle that PNs from other sources such as cadavers can

potentially be used in a clinical context in the future. All surgical procedures were performed

under halothane anaesthesia (induction 5%, maintenance 2% in 1:3 O2/N2O mixtures). Rats

also received a subcutaneous injection of the analgesic buprenorphine (0.02mg/kg, Temgesic;

Reckitt & Colman, Hull, UK) and intramuscular injection of Benacillin (0.3mg/kg, Troy

Laboratories Pty. Ltd. Australia). Experiments conformed to NHMRC guidelines and were

approved by the Animal Ethics Committee of the University of Western Australia.

Figure 4.1 Diagram showing experimental protocol. PN sheaths were made from sciatic nerves of normal

SD rats. SCs were cultured from F344 rats, transduced with LV-GFP or LV-CNTF ex vivo, and then

injected into PN sheaths. These reconstructed PNs were grafted to the cut end of ONs, animals were kept

for 4 weeks. Flurogold (FG) was injected into the distal end of the grafts 3 days before sacrifice to

retrogradely label the regenerated RGCs.

52

Figure 4.2 Time course diagram showing experimental design.

Production of acellular PN sheaths Acellular PN conduits were prepared from the peroneal nerve (Fig. 4.3) of euthanized (ip,

Nembutal, sodium pentobarbitone, Rhone Merieux, Pinkenba, Australia) SD rats. Segments of

peroneal nerve (1.5 cm in length) were dissected out and immediately freeze-thawed 5 times to

kill endogenous cells (Gulati et al., 1995; Ide, 1996; Cui et al., 2003b). This procedure does not

significantly disrupt the basal lamina scaffold within the nerves (Cui et al., 2003b).

Figure 4.3 Diagram showing branches of left sciatic nerve. Provided by Grant Ferguson from School of

Animal Biology, University of Western Australia.

Adult Schwann cell cultures The preparation of adult SCs to a high purity (97%) has been described previously (Morrissey et

al., 1991; Cui et al., 2003b). Briefly, under aseptic conditions sciatic nerves of F334 rats were

divested of their epineurium and connective tissue and cut into 1 mm explants. These explants

were placed onto 100 mm culture dishes (Corning, New York) with Dulbecco’s Modified Eagle’s

medium (DMEM; Sigma, St Louis, MO) containing 10% fetal bovine serum (Sigma, St Louis,

MO, USA) (D-10S). After allowing fibroblasts to grow out for 3 weeks, explants were

enzymatically and mechanically dissociated before transferring to new poly-l-lysine (PLL,

Sigma) coated dishes with D-10S containing 20 μg/ml bovine pituitary extract (PEX) (GibcoBRL,

Grand Island, New York) and 2 μM forskolin (Sigma) for SC expansion (Morrissey et al., 1991).

When SCs reached confluence (4-5 × 106 per dish), they were rinsed in Ca2+ and Mg2+ free

53

Hanks balanced salt solution (Sigma) and briefly treated with trypsin-versene (CSL, Parkville,

VIC, Australia). Cells were washed in D-10S and passaged into new dishes of D-10S

supplemented with PEX and forskolin at a density of 2 × 106 cells per 10 cm dish. SCs purity

was routinely checked by immunostaining with antibodies to S100 (Dako, Glostrup, Denmark)

(for SCs) and Thy1.1 (Serotec, Oxford, UK) (to check for contaminating fibroblasts).

Production of lentiviral vectors Plasmids needed for production of lentiviral vectors (LV) were generously provided by Drs. L.

Tamagnone and L. Naldini (Institute for Cancer Research, University of Torino, Italy). For

construction of the LV-CNTF vector, the rat CNTF fragment (courtesy Dr P. Richardson) which

contains signal sequence required for the release of human growth hormone was amplified by

PCR, out of the plasmid HRC-5AS (gift of Dr. J. Henderson) using the following primers: 5’-

CGCGGATCCAATTCCGCAATGGCTACA-3’ containing a BamHI site and 5’-GGACTAGTCTA

CATCTGCTTATCTTTGGC-3’ containing a SpeI site at the 5’ site or the 3’site respectively (Fig.

4.4). Subsequently the CNTF fragment was ligated into the BamHI/SpeI digested multiple

cloning site of pRRLsin-PPThCMV-MCS-wpre. Stocks of LV-GFP and LV-CNTF were produced

by cotransfection of three plasmids, the viral core packaging construct pCMVdeltaR8.74, the

VSV-G envelope protein vector pMDG.2, and the transfer vector pRRLsin-PPThCMV-MCS-

wpre containing either GFP or CNTF fragment, into HEK 293T cells (Naldini et al., 1996a;

Follenzi and Naldini, 2002). 2.5-5 ×106 cells were seeded into 10 cm dishes (8 dishes for each

stock) in Iscove’s modified Dulbecco culture medium (IMDM; Sigma), containing 10% foetal calf

serum (FCS; Sigma), penicillin (100 IU/ml), 100 µg/ml streptomycin and 2 mM Glutamax

(Sigma). Culture medium was refreshed 2 hours before transfection. LV stocks were generated

from 3 plasmids by transient transfection of 293T cells as described (Naldini et al., 1996a). Cells

were transfected with 3.5 µg envelope plasmid, 6.5 µg packaging plasmid and 10 µg GFP- or

CNTF-expressing gene transfer plasmid per 10 cm dish. After 16-18 hours, medium was

replaced with the same IMDM as above, containing 2% FCS. After another 24 hours, viral

particle containing medium was harvested and cellular debris was removed by low-speed

centrifugation and filtration through a 0.22 µm cellulose acetate filter. If needed, the viral

particles were concentrated by ultracentrifugation at 28000 rpm. After the supernatant was

discarded, the pellet containing the LV particles was resuspended in phosphate buffered saline

(PBS), aliquoted and stored at –80oC until further use.

54

Figure 4.4 Schematic drawing of the vectors. Vectors carry an internal cassette containing the release

signal sequence of human growth hormone/rat CNTF or enhanced green fluorescent protein (eGFP)

sequence under control of the human cytomegalovirus (hCMV) promoter. The following viral cis-acting

sequences are labelled: LTR regions (U3, R, U5); major splice donor site (SD); encapsidation signal (Ψ)

including the 5' portion of the gag gene (GA); Rev-response element (RRE); splice acceptor sites (SA);

and the post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE).

For LV-GFP stocks, the number of transducing particles was determined by infecting HEK 293T

cells and counting the number of GFP-expressing cells after 48 hours. Titres were expressed as

transducing units (TU) per ml and concentrated stocks ranged in the order from 108 to 109

TU/ml. For CNTF-expressing viral stocks, viral particle content was determined by p24 antigen

measurement (ELISA; NEN-050, Perkin Elmer Life Sciences) and the relative TU/ml was

calculated by normalizing against the p24 content of a LV-GFP stock.

Transduction of Schwann cells with lentiviral vectors When SCs reached 70-80% confluence, replication-deficient LV-GFP or LV-CNTF vectors were

added to the dish at a multiplicity of infection (MOI) of 1:50 for 24 hours. After washes,

transduced SCs were incubated for another 2 days to achieve high transgene expression before

being used in the reconstruction of PN bridges. Expression of reporter gene GFP was visible

directly under a fluorescence microscope and examined 24 and 48 hours after LV-GFP

transduction. Immunoreaction with anti-CNTF antibody was carried out to reveal CNTF-positive

SCs 48 hours after transduction. Briefly, SCs was permeabilised for 30 minutes in PBS with

0.1% Triton X-100 (Progen Industures, Queensland, Australia) and 5% horse serum (Invitrogen)

followed by incubation overnight at 4°C with goat anti-rat CNTF antibody (1:100; R&D Systems,

Minneapolis, USA) which was diluted in PBS with 0.1% Triton X-100 and 5% horse serum.

After washes, cells were incubated with donkey anti-goat Cy3 conjugated secondary antibody

(1:500; Jackson ImmunoResearch Laboratories, West Grove, USA) in PBS for 60 minutes. Goat

IgG control immunoglobulin or omission of primary antibody was used as negative control.

55

Reverse transcription PCR (RT-PCR) analysis To test for continued CNTF transgene expression in SCs, RT-PCR was used to examine the

level of CNTF mRNA in LV-GFP and LV-CNTF manipulated SCs in vitro and in PN grafts 4

weeks after in vivo transplantation. To obtain the PN grafts, the same surgical procedures as for

the regeneration study mentioned above were performed. 4 weeks after PN transplantation

animals were euthanased with Nembutal and the PN grafts were immediately dissected out and

placed in RNAlater (Ambion, Austin, USA). RNA was isolated from each PN using 1 ml RNAwiz

(Ambion, Austin, USA) and equal amounts of total RNA (1 µg) were reverse transcribed in 25 µl

volumes with M-MLV RT (Promega, Madison, USA) and random hexamers (Promega, Madison,

USA) according to manufacturer’s instructions. Aliquots of the cDNA solution were subjected to

PCR with primer pairs specific for the constitutively expressed mRNA of CNTF (289 bp) or

GAPDH (240 bp).

Primer sequences were as follows:

CNTF forward primer: 5’ CTCTGTAGCCGTTCTATCTG 3’;

CNTF reverse primer: 5’GAGTATGTATTGCCTGATGG 3’.

GAPDH forward primer: 5’CAGAACATCATCCCTGCATCCACT3’;

GAPDH reverse primer: 5’GTTGCTGTTGAAGTCACAGGAGAC 3’

Reactions were performed using 25 mM MgCl2, 0.5 µM primers for both CNTF and GAPDH in a

total volume of 50 µl. Cycling conditions were: 94oC 60s, 50oC 60s, 72oC 60s for 35 cycles.

Controls (with and without RT enzyme) were used to check for genomic DNA amplification.

CNTF Enzyme Linked Immuno Sorbant Assay (ELISA) CNTF levels in the conditioned media and protein extracts from transduced SCs in vitro and

engineered PN grafts 4 weeks after transplantation were determined using quantitative

sandwich ELISA. To obtain the PN grafts, animals were overdosed with Nembutal, and then PN

grafts were quickly dissected from the rats and snap-frozen in liquid nitrogen. The PNs were

stored at -80°C until use. Each PN was homogenized in ice-cold 10 mM phosphate buffer (pH

7.4) containing 30 mM NaCl, 0.1% Tween 20 (ICN, Ohio, USA), 0.1% bovine serum albumin

(BSA; Sigma), and protease inhibitors (Sigma). The suspensions were centrifuged at 15,000g

for 15 min at 4°C, after which the supernatant was collected. After reaction with the protein

assay agent (Bio-Rad, Richmond, CA, USA), protein concentration of each sample, revealed by

an absorbance shift in Coomassie Brilliant Blue G-250 when bound to arginine and aromatic

residues, was measured by a spectrophotometer (Beckman, Germany). 96-well microplates

(Costar, Cambridge, MA) were coated with 100 μl/well of monoclonal mouse anti-CNTF

antibody (2 μg/ml; R&D Systems, Minneapolis, USA) diluted in PBS buffer overnight at 4°C.

The plates were then incubated overnight at room temperature with blocking solution (1% BSA,

5% sucrose and 0.05% NaN3 in PBS). With interceding washes (0.05% Tween 20 in PBS, pH

7.4), the plates were subject to sequential 2 hour incubations at room temperature with aliquots

of conditioned medium, cell lysis and protein extracts from PNs, or rat recombinant CNTF

(rrCNTF; 0-0.003125 μg/ml; Peprotech, Rehovot, Israel), biotinylated polyclonal goat anti-CNTF

antibody (300 μg/ml; R&D Systems, Minneapolis, USA), and ABC Reagent (Vectastain; Vector

Laboratories, Burlingame, USA). Horseradish peroxidase activity was detected using 3,3’,5,5’-

56

tetramethylbenzidine (MP Biomedicals, Irvine, USA) as the color substrate. After 30 min

incubation, the colour reaction was stopped by adding 50 μl of 1 M H2SO4. Absorbance at 450

nm was measured using an ELISA reader (Bio-Rad). Using serial dilutions of known amounts of

rrCNTF, this colour reaction yielded a nonlinear standard curve from 0.0048 to 0.3125 ng.

Nonlinear regression was performed using GraphPad Prism version 4.03 for Windows

(GraphPad Software, San Diego, USA). CNTF levels in the samples were quantified within the

nonlinear range of the standard curve and normalized for the total volume that was assayed in

each PN. Detection limit was 48 pg/ml.

CNTF bioactivity assay To determine whether CNTF produced by the LV-CNTF is biologically active, conditioned

medium from LV-GFP and LV-CNTF transduced SCs was collected, aliquoted and stored

immediately in -80ºC until use for bioactivity assay. Embryonic day 15 (E15) dorsal root ganglia

(DRG) were obtained from timed pregnant female rats. Pregnant rats were euthanized with a

intraperitoneal overdose of Nembutal and the entire litter was rapidly removed by caesarean

section and transferred to ice-cooled L-15 medium. The DRGs were aseptically dissected out

from the rat embryos and pooled in ice-cooled L-15 medium. Isolated embryonic DRGs were

subsequently transferred to collagen I-coated Aclar hats as previously described (Plant et al.,

2002) and allowed to adhere. Medium from SCs transduced with LV-CNTF or LV-GFP was

added to the hats. The medium consisted of DMEM/F-12 (50:50% mixtures), 10% serum. The

medium on the DRG was replenished every day from new stocks that were thawed quickly.

DRGs were grown for 3 days in a CO2 incubator (5%) at 37ºC and then fixed in 4%

paraformaldehyde. Double immunohistochemical labeling was performed to identify SCs using

rabbit polyclonal S-100 antibody and outgrowing neurites using a monoclonal pan-neurofilament

antibody (identifies 68, 160 and 200 kD) respectively. Cell nuclei were labeled with Hoechst

33342 (Sigma) contained in the Citifluor mounting medium. Two pregnant mother rats were

used as E15 DRG donors for bioactivity assay to confirm the CNTF produced was biologically

active. Three collagen I-coated hats per treatment (control or CNTF) were done in each

embryonic preparation.

Cellular reconstitution of freeze-thawed nerves Prior to the injection of LV transduced adult SCs into freeze-thawed PN sheaths, the acellular

PN segments were placed onto a dish containing a confluent culture of appropriate cells (i.e.

adult SCs transduced with the same viral vectors). 105 SCs (5×104 in 1 µl of medium) were then

slowly injected into each end of the PN via a glass micropipette attached to a 50 µl Hamilton

syringe (Cui et al., 2003b). Placement of the cell-injected PN sheaths on confluent or near-

confluent beds of the same cells allowed for further cellular infiltration of the PN sheaths (Gulati

et al., 1995). PN pieces were maintained in culture in D-10S containing PEX (20 μg/ml;

GibcoBRL, Grand Island, New York) and forskolin (2 μM; Sigma) for 24 hours before grafting.

57

Optic nerve surgery SC repopulated PNs were grafted onto the cut left ON of F344 rats. All of these rats were

anesthetized with halothane (see earlier). The ON was exposed intraorbitally after removal of

some of the extraocular muscles and was completely transected approximately 1.5 mm behind

the optic disc. Care was taken to avoid damaging orbital blood vessels and the internal

ophthalmic artery lying beneath the ON. A reconstituted PN graft was sutured using a 10/0

suture (Ethilon; Johnson & Johnson, North Ryde, NSW, Australia) onto the proximal stump of

the axotomized ON immediately after transection (Cui et al., 1999; Cui and Harvey, 2000). The

distal part of the PN was placed over the skull, the free end tied with 6/0 suture (Ethilon) and

secured to connective tissue. Animals with any kind of postoperative complications (e.g., blood

vessel damage, cataract) were excluded from analysis.

Experimental groups Transplanted animals were divided into 2 experimental groups for RGC survival and axonal

regeneration studies. The first group (n=13) received PN grafts reconstituted with LV-GFP

transduced SCs. The second group (n=12) received PN grafts reconstituted with LV-CNTF

transduced SCs. Additional rats under the same experimental conditions (receiving PN

reconstituted with LV-GFP or LV-CNTF transduced SCs) were used for (i) immunostaining of

CNTF (n=9) to examine CNTF expression in the PN grafts 4 weeks after transplantation, (ii) RT-

PCR and ELISA (n=10) to measure CNTF production in the PN grafts, and (iii) electron

microscopy (n=6) to investigate the ultrastructure of the regrowing axons in the reconstructed

PN grafts.

Retrograde labeling of regenerating RGCs In adult hamster, the fastest regenerating RGC axons grow in PN grafts at a rate of about 2

mm/day after an initial delay period of 4.5 days (Cho and So, 1987). The number of

regenerating RGCs reaches a peak level at 3-4 weeks post PN grafts (Villegas-Perez et al.,

1988; Ng et al., 1995). Therefore the number of adult axotomized RGCs regrowing axons into

PN grafts was counted 4 weeks after the surgery. This time point has been used in several

previous studies, therefore it is possible to compare between studies. To retrogradely label

regenerating RGC axons, animals were anesthetized with halothane (see earlier), the graft lying

on the skull was exposed and 0.2 μl of 4% FG (Fluorochrome, Denver, CO) was slowly injected

into the distal end of the graft. It was important to inject only a small volume of FG in order to

avoid diffusion of dye towards the optic disc and consequent staining of viable, but non-

regenerating, RGCs. Cryostat sections of FG-injected PN grafts confirmed consistent FG

labelling in the distal end of the PN bridges with limited diffusion along the nerve. Animals were

left for 3 days to maximize retrograde transport of the dye. They were then deeply

anaesthetized (0.2ml ip, Nembutal;, sodium pentobarbitone, Rhone Merieux, Pinkenba,

Australia) and perfused with 4% paraformaldehyde in 0.1 M phosphate buffer (PBS). Retinas

and PN grafts were dissected out and post-fixed in the same fixative for one and two hours

respectively. After a final wash in PBS, retinas were cut with fine iris scissors at four points from

the edge to the center and flat-mounted in Citifluor with RGC layer facing up on glass slides.

58

Retinas were then coverslipped, sealed with nail varnish and the total number of FG-labeled

RGCs was counted. To determine the total number of FG-labelled RGCs, the outline of each

retina was drawn on a computer screen using a MD2 microscope digitizer (Accustage,

Minnesota, USA) and a grid was randomly placed over the drawing. A cursor was placed on

each grid intersection and the number of FG-labeled RGCs was counted at that point. Each

sample field was 0.235 mm × 0.235 mm and 60-80 fields were sampled per retina.

Immunohistochemical staining and counting of viable RGCs After FG counts were made, retinas were immunostained with the βIII-tubulin antibody (TUJ1;

Cat#MMS-435P, Covance). βIII-tubulin immunostaining has been shown to be an efficient and

reliable method to label surviving RGCs in retinal wholemounts or sections after ON injury (Cui

et al., 2003a; Yin et al., 2003; Koprivica et al., 2005; Ahmed et al., 2006; Leaver et al., 2006c).

For immunostaining, retinas were blocked in 10% normal goat serum (NGS, Hunter Antisera,

NSW, Australia) and 0.2 % Triton X-100 (Progen Industries, Queensland, Australia) for 1 hour,

then incubated in the same medium with βIII-tubulin antibody (1:500; Covance, Research

Products, Denver, PA) overnight at 4°C. After further washes, retinas were incubated with Cy3-

conjugated goat anti-mouse secondary antibody (Jackson Laboratories, Bar Harbor, USA)

overnight at 4°C. The same sampling procedures described in FG counting were used to

determine the total number of βIII-tubulin positive cells.

Cryosectioning and immunostaining of PN grafts Four weeks after transplantation, PN grafts were detached from the back of the operated eye

and were cryo-protected in a 30% sucrose solution overnight. Frozen cryostat sections (16 µm

thickness) were cut longitudinally and collected on gelatine coated slides. One rat that received

an LV-GFP manipulated PN was allowed to survive for 12 weeks in an attempt to see whether

long-term transgene expression could be achieved in this model. Parallel series of sections

were taken, collecting every fifth section from the PNs, such that each slide contained a series

of longitudinal sections across the whole nerve. GFP expression was examined directly under a

fluorescence microscope. To identify CNTF-positive and regenerating axons in the reconstituted

PN grafts, immunohistochemistry of CNTF (same as staining for transduced SCs), pan-

neurofilament (Zymed, San Francisco, USA) (recognizing 68, 160 and 200 kD neurofilament

proteins present in the perikarya and axons of neurons throughout the CNS and PNS axons),

calcitonin gene-related peptide (CGRP) (Biogenesis, UK) (for sensory axons) and S-100 (Dako)

(for SCs) was carried out on the cryosections. Frozen sections were washed in PBS and

blocked for 1 hour in the antibody diluent containing 10% NGS and 0.2% Triton X-100 (Progen

Industries, Queensland, Australia) in PBS. Sections were incubated overnight at 4°C for pan-

neurofilament (1:400; Zymed, San Francisco, USA) and S-100 antibodies (1:200; Dako,

Glostrup, Denmark), or overnight at room temperature for CGRP antibody (1:1000; Biogenesis,

UK). Control IgG immunoglobulin or omission of primary antibody were used as negative

controls. After three washes in PBS, appropriate secondary fluorescent antibodies (Jackson

Laboratories) were then added for 1-4 hours at room temperature. All sections were mounted in

Citifluor.

59

Counts of axons that had regrown into PN grafts On average, 5-6 sections were stained for each nerve, and in each of these sections the

number of regenerating axons was counted at increments of 625 µm from the proximal to distal

ends of the PN graft. A linear eyepiece graticule was used as a marker and oriented orthogonal

to the long axis of the nerve; every 625 µm the number of immunostained axons that crossed

this marker was documented. The average number of axons per section was then determined

for each fixed increment along the graft. For each group these data were then averaged to give

an estimate of the number of regenerating axons per section at different distances along the PN

grafts as described previously (Gillon et al., 2003). Immunostaining and counting of pan-

neurofilament and CGRP positive axons were performed in different but similar serial sections.

Semithin and ultrathin microscopy To assess the viability of adult SCs in reconstructed PN grafts and to determine whether

regenerating RGC axons were myelinated by these cells, 3 PN grafts from each treatment

group were processed for semithin and electronic microscopic (EM) analysis (Cui et al., 2003b).

For comparison, lengths of intact normal peroneal nerve were also removed and processed for

EM analysis. (Semithin section and EM were performed by Dr. Michael Archer, School of

Animal Biology, the University of Western Australia)

Statistical analysis Statistical analysis was performed using GraphPad Prism version 5 and InStat version 3.06 for

Windows (GraphPad Software, San Diego, USA). Data that met the criteria for parametric tests

were analyzed using unpaired two-tailed Student t test. Groups of data that failed tests for

normality were analyzed using the Mann-Whitney test.

4.3 Results Successful and rapid transduction of Schwann cells in vitro The LV vector used in this study was highly efficient in transducing SCs. The reporter GFP gene

was expressed rapidly by transduced SCs; the proportion of GFP expressing SCs increased

from less than 20% at 24 hours to over 90% at 48 hours after transduction in vitro (Fig. 4.5 A,

B). In contrast, about 30% of the SCs were CNTF-positive 48 hours after LV-CNTF transduction

(Fig. 4.5 C, D). The discrepancy in transduction efficacy between these 2 types of LVs may be

due to lack of sensitivity of the CNTF immunofluorescence procedure and/or due to different

transduction efficacy of each stock. In addition, most of the CNTF is released from the cells thus

immunostaining will only stain the small fraction that remains in the cytoplasm (Fig. 4.7 A). It is

also possible that CNTF degrades quickly, further reducing the levels detected within the cells.

CNTF released from LV-CNTF transduced Schwann cells is biologically active Compared with conditioned medium from LV-GFP transduced SC cultures, conditioned medium

from LV-CNTF transduced SC cultures promoted neurite outgrowth of embryonic DRG explants.

Three days after conditioned medium treatment, immunostaining with pan-neurofilament

60

antibody revealed a clear increase in the number of outgrowing neurites in all 3 embryonic

DRGs after treatment with supernatant from LV-CNTF transduced SCs compared with LV-GFP

supernatant (Fig. 4.5 E, F). Owing to the large number of the outgrowing and often overlapping

neurites after LV-CNTF supernatant treatment, we were unable to count the numbers of

neurites and quantitatively analyse the clear difference in the number of outgrowing neurites

between the 2 groups.

The results thus confirmed that the CNTF produced and released by LV-CNTF transduced SCs

did have biological activity. Interestingly, as revealed by immunoreaction with S-100 antibody

and Hoechst 33342 staining, the LV-CNTF supernatant treatment also clearly increased SC

migration out of the DRG explants. The cellular migration distances of Hoechst 33342 labelled

cells were significantly different at p<0.01 level (two-tailed student t test), with the average

migration area being 5.66±1.14 mm2 in LV-GFP group and 10.88±1.017 mm2 in LV-CNTF group

(±standard deviation).

Enhanced CNTF mRNA expression after LV-CNTF transduction in vitro and in vivo RT-PCR analysis of CNTF mRNA expression levels was carried out in LV-GFP and LV-CNTF

transduced SCs and in engineered PN grafts 4 weeks after transplantation. An increase in the

level of CNTF mRNA expression was clearly seen in SCs 2 days after transduction in vitro (Fig.

4.6 A) and in PN grafts 4 weeks after in vivo transplantation (Fig. 4.6 B), indicating successful

incorporation of the CNTF gene into adult SCs and prolonged expression of the transgenic

mRNA after in vivo transplantation. Lower levels of CNTF were seen in LV-GFP transduced

SCs 48 hours in culture or in PNs repopulated with LV-GFP transduced SCs 4 weeks after

transplantation.

61

Figure 4.5 Direct fluorescence images of reporter gene GFP expression in adult SCs 24 (A) and 48 (B)

hours after LV-GFP transduction: over 90% of SCs were expressing GFP 48 hours after transduction.

Immunostaining with anti-CNTF antibody of normal adult SCs (C) and adult SCs 48 hours after LV-

CNTF transduction (D): no detectable CNTF-positive SCs were seen in normal SCs but about 30% of

CNTF-positive SCs (red in D) were seen 48 hours after LV-CNTF transduction. Bioactivity assay of

supernatants from LV-GFP (E) and LV-CNTF (F) transduced SCs on E15 DRG: significantly more

neurite outgrowth and cellular migration were seen after LV-CNTF supernatant treatment. Green, pan-

neurofilament positive neurites; red, S-100 positive SCs; blue, Hoechst 33342 labeled nuclei. Scale bars,

100 µm in A-D and 200 µm in E and F.

62

Figure 4.6 RT-PCR of CNTF mRNA from transduced SCs 2 days after in vitro transduction (A) and

from engineered PN grafts 4 weeks after in vivo transplantation (B). Low level of CNTF mRNA

expression was detected in control SCs 2 days after transduction in vitro or in PNs 4 weeks after in vivo

transplantation. Significantly higher levels of CNTF mRNA were seen in SCs in vitro or PNs in vivo after

LV-CNTF treatment at corresponding times. +, with reverse transcription polymerase; -, without reverse

transcription polymerase.

Increased CNTF production as revealed by ELISA analysis ELISA analysis of CNTF product in transduced SCs in vitro and engineered PN grafts 4 weeks

after in vivo transplantation revealed a consistent increase in CNTF protein after LV-CNTF

treatment. Significant increases in CNTF level was seen in both supernatant and cultured SCs

48 hours after LV-CNTF transduction (Fig. 4.7 A). It is known that SCs produce various

neurotrophic factors including CNTF, but the natural form of CNTF is usually cytosolic and

apparently not readily released from cells. Thus, as expected, the level of CNTF in the

supernatant of LV-GFP transduced SCs was undetectable. However, the level of endogenous

CNTF in these SCs was generally very low. Of the 6 ELISA tests on LV-GFP transduced SCs,

no detectable CNTF was seen in 5 tests, but an outlier occurred in the other run that yielded an

unexpected high level of CNTF at 10 ng per 106 LV-GFP transduced SCs, thus resulting in an

average level of cytosolic CNTF of 1.7 ng per 106 LV-GFP transduced SCs.

CNTF produced after LV-CNTF transduction contained the human growth hormone release

sequence, and could thus be released from the transduced SCs. Consistent with this, 1×106

SCs transduced with LV-CNTF secreted an average of 94 ng of CNTF in 48 hours into the

culture medium (filled columns in Fig. 4.7 A). LV-CNTF transduced SCs also contained on

63

average, 22 ng of cytosolic CNTF per 1×106 cells; thus while the level of CNTF secretion was

very high from these transduced cells, there were still relatively large amounts of CNTF in the

cytoplasm compared to the LV-GFP transduced cell population.

In vivo, 4 weeks after transplantation, a significant difference (p<0.05) in CNTF content was

detected between the 2 types of transduced PN grafts. This CNTF was presumably mostly

cytosolic in origin. The average CNTF content per mg of total protein was 5.7 ng in LV-CNTF

engineered PN grafts, while the content was 1.8 ng/mg in LV-GFP engineered PN grafts (Fig.

4.7 B). Measurement of total CNTF content in each LV-CNTF transduced PN graft revealed an

average level of 1.785 ng of CNTF per graft. Based on our in vitro data, the levels of secreted

CNTF were likely to be at least 4-5 times this amount.

64

Figure 4.7 ELISA of CNTF from conditioned media and SCs in vitro (A) and engineered PN grafts 4

weeks after in vivo transplantation (B). In the in vitro condition, no detectable CNTF was seen in the

supernatant from LV-GFP transduced SCs and was seen at a very low level within LV-GFP transduced

SCs. Significantly more CNTF was seen after LV-CNTF treatment in both supernatant and SCs in vitro

and PN grafts in vivo compared with LV-GFP treatment. *p<0.05, **p<0.01; two-tailed student t test.

Error bars, SEM.

65

Figure 4.8 Photomontages of PN grafts reconstituted with LV-GFP 7 days in vitro (A) and LV-CNTF

transduced SCs 4 weeks after in vivo transplantation (B). PN sections from LV-CNTF engineered animals

were immunoreacted with anti-CNTF antibodies to show CNTF positive SCs (red) while GFP expressing

SCs were directly visible using fluorescence. Transduced SCs were observed to be viable and disperse

along the entire length of the PN segments. Higher power images of a PN graft reconstituted with LV-

GFP transduced SCs showing GFP (C) and S-100 (D) positive adult SCs 4 weeks after transplantation. E,

merged image of C and D. F, higher power image of a PN graft reconstituted with LV-CNTF transduced

SCs showing CNTF positive adult SCs 4 weeks after transplantation. G, long-term (12 weeks) transgene

(GFP) expression. FG-labeled regenerating (H) and TUJ1-positive viable (I) RGCs in an animal that

received an LV-GFP manipulated PN graft (H and I, same field). J and K (same field), FG-labeled

regenerating (J) and TUJ1-positive viable (K) RGCs in an animal that received an LV-CNTF manipulated

PN graft. Scale bars, 400 µm in A and B and 100 µm in C-J.

66

Immunostaining of reconstituted PNs reveals long-term Schwann cell viability One week after injection of SCs into PN sheaths in vitro (Fig. 4.8 A), or 4 weeks after PN

transplantation in vivo (Fig. 4.8 B), GFP expressing and CNTF immunopositive SCs were seen

to be dispersed along the entire length of the PN grafts, indicating the presence of many viable

SCs. The majority of these cells congregated towards the middle of the grafts, forming a

longitudinal core of cells along the axis of the PN implants. This is consistent with a previous

study (Cui et al., 2003b). Importantly, 4 weeks after PN transplantation, large numbers of

transduced S-100 positive SCs continued to express high levels of GFP (Fig. 4.8 C-E) or CNTF

(Fig. 4.8 F). In addition, in the PN graft from the long-term survival rat, expression of reporter

gene GFP was still visible (Fig. 4.8 G), indicating the possibility of prolonged transgene

expression in this model.

Increased RGC survival after LV-CNTF treatment Examples of TUJ1 immunopositive RGCs after LV-GFP or LV-CNTF treatment are shown in

Figures 4.8I and 4.8K. There was a significantly higher number of surviving RGCs in the LV-

CNTF PN grafted animals in comparison to LV-GFP animals (10262±1085/retina, n=12

compared to 6217±626/retina, n=13; p=0.003, two-tailed Student t test) (Fig. 4.9).

Increased number of RGCs regenerating an axon after LV-CNTF treatment Examples of FG retrogradely labelled axon-regenerating RGCs after LV-GFP or LV-CNTF

treatment are shown in Figures 4.8H and 4.8J. There was approximately an eight-fold increase

in the mean number of RGCs regenerating into the graft after LV-CNTF intervention

(2555±1079/retina, n=12) compared with LV-GFP intervention (290±164/retina, n=10) (Fig. 5.8).

As we previously found an average 299 RGCs/retina regenerating axons into congeneic PN

sheaths repopulated with congeneic SCs without genetic manipulation (Cui et al., 2003b), it is

unlikely that the expression of a high level of GFP in the PNs would exert a toxic effect in this

condition. The difference between the two LV groups was highly significant (p=0.0002, Mann-

Whitney test). In the best case, one of LV-CNTF treated animals had very high numbers of both

surviving (18753) and regenerating (13748) RGCs; in this animal, over 70% of viable RGCs

regenerated an axon into this PN graft. Examination of this PN graft also revealed a large

number of pan-neurofilament positive regrowing axons in the graft (see below).

In summary, both RGC survival and axonal regeneration were increased after transplantation of

LV-CNTF engineered PN grafts. When compared to LV-GFP grafted PNs, the relative influence

of LV-CNTF on RGC survival (65% increase) was less than the effect on axonal regeneration

(781% increase). Only 4.7% of viable adult RGCs were FG-labeled in the LV-GFP group

compared with 24.9% in the LV-CNTF group, suggesting that the major therapeutic effect of

sustained supply of CNTF in the PN grafts was in the promotion of long-distance axonal

regeneration.

67

0100020003000400050006000700080009000

100001100012000

LV-GFP n=13

LV-CNTF n=12

**

***

SurvivalRegeneration

Ave

rage

num

ber

of R

GC

s/ R

etin

a

Figure 4.9 The average number and SEM of TUJ1-positive surviving and FG-labeled regenerating RGCs

after genetic manipulation of the reconstituted PN grafts using LV-GFP and LV-CNTF. Significantly

higher numbers of both surviving and regenerating RGCs were seen in LV-CNTF manipulated animals

(**p<0.01, two-tailed Student t test; ***p<0.001, Mann-Whitney test).

Immunohistochemical analysis confirmed axonal regrowth in reconstructed PN grafts Consistent with the FG-labeled RGC counts obtained from the retinal wholemounts,

immunohistochemical staining of longitudinal PN sections with pan-neurofilament antibodies

revealed numerous regenerating axons in all LV-CNTF treated PN grafts. In the animal with an

especially high number of FG-labeled regenerating RGCs after LV-CNTF treatment, a large

number of regrowing axons was present along the whole length of the PN graft, although

substantially more axons were seen in proximal parts of the graft close to the ON-PN interface

(Fig. 4.10 A, B). There were consistently higher average numbers of regenerating axons in LV-

CNTF treated PN grafts compared to LV-GFP treated PN grafts along the length of the

reconstructed PN grafts (Fig. 4.10 C). There was thus a clear beneficial effect of enhanced

CNTF expression on sustained axonal regrowth in PN tissue. Interestingly, in both groups there

were similar numbers of regenerating axons at the most proximal end (axon entry site) of the

PN grafts, but in the LV-GFP treated group there was a greater decrease in axonal numbers

with increasing distance along the grafts (Fig. 4.10 C). A comparable fall-off in axonal number at

the distal end of PN grafts has also been described in blind-ended PN autografts (David and

Aguayo, 1981; Golka et al., 2001) and in immunosuppressed allografts (Gillon et al., 2003). It

remains to be seen whether this fall-off in axonal numbers after ON-PN transplantation is seen

in grafts that are inserted into retinorecipient target sites in the brain (Bray et al., 1987; Thanos,

1997; Sauve et al., 2001).

Part of the sections was further immunostained with CGRP. Immunohistochemical staining of

CGRP was performed in an adjacent series of sections to those stained for pan-neurofilament,

and axon numbers were counted separately. A higher proportion of CGRP immunopositive

68

sensory axons in pan-neurofilament stained regenerating axons was revealed in LV-GFP

treated compared with LV-CNTF treated group (Fig 4.11). This will be discussed further in

Chapter 5.

1000 2000 3000 4000 5000 6000 70000

10

20

30

LV-CNTF n=12LV-GFP n=13

C. Pan-neurofilament

Distance from proximal end(in 625 μm increments)

No.

of r

egen

erat

ing

axon

spe

r sec

tion

per m

m

Figure 4.10 Pan-neurofilament staining showing regenerating RGC axons in the proximal (A) and distal

(B) parts of a PN graft repopulated with LV-CNTF transduced SCs. Numerous axons were seen

throughout the whole length of the PN graft. Arrowhead points to a suture that was used to connect the

PN graft with the ON stump. P, proximal to the ON stump; D, distal to ON stump. Scale bar, 50μm. C,

immunohistochemical data from LV-GFP and LV-CNTF engineered PN grafts 4 weeks after

transplantation. The average number of pan-neurofilament positive axons across the PN is plotted against

incremental distance from PN-ON interface. While the numbers of regenerating axons were similar at the

entry zone between the two groups, they decreased gradually towards the distal part of the PN grafts in

both conditions.

69

LV-GFP

0 1000 2000 3000 4000 5000 6000 70000

10

20

30

40

50

60

70

Pan-Neurofilament n=6CGRP n=6

(A)

Distance from proximal end(in 625 um increments)N

o. o

f reg

ener

atin

g ax

ons

/sec

tion

/mm

LV-CNTF

0 1000 2000 3000 4000 5000 60000

10

20

30

40

50

60

70Pan-Neurofilament n=3CGRP n=3

(B)

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s /s

ectio

n /m

m

Figure 4.11 The number of pan-neurofilament and CGRP

positive regenerating axons were counted at various distances

along the LV-GFP (A) or LV-CNTF (B) SCs reconstructed PN

grafts. The average percentage of CGRP positive to pan-

neurofilament positive axons in the different types of

reconstructed PN grafts (C). *p<0.05 compared with LV-GFP

group; unpaired Welch corrected t test.

Electron microscopy of adult SC repopulated PN grafts Examination of semithin and ultrathin transverse sections of adult SC-repopulated PN 4 weeks

after PN-ON transplantation revealed that, in accordance with immunohistochemical

observations, regenerating axons were usually located toward the center of the grafts and often

formed close-packed axon fascicles (Fig. 4.12 A, B). No attempt was made to quantify the

number of regenerating axons in this material. Consistent with our previous study (Cui et al.,

2003b), SCs were found in large numbers and had a normal ultrastructural appearance (Fig.

4.12 C), indicative of their continued viability 4 weeks after injection into PN sheaths and

transplantation to host ON. SCs myelinated regenerating RGC axons (Fig. 4.12 C). The myelin

was densely packed, typical of normal PN myelination. Some of the axons were small and

unmyelinated, often grouped together in fascicles, and sometimes clearly associated with a

single SC (Fig. 4.12C). As described previously (Cui et al., 2003b), a consistent and intriguing

difference between normal and reconstructed PN was the presence of substantially higher

amounts of collagen in the extracellular space of the reconstituted nerves (Fig. 4.12 C).

Recombinant CNTF enhances myelin formation by oligodendrocytes in culture (Stankoff et al.,

2002) and in the injured PNS the cytokine accelerates SC myelination of regenerating axons

(Sahenk et al., 1994; Zhang et al., 2004). It was therefore surprising that at 4 weeks after

transplantation, no qualitative differences in axon myelination were seen between the LV-CNTF

and LV-GFP treated PN grafts. Perhaps the myelination of adult RGC axons by SCs in the

reconstructed PN grafts is slow and is not complete at this time, therefore, longer survival times

might reveal a difference between these two groups.

GFP CNTF0.0

0.5

1.0

*

(C)

Rat

io C

GR

P/PA

N

70

Figure 4.12 Representative semithin (A), ultrathin (B) and electron microscopic (C) images of LV-CNTF

transduced SCs-reconstituted PNs 4 weeks after transplantation. Repopulating SCs (sc in C) survived and

were of healthy appearance. Numerous myelinated (arrows in B and C) and unmyelinated (asterisks in C)

regenerating RGC axons, which were often in clusters (arrowhead in B), were observed in the

reconstituted PN grafts. Dense myelin sheaths wrapping regenerating axons were seen throughout the

transverse sections (arrows in B and C). Sometimes axon myelination in progress was evident as the

axons were only partially wrapped by myelin sheath (white arrowhead in C). Basal lamina formation

(black arrowheads in C) and a substantial amount of collagen deposition were also visible (c in C). Scale

bars, 100 μm (A), 10 μm (B) and 2 μm (C).

71

4.4 Discussion As reviewed in Chapter 2, neural regeneration in acellular PN allografts is slow and this type of

graft is not suitable for supporting long distance CNS regeneration (Berry et al., 1988; Cui et al.,

2003b). Viable SCs are essential for the regrowth of axons in PN autografts (Bray et al., 1987;

Berry et al., 1988; Smith and Stevenson, 1988; Bunge et al., 1999). SCs promote axonal

regeneration in both CNS and PNS due to their capacity to provide growing axons with a variety

of adhesion molecules and neurotrophic factors (Berry et al., 1988; Fawcett and Keynes, 1990;

Dezawa and Adachi-Usami, 2000). Therefore, one approach to improve the properties of

acellular grafts is to repopulate them with autologous or congeneic SCs (Gulati et al., 1995).

Using in vitro expanded populations of SCs, Cui et al. (2003b) developed a way of

reconstructing PN segments that was shown to support long distance axonal regeneration of

RGCs after transplantation). Although the number of regenerating RGCs in rats with adult SC-

repopulated grafts was generally less than that seen with PN autografts, intraocular injections of

recombinant CNTF significantly increased the amount of regeneration in these reconstructed

PN grafts (Cui et al., 2003b).

To further improve the chimeric PN graft procedure, in the present study a gene therapy

approach was used to introduce a gene expressing a secretable form of CNTF into SCs prior to

reconstitution of the grafts. In the chimeric PN constructs there was therefore enhanced CNTF

production. We examined whether this new type of engineered bridge could further promote

survival and axonal regeneration of injured RGCs. The results showed that LV was efficient in

ex vivo transduction of adult SCs, and that the CNTF produced and secreted by these

transduced SCs was biologically active. A sustained supply of CNTF by genetically modified

SCs in reconstituted PN segments can be achieved over an extended period after

transplantation to the cut ON. Importantly, these reconstituted PN segments containing LV-

CNTF transduced SCs promoted both the survival and especially the long-distance axonal

regeneration of injured adult RGCs. Transduced SCs expressed the transgene for at least 12

weeks, and enhanced RGC survival and axonal regeneration were correlated with increased

CNTF production in PN grafts.

CNTF has previously been shown to be effective in promoting the survival and regrowth of adult

RGC axons into PN grafts, when injected intraocularly as a recombinant protein (Cui et al.,

1999; Cui and Harvey, 2000; Cui et al., 2003a). It is demonstrated here for the first time that

supply of CNTF in the PN bridges themselves can also exert beneficial biological actions on

adult CNS neurons, and with similar or even greater efficiency. After multiple intraocular CNTF

injections in rats with PN autografts, it was previously shown that there were, on average,

15,574 surviving RGCs, of which 23.6% (3678) were retrogradely labeled with FG and had

regenerated an axon to the distal end of the graft (Cui et al., 2003a). In a previous chimeric PN

study (Cui et al., 2003b), using unmodified adult SCs in reconstituted PNs, even after intraocular

CNTF injections, there was an average of only 999 regenerating RGCs per grafted animal. In

72

the present study, using LV-CNTF transduced SCs, a mean of 10262 surviving RGCs was

achieved, of which 24.9% (2555) regenerated an axon, an impressive outcome.

There is some evidence that CNTF can act via retrograde signalling transport to achieve its

biological function in facial motoneurons (Kirsch et al., 2003) and in peripheral nerves (Curtis et

al., 1993). RGCs express CNTFRα (Kirsch et al., 1997; Ju et al., 2000) and expression of this

receptor in the retina is transiently increased after ON injury (Ju et al., 2000). It is thus possible

that the observed enhancement of RGC survival and increased axonal regeneration was

achieved by CNTF retrograde signalling from the engineered SCs to RGC somas in the retina.

On the other hand, local environmental modulation of growth cone path-finding and elongation

by sustained supply of CNTF within the PN grafts may also have contributed to the observed

axonal regeneration. Importantly, similar numbers of axons were observed to grow into the

proximal ends of LV-GFP and LV-CNTF engineered PN grafts, indicating that the potential for

injured axons to enter the PN grafts is similar in both conditions. This, together with the vast

difference in the number of long distance regrowing axons in the two types of PN grafts (Fig.

4.10 C) suggests that CNTF exerts its primary effect on axon elongation rather than on local

sprouting at the proximal PN-ON interface. Issues concerning CGRP immunopositive axons

inside PN grafts (Fig. 4.11) will be discussed in Chapter 5.

Previous studies have used viral vectors to transfer growth factor genes directly into fresh PN

segments (Blits et al., 1999; Blits et al., 2000; Ruitenberg et al., 2002; Ruitenberg et al., 2003).

The present approach allows the specific ex vivo transduction of purified adult SCs and their

subsequent placement within cell-free PN sheaths. Unlike direct LV injection into PNs, our more

selective approach means that other PN cells such as endothelial cell, macrophage and

fibroblast are not transduced, thus reducing any potential immunogenic effects of the vector.

Potentially, SCs engineered with different genes can be mixed together to even further optimize

axonal regeneration in such reconstituted grafts. The use of this ex vivo transduction of purified

adult SCs with LV has advantages over PN autografts as 1) this approach results in prolonged

but potentially modifiable transgene expression after in vivo transplantation, and 2) it eliminates

the need to harvest the patients’ own PNs as bridging materials, a process that will by itself lead

to additional functional deficits. Remarkably, the extent of RGC axonal regeneration in the LV-

CNTF modified PN grafts (mean of 2555 FG labeled RGCs) is almost 2.5-fold higher than the

figure previously reported for PN autografts in the absence of any other interventions (mean of

1116 RGCs) (Cui et al., 2003a).

Finally, it is important to note that the LV vector was developed only 10 years ago (Naldini et al.,

1996a). It has the ability to integrate into the genome of non-dividing cells (Naldini et al., 1996b)

and has been demonstrated to offer the satisfactory combination of efficacy of gene transfer,

sustained transgene expression, and biosafety. However, insertional mutagenesis by vector

DNA has always been recognized as a potential hazard, and recent clinical trials have

highlighted this risk (Hacein-Bey-Abina et al., 2003a; Hacein-Bey-Abina et al., 2003b). A recent

paper also points out the importance in investigating the safety issues prior to any clinical trials,

73

a high incidence of LV vector associated tumorigenesis was found following in utero and

neonatal gene transfer in mice (Themis et al., 2005). Importantly, the same vector used in

present study was also tested, and shown to have no observable ontogenetic effect. Recent

development in integration-deficient (Yanez-Munoz et al., 2006) and controllable (Blesch et al.,

2001) LV vectors may represent the future directions of such viral vectors, and hasten their use

in clinical medicine.

4.5 Conclusion The present study demonstrated that genetically engineered, reconstituted PN grafts could

successfully bridge tissue defects and promote axonal regeneration. This novel technique could

provide a clinical alternative to using multiple PN autografts to promote regrowth in injured CNS.

It provides a basis for the development of new therapeutic alternatives for the treatment of

traumatic CNS injuries, alternatives that may also be of benefit in the field of plastic surgery and

PN repair.

74

Chapter Five

Lentiviral-mediated transfer of BDNF or GDNF to

Schwann cells in reconstructed peripheral nerve

grafts

5.1 Introduction As reviewed in Chapters 1&2, BDNF plays an important role in the survival, differentiation,

axonal extension and regeneration of various types of CNS neurons (Monteggia et al., 2004). In

the retina, BDNF is a potent survival neurotrophic factor for damaged RGCs (Mey and Thanos,

1993; Mansour-Robaey et al., 1994; Di Polo et al., 1998; Klocker et al., 2000; Pernet and Di

Polo, 2006). Its trophic effects on RGC survival and axonal regeneration have been tested in

different animals including rat (Isenmann et al., 1998), cat (Chen and Weber, 2001), and pig

(Bonnet et al., 2004); also in various injury models including ON transection (Mo et al., 2002),

crush (Huang et al., 2000; Chen and Weber, 2001) and glaucoma (Martin et al., 2003).

Similar to BDNF, GDNF plays an important role in neurodevelopment (Yan et al., 2003) and

neuronal survival (Blesch and Tuszynski, 2001; Dolbeare and Houle, 2003; Eslamboli et al.,

2003; Saito et al., 2003; Sakamoto et al., 2003; Tai et al., 2003; Wu et al., 2003b; Bohn, 2004;

Krieglstein, 2004; Lu et al., 2004a; Zhao et al., 2004b). RGCs in the retina express the GDNF

receptors GFRα-1 (Lindqvist et al., 2004) and Ret (Pachnis et al., 1993). GDNF can also be

retrogradely transported to RGCs (Yan et al., 1999). Many studies have demonstrated a

protective effect of GDNF on RGCs after injury (Klocker et al., 1997; Koeberle and Ball, 1998;

Yan et al., 1999; Koeberle and Ball, 2002; Schmeer et al., 2002; Straten et al., 2002; Lindqvist

et al., 2004; Ishikawa et al., 2005).

In this part of the study, we used the same strategy as described in Chapter 4, but used LV

vectors expressing BDNF (LV-BDNF) or GDNF (LV-GDNF). SCs were transduced with LV-

BDNF or LV-GDNF and used to cellularly reconstruct PN. These PNs were then grafted onto

the cut ON in adult rats and we examined their impact on RGC survival and axonal regeneration

compared with PN grafts containing LV-GFP or LV-CNTF transduced SCs. The in vivo results

showed that unlike the LV-CNTF studies, LV transduction of SCs with BDNF or GDNF did not

have beneficial effects on RGCs. Interestingly, PNs containing BDNF engineered SCs attracted

many peripheral sensory neural axons from the surrounding environment into the reconstructed

nerves.

5.2 Materials and Methods See Chapter 4 for methods of production of acellular PN sheaths, adult Schwann cell culture,

production of lentiviral vectors, bioactivity assay, cellular reconstitution of freeze-thawed nerves,

75

optic nerve surgery, retrograde labeling of regenerating RGCs, immunohistochemical staining of

viable RGCs, cryosectioning and immunostaining of PN grafts, counts of axons that had

regrown into PN grafts.

Adult (8-10 weeks old) female Fischer 344 (F344) and Sprague Dawley (SD) rats were used in

this study (source: Animal Resource Center, WA). SD rats were used as PN sheath donors.

Animals were anesthetized with intraperitoneal injections of 1 ml/kg body weight of an equal

volume mixture of xylazine (20mg/ml) and ketamine (100mg/ml). Animals also received a

subcutaneous injection of buprenorphine (0.02mg/kg) and intramuscular injection of Benacilin

(0.1ml). Experiments conformed to NHMRC guidelines and were approved by the Animal Ethics

Committee of the University of Western Australia.

Experimental Groups Transplanted animals were divided into 3 experimental groups for RGC survival and axonal

regeneration studies. The first group (n=13) received PN grafts reconstituted with LV-GFP

transduced SCs (data from Chapter 4). The second group (n=8) received PN grafts

reconstituted with LV-BDNF transduced SCs. The third group (n=11) received PN grafts

reconstituted with LV-GDNF transduced SCs. All animals were kept for 4 weeks and received

FG injections into distal PN 3 days before sacrifice. Retinas and PN grafts were then dissected

out and used for analyzing RGC survival and axonal regrowth as described in Chapter 4.

Additional rats in each group (receiving PN reconstituted with LV-GFP, LV-BDNF or LV-GDNF

transduced SCs) were used for ELISA (n=2 for each group) to measure BDNF and GDNF

production in the PN grafts. One pregnant mother rat was used as E15 DRG donor for

bioactivity assay to confirm that the BDNF or GDNF produced by LV transduced SCs was

biologically active. Embryonic DRGs were placed on collagen I-coated hats, 3 preparations

were made for each factor. Additional rats received PN autografts, a 1.5 cm segment of

peroneal nerve from the same animal was grafted onto the cut ON end immediately after

transection. The same ON surgery procedure was performed as described in chapter 4. Animals

were kept for 1 or 4 weeks, and received FG injection 3 days before perfusion.

Production of lentiviral vectors Plasmids used for production of LV vectors were generously provided by Prof. Joost Verhaagen

(The Netherlands Institute for Brain Research, 1105 AZ Amsterdam, The Netherlands).

Concentrated LV-BDNF and LV-GDNF was produced by Ajanthy Arulpragasam or by Prof.

Joost Verhaagen’s lab (in the Netherlands Institute for Brain Research, 1105 AZ Amsterdam,

The Netherlands), with titers of 2.6x1010 TU/ml and 2.0x109 TU/ml respectively. Viral particles

were dissolved in PBS, aliquoted and stored at -80oC. Viral particle content was determined by

p24 antigen measurement (ELISA; NEN-050, Perkin Elmer Life Sciences). The relative

transducing units (TU) /ml for LV-GDNF was calculated by normalizing against the p24 content

of a LV-GFP stock.

76

Transduction of Schwann cells with lentiviral vectors When SCs reached 70-80% confluence, replication-deficient LV-GFP, LV-BDNF or LV-GDNF

vectors were added to the dish at a multiplicity of infection (MOI) of 1:50, 1:100 or 1:50

respectively for 24 hours. After washes, transduced SCs were incubated for another day to

achieve high transgene expression before being used in the reconstruction of PN bridges.

Quantitative PCR of BDNF or GDNF To test for continued transgene expression in SCs, real-time PCR was used to examine the

level of BDNF or GDNF mRNA in LV-GFP, LV-BDNF and LV- GDNF manipulated SCs in vitro.

RNA was isolated from cultured SCs using 1ml of RNAwiz (Ambion), and equal amounts of total

RNA (1 µg) were reverse transcribed in 25 µl volumes with Moloney murine leukemia virus

reverse transcriptase (Promega) and random hexamers (Promega), according to manufacturer’s

instructions. The reactions were then purified through columns (MoBio PCR Clean-up; MoBio

Laboratories, West Carlsbad, CA) before PCR. Quantitative PCR was performed using the

Roche (Basel, Switzerland) LightCycler with the following primers: BDNF: (forward, 5’- ATG

AAA GAA GCA AAC GTC C -3’; reverse, 5’- CCT GCA GCC TTC CTT CG -3’). GDNF:

(forward, 5’-ATG AAG TTA TGG GAT GTC G-3’; reverse, 5’-GAT ACA TCC ACA CCG TTT

AG-3’). L19 ribosomal protein RNA: (forward, 5’-CTGAAGGTCAAAGGGAATGTG-3’; reverse,

5’-GGACAGA GTCTTGATG ATCTC-3’). Reactions were performed using 1 µl of FastStart DNA

Master SYBR Green I (Roche) with 0.5 µM primers in a total volume of 10 µl. Cycling conditions

were: 95°C for 10 sec, 55°C for 20 sec, and 72°C for 20 sec for 50 cycles (BDNF); 95°C for 0

sec, 54°C for 15 sec, and 72°C for 5 sec for 40 cycles (GDNF or L19). Controls (with or without

RT enzyme) were used to check for genomic DNA amplification. All the samples were run at the

same time. Amplification was checked by melt curve analysis and by electrophoresis in 2%

agarose/1XTAE/ethidium bromide for product size (BDNF: 537bp, GDNF: 633bp, L19: 194bp).

ELISA BDNF or GDNF levels in the conditioned media and protein extracts from transduced SCs in

vitro and engineered PN grafts in vivo were obtained using ELISA kits (BDNF Emax®; Cat.#

G7610; GDNF Emax®; Cat.# G7620) purchased from Promega corporation. SCs or PN grafts

were homogenized in 500 μl of assay buffer (see chapter 4), centrifuged at 12,000g 15mins

4oC, and the supernatants were used as the samples for the assay. Duplicate standards and

samples were processed in a Nunc-ImmunoTM MaxiSorpTM 96-well plate according to the

detailed protocol provided by Promega. Briefly, plates were coated with monoclonal antibody,

and then plates were blocked, followed by incubation of standards or samples. ELISA was

developed using a polyclonal antibody revealed by an anti-IgY antibody conjugated to

horseradish peroxidase for detection, followed by the peroxidase substrate and

tetramethylbenzidine solution to produce the color reaction. The absorbance of the plate was

read at 450 nm on a plate reader, and the samples were plotted against the levels obtained

from the standard curve. The assay sensitivity is 15.6 pg/ml for BDNF and 31.2 pg/ml for GDNF.

At the dilution used, the sample values were above the lower limit on the standard curve.

77

Cryosectioning and immunostaining of optic nerve, peripheral nerve grafts To investigate the origin of sensory axons inside the reconstituted PN grafts and to compare

with staining in normal PN and ON, sections from normal PN, ON tissue and PN autografts 1 or

4 weeks after transplantation, were stained for pan-neurofilament, tyrosine hydroxylase (TH)

(Chemicon; gift of Dr. Janet Keast, Sydney University; 1:1000), calcitonin gene-related peptide

(CGRP) (1:1000; Biogenesis, UK), or vesicular acetylcholine transporter (VAChT) (Chemicon;

gift of Dr. Janet Keast, Sydney University; 1:1000). The same staining procedures were used as

described for CGRP in Chapter 4.

Statistical analysis

Statistical analysis was performed using GraphPad InStat version 3.06 for Windows (GraphPad

Software, San Diego, USA). RGC numbers from different groups that met the criteria for

parametric tests were analyzed by one-way ANOVA test, Dunnett’s post-test was used to

compare mean values of experimental groups against the control group (the GFP group),

whereas Bonferroni’s post-test was used to compare mean values among all intragroups.

Groups of data that failed tests for normality were analyzed by Kruskal-Wallis test, Dunn’s post-

test was used to compare between groups. Two-way ANOVA and post-hoc Bonferroni tests

were used to assess changes in the number of axons at different distances along the length of

the PN grafts in different experimental groups (Fig. 5.6).

5.3 Results Successful and rapid transduction of Schwann cells in vitro Reverse transcription and real-time PCR analysis of mRNA expression levels were carried out

in LV transduced SCs 48 hours after transduction. Relative to respective LV-GFP control

samples, an approximately 90 and 40 fold increase in the level of BDNF or GDNF mRNA

expression was seen after SCs transduced with LV-BDNF or LV-GDNF respectively, indicating

successful incorporation of the BDNF or GDNF gene into adult SCs (Fig. 5.1).

Figure 5.1 Real-time PCR result shows levels of BDNF (A) or GDNF (B) mRNA expression from LV-

GFP, LV-BDNF or LV-GDNF transduced Schwann cells.

78

Increased BDNF, GDNF production revealed by ELISA analysis ELISA analysis of BDNF and GDNF protein in transduced SCs in vitro and engineered PN

grafts 4 weeks after in vivo transplantation revealed that there were significant increases in

BDNF and GDNF protein levels in both supernatant and cultured SCs 48 hours after LV

transduction (Fig. 5.2). The level of BDNF protein in the supernatant of control LV-GFP

transduced SCs was 0.26 ng/106 cells/24 h. In comparison, 1×106 SCs transduced with LV-

BDNF secreted an average of 5.9 ng BDNF/106 cells /24 hours into the culture medium (Fig. 5.2

A). LV-BDNF transduced SCs also contained, on average, 0.4 ng of cytosolic BDNF per 1×106

cells; thus while the level of BDNF secretion was much higher from these transduced cells,

there were still relatively large amounts of BDNF in the cytoplasm compared to the LV-GFP

transduced cell population (0.05 ng/1×106 cells). In vivo, 4 weeks after transplantation, a higher

BDNF content was detected compared to LV-GFP SCs reconstructed PN grafts (Fig. 5.2 A).

This BDNF was presumably mostly cytosolic in origin. Measurement of total BDNF content in

each LV-BDNF SC reconstituted PN graft revealed an average of 0.01 ng BDNF per graft, while

it was undetectable in PN grafts containing LV-GFP engineered SCs. Based on our in vitro data,

the levels of secreted BDNF in PN grafts were likely to be about 15 times this amount.

The level of endogenous GDNF in normal SCs was generally very low. Of the 3 ELISA tests on

LV-GFP transduced SCs, no detectable GDNF was seen in 2 tests. 1×106 SCs transduced with

LV-GDNF secreted an average of 1.4 ng of GDNF/24 hours into the culture medium (Fig. 5.2 B).

LV-GDNF transduced SCs contained, on average, 114 pg of cytosolic GDNF per 1×106 cells;

thus while the level of GDNF secretion was very high from these transduced cells there were

still relatively large amounts of GDNF in the cytoplasm compared to the LV-GFP transduced cell

population. However, 4 weeks after transplantation, no GDNF protein was detected in these 2

types of LV transduced PN grafts.

BDNF or GDNF released from transduced Schwann cells is biologically active Compared to conditioned medium from LV-GFP transduced SC cultures, conditioned medium

from either LV-BDNF or LV-GDNF transduced SCs promoted more neurite outgrowth from

embryonic DRG explants (Fig. 5.3 A-C). Three days after conditioned medium treatment,

immunostaining with pan-neurofilament antibody revealed a clear increase in the number of

outgrowing neurites in all 3 embryonic DRGs treated with supernatant from either LV-BDNF

(Fig. 5.3 B) or LV-GDNF (Fig. 5.3 C) transduced SCs compared with LV-GFP supernatant (Fig.

5.3 A). Owing to the large number of the outgrowing and often overlapping neurites after LV-

BDNF, LV-GDNF supernatant treatment, I was unable to count the numbers of neurites and

quantitatively analyse the clear difference in these groups. However, unlike LV-CNTF

supernatant, LV-BDNF and LV-GDNF supernatant treatment did not increase cellular migration

of S100 or Hoechst 33342 labelled cells out of the DRG explants.

79

0

1

2

3

4

5

6

0.4

5.9

0.260.01ND0.05

A

Supernatant Schwann cells PNs

LV-BDNFLV-GFP

BD

NF(

ng)/

106 c

ells

/24h

0

500

1000

1500

ND NDND

B

Supernatant Schwann cells PNs

LV-GDNFLV-GFP

GD

NF(

pg)/

106 c

ells

/24h

Figure 5.2 ELISA data shows levels of BDNF (A) or GDNF (B) protein released from or within Schwann

cells in culture, reconstructed PN grafts 4 weeks in vivo.

Figure 5.3 Bioactivity assays of supernatants from LV-GFP (A), LV-BDNF (B) and LV-GDNF (C)

transduced SCs on E15 DRG: more neurite outgrowth (green signal) was seen after LV-BDNF or LV-

GDNF supernatant treatment. Green, pan-neurofilament positive neurites; red, S-100 positive SCs; blue,

Hoechst 33342 labeled nuclei. Scale bars, 200 μm.

RGC survival after LV-BDNF or LV-GDNF treatment Examples of βIII-tubulin immunopositive RGCs after LV-BDNF treatment are shown in Figure

5.4 B. The average number and SEMs of βIII-tubulin positive surviving RGCs were

6217±626/retina (n=13) after LV-GFP PN graft, 5211±406/retina (n=8) after LV-BDNF PN graft

and 3689±219/retina (n=11) in LV-GDNF PN grafted animals (Fig. 5.5). The difference was

A B C

80

statistically significant when LV-GFP and LV-GDNF data were compared (p<0.01, One-way

ANOVA with Bonferroni post test).

Figure 5.4 Examples of FG labelling (A) and βIII-tubulin staining (B) from retinas with LV-BDNF SCs

reconstructed PN graft. Scale bars, 100 μm.

0

1000

2000

3000

4000

5000

6000

7000 SurvivingRegenerating

**

LV-GFP LV-BDNF LV-GDNF

RG

Cs

num

ber/

Ret

ina

Figure 5.5 The average number (± SEM) of surviving βIII-tubulin positive and regenerating FG labeled

RGCs in LV-GFP, LV-BDNF or LV-GDNF SCs reconstructed PN graft. **p<0.01, One-way ANOVA

with Bonferroni post test.

RGC regeneration after LV-BDNF, LV-GDNF treatment Examples of FG retrogradely labelled axon-regenerating RGCs after LV-BDNF treatment are

shown in Figure 5.4A. There was no significant difference in the mean number of RGCs

regenerating an axon into the graft after LV-BDNF intervention (331±175/retina, n=5) compared

with LV-GFP intervention (290±164/retina, n=10) (Fig. 5.5). Unexpectedly, no FG labelled RGCs

were found in retinas with LV-GDNF treatment. In summary, compared to LV-GFP grafted PNs

neither RGC survival nor axonal regeneration was significantly increased after transplantation of

PN grafts containing engineered LV-BDNF or LV-GDNF SCs.

81

Immunohistochemical analysis revealed sustained axonal ingrowth in LV-BDNF SC

reconstructed PN grafts In contrast to the FG or βIII-tubulin labelled RGC counts obtained from retinal wholemounts,

immunohistochemical staining of longitudinal PN sections with pan-neurofilament antibody

surprisingly revealed large number of pan-neurofilament positive axons in LV-BDNF treated PN

grafts (Fig. 5.6). Along the length of the reconstructed PN grafts there were consistently higher

average numbers of axons in LV-BDNF treated PN grafts compared to LV-GFP, and even when

compared to LV-CNTF treated PN grafts (Fig. 5.6). Double staining of the PN sections with

CGRP and pan-neurofilament antibodies revealed that most of these pan-neurofilament positive

axons were also CGRP positive (Fig. 5.7). Counting of axon numbers revealed a higher

proportion of CGRP+ axons in LV-BDNF grafts (>75% pan-neurofilament stained axons were

CGRP+ compared with 25% in LV-CNTF PN grafts) (Fig. 5.8). This suggested that the axons did

not come from the regenerated RGCs but from the peripheral sensory nervous system.

0 2000 4000 6000 8000 1000005

1015202530354045

LV-CNTFLV-GFP

Pan-neurofilament

LV-BDNF

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n pe

r m

m

Figure 5.6 Average numbers (± SEM) of pan-neurofilament staining positive regenerating axons at

various distances along the PN graft. The average number of pan-neurofilament positive axons across the

PN is plotted against incremental distance from the PN-ON interface.

82

Figure 5.7 Examples of CGRP (A), pan-neurofilament (B) staining (merged C) of sections in PN graft four weeks after surgery. Arrows show examples of axons immunoreactive for both CGRP and pan-neurofilament. Scales bar, 100µm.

GFP

0 1000 2000 3000 4000 5000 6000 70000

10

20

30

40

50

Pan-NeurofilamentCGRP

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n pe

r m

m (A)

BDNF

0 1000 2000 3000 4000 5000 6000 70000

10

20

30

40

50

(B)

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n pe

r m

m

CNTF

0 1000 2000 3000 4000 5000 60000

10

20

30

40

50

60

70

(C)

Distance from proximal end(in 625 um increments)N

o. o

f reg

ener

atin

g ax

ons

/sec

tion

/mm

GFP BDNF CNTF0.0

0.2

0.4

0.6

0.8

1.0

1.2

**

(D)

Rat

io C

GR

P/PA

N

Figure 5.8 The average number (± SEM) of pan-neurofilament and CGRP positive regenerating axons at

various distances along the LV-BDNF SCs reconstructed PN graft (B). Data from LV-GFP PNs (A), LV-

CNF PNs (C) were shown for comparison. (D) The average ratio of CGRP positive compared to pan-

neurofilament positive axons in different types of reconstructed PN grafts 4 weeks in vivo. **p<0.01;

Kruskal-Wallis test with Dunn’s post test, comparisons were made against the LV-GFP or LV-BDNF

group.

83

Immunostaining in normal peroneal, optic nerves and PN autografts To further investigate the potential origin of these CGRP positive axons, normal ONs and PNs

were sectioned and stained for TH, VAChT, and CGRP. In normal ON sections, axons were

immunostained for pan-neurofilament and βIII-tubulin, but there was no CGRP or VAChT

immunopositive sensory, motor, sympathetic or parasympathetic axons (Fig. 5.9). Some CGRP,

TH, VAChT positive fibers were found around the ON and the eye ball (Fig. 5.9 D-F). This

confirmed that axons inside the ON come from RGCs; no other neurons project an axon into the

ON. Outside the ON there are some autonomic fibers associated with blood vessels, or sensory

axons that innervate the eye ball. In normal peroneal nerve, immunostaining revealed large

numbers of axons stained for TH, CGRP and pan-neurofilament (Fig. 5.10 A,B,D), but lower

numbers of axons stained for VAChT (Fig. 5.10 C). This confirmed that normal peroneal nerve

contained both motor (stained for VAChT) and sensory (stained for TH, CGRP) axons.

In sections from PN autografts 1 week after transplantation, pan-neurofilament staining showed

that all the peripheral axons originally within the PN tissue had degenerated after

transplantation onto the ON stump. Pan-neurofilament staining debris but not axons were seen

in the middle and distal parts of the PN (Fig. 5.11 B,C). One week after grafting, in the proximal

end of the PN, axons were found, and had grown into PN grafts up to about 300 µm (Fig. 5.11

A). This is also confirmed with FG injection into the distal end of the PN; no labeled RGCs were

found in the retina. This demonstrated that all axons in PN tissue had degenerated and no

regrowing axons reached the distal end at 7 days. However, in PN sections 4 weeks after

autograft, axons positive for pan-neurofilament, CGRP, TH and VAChT (Fig. 5.10 E-H) were

found along the length of the grafted PN tissue.

84

Figure 5.9 Immunostaining in normal optic nerve sections showed βIII-tubulin (A), pan-neurofilament (B,

C) immunoreactive axons, no staining for VAChT (D), TH (E), or CGRP (F) axons were found. Scale

bars, 100 µm.

85

Figure 5.10 Photomicrograph of immunostaining from peroneal nerve before and 4 weeks after grafting.

PN sections from normal peroneal nerve were immunoreactive for pan-neurofilament (A), CGRP (B), TH

(D), but not VAChT (C). However, 4 weeks after PN graft, axons in grafts were immunolabelled for all

these antibodies (E-H). Many axons were immunostained for Pan-neurofilament (E), but only a few axons

were immunostained for CGRP, VAChT or TH (arrows in F, G and H). Scale bar, 100 µm.

Figure 5.11 Pan-neurofilament staining of the PN sections 1 week after PN autograft shows no axons in

the distal end (C) and middle part (B) of the PN grafts. A few axons were found in the proximal end (A),

which is about 320 µm from the suture in the proximal end. Pan-neurofilament staining debris can be seen

in the middle of the graft (B), no axons were found in the distal end (C). S, suture. Scale bar, 100 µm.

Proximal End Distal End

320 μm

Middle

A B C

THVAChTCGRP Pan- Neurofilament

Normal Peroneal

Nerve

PN autograft

A B

E

C D

F G H

86

Immunohistochemical analysis confirmed little axonal growth in LV-GDNF SCs reconstructed PN grafts Consistent with the lack of FG-labeled RGCs in retinal wholemounts, immunohistochemical

staining of longitudinal PN sections with pan-neurofilament antibodies revealed lower numbers

of axons in LV-GDNF treated PN grafts comparing with LV-GFP treated PN grafts (Fig.5.12).

1000 2000 3000 4000 5000 6000 7000 80000

5

10

15

20

25Pan-Neurofilament

GDNFGFP

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n pe

r m

m

Figure 5.12 Average numbers (± SEM) of pan-neurofilament staining positive regenerating axons at

various distances along the LV-GDNF PN graft. The average number of pan-neurofilament positive

axons across the PN is plotted against incremental distance from the PN-ON interface. Data from LV-

GFP PNs are shown for comparison.

5.4 Discussion It was shown in Chapter 4 that CNTF gene modified SCs in chimeric PN constructs can promote

the survival and axonal regeneration of injured adult rat RGCs. The same method was used to

examine if other important neurotrophic factors such as BDNF and GDNF had similar beneficial

effects on injured RGCs. The present study showed that LV-BDNF and LV-GDNF can

successfully transduce SCs and that the BDNF or GDNF secreted by SCs is biologically active

(Fig.5.3). However, these reconstituted PN segments containing LV-BDNF or GDNF transduced

SCs did not promote either the survival or axonal regeneration of injured adult RGCs. In fact,

outcomes were even worse in GDNF PNs compared to the GFP control (Fig. 5.5).

Unexpectedly, more axons were observed inside the PN segments reconstructed with LV-BDNF

transducted SCs. Thus BDNF transduction did not support increased RGC axonal regrowth but

did attract axon sprouting of CGRP-immunoreactive fibers from the surrounding environment

into the reconstructed PN. There was thus a clear beneficial effect of enhanced BDNF

expression on sensory axonal growth and/or sprouting into PN tissues.

87

BDNF has previously been shown to stimulate RGC survival and axonal regeneration (Huang et

al., 2000; Chen and Weber, 2001; Mo et al., 2002; Martin et al., 2003; Bonnet et al., 2004), but

its effectiveness is limited; higher doses do not yield increased cell survival, and multiple

applications are not additive, and do not maintain long-term RGC viability. This limitation of

BDNF in promoting RGC survival following ON injury is, in part, likely to be due to BDNF

induced down-regulation of the full-length TrkB receptor (Frank et al., 1997; Cui et al., 2002;

Chen and Weber, 2004). The present results also show that sustained supply of BDNF in the

PN bridges is not sufficient to promote RGC survival or regeneration, even though BDNF can be

both anterogradely and retrogradely transported (Nawa and Takei, 2001; Spalding et al., 2002).

Therefore, we hypothesize that the non-beneficial effect of BDNF is associated with a down-

regulation of the TrkB receptors in RGCs as well as competition from peripheral axons from the

surrounding environment. However, further experiments are needed to prove this.

As reviewed in Chapter 2, there is evidence that after axotomy, die-back of RGC axons is

decreased by BDNF application (Weibel et al., 1995). However, the current data suggests that

BDNF is not neurotropic for RGC axons i.e. they do not grow towards a source of BDNF.

Interestingly, in a recent paper by Pernet et al. they demonstrated BDNF had synergistic effect

with lens injury on RGC survival but caused hypertrophic axonal swelling and ON dystrophy

(Pernet and Di Polo, 2006). Others have reported that BDNF acts as an arborization factor

(Cohen-Cory and Fraser, 1995; Sawai et al., 1996), but does not promote long-distance RGC

axonal regeneration (Cui et al., 1999; Leaver et al., 2006c). While, the exact impact of BDNF on

RGC axons (non-neurotrophic, detrimental or arborization effect) needs further investigation,

taken together it appears that BDNF is not a good candidate for stimulating axonal regrowth in

certain parts of the CNS.

From the immunostaining of PN grafts it is clear that no axons remain in the PN tissue 1 week

after graft, therefore all the axons stained by pan-neurofilament must be newly grown axons.

However, axons from RGCs should not be immunostained for CGRP, TH or VAChT. Therefore,

where do these sensory axons come from? They must come from either inside or outside of the

retina. Recent research has characterized a normal dopaminergic system in the retina (Eglen et

al., 2003) and TH has also been shown to be expressed by dopaminergic amacrine cells in

RGC and inner nuclear layer (INL) (Kielczewski et al., 2005). In normal animals no amacrine

cells project axons into ON (Perry and Walker, 1980; Perry, 1981; Sievers et al., 1989; Klocker

et al., 2001). However, there is evidence that BDNF regulates dopaminergic amacrine cells in

the retina (Cellerino et al., 1999) and intravitreal injection of BDNF promotes type I amacrine cell

arborization and TH-labelled varicosity after ON transection (Lee et al., 2005). Therefore, it is

possible that the axons from some of the displaced dopaminergic amacrine cells may have

grown into the PN graft. Despite this possibility, in my view it is much more likely that these

CGRP positive axons come from the surrounding areas of eyeball, perhaps from trigeminal

nerve branches. It has been shown that around the eyeball and ON sheath, there are sensory

axons that innervate the tissue of the eye (Schmid et al., 2005). CGRP, TH positive axons are

also found surrounding the vessels of ON (Bergua et al., 2003). These CGRP, TH, VAChT

88

positive fibers can also be seen in the sections in Figure 5.9 D-F. Furthermore, from gene array

studies, it is known that RGCs and other sensory ganglia such as dorsal root and trigeminal

ganglia share some transcription factors (Xiang et al., 1995). They also share similar genetic

regulatory hierarchies (Xiang et al., 1995; Farkas et al., 2004) or neurotrophic responses. It is

possible for their axons to respond the same way as RGC axons, i.e. grow into PN grafts. Thus,

the CGRP positive axons that regrow into PN grafts may come from the sensory branches of

the trigeminal nerve. Indeed, recent reports have demonstrated that CGRP is a marker for

trigeminal primary nociceptors, and nearly 50% trigeminal ganglion cells are BDNF

immunoreactive. BDNF may modulate nociceptive transmission in the medullary dorsal horn

(Ichikawa et al., 2006). Similar functions of BDNF have been shown to contribute to neuropathic

pain after SCI (Obata and Noguchi, 2006).

Previous studies have shown that GDNF is effective in promoting axonal regeneration in sciatic

nerve bridged with a conduit containing GDNF gene modified SCs (Ping et al., 2003; Li et al.,

2006), a fibrin sealant containing GDNF (Jubran and Widenfalk, 2003), or synthetic nerve

guidance channels releasing GDNF (Chen et al., 2001; Fine et al., 2002). The high affinity

GDNF receptor, GFRα-1 is expressed by RGCs and Müller cells (Koeberle and Ball, 2002;

Lindqvist et al., 2004). Exogenous administration of GDNF can be retrogradely transported and

significantly attenuate the degeneration of RGCs after ON transection in a dose-dependent

fashion (Yan et al., 1999). However, the protective effect of GDNF was found to be transient

e.g. within 1 week even with intraocular injection of FBs expressing GDNF (Lindqvist et al.,

2004). Therefore, the lack of effect of GDNF gene modified SCs reconstructed PN grafts may

be due to the limited effect of GDNF secreted from SCs. We also can not exclude the possibility

that LV-GDNF SCs did not survive well in the reconstructed PN environment, leading to no

detected GDNF in the PN grafts 4 weeks after transplantation (Fig.5.2B). Further study using

nucleus labelling or a LV-GDNF-eGFP bi-cistronic vector is needed to prove this hypothesis. In

addition, the unexpected GDNF result may also suggest an adverse effect of massive GDNF

expression on SC bioactivity such as secretion of other neurotrophic factors, or a negative

influence on SC viability. However due to time constraint, no further studies have been

conducted to investigate these possibilities.

5.5 Conclusion

In conclusion, LV-BDNF or GDNF can successfully transduce SCs to express the corresponding

neurotrophic factor. However, reconstructed PN grafts containing LV-BDNF or GDNF

transduced SCs did not enhance RGC survival or regrowth. Interestingly, BDNF secreted from

this PN tissue attracted more peripheral sensory axons from the surrounding environment into

the chimeric PN grafts. Importantly, we showed here for the first time that there is growth of

various types of axons into PN grafts, which may lead to miscounting of axonal numbers and

correspondingly inaccurate evaluation of RGC regeneration. GDNF secretion may interfere with

the normal cellular function of SCs. Therefore, BDNF or GDNF may not be suitable for RGC

regeneration when applied to the retinofugal pathways.

89

Chapter Six

PN grafts containing fibroblasts or mixtures of

fibroblasts and Schwann cells

6.1 Introduction As reviewed in Chapters 1&2, fibroblasts (FBs) and Schwann cells (SCs) are two major cell

constituents of the peripheral nerve (PN). Many studies have demonstrated them to be a source

of a variety of neurotrophic factors with potential clinical applications. Autologous SCs and FBs

can easily be obtained from small pieces of PN. Transplantation of genetically modified FBs has

been widely tested in animal injury models as means to deliver a continuous supply of active

neurotrophic factors (Blesch and Tuszynski, 2001; Lindqvist et al., 2004). For example, FBs

genetically modified to express BDNF, NT3, or NGF promote regeneration of axons and

recovery of function when applied into the injured spinal cord of adult rat (Tuszynski et al., 1994;

Liu et al., 1999; Jin et al., 2000; Himes et al., 2001; Liu et al., 2002b; Murray et al., 2002). Also

reported before by our group, combined use of CNTF and BDNF expressing FBs can

synergistically enhance RGC axonal regrowth within polymer scaffolds implanted into the rat

optic tract (Loh et al., 2001). Therefore in this part of the study, CNTF gene modified FBs were

injected into PN autografts as a means of delivery of CNTF or used to reconstitute acellular PN

sheaths. In two other groups, SCs were mixed with FBs to reconstruct PN grafts. The amount of

survival RGC and axonal regrowth into the modified PN grafts were quantified. These studies

were aimed at determining whether a sustained increase of CNTF expression in PN grafts could

enhance RGC regeneration, and examined if the use of CNTF gene modified FBs plus SCs in

reconstructed PN would achieve similar effects as LV-CNTF SCs (see Chapter 4).

6.2 Materials and Methods See chapter 4 for methods of adult SC culture, CNTF Immunostaining, ELISA, production of

acellular PN sheaths, cellular reconstitution of freeze-thawed nerves, optic nerve surgery,

retrograde labelling of regenerating RGCs, immunohistochemical staining of viable RGCs,

cryosectioning and immunostaining of PN grafts, counts of axons that had regrown into PN

grafts.

Fibroblast cell culture Dermal FBs from adult Fischer 344 rats were transduced by a retroviral vector from the maloney

leukaemia virus containing rat CNTF gene (same gene was used in LV-CNTF construct) in Prof.

F. H. Gage (Salk Institute) ’s laboratory. Same dermal FBs without viral transduction were used

as control. FB cultures were incubated at 37°C in 5% CO2 and were grown in flasks containing

Dulbecco’s modified Eagle’s medium (DMEM, Trace), supplemented with 10% fetal calf serum

(FCS, Gibco), L-glutamine (2 mmol/L, CSL), penicillin (10,000 IU/ml) and streptomycin (10

90

mg/ml), all antibiotics diluted 1:100 in the culture media. Cultures were passaged when

confluent (3–5 days) and replated at a density of 1:3.

Experimental Groups Animals were randomly divided into 5 experimental groups (Table 6.1). The first group (n=5)

received normal PN autografts that were injected with 2×104 control normal FBs (CON-FBs).

The second group (n=6) received normal PN autografts that were injected with 2×104 FBs

expressing CNTF (CNTF-FBs). The third group (n=6) received acellular PN grafts reconstituted

with 1×105 SCs plus 2×104 CON-FBs. The fourth group (n=5) received acellular PN grafts

reconstituted with 1×105 SCs plus 2×104 CNTF-FBs. The last group (n=5) received acellular PN

grafts reconstituted with 1×105 CNTF-FBs. In group I and II, PNs were dissected out and

cultured in a Petri dish (in SC culture medium) for 6 days before injection to allow endogenous

FB to migrate out (Morrissey et al., 1991). After 6 days, 2×104 CON-FBs or 2×104 CNTF-FBs

were slowly injected into the cellular PN segments (1×104/0.5 μl into each end) via a glass

micropipette attached to a 50 µl Hamilton syringe (Cui et al., 2003b). PN pieces were

maintained in culture in D-10S for 24 hours before grafting. In group III-V, the same

reconstruction method was used as described in Chapter 4. All PNs were grafted onto the cut

ON of 8 week old female Fischer rats. All animals were kept for 4 weeks and received FG

injection 3 days before sacrifice. Retinas were dissected out and used for analyzing RGC

survival and regeneration. PN grafts were cryosectioned and regrowing axons were stained with

pan-neurofilament and analyzed as described in Chapter 4.

Table 6.1 Experimental cohorts.

Group FBs SCs PN n

I 2×104 FBs - autograft 5 II 2×104 CNTF-FBs - autograft 6 III 2×104 FBs 1×105 SCs reconstituted 6 IV 2×104 CNTF-FBs 1×105 SCs reconstituted 5 V 1×105 CNTF-FBs - reconstituted 5

Statistical analysis

Statistical analysis was performed using GraphPad InStat version 3.06 for Windows (GraphPad

Software, San Diego, USA). RGC numbers from different groups were analyzed by one-way

ANOVA test. Bonferroni’s post-test was used to compare mean values among all groups.

6.3 Results Increased CNTF production in FBs as revealed by immunohistochemistry and ELISA

analysis A previous report using RT-PCR analysis had shown CNTF PCR products were detected in

these CNTF engineered FBs but not in control FBs (Loh et al., 2001). Consistent with this,

nearly 100% of CNTF-FBs expressed CNTF as revealed by immunostaining with CNTF

antibody (Fig. 6.1 B), but not in the control FBs (Fig. 6.1 A). ELISA analysis of CNTF protein in

91

CNTF-FB in vitro revealed an increase in CNTF protein. Significant increases in CNTF level

were seen in both supernatant and cell lysis of cultured CNTF-FB. However, only a small

amount of CNTF was secreted into the supernatant. CNTF-FBs secreted less than 1/10 the

amount of CNTF that was secreted from LV-CNTF transduced SCs (see Chapter 4). No

detectable CNTF was found in the supernatant of normal CON-FB (Fig. 6.2).

Figure 6.1 Immunostaining of CNTF in control FB (A) and CNTF-FB (B). Red, CNTF positive cells,

blue, Hoechst 33342-labeled nuclei. Scale bars, 50um.

0.0

2.5

5.0

7.5

ND

Cells Supernatant

CNTFFBCONFB

CN

TF(n

g)/ 1

06 cel

ls

Figure 6.2 ELISA data shows levels of CNTF protein released from or within CNTF-FB and CON-FB.

RGC survival after transplantation of CNTF-FB reconstructed PN grafts An example of surviving βIII-tubulin immunopositive RGCs after CNTF-FB treatment is shown in

Figure 6.3. The average number and SEMs of βIII-tubulin positive surviving RGCs were

1589±351/retina (n=5) in group I (2×104 CON-FB) and 1311±292/retina (n=6) in group II (2×104

CNTF-FB) PN autografted animals (Fig. 6.4). In groups that received reconstructed PNs with

FBs and SCs, similar numbers of surviving RGCs were found, i.e. 2815±242/retina (n=6) in

92

group III (1×105 SCs plus 2×104 CON-FB) and 2627±406/retina (n=5) in group IV (1×105 SCs

plus 2×104 CNTF-FB) (Fig. 6.4). These numbers are similar to ON transection alone without any

other treatment which is 2815±161 RGCs/retina (n=3; unpublished observation). In group V

(1×105 CNTF-FB) reconstructed PN-grafted animals, there were an average 5250±524/retina

(n=5) survival RGCs, which is closer to the PN autograft data (see Chapter 7), also significantly

higher compared to all other groups (p<0.001, One-way ANOVA with Bonferroni's post test)

(Fig. 6.4).

Figure 6.3 βIII-tubulin positive surviving RGCs with CNTF-FB reconstructed PN graft. There were no

FG labeled regenerating RGCs. Scale bar, 100μm.

0

1000

2000

3000

4000

5000

6000

7000

SurvivingRegenerating

CNTFFBCONFB SC+CNTFFBSC+CONFB CNTFFB

PN autograft Reconstructed PNgraft

SC

RG

C N

umbe

r/ R

etin

a

Figure 6.4 The average number of surviving βIII-tubulin positive and regenerating FG labeled RGCs in

FB manipulated PN grafts. ***p<0.001 CNTF-FB compared with all the other groups, Bonferroni’s test.

Error bars represent SEM. Data from LV-GFP SC reconstructed PN grafts are shown for comparison.

93

No RGC regeneration after CNTF-FB reconstructed PN graft In all groups there were very few retrogradely labelled RGCs that regenerated an axon into the

PN grafts: CON-FB intervention (481±176/retina n=3), SC plus CON-FB (48±42/retina n=5), and

SC plus CNTF-FB (141±96/retina n=5). No regenerating RGCs were found when only CNTF-

FBs were used in reconstituted PNs (Fig. 6.4).

Immunohistochemical analysis confirmed less or no axonal regrowth in reconstructed

PN grafts Consistent with the FG or βIII-tubulin labelled RGC counts obtained from retinal whole mounts,

immunohistochemical staining of longitudinal PN sections with pan-neurofilament antibodies

revealed very few regenerating axons crossing the entry zone to reconstructed PN tissue in all

the PN graft groups. In the transition zone of ON-PN graft, pan-neurofilament staining revealed

that many RGC axons did not penetrate the border, but appeared to turn back on themselves

(Fig 6.5).

Figure 6.5 An example of pan-neurofilament staining of longitudinal sections through the transitional

zone from the optic nerve to CNTF-FB reconstructed PN graft, showing very few RGC axons crossing

the ON-PN border. (A) and (B) are from the same field. (B) is shown under higher magnification. Scale

bars, 100μm.

6.4 Discussion In the present study, SCs and CNTF gene modified FBs combined with our PN reconstruction

technique were used in an attempt to promote RGC survival and axonal regeneration. However,

neither CON-FBs nor CNTF-FBs in PN grafts promoted RGC survival or axonal regeneration.

On the contrary, FBs had an adverse effect and all but neutralised the neurotrophic effect of PN

autografts.

FBs and SCs are major cellular components in normal PNs, accounting for about 15-30% and

75% of the cell populations respectively (Schubert and Friede, 1981; Salonen et al., 1988). In

normal sciatic nerve, a 1.5 cm segment would contain about 1x105 SCs and 2x104 FBs. Thus

injection of a moderate number (2x104) of genetically modified FBs should not substantially alter

the cellular microenvironment of the PN grafts. We also chose to reconstruct freeze-thawed,

94

acellular PN segments with the same number of SCs and FBs as distributed in normal PN

tissue. In PN graft reconstructed with 1x105 FBs, the number of surviving RGCs was increased,

it was close to PN autografts or PN reconstructed with 1x105 SCs alone (Fig. 6.4; also see

Chapter 4).

RGC survival in reconstructed grafts Reconstructed PN graft containing 1×105 CNTF-FBs can achieve a similar effect on RGC

survival as PN reconstructed with 1x105 LV-GFP SCs alone. This survival effect may be due to

retrograde transport of CNTF by RGC axons that are located close to the ON-PN graft interface.

The secretable CNTF construct used to produce CNTF-FB cell line is the same as used in LV-

CNTF. However, the amount of CNTF secreted from CNTF-FBs is much lower than LV-CNTF

SCs, and only about 3 times higher than LV-GFP SCs. In addition, SCs produce other

neurotrophic factors (Assouline et al., 1987; Funakoshi et al., 1993; Bampton et al., 2005).

Therefore, the survival effect achieved in 1×105 CNTF-FBs is much lower than LV-CNTF SCs

and only comparable to LV-GFP SC reconstructed PN graft.

Interestingly, in SC reconstructed PN grafts containing 1×105 SCs the addition of 2×104 FBs did

not improve, but actually abolished the beneficial effect of SCs. This is hard to explain, as SCs

and FBs are two major cell constituents of PN, we also used the cell number and ratio similar to

the normal situation. This reconstructed PN should be more close to autograft than reconstruct

with either SCs or FBs alone. These data are possibly explained by an adverse effect of the FB

cell line. Perhaps unlike the cultured SCs, FB cell line continued to divide after transplantation

and physically block the grafts. Further studies using bromodeoxyuridine (BrdU), ki67 to label

dividing cells are needed to investigate the proliferation state of FBs. Immunostaining using a

pan-neurofilament antibody also showed that many axons cannot penetrate the transitional

zone from ON to PN. This may influence the capacity of RGC axons to pick up and retrogradely

transport neurotrophic factors, therefore abolishing the beneficial effect of these grafts.

RGC regeneration in reconstructed grafts The lack of beneficial effect on RGC axonal regrowth may also be because injected FBs

produce axonal growth-inhibitory molecules like tenascins (Hagios et al., 1996), Eph receptor

(Bundesen et al., 2003) and proteoglycans that inhibit RGC axon regrowth. Indeed, recent

research has found that NG2 is expressed on endoneurial and perineurial FBs in PN, but not on

SCs (Morgenstern et al., 2003). Axons preferred to grow on the SCs and seldom crossed onto

the FBs. Three-dimensional cultures of sciatic nerve FBs were also inhibitory to the growth of

DRG axons. Inhibition of proteoglycan synthesis made the cells more permissive. These data

suggest that NG2 may play a role in blocking axon regeneration through scar tissue in injured

PN (Morgenstern et al., 2003). Apart from NG2, FBs also secret type IV collagen which is

inhibitory to axonal regrowth (Stichel and Muller, 1998; Stichel et al., 1999; Fawcett, 2006).

Thus, the secretion of inhibitory molecules from FBs may contribute to the non-beneficial effect

on RGC regeneration seen in all these groups. However, Van Gieson staining to identify

95

collagen did not reveal evident changes of collagen deposit in various PN grafts (data not

shown). More study therefore is needed to examine other inhibitory molecules.

PN autografts with FB injection Surprisingly, the present study showed that FB injection into PN tissue neutralised the effect of

the PN autograft. Counting of survival RGC number revealed similar levels of survival as ON

transection only (2815±161 RGCs/retina). This indicated the PN tissue was not healthy, or SCs

did not survive well. Maybe some SCs also migrate out in Petri dish before graft, or the injection

procedure influenced PN structure or cell availability. Considering the results from SCs plus FBs

reconstructed PN grafts, it is more likely this is due to the inhibitory effects of FBs, which act

against the neurotrophic support usually found in PN.

6.5 Conclusion

In conclusion, the work presented in this chapter shows that CNTF expression per se in the PN

grafts is not sufficient to promote either RGC survival or regeneration. More importantly, it

suggests the type of cell producing the factor is also of great importance. FB cell lines may not

be suitable candidates for reconstituting PN grafts, even when engineered to express relevant

growth factors. SCs would seem to be the preferred cell type for use in structures that bridge

major tissue defects in CNS injury (Cui et al., 2003b)(see also Chapter 4).

96

Chapter Seven

Synergistic effect of C3, cyclic AMP and CNTF on

adult retinal ganglion cell survival and axonal

regeneration into PN autografts 7.1 Introduction As reviewed in Chapters 1,2 and 3, adult RGCs exhibit little or no spontaneous regenerative

response after injury, most dying within about 14 days after axotomy (Berkelaar et al., 1994;

Nickells, 2004). The survival of injured RGCs can be increased for a period of time by

application of recombinant or virally expressed neurotrophic factors such as BDNF, NT-4/5 or

CNTF (Mey and Thanos, 1993; Mansour-Robaey et al., 1994; Peinado-Ramon et al., 1996; Yan

et al., 1999; Weise et al., 2000; Nakazawa et al., 2002; Oshitari and Adachi-Usami, 2003; Logan

et al., 2006). CNTF in particular is an effective axogenic factor for injured RGCs (Cui et al.,

1999; Jo et al., 1999; Cui et al., 2003a; Leaver et al., 2006c). Injury to adult RGCs also causes

changes in receptor expression (Cui et al., 2002; Chen and Weber, 2004; Lindqvist et al., 2004)

and may alter responsiveness to any trophic signals the neuron might receive (Shen et al.,

1999; Goldberg et al., 2002b). It is therefore important to ensure that the responsiveness to

such factors is enhanced and/or maintained during the regenerative process. In this regard,

intracellular cAMP levels have been shown to influence neurotrophin receptor levels in cell

membranes (Meyer-Franke et al., 1998; Park et al., 2004a) and enhance neuronal

responsiveness to diffusible growth factors (Cui et al., 2003a; Li et al., 2003a; Park et al.,

2004a).

In addition to loss of neurotrophic support, neurite growth is inhibited by the glial scar, which

includes reactive astrocytes, secreted CSPGs, and is also inhibited by myelin-associated factors

such as OMgp, MAG and Nogo (Grandpre and Strittmatter, 2001; Chaudhry and Filbin, 2006;

Yiu and He, 2006)(see also chapter 1). Most of these axonal growth inhibitory ligands act via

Rho GTPase signaling pathway (Borisoff et al., 2003; Fournier et al., 2003; Monnier et al., 2003;

Sandvig et al., 2004; Chaudhry and Filbin, 2006) and inactivation of Rho or downstream

effectors such as Rho-kinase (ROCK) have been shown to promote neural regeneration both in

vitro and in vivo. The enzyme C3 transferase is a toxin from Clostridium botulinum which

inactivates Rho by ADP ribosylation (Saito, 1997). Cell-permeable C3 fusion proteins stimulate

neurite growth in tissue culture (Shearer et al., 2003; Bertrand et al., 2005) and in vivo

(Lehmann et al., 1999; Dergham et al., 2002; Fournier et al., 2003; Monnier et al., 2003;

Bertrand et al., 2005; Bertrand et al., 2007).

In the present study I tested the effect of intravitreal injections of one of the C3 fusion proteins

(C3-11) on promoting RGC survival and axonal regeneration into a PN graft. I further tested

whether C3-11 combined with CNTF and/or a non-degradable cell permeant cAMP analogue

97

chlorphenylthio-cAMP (CPT-cAMP) (Cui et al., 2003a) had synergistic effects. RGC viability and

axonal regeneration was quantitatively assessed four weeks after PN transplantation using

immunohistochemical and retrograde tracing techniques as described before. Furthermore, to

look at the influence of C3-11 on the activity of other cell types especially macrophages inside

retina, immunostaining of ED1, PCNA and Ki67 were performed on retinal sections.

7.2 Materials and Methods See Chapter 4 for methods for intraorbital ON axotomy and PN graft, retrograde labeling of

regenerating RGCs, retinal wholemounts, immunohistochemical staining of viable RGCs,

cryosectioning of PN grafts and counts of axonal regrown into PN grafts.

Adult (8-10 weeks old) female F344 rats were used in this study. Animals were anesthetized

with intraperitoneal injections of 1:1 mixture of xylazine (20mg/ml) and ketamine (100mg/ml),

with a total injection of 1 ml/kg body weight. Animals also received a subcutaneous injection of

buprenorphine (0.02mg/kg) and intramuscular injection of Benacilin (0.1ml). Chloramphenicol

eye ointment (ilium chloroint; Troy Laboratories) was applied after each intravitreal injection.

Experiments conformed to NHMRC guidelines and were approved by the Animal Ethics

Committee of the University of Western Australia.

Rho antagonist C3-11 C3-11 (BA-210) was kindly provided by Dr. Lisa McKerracher (University of Montreal, Montreal,

Québec, Canada). C3-11 was supplied under a specific confidentiality agreement with BioAxone

Therapeutic. Inc. The data in this chapter are therefore confidential and must not be released to

any third party. C3-11 was purified by fast-protein liquid chromatography (FPLC), as described

previously (Han et al., 2001). The FPLC purified protein was ~99% pure (Bertrand et al., 2005;

Bertrand et al., 2007). Its activity was also verified by neurite growth assay (Winton et al., 2002;

Bertrand et al., 2005).

Experimental groups for RGC regeneration All of the animals received PN autografts as described before (see Chapter 4 and 5). PN

autografted animals were allocated to different experimental groups (Table 7.1). The first and

second groups received a single saline injection at 4 days, or a double saline injection at 4 and

11 days after PN-ON surgery respectively. A glass micropipette was inserted peripherally from a

temporal approach, immediately adjacent to the ora serrata, and angled toward the vitreous

humour. Care was taken to avoid any damage to the lens during intravitreal injection

procedures. These groups served as controls. Another 3 groups received single, double or triple

injections of C3-11 (1 μg/4 μl per injection) at 4 days, 4 and 11 days, or 4, 11 and 18 days after

PN-ON surgery. The remaining animals received intravitreal injections of C3-11, the cell-

permeable cAMP analog CPT-cAMP (0.1 mM; Sigma) (Cui et al., 2003a), and/or CNTF (1.5 µg

per injection; PeproTech, Rehovot, Israel) in various combinations (Table 7.1). All of these

animals received two 4 µl injections, on days 4 and 11 after PN-ON surgery. Concentrations of

factors were as described in previous reports (Cui et al., 2003a; Park et al., 2004a; Bertrand et

98

al., 2005). After PN autografts, rats were kept for 4 weeks, and received FG injection 3 days

before sacrifice. Retinas were then dissected out and used for analyzing RGC survival and

regeneration. PN grafts were cryosectioned in longitudinal sections and axons were stained for

pan-neurofilament and CGRP as described earlier in chapters.

To investigate any morphological changes of retina induced by PN grafts and intravitreal C3-11

injections, additional rats (n=2 for saline or C3-11; n=1 for Zymosan A) were used for

immunostaining by ED1 (a marker for activated cells of monocyte lineage) and markers for cell

proliferation such as PCNA (proliferating cell nuclear antigen) or Ki67 antibody. Animals were

kept for two weeks after PN graft, received two 4 µl injections at day 4 and 11. Zymosan A (15.6

μg/μl in saline; Sigma) was sterilized at 90oC for 10 mins as described in a previous report (Yin

et al., 2003).

Retinal section and Immunostaining Animals were perfused as described before. Retinas were dissected out and embedded in OCT

(Jung Tissue Freezing Medium) overnight. 16μm frozen sections were cut horizontally, and

collected on gelatin-coated slides. Parallel series of sections were taken, collecting every third

retinal section. Retinal sections were collected onto about 10 slides such that each slide

contained a series of sections across the whole retina. For immunohistochemistry frozen

sections were washed in PBS and retinal sections were processed with an ED1 (1:200; Serotec,

Raleigh, NC), PCNA (1:200; Cat#MAB424, Chemicon, Temecula, CA) or Ki67 monoclonal

antibody (1:250; Clone#MIB-1, Dako) according to the same protocol as βIII-tubulin staining,

and visualized using a Cy3-conjugated anti-mouse secondary antibody (1:400; Jackson

ImmunoResearch Laboratories). All sections were mounted in Citifluor containing Hoechst

33342 (Sigma) to label cell nuclei. ED1 immunopositive cells were counted along different

layers of the retina. Average densities of ED1 immunopositive cells were evaluated in mean ±

SEM/mm and plotted.

Statistical analysis

Statistical analysis was performed using GraphPad InStat version 3.06 for Windows (GraphPad

Software, San Diego, USA). RGC numbers from different groups that met the criteria for

parametric tests were analyzed by unpaired Welch’s corrected t test or one-way ANOVA test.

Groups of data that failed tests for normality were analyzed by the Mann-Whitney test or

Kruskal-Wallis test. Dunnett’s post-test were used to compare mean values of experimental

groups against the same control group (the saline group), whereas Bonferroni’s post-test was

used to compare mean values among all intragroups. Two-way ANOVA, regression analysis

and post-hoc Bonferroni tests were used to assess changes in the number of axons at different

distances along the length of the PN grafts in different experimental groups (Fig. 7.4).

99

7.3 Results Treatment with C3-11 stimulates RGC survival and axonal regeneration into PN grafts Previous reports have shown that C3 transferase delivered to the site of ON lesion (Lehmann et

al., 1999) or cell body (Fischer et al., 2004b; Bertrand et al., 2005; Bertrand et al., 2007) can

promote axonal regeneration into an inhibitory CNS environment. To test if Rho antagonists can

promote RGC survival and axonal regeneration into a more permissive growth environment, we

injected the cell-permeable Rho antagonist C3-11 (Bertrand et al., 2007) into the eye of young

adult Fischer F344 rats at 4, 11, 18 days after ON transection and autologous PN

transplantation. Four weeks after PN transplantation the number of surviving RGCs was

assessed in retinal wholemounts using βIII-tubulin immunohistochemistry. RGCs with

regenerating axons were retrogradely labeled with FG after injection of the tracer into the distal

end of each PN graft. Examples of βIII-tubulin and FG label in retinal wholemounts from saline

and C3-11 injected eyes are shown in Figure 7.1. In the single (4 day) C3-11 injection group,

the number of βIII-tubulin immunoreactive RGCs was significantly higher (15632±1889 /retina;

n=5) than saline control (6834±336 /retina; n=6) (unpaired student t test with Welch’s correction,

p=0.01) (Fig. 7.2). However, the number of retrogradely labeled RGCs that regenerated an axon

into the PN grafts was not significantly different (unpaired student t test with Welch’s correction,

p=0.24) (Fig. 7.2).

100

Figure 7.1 Fluorogold (FG) labeled regenerating (A, C) and viable βIII-tubulin positive (B, D) RGCs in

rats that received saline (A and B, same field) or C3-11 injections (C and D same field). These field were

taken from similar retinal eccentricities from the optic disk. Scale bars, 100 μm.

0

2000

4000

6000

8000

10000

12000

14000

16000

18000

20000

Saline C3 C3DSalineD

SurvivingRegenerating* **

*

C3T

RG

C N

umbe

r / R

etin

a

Figure 7.2 Average number of surviving (βIII-tubulin positive) and regenerating (fluorogold labeled)

RGCs per retina after injection of saline or C3-11 (C3). SalineD, saline double injection; C3D, C3-11

double injection; C3T, C3-11 triple injection. * p<0.05, **p<0.0001; unpaired student t test Welch’s

corrected; comparisons were made against the saline group respectively. Error bars represent SEM.

101

Repeated doses of C3-11 enhanced both the survival and axonal regeneration of injured RGCs

(Fig. 7.2). In the double C3-11 injection group (day 4 and 11 injections), RGC survival

(15764±948 /retina; n=7; p<0.0001) and regeneration (5847±1165 /retina; n=7; p=0.01) was

significantly higher (unpaired student t test with Welch’s correction) than in the comparable

saline double injection group (Fig. 7.2). In the triple C3-11 injection group (day 4, 11 and 18

injections), RGC survival and regeneration were not significantly greater than the double

injected animals (Fig. 7.2). Note that our previous studies revealed no significant difference

between PN-ON graft only and saline injection groups (Cui et al., 2003a; Park et al., 2004a),

thus the eye injection procedure does not by itself influence RGC viability in PN grafted rats.

RGC survival and regeneration into PN grafts with combined C3-11, CNTF and CPT-cAMP

injections The results from the intravitreal C3-11 injections indicated that this Rho inhibitor can promote

RGC survival and axonal regeneration into PN grafts. Double injections were better than single

injection but there was no obvious additional benefit using the triple injection procedure. Thus in

all subsequent studies, to minimize ocular injury and at the same time optimize therapeutic

effects, the double injection protocol was used. Intraocular injection of CNTF and CPT-cAMP

has previously been shown to be effective in promoting adult RGC survival and axonal

regeneration into PN grafts (Cui et al., 2003a). To test if inactivation of Rho combined with

neurotrophic molecules and/or cyclic nucleotides could further increase RGC survival and

regeneration, rats in these various groups received two intravitreal injections, at 4 and 11 days

after the PN-ON graft procedure.

In groups injected with C3-11 alone or C3-11 combined with either CNTF or CPT-cAMP, RGC

survival was significantly higher than the saline control (Dunnett’s post test, p<0.01) (Fig. 7.3),

but the addition of either CNTF or CPT-cAMP did not further enhance the survival promoting

effect of C3-11. Further comparison between treatment groups revealed that RGC survival in

C3-11 and C3-11/CNTF/CPT-cAMP groups was similar, but RGC viability in both groups was

significantly higher than in the CNTF/CPT-cAMP group (Bonferroni’s test ; P<0.01 and P<0.001

respectively) (Fig. 7.3).

The total number of regenerating RGCs was increased after C3-11, C3-11/CNTF or C3-11/CPT-

cAMP injections (Fig. 7.3), but only after intravitreal injections of all three factors was this

increase significantly greater than saline controls (Kruskal-Wallis test with Dunn’s test, p<0.05).

Indeed, the combination of C3-11/CNTF/CPT-cAMP offered the best overall effect; both RGC

survival (16736±1405/retina; n=7) and axonal regeneration (9666±1884/retina; n=6) were

significantly higher than saline injection controls. It is instructive to compare between groups the

proportion of surviving βIII-tubulin positive RGCs that were double-labeled with FG and

therefore regenerated an axon into the PN graft. In the saline group 25% of viable RGCs

regenerated an axon compared to 37% in the C3-11 group, 38% in the C3-11/CNTF group and

32% in the C3-11/CPT-cAMP group. Consistent with previous work (Cui et al., 2003a; Park et

102

al., 2004a), after combined CNTF/CPT-cAMP eye injections the proportion of surviving RGCs

that regrew an axon was higher (54%), an outcome also seen after C3-11/CNTF/CPT-cAMP

injections (58%). Importantly, only in the combined C3-11/CNTF/CPT-cAMP treatment group

was there both an increase in the total number of viable RGCs and the proportion of these

neurons that regenerated an axon.

0

2000

4000

6000

8000

10000

12000

14000

16000

18000

Saline C3 C3/CNTF C3/CPT-cAM P

C3/CNTF/CPT-cAM P

CNTF/CPT-cAMP

SurvivingRegenerating

****

*

**

***

** **

RG

C N

umbe

r / R

etin

a

Figure 7.3 Average number of surviving (βIII-tubulin positive) and regenerating (fluorogold labeled)

RGCs per retina after various double injection (days 4 and 11 after PN transplantation) protocols.

*p<0.05, **p<0.01; Dunnett’s test; comparisons were made against the saline group. **p<0.01 C3-11 vs.

CNTF/CPT-cAMP group, ***p<0.001 C3-11/CNTF/CPT-cAMP vs. CNTF/CPT-cAMP group,

Bonferroni’s test. Error bars represent SEM.

Immunohistochemical analysis of axonal regeneration within PN grafts Consistent with the FG-labeled RGC counts there were more regenerating axons in the double

and triple C3-11 injection groups (Fig. 7.4 A-C). Note that with double and triple C3-11 injections

the number of pan-neurofilament positive axon was higher at the proximal end of the grafts and,

compared to saline and single C3-11 injection groups, this growth was more effectively

maintained along the length of the transplant (Fig. 7.4 B, C). Although the PN grafts from the

C3/CNTF/CPT-cAMP group generally contained the most axons, comparison between different

combined treatment groups failed to show any significant differences in axon numbers (Fig. 7.4

D). Earlier chapters have shown that not all axons come from RGCs. Therefore CGRP staining

was performed on sections from C3-11 treated animals. Axon counting revealed a similar

pattern of distribution of CGRP immunopositive sensory axons in reconstructed PN grafts using

LV-CNTF transduced SCs (Fig. 7.5 A). This proportion is significantly lower compared to PN

grafts containing LV-GFP or LV-BDNF transduced SCs (Fig. 7.5 B). This innervation by other

axons in addition to RGC axons may explain why the effect of C3/CNTF/CPT-cAMP on RGC

regeneration was not reflected in axon numbers in the sections of PN grafts (Fig. 7.4 D).

103

Figure 7.4 Average number (± SEM) of pan-neurofilament immunostained axons at various distances

along PN autograft in different eye injection groups. The average number of pan-neurofilament positive

axons per section across the PN is plotted against incremental distance from the PN-ON interface. (A) In

saline and C3-11 single injection groups similar numbers of axons enter PN grafts and grow towards the

distal end of the grafts. (B) More axons are seen along the length of the the PN grafts in the C3-11 double

injection versus saline double injection groups. (C) Repeated C3-11 treatments promoted more axonal

regrowth into the PN grafts. (D) Comparison of pan-neurofilament counts in PN grafts from four eye

injection groups: C3-11/CNTF/CPT-cAMP, C3-11/CNTF, C3-11/CPT-cAMP and CNTF/CPT-cAMP. In

(D) the data from the double injection saline control group (plotted in B) is shown by the dotted line.

Error bars represent SEM.

104

C3-11

0 1000 2000 3000 4000 5000 6000 70000

25

50

75Pan-NeurofilamentCGRP

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n pe

r m

m

(A)

GFP BDNF C3-110.0

0.2

0.4

0.6

0.8

1.0

1.2

**

(B)

Rat

io C

GR

P/PA

N

Figure 7.5 The average number (± SEM) of pan-neurofilament and CGRP positive regenerating axons at

various distances along the PN autograft. (B) The average ratio of CGRP positive compared to pan-

neurofilament positive axons in different types of reconstructed PN grafts 4 weeks in vivo. **p<0.01;

ANOVA with Bonferroni post test, comparisons were made against the LV-GFP or LV-BDNF group

Spatial differences in the distribution of surviving and regenerating RGCs RGC densities in different treatment groups were assessed at various eccentricities from the

ON head (Fig. 7.6). There was a gradual decrease in the density of surviving RGCs with

increasing distance from the ON head in saline control groups (Fig. 7.6 A). This largely reflects

similar changes in RGC density at increasing eccentricities in normal rat retina (Danias et al.,

2002) and suggests that, in PN grafted rats, without additional intervention there is

proportionate loss of about 90% of RGCs at all retinal eccentricities. In the C3-11 and C3-

11/CPT-cAMP injection groups a decreasing gradient was also evident although less obvious

than in the control group (Fig. 7.6 B,C), but in other combined treatment groups RGC densities

were similar at all eccentricities. This was especially the case in the C3-11/CNTF and

C3/CNTF/CPT-cAMP groups (Fig. 7.6 D,F). These observations imply that the neuroprotective

effects of Rho inhibition on axotomized RGCs was relatively greater in peripheral retina.

Important differences in RGC regenerative ability with eccentricity were also revealed. In all

groups the proportion of surviving RGCs that regenerated an axon into a PN graft was always

higher in central retina (Fig. 7.6). In the double saline injection group these proportions

averaged about 46% in central, 38% in intermediate and 24% in peripheral retina (Fig. 7.6 A).

Similar values were seen in the C3-11 and C3-11/CPT-cAMP groups (Fig. 7.6 B,C). Intravitreal

injections of CNTF, either with C3-11, CPT-cAMP or with both C3-11 and CPT-cAMP increased

the proportion of regenerating RGCs in central retina. Increased regeneration was also seen in

more peripheral retina when CNTF was injected with CPT-cAMP (Fig. 7.6 E), but the most

dramatic effects were seen after combined C3-11/CNTF/CPT-cAMP injections; in this group the

proportion of viable RGCs that regenerated an axon was 86% in central, 72% in intermediate,

and 46% in peripheral retina (Fig. 7.6 F).

105

Figure 7.6 RGC densities at different eccentricities from the optic nerve head (ONH) for six eye injection

groups. Central, intermediate and peripheral values represent density measurements of surviving (βIII-

tubulin positive) and regenerating (fluorogold positive) RGCs sampled within concentric circles with

radii of 0.1-1.4 mm, 1.4-2.8 mm, or over 2.8 mm from the ONH respectively. The proportion of viable

RGCs that regenerated an axon into PN autografts is shown by the percentage values. Based on the data

of Danias et al. (2002), note that the density of RGCs in these zones in normal rat (Wistar) retina

approximates 2200 cells/mm2 (central), 2000 cells/mm2 (intermediate) and 1200 cells/mm2 (peripheral).

Error bars represent SEM.

Macrophage distribution in retinas after C3 injection

Activated macrophages were visualized with ED1 antibody. As described before (Leon et al.,

2000; Yin et al., 2003), very few ED1 immunopositve cells were found in RGC layer after PN

graft and saline injection (Fig. 7.7 A,B). Injection of Zymosan into the vitreous results in a

massive infiltration of ED1-positive monocytes in the retina, and it is impossible to count

individual cells (Fig. 7.7 C). In the retinas with C3 injection, there was a moderate infiltration of

ED1-positive cells in RGC and ONL layer (Fig. 7.7 F). Interestingly, in addition to the small

106

extent of infiltration of ED1 immunopositive cells in retinal sections with C3 injection, it was only

found that the ONL and photoreceptor layers had a ruffled appearance (Fig. 7.7 D,E). This

morphological change was also observed in retinal wholemounts. It was hypothesized that this

ruffled appearance might be due to C3-11 induced proliferation of cells in the ONL and

photoreceptor region. However, staining of retinal sections with cell division markers PCNA or

Ki67 antibodies did not shown any positive staining (data not shown).

Figure 7.7 ED1 staining (Red) of retinal sections in rats that received saline (A and B), Zymosan (C) or

C3-11 injections (D and E) 2 weeks after ON transection and PN grafts. Average numbers of ED1-

positive cells were quantified in different layers of the retina (F). GCL, ganglion cell layer; IPL, inner

plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Red,

ED1 positive cells; blue, Hoechst 33342 labeled nuclei. Scale bar, 100 μm. Error bars represent SEM.

7.4 Discussion In the present study the effect of the Rho GTPase antagonist C3-11 on RGC survival and

axonal regeneration into autologous PN grafts was examined. Four weeks after ON transection

and PN transplantation, compared to saline injections a single C3-11 increased RGC viability

and repeated injections also increased axonal regrowth. RGC survival and axonal regeneration

were significantly and substantially increased when C3-11 was combined with the neurotrophic

factor CNTF and the cAMP analogue CPT-cAMP.

cAMP levels in the retina The cAMP analogue used in present study is a nondegradable membrane-permeable cyclic

adenosine monophosphate analogue, 8-(4-chlorophenylthio)-adenosine 3’:5”-cyclic

monophosphate (CPT-cAMP) (Fig. 7.8), which has been shown previously to be effective in

neonates (Shen et al., 1999; Goldberg et al., 2002a), adult rats (Cui et al., 2003a; Park et al.,

107

2004a) and in goldfish (Rodger et al., 2005). However, many studies used another membrane-

permeable, non-hydrolyzable cAMP analog dibutyryl-cAMP (db-cAMP) (Fig. 7.8) (Kao et al.,

2002; Li et al., 2003a; Lu et al., 2004b; Monsul et al., 2004; Pearse et al., 2004; Deng et al.,

2005; Domeniconi and Filbin, 2005) which is metabolized in cells to mono-butyrate cAMP and

the free butyrate that can have non specific effects on cells. Some groups (Li et al., 2003a) also

use adenosine- 3', 5'- cyclic monophosphorothioate, Sp-isomer (sp-cAMP), which is higher

resistance against cyclic nucleotide phosphodiesterases (that is responsible for cAMP

degradation) compared to db-cAMP and has no metabolic side effects. However, whether there

are different effects on RGCs using these different cAMP analogues is unclear. Forskolin (an

adenylate cyclase activator can elevate cAMP to non-physiological levels) alone can sufficiently

elevate cAMP levels in RGCs in culture, but it does not increase cAMP immunoreactivity in

RGCs in vivo, unless combined with the cyclic nucleotide phosphodiesterase inhibitor IBMX

(Shen et al., 1999; Chierzi et al., 2005).

Changes of cAMP levels after CNS injury have been reported before. In normal rat retina,

strong cAMP immunostaining was observed in INL, and faint staining in RGC layer; 6 days after

ON transection and PN autograft, the level of cAMP immunoreactivity was reduced in INL and

very few positive cells were found in RGC layer (Cui et al., 2003a). Similar drop of cAMP levels

after axotomy was also reported by others (Shen et al., 1999). Interestingly, in goldfish retina

where spontaneous regeneration can be successful, endogenous cAMP levels increased in the

whole retina and in RGCs during regeneration (Rodger et al., 2005). This also implies the

intrinsic response of RGCs after axotomy is controlled by cAMP levels (Shen et al., 1999),

which has been observed in other neurons as well (Cai et al., 2001; Neumann et al., 2002b; Qiu

et al., 2002; Lu et al., 2004b).

Fig 7.8 Diagram

shows the CPT-

cAMP (A) and

db-cAMP (B)

structures.

RGC survival after C3 injection In normal rats from our F344 colony, an average about 110,580±7960 βIII-tubulin positive RGCs

per retina was found (n=4). Thus after a single injection of C3-11 about 14% of RGCs remained

alive four weeks after injury compared with about 7% in the saline control group. This survival-

promoting effect is consistent with previous studies that used adult rat ON crush models

(Fischer et al., 2004b; Bertrand et al., 2005). RGC viability was not further increased by double

or triple C3-11 injection protocols, suggesting that the effects of this particular cell-permeable

C3 fusion protein are maintained for at least four weeks after an intravitreal injection. The C3–11

may act directly on RGCs but may also exert effects via other retinal cells, such as Müller cells,

108

which can influence RGC survival (Harvey et al., 2006). It is also possible that C3-11 injections

induce some macrophage activation in the eye (Fig 7.7), potentially of relevance because the

macrophage-derived factor oncomodulin has been shown to promote injured RGC survival (Yin

et al., 2003; Yin et al., 2006). However, this is unlikely, as macrophage activation is much more

massive in Zymosan injection (Fig 7.7C), and in vitro studies without the influence of

macrophages have also revealed the beneficial effects of the C3 fusion proteins (Bertrand et al.,

2005).

A number of studies have shown that Rho signalling pathways promote neuronal survival

(Kobayashi et al., 2004; Desagher et al., 2005; Kanekura et al., 2005; Loucks et al., 2006). In

cerebellar neurons, Rho family GTPases act via a pro-survival Rac-dependent mitogen-

activated protein kinase (MAPK)/ERK pathway which in turn suppresses a pro-apoptotic Janus

kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathway (Loucks

et al., 2006). Perhaps consistent with this, pharmacological inhibition of JAK/STAT increases

RGC viability in PN grafted adult rats (Park et al., 2004a); however survival is also increased

after inhibition of MAPK/ERK or PI3 kinase and, as described in the present study, by C3-11

inactivation of Rho. Others have reported that inactivation of Rho results in increased survival of

neural cells (Dubreuil et al., 2003) and ROCK is involved in the fragmentation and subsequent

phagocytosis of apoptotic cells (Orlando et al., 2006). Interestingly, the ROCK inhibitors Fasudil

and Y-27632 reduce RGC loss after NMDA-induced neurotoxicity (Kitaoka et al., 2004). In

injured spinal cord it has been suggested that Rho inactivation reduces cell death by preventing

the synthesis of pro-apoptotic proteins such as p75 (Dubreuil et al., 2003). p75 has been

implicated in developmental RGC death (Frade and Barde, 1999), and while the role of this

receptor and its close relative TROY (Park et al., 2005) in injured adult RGC survival in vivo

remains unclear, knockdown of p75 and consequent inactivation of Rho-A has been reported to

increase adult RGC viability in dissociated cultures (Ahmed et al., 2006).

Spatial differences in the distribution of surviving and regenerating RGCs In normal rat retina there is a centro-peripheral density gradient of RGCs (eg Danias et al.,

2002). RGCs in central retina are more vulnerable to ON axotomy (Klocker et al., 1997; Hou et

al., 2004a), perhaps because the length of the axon within the retina and associated trophic

support from adjacent fibres and glia influences the kinetics of RGC death (Isenmann et al.,

2003). Intraocular injections of neuroprotective factors have variously been described as

enhancing injured adult RGC survival more in central retina (Isenmann et al., 1998; Hou et al.,

2004a) or in peripheral retina (Klocker et al., 1997; Klocker et al., 1998).

The extent of RGC survival (βIII-tubulin immunopositive) and axonal regeneration (FG labeled)

was quantified at three different eccentricities within the retinas (0.1-1.4 mm, 1.4-2.8 mm, or

over 2.8 mm from the ON head) (Fig. 7.6). After two control saline injections RGC density

showed a similar centro-peripheral gradient as in normal rats. About 10% of RGCs were viable

across the whole retina; however the proportion of surviving RGCs that regenerated an axon

was higher in cells located close to the optic disk. Although the total number of viable RGCs

109

was higher, these overall trends were similar in the C3-11 and C3-11/CPT-cAMP groups. A

survival gradient was less evident in the C3-11/CNTF and C3-11/CNTF/CPT-cAMP injected

rats, but only in the latter group was this increased survival also associated with an increase in

the proportion of RGCs regenerating an axon. Remarkably, in these animals 86% of surviving

RGCs in central retina regenerated an axon 1-1.5mm into a PN graft. In peripheral retina this

proportion was reduced to just under 50%, about double the value seen in control PN grafted

eyes.

RGCs in central retina are closer to an important source of trophic factors emanating from the

grafted PN tissue, but the observed regenerative bias towards central retina was seen even

though the repeated intraocular injections would presumably have affected all surviving RGCs,

irrespective of their retinal location. These observations highlight a previously noted conundrum;

the closer a neuron is to the site of axotomy the more likely it is that the neuron will die, but if the

neuron survives it has a much greater capacity to regenerate its axon (Berkelaar et al., 1994;

Ota et al., 2002). Our data suggest that delivery of neurotrophic factors and growth inhibitor

antagonists to neurons has differential effects on survival versus axonal regeneration in vivo. It

will be of interest to determine if this distribution pattern of surviving and regenerating RGCs can

be altered by application of C3-11 and/or CNTF to the distal end of the PN graft or ON stump.

Long-distance regeneration of RGC axons in peripheral nerve grafts Within 24 hours of an ON lesion CSPGs begin to be expressed at the injury site (Selles-Navarro

et al., 2001). CSPGs are also abundant in PN sheaths and the interstitium, secreted by FBs

(Morgenstern et al., 2003) and SCs (Muir et al., 1989; Bruce et al., 2000; Castro and Kuffler,

2006). These CSPGs are up-regulated after PN injury (Zuo et al., 1998a). SC-derived myelin

also contains myelin derived inhibitors such as MAG (Filbin, 1995; Kuramoto et al., 1997) which

inhibits axonal outgrowth from adult DRG neurons (Mukhopadhyay et al., 1994) and can restrict

regeneration in PN in vivo (Torigoe and Lundborg, 1998). Shen et al. confirmed these inhibitory

effects and pointed out that successful PN regeneration occurs, but only after myelin is cleared

and myelin-specific proteins are down-regulated by SCs (Shen et al., 1998). Delay of myelin

clearance impedes PN regeneration unless the MAG gene is disrupted and the myelin is

therefore MAG-free (Schafer et al., 1996). Importantly, peripheral myelin is also non-permissive

for RGC axons (Bahr and Przyrembel, 1995).

MAG binds with the NgR and co-receptor (p75/TROY) and in the presence of an intracellular co-

receptor component Lingo-1 causes growth cone collapse by activating Rho-A (Chaudhry and

Filbin, 2006; Yiu and He, 2006). NgR, Lingo-1 and TROY are expressed by cells in the GCL,

presumed to be RGCs (Park et al., 2005; Ahmed et al., 2006). Rho and its downstream effector

ROCK also mediate axonal growth inhibition associated with CSPGs (Monnier et al., 2003).

Recent evidence also suggests that growth inhibition elicited by myelin and CSPGs can be

mediated by an NgR-and Ca2+-dependent mechanism that activates epidermal growth factor

receptor and as yet unknown downstream pathways (Koprivica et al., 2005; Ahmed et al.,

2006). In the present study, C3-11 inhibition of retinal Rho was presumably the primary

110

mechanism that led to increased long distance regenerative growth of RGC axons into PN

grafts. It was also shown that C3 fusion protein is transported from cell body to axon and vice

versa (Bertrand et al., 2005). It is most likely therefore that the C3-11 injected into the eye had

direct effects on RGCs and was also anterogradely transported to the RGC growth cones in the

PN grafts. Unlike RGC survival, dual but not single C3-11 injections were effective in eliciting

regeneration; a third injection did not further enhance the proportion of surviving RGCs that

were retrogradely labeled with FG, although in this group there were more pan-neurofilament

positive axons within the graft tissue. In C3-11 injection groups we observed gradually

decreasing numbers of axons along the grafts, although this decline appeared less with

increasing dose of C3-11 (Fig. 7.4).

Effect of combined treatment of C3-11 with CNTF and CPT-cAMP A major goal of this study was to determine whether RGC survival and/or regeneration could be

further enhanced by a combinatorial strategy that provides exogenous neurotrophic support,

enhances responses to neurotrophic factors, and at the same time blocks the effects of growth

inhibitory molecules. After ON crush, pro-regenerative effects of the Nogo-neutralizing antibody

IN-1 are potentiated by co-application with CNTF (Cui et al., 2004) and CNTF-induced growth of

adult retinal neurites in vitro is enhanced when Rho-A activity is suppressed by siRNA

knockdown of p75 (Ahmed et al., 2006). Perhaps surprisingly therefore, in the present study

twice repeated injections of C3-11 with CNTF, or C3-11 with the cAMP analogue CPT-cAMP did

not result in increased RGC viability or stimulate greater axonal regrowth. On the other hand

injections containing all three factors (C3-11/CNTF/CPT-cAMP) did alter the regenerative

response. This was the only group in which there was increased RGC survival as well as a

substantial increase in the proportion of viable RGCs (58%) that regenerated an axon into PN

grafts. These animals also contained the highest number of pan-neurofilament positive axons in

the PN grafts. A similar proportion (54%) of regenerating FG labeled RGCs was seen in the

CNTF/CPT-cAMP group (see also Cui et al., 2003), but in these rats four weeks after two

CNTF/CPT-cAMP eye injections the increase in RGC viability was not significant compared to

saline controls.

A previous report examined the mechanisms that underly the cooperative effects of CNTF and

rasied cAMP on adult RGC regeneration (Park et al., 2004a). The present data reveals further

interactive effects between Rho inhibition, CNTF and altered cyclic nucleotide levels in mature

RGCs. The effects on neuronal survival and axonal regeneration were only partially additive

suggesting some convergence in the signaling pathways activated by these various factors. As

an example, cAMP-induced activation of protein kinase A phosphorylates and thus inhibits Rho

signalling pathways (Lang et al., 1996; Dong et al., 1998). On the other hand, a more

independent route by which cAMP elevation overcomes myelin inhibitors such as MAG is by

activation of cAMP response element binding protein (CREB) and upregulation of Arginase I

and polyamines (Cai et al., 2002; Gao et al., 2004). CNTF activates multi-subunit receptor

complexes that can influence a number of signaling pathways including JAK/STAT3,

MAPK/ERK and PI3K/Akt (Park et al., 2004a). CNTF combined with other neurotrophic factors

111

appears to initiate a series of events that results in RhoA inactivation in RGCs and CNTF-

induced growth of adult retinal neurites in vitro is enhanced when RhoA is inactivated (Ahmed et

al., 2006). It remains to be determined why elevation of cAMP is required to obtain additional

synergistic effects on RGC axonal regeneration into PN grafts in vivo, although there is

evidence for cAMP-induced changes in CNTF receptor subunit expression (Park et al., 2004a)

and/or suppressor of cytokine signaling (SOCS) (Park et al., 2006).

7.5 Conclusion

In conclusion, the present study demonstrated the beneficial effects of the Rho GTPase

antagonist C3-11 on RGC survival and the regeneration of RGC axons into the relatively

permissive regenerative environment of a PN graft. These effects were significantly enhanced

by combining Rho inactivation with provision of exogeneous CNTF and intraretinal elevation of

cAMP, and together the data again reveal the power of combinatorial strategies in the

therapeutic management of neurotrauma. The mechanisms underlying these partially

synergistic effects remain to be elucidated, but it would prove informative to determine why

there were differential effects on RGC survival versus regeneration at different retinal

eccentricities and when using different combinations of growth-promoting factors.

112

Chapter Eight

Chondroitinase-ABC treated PN autografts

8.1 Introduction As described earlier (Chapter 1&2), glial scaring is an important inhibitory barrier for axonal

regrowth after CNS injury. Several inhibitory molecules exist in the glial scars including tenascin,

keratin, chondroitin sulfate proteoglycans (CSPGs) (Fig 8.1), and class III semaphorins.

Growing evidence has demonstrated that CSPGs are detrimental to neural regeneration

(Chierzi and Fawcett, 2001; Yang et al., 2006). CSPG expression is enhanced after CNS injury

(Lemons et al., 1999; Ikegami et al., 2005; Kim et al., 2006a), correlating with decreased neurite

outgrowth (Beggah et al., 2005; Properzi et al., 2005). Different strategies to overcome the

inhibitory effect of CSPGs have been tested in vivo, (i) use of an enzyme that degrades CSPGs,

Chondroitinase-ABC (Ch-ABC) (Houle et al., 2006; Kim et al., 2006a), (ii) decorin which is a

naturally antagonist of scar formation (Davies et al., 2004), (iii) DNA enzymes against the GAG-

chain initiating enzyme (Grimpe and Silver, 2004), or X ray irradiation (40 Gy) that reduce the

number of reactive astrocytes and glia formation (Zhang et al., 2005). All of these methods have

been shown to attenuate inhibitory activity of CSPGs, and promote regeneration in vivo (Dou

and Levine, 1994; Zuo et al., 1998c; Yick et al., 2000; Moon et al., 2001; Bradbury et al., 2002;

Morgenstern et al., 2002; Zuo et al., 2002; Yick et al., 2003).

Figure 8.1 Proteoglycan structure. Adapted from Histology (Ross et al., 2003).

Importantly, CSPGs are also found in the PNS. They are abundant in the PN sheaths and

interstitium. They are secreted by fibroblasts (Morgenstern et al., 2003), Schwann cells (SCs)

(Muir et al., 1989; Bruce et al., 2000; Castro and Kuffler, 2006), and up-regulated following PN

injury (Zuo et al., 1998b; Morgenstern et al., 2003). Injection of Ch-ABC near the injury site or

soaking the nerve grafts with Ch-ABC can enhance axonal regeneration through the PN injury

site (Zuo et al., 2002; Groves et al., 2005; Houle et al., 2006).

113

PN grafted on to the cut ON enhances RGC survival and axonal regeneration. The beneficial

effect of C3-11 observed in chapter 7 is probably related to inhibition of RGC responses to

myelin associated inhibitors. However, because Rho GTPase can also be activated by CSPGs

(Monnier et al., 2003; Laabs et al., 2005), the beneficial effect of C3-11 may also reflect altered

RGC responses to CSPGs (Jain et al., 2004) present in PN tissues, In the present study Ch-

ABC was tested on ON-PN graft model. I first examined the effectiveness of Ch-ABC over time.

Then I investigated whether degradation of CSPGs inside PNs by Ch-ABC could further

enhance RGC survival and/or axonal regeneration into PN grafts.

8.2 Materials and Methods See Chapter 4 for methods of optic nerve surgery, flurogold injection, immunohistochemical

staining of viable RGCs, cryosectioning and immunostaining of PN grafts, counts of RGC

number and axons in PN grafts.

Adult (8-10 weeks old) female F344 rats were used in this study. Animals were anesthetized

with intraperitoneal injections of 1:1 mixture of xylazine (20mg/ml) and ketamine (100mg/ml),

with a total injection of 1 ml/kg body weight. Animals also received a subcutaneous injection of

buprenorphine (0.02mg/kg) and intramuscular injection of Benacilin (0.1ml). Experiments

conformed to NHMRC guidelines and were approved by the Animal Ethics Committee of the

University of Western Australia.

Nerve preparation A 1.5 cm long segment of the left peroneal nerve distal to the branch point of the peroneal nerve

from sciatic nerve was dissected out from anesthetized adult Fisher 344 rats. Each PN segment

was placed into a petri dish containing 5 µl of either PBS, 10%BSA (pH 7.4), or protease-free

Ch-ABC (from Proteus vulgaris, E.C. 4.2.2.4, Seikagaku Tokyo, Japan) (20 U/ml in PBS,

10%BSA, pH 7.4). In addition, 1 µl Ch-ABC or PBS was slowly injected into each end of the PN

via a glass micropipette attached to a 50 µl Hamilton syringe. This method and concentration

have been previously shown to be effective in PN regeneration in vivo (Groves et al., 2005). PN

segments were then incubated at 37oC, in an atmosphere of 5% CO2 for 1 hour. Medium was

mixed every 15 mins, to ensure PN segments were covered in the medium at all times. After

incubation, PN segments were grafted onto the cut end of the ON as described before. Animals

were killed and analysed at different time points (see below).

Experimental Groups First, to examine the effectiveness of Ch-ABC over time, transplanted animals were divided into

Ch-ABC and control PBS groups. The Ch-ABC group (n=2 for each time point of 1, 3, 6, 10, 28

days after surgery) received PN grafts treated with Ch-ABC. The control group (n=2 for each

time point) received PN grafts treated with PBS. Animals were sacrificed and perfused at each

time point. Retinas and PN grafts were dissected out and used for analyzing RGC survival and

CSPG immunostaining. Second, the effect on RGC survival and axonal regeneration into PN

114

grafts was examined. Additional rats with PN grafts soaked with Ch-ABC (n=9) or PBS (n=10)

were kept for 4 weeks received FG injection into distal PN 3 days before sacrifice. Retinas and

PN grafts were then dissected out and used for analyzing RGC survival and axonal regrowth as

described in Chapter 4.

Cryosectioning and immunostaining of PN grafts Animals were killed by overdose of lethabarb (0.2 ml i.p.) and fixed with 4% paraformaldehyde.

PN grafts were detached from the back of the operated eye and were cryo-protected in a 30%

sucrose solution overnight. Frozen cryostat sections (16 µm thickness) were cut longitudinally or

transversely and collected. The sections were treated with blocking buffer (10% NGS in PBS

and 0.2% Triton X-100) and then incubated overnight at 4oC with primary antibodies 2-B-6

(Seikagaku, Japan; 1:100), CS-56 (Sigma; 1:200), or pan-neurofilament (Zymed; 1:400) (all

diluted in blocking buffer). Antibody 2-B-6 recognizes an epitope created following Ch-ABC

degradation of chondroitin-4 sulfate, and does not recognize intact chondroitin sulfate (Moon et

al., 2001; Zuo et al., 2002). While, CS-56 antibody immunostains a variety of CSPGs, it

recognizes the terminal portions of chondroitin sulfate -4 or -6 side chains (Avnur and Geiger,

1984; Fawcett and Asher, 1999; Moon et al., 2001). Bound primary antibody was labeled with

goat anti-mouse Cy3 conjugated secondary antibody (1:400; Jackson ImmunoResearch

Laboratories) for 1 hr at room temperature in the dark. Then sections were washed, cover

slipped in Citifluor and sealed with nail varnish. Omission of primary antibody was used as

negative control for background staining. Sections were evaluated by immunofluroescence

microscopy using a Nikon E800 epifluorescent microscope. All the sections were stained at the

same time and all pictures were taken using the same exposure time. Numerical values

(arbitrary units; higher value indicating greater staining) of the intensity of immunostaining were

generated using Image-Pro 3DS 5.1 software. Images were collected at 200x magnification,

digitized, and evaluated with a free form profile measurement tool that defined the stained

regions of the sections. The intensity of fluorescence (red signal) in CS-56, 2-B-6 antibody

positive staining was normalized by comparison to background areas. Normalized value= (raw

value-background value) /background value.

Statistical analysis

Statistical analysis was performed using GraphPad InStat version 3.06 for Windows (GraphPad

Software, San Diego, USA). RGC numbers from different groups that met the criteria for

parametric tests were analyzed by unpaired Welch’s corrected t test. Groups of data that failed

tests for normality were analyzed by the Mann-Whitney test.

8.3 Results Degradation of CSPGs by treatment of PN segments with Ch-ABC To determine whether Ch-ABC treatment could effectively degrade CSPGs throughout intact

segments of PN in vitro. Segments of rat peroneal nerve were bathed en bloc in Ch-ABC or

PBS solution for 1 hour at 37oC. CSPG degradation within the nerves was examined

immediately after incubation by immunostaining with CS-56 and 2-B-6 antibodies. 2-B-6

115

immunostaining was intense throughout the entire nerve treated with Ch-ABC; while only slight

staining was found in PBS treated nerves (Fig. 8.2 A). The arbitrary values of staining intensity

of CSPG (CS56) was slightly lower in Ch-ABC treated PN compared to PBS control; while

degraded chondroitin sulfate proteoglycans (2-B-6) was much higher in Ch-ABC treated,

compared to PBS control (Fig. 8.2 B). These results confirmed that chondroitin sulfate chains

were effectively degraded by Ch-ABC.

Time course study of CSPG expression in PN graft in vivo To determine the changes of CSPG expression in PN grafts in vivo, the immunoreactivity of

CSPGs was examined at different time points after grafting. As shown in Figure 8.3 and 8.4,

while immunoreactivity of CSPG was at similar low levels in both Ch-ABC and PBS treated

nerves just before graft; CS-56 immunoreactivity started to increase 10 days after PN graft in

the Ch-ABC group. At 28 days post grafting, much higher and diffuse CSPG immunoreactivity

was observed along the length of the PN grafts in Ch-ABC treated nerves compared with PBS

(Fig. 8.3). No significant changes of CS-56 immunoreactivity were observed during the 4 week

period in the PBS group (Fig. 8.4).

For the CSPG neoepitope, higher immunoreactivity with 2-B-6 antibody was observed in Ch-

ABC treated animals in the first 10 days after graft. Then it decreased to control levels 4 weeks

after grafting (Fig. 8.3). In PBS control group, similar levels of weak immunoreactivity of 2-B-6

were found continuously at all time points after PN grafting (Fig. 8.4).

Time course study of survival RGC number after Ch-ABC treatment In addition to analysis of CSPG changes in PNs after transplantation, βIII-tubulin

immunopositive surviving RGCs were counted at different time points (Fig. 8.5). The pattern of

RGC loss was similar in Ch-ABC or PBS treatment. RGC loss began from day 3 then increased

from day 6 to 10. At day 28 only about 7% of RGCs left (Fig. 8.5). Interestingly, from day 1 to 6

there seemed to be more RGCs in Ch-ABC treated animals compared with PBS control (Fig.

8.5). However, due to the lower animal numbers (n=2 each time point) no statistical analysis

was performed. There was no difference at 10 or 28 days post surgery (see below).

116

Figure 8.2 CSPG neoepitope immunofluorescence of chondroitinase ABC treated PN grafts in vitro. Rat

peroneal nerve segments were treated en bloc with chondroitinase ABC for 1 hour. CSPG were labeled

with CS-56 antibody, CSPG neoepitope was labeled with 2-B-6 antibody (A). All the sections were

stained at the same time and all the pictures taken using the same exposure time. (B) Histogram showing

quantification of CS-56 and 2-B-6 immunohistochemistry in PN sections in vitro. Scale bar, 100 µm.

117

0 5 10 15 20 25 300

1

2

3

2B6CS56

Days Post Injury

Flur

osce

nt In

tens

ity(a

rbitr

ary

units

)

Figure 8.3 Intensity of immunofluorescence in chondroitinase ABC treated PN grafts 1, 3, 6, 10 or 28

days after graft. CSPGs were labeled with CS-56 antibody, CSPG neoepitope was labelled with 2-B-6

antibody. All the sections were stained at the same time and all the photos taken using the same exposure

time. Scale bar, 100 µm.

118

0 5 10 15 20 25 300

1

2

3

2B6CS56

Days Post Injury

Flur

osce

nt In

tens

ity(a

rbitr

ary

units

)

Figure 8.4 Intensity of immunofluorescence in PBS treated PN grafts 1, 3, 6, 10 or 28 days after

graft. CSPGs were labeled with CS-56 antibody, CSPG neoepitope was labelled with 2-B-6 antibody. All

the sections were stained at the same time and all the photos taken using the same exposure time. Scale

bar, 100 µm.

0 5 10 15 20 250

20000

40000

60000

80000

100000

120000

140000

PBSCh-ABC

Days after surgery

RG

Cs

/ret

ina

Figure 8.5 The average number (± SEM) of surviving βIII-tubulin positive RGCs at different time points

(1, 3, 6, 10, 28 days) in control or Ch-ABC treated PN graft.

119

Similar numbers of RGCs survived 4 weeks after treatment Examples of βIII-tubulin immunopositive RGCs after PBS or Ch-ABC treatment are shown in

Figure 8.6 A and C. There was no statistical difference between the number of survival RGCs

after PBS or Ch-ABC treatment (p=0.8421, Mann-Whitney test). The average numbers and

SEMs of βIII-tubulin positive surviving RGCs were 7844±617/retina in PBS and 8381±844/retina

in Ch-ABC treated PN grafted animals (Fig. 8.7).

Figure 8.6 Examples of surviving βIII-tubulin positive and regenerating Flurogold labeled RGCs in retina

in PBS (A, B) or Ch-ABC (C, D) treated PN grafted animals. Scale bar, 100 µm.

0

1000

2000

3000

4000

5000

6000

7000

8000

9000

PBS Ch-ABC

*

SurvivingRegenerating

RG

Cs

Num

ber

/ Ret

ina

Figure 8.7 The average number (± SEM) of surviving βIII-tubulin positive and regenerating flurogold

labeled RGCs in PBS or Ch-ABC treated PN graft 4 weeks in vivo. * Significant difference level p<0.05

compared with Ch-ABC treatment group.

120

Less RGCs regenerate into PN graft 4 weeks after Ch-ABC treatment Examples of Flurogold labeled RGCs after PBS or Ch-ABC treatment are shown in Figure 8.6 B

and D. Surprisingly, there was a significant difference (p=0.0350, Mann-Whitney test) in the

average number of FG labeled RGCs in the PBS group (2563±454/retina) compared to Ch-ABC

group (1340±418/retina) (Fig. 8.7). There were fewer regenerating RGCs in the Ch-ABC treated

animals.

Immunohistochemical analysis of axonal regrowth in reconstructed PN grafts Consistent with the unexpected FG-labeled RGC counting result obtained from retinal

wholemounts, immunohistochemical staining of longitudinal PN sections with pan-neurofilament

antibody revealed consistently higher average numbers of axons in PBS treated compared to

Ch-ABC treated PN grafts along the length of the PN tissue (Fig. 8.8). In both groups there were

similar numbers of regenerating axons at the proximal end (axon entry site) of the PN grafts, but

in the Ch-ABC treated group there was a greater decrease in axonal numbers with increasing

distance along the grafts (Fig. 8.8). This decrease in numbers of regenerating axons was

consistent with the lower number of FG-labeled RGCs in the retina. Thus there was clearly a

non beneficial effect of Ch-ABC treatment on RGC axonal regrowth in PN tissues.

0 2000 4000 6000 800005

1015202530354045

PBS

Pan-neurofilament

Ch-ABC

Distance from proximal end(in 625 um increments)

No.

of r

egen

erat

ing

axon

s pe

r se

ctio

n

Figure 8.8 The average number (±SEM) of pan-neurofilament positive regenerating axons at various

distances along the PBS or Ch-ABC treated PN grafts.

8.4 Discussion Previous studies have shown that CSPGs are inhibitory molecules that can be found in glial

scars after CNS injury; digestion of CSPGs with Ch-ABC can promote axonal regeneration and

even achieve functional recovery (Zuo et al., 1998b; Bradbury et al., 2002; Yick et al., 2003;

Chau et al., 2004; Houle et al., 2006). The present study showed that (i) CSPG was expressed

in PN segments; (ii) Ch-ABC could successfully digest the side chain of CSPGs; however (iii)

121

CSPG expression was upregulated 10 days after Ch-ABC treatment and reached even more

than control level at 28 days; (iv) Ch-ABC treatment did not improve RGC survival or

regeneration 4 weeks post injury, and may even have had detrimental effects.

Previous studies using Ch-ABC The dosage of Ch-ABC used in many previous reports differs, as Ch-ABC has high molecular

weight, making it difficult to penetrate the pia mater. Furthermore, proteins (e.g. enzyme) are

generally more stable at high concentrations (Ikegami et al., 2005). Therefore, it has been

recommended to be used continuously at small volumes and high concentrations. However,

high concentration (>20 U/ml) of Ch-ABC may be detrimental in vivo (Tom et al., 2006). Some

examples of previous in vitro studies are listed here:

(a) 6-10 µm rat sciatic nerve sections were digested with 0.02 U/ml Ch-ABC for 3 h for staining

with chondroitin sulfate “stub” antibodies (Morgenstern et al., 2003).

(b) E14 retinal explant cultured with 0.5 U/ml Ch-ABC (Cheung et al., 2005).

(c) Cultured RGCs treated with 10 U/ml Ch-ABC (Inatani et al., 2001).

(d) 0.02 U/ml Ch-ABC was added to the SC and DRG co-culture 20 mins and repeated 24h,

after plating the DRG neurons (Castro and Kuffler, 2006).

Examples of in vivo studies include:

(a) 200µl of 5 U/ml Ch-ABC was intrathecally delivered to hemisected spinal cord (Chau et al.,

2004).

(b) 0.2U of 10 U/ml Ch-ABC was applied with gelfoam immediately after surgery with another 3

intrathecal injections of same volume at 3, 7, and 11 days (Kim et al., 2006a).

(b) 6µl of 10 U/ml Ch-ABC was intrathecally immediately injected to dorsally hemisected spinal

cord (Bradbury et al., 2002).

(c) 2µl of 10 µg/ml Ch-ABC was applied to complete transected spinal cord every other day for 4

weeks (Fouad et al., 2005).

(d) 200µl of 200 U/ml Ch-ABC was continuously, using osmotic pump, injected into the

subarachnoid space after spinal cord contusion injury (Ikegami et al., 2005).

(e) 3µl of 600 ng Ch-ABC was intrathecally delivered to nigrostriatal axotomy lesion at day 0, 3,

7 and 10 post axotomy (Moon et al., 2001).

(f) 1 µl of 50 U/ml Ch-ABC was injected lateral to the cuneate nucleus immediately and one

week after cervical SCI (Massey et al., 2006).

(g) 5 µl of 1 U/ml Ch-ABC was delivered by minipump to C5 dorsal quadrant spinal cord lesion

(Houle et al., 2006).

(h) 750nl of 48 U/ml Ch-ABC was injected into the superior colliculus 3 d after the retinal

scotoma (Tropea et al., 2003).

(i) 3-5 mm common fibular nerve was soaked with 10µl of 20 U/ml Ch-ABC room temperature

for 1 hour before graft (Groves et al., 2005).

(j) Distal stump of cut sciatic nerve was draped over s piece of Parafilm and soaked in 20 U/ml

Ch-ABC for 1 hour (English, 2005) or injected with 1 U in 2 µl Ch-ABC (Zuo et al., 2002) before

reconnected.

122

Importantly, the dosage applied in the present study was 7 µl of 20 U/ml (in PBS and 10%BSA;

pH 7.4), including 1 µl Ch-ABC was injected into each end of the PN. This concentration is

consistent with most in vivo studies and has been shown previously to be effective in promoting

PN regeneration in vivo (Groves et al., 2005).

Effect of Ch-ABC on RGC survival The changes of RGC number after ON transection and PN graft are consistent with previous

reports (Villegas-Perez et al., 1988; Berkelaar et al., 1994) i.e. RGCs are still alive and look

normal in 3 days (Thanos, 1988), after 5 days they begin to die, death rate peaking at about 7

days post injury (Fig. 8.5). There was a slight difference between the two groups in the first 10

days but after 10 days there was no difference in the number of surviving RGCs in the two

treatment groups.

Effect of Ch-ABC on RGC regeneration CSPGs exist in normal animal tissues and are secreted by FBs (Morgenstern et al., 2003), SCs

(Muir et al., 1989; Bruce et al., 2000; Castro and Kuffler, 2006), oligodendrocyte precursors,

meningeal cells (Properzi et al., 2005) and reactive astrocytes (McKeon et al., 1991). After injury

to the adult CNS, numerous cytokines and growth factors are released, contributing to reactive

gliosis and extracellular matrix production (Smith and Strunz, 2005). This glial scar structure

forms an inhibitory substrate for axon re-growth. CSPGs are up-regulated specifically around

the lesion site where the glial scar forms (Ikegami et al., 2005) and contributes to neuronal

growth inhibition, specifically through the CSPG sugar side chains. These chains are composed

of repeats of the same disaccharide unit carrying sulphate groups in different positions. The

sulphation pattern directly influences the CSPG binding properties and function. However the

specific sulphation pattern required for the inhibitory activity of these molecules on axonal

growth is still unknown (Properzi et al., 2003; McCann et al., 2006).

Based on previous work, we hypothesized that Ch-ABC treatment in PN would eliminate the

inhibitory effect of CSPGs and therefore provide a more permissive environment, further

improving axonal regrowth from adult RGCs. However, on the contrary, in vivo results showed

that Ch-ABC treatment is not effective in promoting RGC axonal regeneration into PN grafts.

Some possible explanations may be: (i) A single initial pre-transplantation treatment of Ch-ABC

can not fully remove the GAGs from CSPGs that are made afterwards, i.e. compensatory over-

production of CSPGs; (ii) Effects of Ch-ABC are transient, consistent with some previous

observations (Bruckner et al., 1998); (iii) The enzyme is not effective in removing all GAGs from

CSPGs; (iv) The neurite-outgrowth inhibitory effect of CSPGs on RGCs is associated with not

only the GAGs but also the core glycoprotein; (v) Ch-ABC treatment may disrupt the nerve

sheath organization and alter extracellular matrix structure which are beneficial to axon

regrowth. These various issues are addressed in the following discussion.

123

Previous studies have shown that Ch-ABC treatment does not influence the structural integrity

of laminin-rich basal lamina tubes inside PN. Laminin staining was intense, and basal laminae

appeared intact compared to control (Krekoski et al., 2001). Ch-ABC is regarded as safe, with

no adverse effects on nerve tissues or blood vessels after local application, and currently being

used in clinical trials as a chemonucleolytic agent (Olmarker et al., 1996; Takahashi, 2004).

Therefore, the lack of beneficial effect is unlikely to be correlated to an adverse effect on PN

structures.

In vitro treatment of PNs with Ch-ABC was effective in digesting the CSPG side chains;

however Ch-ABC cannot completely remove GAG chains from the protein core (Grimpe and

Silver, 2004). CSPG removal alone may not be sufficient to significantly diminish the inhibitory

effects of specific CSPGs (Lemons et al., 2003; Groves et al., 2005), or other inhibitors (Groves

et al., 2005). For example, tenascin, which is also expressed in the lesioned adult rat ON, may

influence the early stages in the formation of the glia limitans, and thus prevent the regeneration

of CNS tissue after injury (Ajemian et al., 1994). Recently, a proteoglycan was identified using a

new monoclonal antibody (hybridoma clone mab Te38), that did not alter its inhibitory properties

after Ch-ABC treatment. It is expressed in cells in the optic fissure, the dorsal ON or the chiasm

and inhibits RGC axon outgrowth (Henke-Fahle et al., 2001).

Apart from the possible existence of other Ch-ABC non-response growth inhibitors, Ch-ABC

treatment may be more effective on fast regenerating axons such as the axons regrowing in the

acellular graft 2-4 days after transplantation (Krekoski et al., 2001; Zuo et al., 2002), but not on

the populations of slowly growing axons in PN (Groves et al., 2005; Hoke, 2005) or the RGC

axons in the present study. This lack of effect on slowly growing axons is likely due to the

restoration and even upregulation of CSPGs in the grafts shown in the present study and other

previous reports (Bruckner et al., 1998; Heine et al., 2004; Hoke, 2005).

Furthermore, the sub-components of CSPGs that are inhibitory to RGC regeneration remain

unclear. A recent study indicates that degradation of the CSPG side chain of chondroitin-4-

sulfate or chondroitin-6-sulfate has different effects on axonal regrowth (McCann et al., 2006).

Digestion of both 4- and 6- chondroitin sulfate side chains may not be effective to remove or

inactivate the inhibitory site of CSPGs. Another study showed that neurocan and phosphacan

inhibited neurite outgrowth from RGCs after 48 and 72 hours in culture. However, when CSPG

side chains linked to the core proteins were digested by Ch-ABC, the inhibitory effect remained

and even significantly enhanced the inhibitory effect of phosphacan on neurite outgrowth from

RGCs (Inatani et al., 2001). Thus these data suggest that the presence of CSPG core protein

may have continued to exert growth-inhibitory actions on RGC axons (Ughrin et al., 2003).

Interestingly, regeneration of goldfish ON axons was found to be accompanied by a major

increase of a 28kD CSPG (Pizzi and Elam, 2004).

124

8.5 Conclusion Previous studies have shown PN tissue is not a fully permissive environment for axonal growth

after injury, and caintains axonal growth inhibitors such as MAG and CSPGs. Inhibition of the

Rho GTPase by C3-11 promotes RGC survival and axonal regeneration into autologous PN

grafts (Chapter 7). However the data from the present study using Ch-ABC did not further clarify

this issue. The chondroitinase treatment was initially effective in degrading CSPGs, but over

time new CSPGs were synthesized, by 28 days reaching levels higher than control. These data

suggest a compensatory over-production of CSPGs in the Ch-ABC treated grafts, perhaps

explaining the decreased RGC axonal regeneration in this particular transplant paradigm.

125

Chapter Nine

General discussion

The overall aims of this project were to develop novel combinations of therapies that can

improve the viability and regenerative capacity of RGCs and, hopefully, develop strategies that

can be of more widespread use in CNS repair.

The first part of the project (Chapter 4) described the development of new types of PN bridges

that contained genetically modified adult SCs. Extended from previous studies (Cui et al., 1999;

Cui et al., 2003b), SCs transduced with lentiviral vectors encoding a secretable form of CNTF

were used to reconstitute PN grafts. The PN grafts were sutured on to the cut ON of adult rats.

The in vivo results showed that transducing SCs led to enhanced RGC survival and increased

axonal regrowth in reconstructed PN bridges. This novel technique could provide a clinical

alternative to using multiple PN autografts to promote regrowth in injured CNS. It provides a

basis for the development of new therapeutic alternatives for the treatment of traumatic CNS

injuries, alternatives that may also be of benefit in the field of plastic surgery and PN repair.

These finds were further extended in the following chapters (Chapter 5&6) in two directions: the

efficiency of 1) other neurotrophic factors including BDNF and GDNF, and 2) fibroblasts

expressing CNTF were also tested in these reconstituted PN transplants. Neither of these

approaches led to beneficial effects on RGCs, although PN containing BDNF engineered SCs

attracted substantial numbers of peripheral sensory neural axons from the surrounding

environment into the reconstructed nerves. The data suggest that fibroblasts are not a suitable

candidate for reconstituting PN grafts, even when engineered to express relevant growth

factors. Incorporation of mixed populations of fibroblasts and SCs was also less effective than

using pure SC populations. Despite the lack of positive outcomes in these extended

transplantation experiments, what has become clear is that the nature of the neurotrophic

factors and the cell type expressing these factors are crucial elements in successful CNS repair

strategies.

Apart from modifying and enhancing axonal regrowth, it is also important to maintain RGC cell

viability so that the greatest amount of regeneration is achieved. The next part of the study

(Chapter 7) therefore investigated the effects of intraocular application of a range of

pharmacological agents and other factors. Targeting Rho GTPase, the effect of C3 transferase

was tested on RGC survival and axonal regeneration into PN autografts. Results showed that

there was significantly more RGC survival and axonal regeneration in PN autografts after

repeated intraocular injection of C3-11. This effect was further enhanced when combined with

CPT-cAMP plus CNTF. The use of combination therapies therefore offers the best hope for

126

robust and substantial regeneration. The effect of C3 transferase combined with other types of

neurotrophic factor remains to be examined.

Recent rapid advances in our knowledge of neuron growth inhibitory molecules and pathways

makes it clear that PN tissue is not a completely permissive environment for CNS axonal

regrowth. CSPG is a growth inhibitory molecule abundantly expressed in PN and peripheral

myelin also contains blocking factors (MAG). Therefore in the last part of my study (Chapter 8), I

examined the effect of degradation of CSPGs inside PNs by Ch-ABC. However, in vivo results

showed that this treatment did not improve RGC survival or regeneration. On the contrary, it

actually reduced the amount of RGC axon regeneration. It also suggested a possible

compensatory over-production of CSPGs over time although the exact reason for this requires

further investigation.

Overall, the results from the present study further reveal the complex nature of the injured adult

CNS. Even using combined therapy, there seems to be an upper limit for promoting RGC

survival (usually up to about 20% of the total RGC population survive) that limits the success of

RGC regeneration. What is the reason for this? Is the survival and regeneration response a

random or stochastic event (Harvey et al., 2006)? It is clear that it is important to better

understand the signalling pathways, interaction between different NTs, pharmacological

interventions and the molecular mechanisms that control RGC survival and/or axonal

regeneration after injury. Only then can we design better combinatorial strategies, hopefully

leading to improved functional recovery. To date, most efforts have focused on the extrinsic

influences, more future studies should target on strategies enhancing the intrinsic growth

potential of neurons. Each of the strategies described in the present study might only produce

small improvements; however a combination of therapies could achieve significant beneficial

effects.

127

References: Abdel-Latif D, Steward M, Macdonald DL, Francis GA, Dinauer MC, Lacy P (2004) Rac2 is critical for

neutrophil primary granule exocytosis. Blood 104:832-839. Accioli-De-Vaconcellos ZA, Kassar-Duchossoy L, Mira JC (1999) Long term evaluation of experimental

median nerve repair by frozen and fresh nerve autografts, allografts and allografts repopulated by autologous Schwann cells. Restor Neurol Neurosci 15:17-24.

Acevedo L, Yu J, Erdjument-Bromage H, Miao RQ, Kim JE, Fulton D, Tempst P, Strittmatter SM, Sessa WC (2004) A new role for Nogo as a regulator of vascular remodeling. Nat Med 10:382-388.

Aebischer P, Schluep M, Deglon N, Joseph JM, Hirt L, Heyd B, Goddard M, Hammang JP, Zurn AD, Kato AC, Regli F, Baetge EE (1996) Intrathecal delivery of CNTF using encapsulated genetically modified xenogeneic cells in amyotrophic lateral sclerosis patients. Nat Med 2:696-699.

Agerman K, Hjerling-Leffler J, Blanchard MP, Scarfone E, Canlon B, Nosrat C, Ernfors P (2003) BDNF gene replacement reveals multiple mechanisms for establishing neurotrophin specificity during sensory nervous system development. Development 130:1479-1491.

Ahmed Z, Suggate EL, Brown ER, Dent RG, Armstrong SJ, Barrett LB, Berry M, Logan A (2006) Schwann cell-derived factor-induced modulation of the NgR/p75NTR/EGFR axis disinhibits axon growth through CNS myelin in vivo and in vitro. Brain 129:1517-1533.

Ahuja P, Caffe AR, Holmqvist I, Soderpalm AK, Singh DP, Shinohara T, van Veen T (2001) Lens epithelium-derived growth factor (LEDGF) delays photoreceptor degeneration in explants of rd/rd mouse retina. Neuroreport 12:2951-2955.

Airaksinen MS, Saarma M (2002) The GDNF family: signalling, biological functions and therapeutic value. Nat Rev Neurosci 3:383-394.

Ajemian A, Ness R, David S (1994) Tenascin in the injured rat optic nerve and in non-neuronal cells in vitro: potential role in neural repair. J Comp Neurol 340:233-242.

Al-Chalabi A, Scheffler MD, Smith BN, Parton MJ, Cudkowicz ME, Andersen PM, Hayden DL, Hansen VK, Turner MR, Shaw CE, Leigh PN, Brown RH, Jr. (2003) Ciliary neurotrophic factor genotype does not influence clinical phenotype in amyotrophic lateral sclerosis. Ann Neurol 54:130-134.

Alabed YZ, Grados-Munro E, Ferraro GB, Hsieh SH, Fournier AE (2006) Neuronal responses to myelin are mediated by rho kinase. J Neurochem 96:1616-1625.

Alberch J, Perez-Navarro E, Canals JM (2004) Neurotrophic factors in Huntington's disease. Prog Brain Res 146:195-229.

Alcantara S, Ruiz M, De Castro F, Soriano E, Sotelo C (2000) Netrin 1 acts as an attractive or as a repulsive cue for distinct migrating neurons during the development of the cerebellar system. Development 127:1359-1372.

Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA (1996) Mechanism of activation of protein kinase B by insulin and IGF-1. Embo J 15:6541-6551.

Anand P, Terenghi G, Birch R, Wellmer A, Cedarbaum JM, Lindsay RM, Williams-Chestnut RE, Sinicropi DV (1997) Endogenous NGF and CNTF levels in human peripheral nerve injury. Neuroreport 8:1935-1938.

Anderson MF, Aberg MA, Nilsson M, Eriksson PS (2002) Insulin-like growth factor-I and neurogenesis in the adult mammalian brain. Brain Res Dev Brain Res 134:115-122.

Apfel SC, Kessler JA, Adornato BT, Litchy WJ, Sanders C, Rask CA (1998) Recombinant human nerve growth factor in the treatment of diabetic polyneuropathy. NGF Study Group. Neurology 51:695-702.

Apostolova I, Irintchev A, Schachner M (2006) Tenascin-R Restricts Posttraumatic Remodeling of Motoneuron Innervation and Functional Recovery after Spinal Cord Injury in Adult Mice. J Neurosci 26:7849-7859.

Arakawa Y, Sendtner M, Thoenen H (1990) Survival effect of ciliary neurotrophic factor (CNTF) on chick embryonic motoneurons in culture: comparison with other neurotrophic factors and cytokines. J Neurosci 10:3507-3515.

Arinami T, Toru M (1996) No evidence for association between CNTF null mutant allele and schizophrenia. Br J Psychiatry 169:253.

Arsenijevic Y, Weiss S (1998) Insulin-like growth factor-I is a differentiation factor for postmitotic CNS stem cell-derived neuronal precursors: distinct actions from those of brain-derived neurotrophic factor. J Neurosci 18:2118-2128.

Asan E, Langenhan T, Holtmann B, Bock H, Sendtner M, Carroll P (2003) Ciliary neurotrophic factor in the olfactory bulb of rats and mice. Neuroscience 120:99-112.

128

Asher RA, Morgenstern DA, Fidler PS, Adcock KH, Oohira A, Braistead JE, Levine JM, Margolis RU, Rogers JH, Fawcett JW (2000) Neurocan is upregulated in injured brain and in cytokine-treated astrocytes. J Neurosci 20:2427-2438.

Aspenstrom P, Fransson A, Saras J (2004) Rho GTPases have diverse effects on the organization of the actin filament system. Biochem J 377:327-337.

Assouline JG, Bosch P, Lim R, Kim IS, Jensen R, Pantazis NJ (1987) Rat astrocytes and Schwann cells in culture synthesize nerve growth factor-like neurite-promoting factors. Brain Res 428:103-118.

Avnur Z, Geiger B (1984) Immunocytochemical localization of native chondroitin-sulfate in tissues and cultured cells using specific monoclonal antibody. Cell 38:811-822.

Avwenagha O, Campbell G, Bird MM (2003) The outgrowth response of the axons of developing and regenerating rat retinal ganglion cells in vitro to neurotrophin treatment. J Neurocytol 32:1055-1075.

Azanchi R, Bernal G, Gupta R, Keirstead HS (2004) Combined demyelination plus Schwann cell transplantation therapy increases spread of cells and axonal regeneration following contusion injury. J Neurotrauma 21:775-788.

Bachoud-Levi AC, Deglon N, Nguyen JP, Bloch J, Bourdet C, Winkel L, Remy P, Goddard M, Lefaucheur JP, Brugieres P, Baudic S, Cesaro P, Peschanski M, Aebischer P (2000) Neuroprotective gene therapy for Huntington's disease using a polymer encapsulated BHK cell line engineered to secrete human CNTF. Hum Gene Ther 11:1723-1729.

Bahr M (2000) Live or let die - retinal ganglion cell death and survival during development and in the lesioned adult CNS. Trends Neurosci 23:483-490.

Bahr M, Przyrembel C (1995) Myelin from peripheral and central nervous system is a nonpermissive substrate for retinal ganglion cell axons. Exp Neurol 134:87-93.

Bahr M, Vanselow J, Thanos S (1988) In vitro regeneration of adult rat ganglion cell axons from retinal explants. Exp Brain Res 73:393-401.

Baloh RH, Enomoto H, Johnson EM, Jr., Milbrandt J (2000) The GDNF family ligands and receptors - implications for neural development. Curr Opin Neurobiol 10:103-110.

Bampton ET, Ma CH, Tolkovsky AM, Taylor JS (2005) Osteonectin is a Schwann cell-secreted factor that promotes retinal ganglion cell survival and process outgrowth. Eur J Neurosci 21:2611-2623.

Bandtlow C, Dechant G (2004) From cell death to neuronal regeneration, effects of the p75 neurotrophin receptor depend on interactions with partner subunits. Sci STKE 2004:pe24.

Bandtlow CE (2003) Regeneration in the central nervous system. Exp Gerontol 38:79-86. Bandtlow CE, Zimmermann DR (2000) Proteoglycans in the developing brain: new conceptual insights

for old proteins. Physiol Rev 80:1267-1290. Barbin G, Manthorpe M, Varon S (1984) Purification of the chick eye ciliary neuronotrophic factor. J

Neurochem 43:1468-1478. Barde YA (1990) The nerve growth factor family. Prog Growth Factor Res 2:237-248. Barde YA, Davies AM, Johnson JE, Lindsay RM, Thoenen H (1987) Brain derived neurotrophic factor.

Prog Brain Res 71:185-189. Barnett NL, Pow DV, Bull ND (2001) Differential perturbation of neuronal and glial glutamate

transport systems in retinal ischaemia. Neurochem Int 39:291-299. Barton WA, Liu BP, Tzvetkova D, Jeffrey PD, Fournier AE, Sah D, Cate R, Strittmatter SM, Nikolov

DB (2003) Structure and axon outgrowth inhibitor binding of the Nogo-66 receptor and related proteins. Embo J 22:3291-3302.

Bartsch U, Faissner A, Trotter J, Dorries U, Bartsch S, Mohajeri H, Schachner M (1994) Tenascin demarcates the boundary between the myelinated and nonmyelinated part of retinal ganglion cell axons in the developing and adult mouse. J Neurosci 14:4756-4768.

Bartsch U, Bandtlow CE, Schnell L, Bartsch S, Spillmann AA, Rubin BP, Hillenbrand R, Montag D, Schwab ME, Schachner M (1995) Lack of evidence that myelin-associated glycoprotein is a major inhibitor of axonal regeneration in the CNS. Neuron 15:1375-1381.

Bates CA, Meyer RL (1997) The neurite-promoting effect of laminin is mediated by different mechanisms in embryonic and adult regenerating mouse optic axons in vitro. Dev Biol 181:91-101.

Battiston B, Geuna S, Ferrero M, Tos P (2005) Nerve repair by means of tubulization: literature review and personal clinical experience comparing biological and synthetic conduits for sensory nerve repair. Microsurgery 25:258-267.

129

Baxter GT, Radeke MJ, Kuo RC, Makrides V, Hinkle B, Hoang R, Medina-Selby A, Coit D, Valenzuela P, Feinstein SC (1997) Signal transduction mediated by the truncated trkB receptor isoforms, trkB.T1 and trkB.T2. J Neurosci 17:2683-2690.

Beattie MS, Harrington AW, Lee R, Kim JY, Boyce SL, Longo FM, Bresnahan JC, Hempstead BL, Yoon SO (2002) ProNGF induces p75-mediated death of oligodendrocytes following spinal cord injury. Neuron 36:375-386.

Beazley LD, Rodger J, Chen P, Tee LB, Stirling RV, Taylor AL, Dunlop SA (2003) Training on a visual task improves the outcome of optic nerve regeneration. J Neurotrauma 20:1263-1270.

Bechade C, Mallecourt C, Sedel F, Vyas S, Triller A (2002) Motoneuron-derived neurotrophin-3 is a survival factor for PAX2-expressing spinal interneurons. J Neurosci 22:8779-8784.

Becker CG, Schweitzer J, Feldner J, Schachner M, Becker T (2004) Tenascin-R as a repellent guidance molecule for newly growing and regenerating optic axons in adult zebrafish. Mol Cell Neurosci 26:376-389.

Becker T, Anliker B, Becker CG, Taylor J, Schachner M, Meyer RL, Bartsch U (2000) Tenascin-R inhibits regrowth of optic fibers in vitro and persists in the optic nerve of mice after injury. Glia 29:330-346.

Beggah AT, Dours-Zimmermann MT, Barras FM, Brosius A, Zimmermann DR, Zurn AD (2005) Lesion-induced differential expression and cell association of Neurocan, Brevican, Versican V1 and V2 in the mouse dorsal root entry zone. Neuroscience 133:749-762.

Begum R, Nur EKMS, Zaman MA (2004) The role of Rho GTPases in the regulation of the rearrangement of actin cytoskeleton and cell movement. Exp Mol Med 36:358-366.

Beltran WA, Rohrer H, Aguirre GD (2005) Immunolocalization of ciliary neurotrophic factor receptor alpha (CNTFRalpha) in mammalian photoreceptor cells. Mol Vis 11:232-244.

Benfey M, Aguayo AJ (1982) Extensive elongation of axons from rat brain into peripheral nerve grafts. Nature 296:150-152.

Benowitz LI, Goldberg DE, Madsen JR, Soni D, Irwin N (1999) Inosine stimulates extensive axon collateral growth in the rat corticospinal tract after injury. Proc Natl Acad Sci U S A 96:13486-13490.

Benowitz LI, Jing Y, Tabibiazar R, Jo SA, Petrausch B, Stuermer CA, Rosenberg PA, Irwin N (1998) Axon outgrowth is regulated by an intracellular purine-sensitive mechanism in retinal ganglion cells. J Biol Chem 273:29626-29634.

Benson MD, Romero MI, Lush ME, Lu QR, Henkemeyer M, Parada LF (2005) Ephrin-B3 is a myelin-based inhibitor of neurite outgrowth. Proc Natl Acad Sci U S A 102:10694-10699.

Berardi N, Lodovichi C, Caleo M, Pizzorusso T, Maffei L (1999) Role of neurotrophins in neural plasticity: what we learn from the visual cortex. Restor Neurol Neurosci 15:125-136.

Bergua A, Schrodl F, Neuhuber WL (2003) Vasoactive intestinal and calcitonin gene-related peptides, tyrosine hydroxylase and nitrergic markers in the innervation of the rat central retinal artery. Exp Eye Res 77:367-374.

Berkelaar M, Clarke DB, Wang YC, Bray GM, Aguayo AJ (1994) Axotomy results in delayed death and apoptosis of retinal ganglion cells in adult rats. J Neurosci 14:4368-4374.

Berkemeier LR, Winslow JW, Kaplan DR, Nikolics K, Goeddel DV, Rosenthal A (1991) Neurotrophin-5: a novel neurotrophic factor that activates trk and trkB. Neuron 7:857-866.

Berkowitz BA, Lukaszew RA, Mullins CM, Penn JS (1998) Impaired hyaloidal circulation function and uncoordinated ocular growth patterns in experimental retinopathy of prematurity. Invest Ophthalmol Vis Sci 39:391-396.

Bernhard M, Gries A, Kremer P, Bottiger BW (2005a) Spinal cord injury (SCI)-Prehospital management. Resuscitation 66:127-139.

Bernhard M, Gries A, Kremer P, Martin-Villalba A, Bottiger BW (2005b) [Prehospital management of spinal cord injuries.]. Anaesthesist 54:357-376.

Berry M, Carlile J, Hunter A (1996) Peripheral nerve explants grafted into the vitreous body of the eye promote the regeneration of retinal ganglion cell axons severed in the optic nerve. J Neurocytol 25:147-170.

Berry M, Rees L, Hall S, Yiu P, Sievers J (1988) Optic axons regenerate into sciatic nerve isografts only in the presence of Schwann cells. Brain Res Bull 20:223-231.

Berry M, Barrett L, Seymour L, Baird A, Logan A (2001a) Gene therapy for central nervous system repair. Curr Opin Mol Ther 3:338-349.

Berry M, Maxwell WL, Logan A, Mathewson A, McConnell P, Ashhurst DE, Thomas GH (1983) Deposition of scar tissue in the central nervous system. Acta Neurochir Suppl (Wien) 32:31-53.

130

Berry M, Gonzalez AM, Clarke W, Greenlees L, Barrett L, Tsang W, Seymour L, Bonadio J, Logan A, Baird A (2001b) Sustained effects of gene-activated matrices after CNS injury. Mol Cell Neurosci 17:706-716.

Bertrand J, Di Polo A, McKerracher L (2007) Enhanced survival and regeneration of axotomized retinal neurons by repeated delivery of cell-permeable C3-like Rho antagonists. Neurobiol Dis 25:65-72.

Bertrand J, Winton MJ, Rodriguez-Hernandez N, Campenot RB, McKerracher L (2005) Application of rho antagonist to neuronal cell bodies promotes neurite growth in compartmented cultures and regeneration of retinal ganglion cell axons in the optic nerve of adult rats. J Neurosci 25:1113-1121.

Bhatt DH, Otto SJ, Depoister B, Fetcho JR (2004) Cyclic AMP-induced repair of zebrafish spinal circuits. Science 305:254-258.

Biffo S, Offenhauser N, Carter BD, Barde YA (1995) Selective binding and internalisation by truncated receptors restrict the availability of BDNF during development. Development 121:2461-2470.

Billadeau DD (2002) Cell growth and metastasis in pancreatic cancer: is Vav the Rho'd to activation? Int J Gastrointest Cancer 31:5-13.

Bishop AL, Hall A (2000) Rho GTPases and their effector proteins. Biochem J 348 Pt 2:241-255. Blanco RE, Lopez-Roca A, Soto J, Blagburn JM (2000) Basic fibroblast growth factor applied to the optic

nerve after injury increases long-term cell survival in the frog retina. J Comp Neurol 423:646-658.

Blesch A, Tuszynski MH (2001) GDNF gene delivery to injured adult CNS motor neurons promotes axonal growth, expression of the trophic neuropeptide CGRP, and cellular protection. J Comp Neurol 436:399-410.

Blesch A, Conner JM, Tuszynski MH (2001) Modulation of neuronal survival and axonal growth in vivo by tetracycline-regulated neurotrophin expression. Gene Ther 8:954-960.

Blesch A, Yang H, Weidner N, Hoang A, Otero D (2004) Axonal responses to cellularly delivered NT-4/5 after spinal cord injury. Mol Cell Neurosci 27:190-201.

Blits B, Dijkhuizen PA, Hermens WT, Van Esseveldt LK, Boer GJ, Verhaagen J (2000) The use of adenoviral vectors and ex vivo transduced neurotransplants: towards promotion of neuroregeneration. Cell Transplant 9:169-178.

Blits B, Dijkhuizen PA, Carlstedt TP, Poldervaart H, Schiemanck S, Boer GJ, Verhaagen J (1999) Adenoviral vector-mediated expression of a foreign gene in peripheral nerve tissue bridges implanted in the injured peripheral and central nervous system. Exp Neurol 160:256-267.

Bloch J, Bachoud-Levi AC, Deglon N, Lefaucheur JP, Winkel L, Palfi S, Nguyen JP, Bourdet C, Gaura V, Remy P, Brugieres P, Boisse MF, Baudic S, Cesaro P, Hantraye P, Aebischer P, Peschanski M (2004) Neuroprotective gene therapy for Huntington's disease, using polymer-encapsulated cells engineered to secrete human ciliary neurotrophic factor: results of a phase I study. Hum Gene Ther 15:968-975.

Blottner D, Bruggemann W, Unsicker K (1989) Ciliary neurotrophic factor supports target-deprived preganglionic sympathetic spinal cord neurons. Neurosci Lett 105:316-320.

Bohn MC (2004) Motoneurons crave glial cell line-derived neurotrophic factor. Exp Neurol 190:263-275. Bok D, Yasumura D, Matthes MT, Ruiz A, Duncan JL, Chappelow AV, Zolutukhin S, Hauswirth W,

LaVail MM (2002) Effects of adeno-associated virus-vectored ciliary neurotrophic factor on retinal structure and function in mice with a P216L rds/peripherin mutation. Exp Eye Res 74:719-735.

Bondy CA, Cheng CM (2002) Insulin-like growth factor-1 promotes neuronal glucose utilization during brain development and repair processes. Int Rev Neurobiol 51:189-217.

Bonnet D, Garcia M, Vecino E, Lorentz JG, Sahel J, Hicks D (2004) Brain-derived neurotrophic factor signalling in adult pig retinal ganglion cell neurite regeneration in vitro. Brain Res 1007:142-151.

Bonnington JK, McNaughton PA (2003) Signalling pathways involved in the sensitisation of mouse nociceptive neurones by nerve growth factor. J Physiol 551:433-446.

Borasio GD, Robberecht W, Leigh PN, Emile J, Guiloff RJ, Jerusalem F, Silani V, Vos PE, Wokke JH, Dobbins T (1998) A placebo-controlled trial of insulin-like growth factor-I in amyotrophic lateral sclerosis. European ALS/IGF-I Study Group. Neurology 51:583-586.

Borisoff JF, Chan CC, Hiebert GW, Oschipok L, Robertson GS, Zamboni R, Steeves JD, Tetzlaff W (2003) Suppression of Rho-kinase activity promotes axonal growth on inhibitory CNS substrates. Mol Cell Neurosci 22:405-416.

Bosco A, Linden R (1999) BDNF and NT-4 differentially modulate neurite outgrowth in developing retinal ganglion cells. J Neurosci Res 57:759-769.

131

Bosse F, Hasenpusch-Theil K, Kury P, Muller HW (2006) Gene expression profiling reveals that peripheral nerve regeneration is a consequence of both novel injury-dependent and reactivated developmental processes. J Neurochem 96:1441-1457.

Bothwell M (1997) Neurotrophin function in skin. J Investig Dermatol Symp Proc 2:27-30. Boulton TG, Stahl N, Yancopoulos GD (1994) Ciliary neurotrophic factor/leukemia inhibitory

factor/interleukin 6/oncostatin M family of cytokines induces tyrosine phosphorylation of a common set of proteins overlapping those induced by other cytokines and growth factors. J Biol Chem 269:11648-11655.

Bovolenta P, Fernaud-Espinosa I (2000) Nervous system proteoglycans as modulators of neurite outgrowth. Prog Neurobiol 61:113-132.

Bovolenta P, Wandosell F, Nieto-Sampedro M (1992) CNS glial scar tissue: a source of molecules which inhibit central neurite outgrowth. Prog Brain Res 94:367-379.

Boyd JG, Lee J, Skihar V, Doucette R, Kawaja MD (2004) LacZ-expressing olfactory ensheathing cells do not associate with myelinated axons after implantation into the compressed spinal cord. Proc Natl Acad Sci U S A 101:2162-2166.

Brabeck C, Beschorner R, Conrad S, Mittelbronn M, Bekure K, Meyermann R, Schluesener HJ, Schwab JM (2004) Lesional expression of RhoA and RhoB following traumatic brain injury in humans. J Neurotrauma 21:697-706.

Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, Fawcett JW, McMahon SB (2002) Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature 416:636-640.

Bramlett HM, Dietrich WD (2001) Neuropathological protection after traumatic brain injury in intact female rats versus males or ovariectomized females. J Neurotrauma 18:891-900.

Bray GM, Villegas-Perez MP, Vidal-Sanz M, Aguayo AJ (1987) The use of peripheral nerve grafts to enhance neuronal survival, promote growth and permit terminal reconnections in the central nervous system of adult rats. J Exp Biol 132:5-19.

Brenner MJ, Lowe JB, 3rd, Fox IK, Mackinnon SE, Hunter DA, Darcy MD, Duncan JR, Wood P, Mohanakumar T (2005) Effects of Schwann cells and donor antigen on long-nerve allograft regeneration. Microsurgery 25:61-70.

Brierley CM, Crang AJ, Iwashita Y, Gilson JM, Scolding NJ, Compston DA, Blakemore WF (2001) Remyelination of demyelinated CNS axons by transplanted human schwann cells: the deleterious effect of contaminating fibroblasts. Cell Transplant 10:305-315.

Brodkey JA, Laywell ED, O'Brien TF, Faissner A, Stefansson K, Dorries HU, Schachner M, Steindler DA (1995) Focal brain injury and upregulation of a developmentally regulated extracellular matrix protein. J Neurosurg 82:106-112.

Brodski C, Schnurch H, Dechant G (2000) Neurotrophin-3 promotes the cholinergic differentiation of sympathetic neurons. Proc Natl Acad Sci U S A 97:9683-9688.

Bromley E, Knapp D, Wardle FC, Sun BI, Collins-Racie L, LaVallie E, Smith JC, Sive HL (2004) Identification and characterisation of the posteriorly-expressed Xenopus neurotrophin receptor homolog genes fullback and fullback-like. Gene Expr Patterns 5:135-140.

Bronfman FC, Fainzilber M (2004) Multi-tasking by the p75 neurotrophin receptor: sortilin things out? EMBO Rep 5:867-871.

Brooks DE, Komaromy AM, Kallberg ME (1999) Comparative retinal ganglion cell and optic nerve morphology. Vet Ophthalmol 2:3-11.

Broome JD, Wills KV, Lapchak PA, Ghetti B, Camp LL, Bayer SA (1999) Glial cell line-derived neurotrophic factor protects midbrain dopamine neurons from the lethal action of the weaver gene: a quantitative immunocytochemical study. Brain Res Dev Brain Res 116:1-7.

Brosamle C, Huber AB, Fiedler M, Skerra A, Schwab ME (2000) Regeneration of lesioned corticospinal tract fibers in the adult rat induced by a recombinant, humanized IN-1 antibody fragment. J Neurosci 20:8061-8068.

Brown A, Ricci MJ, Weaver LC (2004) NGF message and protein distribution in the injured rat spinal cord. Exp Neurol 188:115-127.

Brown A, Yates PA, Burrola P, Ortuno D, Vaidya A, Jessell TM, Pfaff SL, O'Leary DD, Lemke G (2000) Topographic mapping from the retina to the midbrain is controlled by relative but not absolute levels of EphA receptor signaling. Cell 102:77-88.

Bruce JH, Norenberg MD, Kraydieh S, Puckett W, Marcillo A, Dietrich D (2000) Schwannosis: role of gliosis and proteoglycan in human spinal cord injury. J Neurotrauma 17:781-788.

132

Bruckner G, Bringmann A, Hartig W, Koppe G, Delpech B, Brauer K (1998) Acute and long-lasting changes in extracellular-matrix chondroitin-sulphate proteoglycans induced by injection of chondroitinase ABC in the adult rat brain. Exp Brain Res 121:300-310.

Bryan B, Cai Y, Wrighton K, Wu G, Feng XH, Liu M (2005) Ubiquitination of RhoA by Smurf1 promotes neurite outgrowth. FEBS Lett 579:1015-1019.

Buch PK, Maclaren RE, Duran Y, Balaggan KS, Macneil A, Schlichtenbrede FC, Smith AJ, Ali RR (2006) In Contrast to AAV-Mediated Cntf Expression, AAV-Mediated Gdnf Expression Enhances Gene Replacement Therapy in Rodent Models of Retinal Degeneration. Mol Ther 14:700-709.

Buffo A, Holtmaat AJ, Savio T, Verbeek JS, Oberdick J, Oestreicher AB, Gispen WH, Verhaagen J, Rossi F, Strata P (1997) Targeted overexpression of the neurite growth-associated protein B-50/GAP-43 in cerebellar Purkinje cells induces sprouting after axotomy but not axon regeneration into growth-permissive transplants. J Neurosci 17:8778-8791.

Bulow HE, Hobert O (2004) Differential sulfations and epimerization define heparan sulfate specificity in nervous system development. Neuron 41:723-736.

Bundesen LQ, Scheel TA, Bregman BS, Kromer LF (2003) Ephrin-B2 and EphB2 regulation of astrocyte-meningeal fibroblast interactions in response to spinal cord lesions in adult rats. J Neurosci 23:7789-7800.

Bunge M, Sauders N, Dziegielewska K (1999) What types of bridges will best promote axonal regeneration across an area of injury in the adult mammalian spinal cord? Degeneration and Regeneration in the Nervous System:171-189.

Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004) Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol Ther 10:302-317.

Burren CP, Berka JL, Edmondson SR, Werther GA, Batch JA (1996) Localization of mRNAs for insulin-like growth factor-I (IGF-I), IGF-I receptor, and IGF binding proteins in rat eye. Invest Ophthalmol Vis Sci 37:1459-1468.

Bush RA, Lei B, Tao W, Raz D, Chan CC, Cox TA, Santos-Muffley M, Sieving PA (2004) Encapsulated cell-based intraocular delivery of ciliary neurotrophic factor in normal rabbit: dose-dependent effects on ERG and retinal histology. Invest Ophthalmol Vis Sci 45:2420-2430.

Buss A, Sellhaus B, Wolmsley A, Noth J, Schwab ME, Brook GA (2004) Expression pattern of NOGO-A protein in the human nervous system. Acta Neuropathol (Berl) 110:113-119.

Cacalano G, Farinas I, Wang LC, Hagler K, Forgie A, Moore M, Armanini M, Phillips H, Ryan AM, Reichardt LF, Hynes M, Davies A, Rosenthal A (1998) GFRalpha1 is an essential receptor component for GDNF in the developing nervous system and kidney. Neuron 21:53-62.

Cafferty WB, Gardiner NJ, Das P, Qiu J, McMahon SB, Thompson SW (2004) Conditioning injury-induced spinal axon regeneration fails in interleukin-6 knock-out mice. J Neurosci 24:4432-4443.

Cai D, Qiu J, Cao Z, McAtee M, Bregman BS, Filbin MT (2001) Neuronal cyclic AMP controls the developmental loss in ability of axons to regenerate. J Neurosci 21:4731-4739.

Cai D, Deng K, Mellado W, Lee J, Ratan RR, Filbin MT (2002) Arginase I and polyamines act downstream from cyclic AMP in overcoming inhibition of axonal growth MAG and myelin in vitro. Neuron 35:711-719.

Calderon-Martinez D, Garavito Z, Spinel C, Hurtado H (2002) Schwann cell-enriched cultures from adult human peripheral nerve: a technique combining short enzymatic dissociation and treatment with cytosine arabinoside (Ara-C). J Neurosci Methods 114:1-8.

Campbell DS, Regan AG, Lopez JS, Tannahill D, Harris WA, Holt CE (2001) Semaphorin 3A elicits stage-dependent collapse, turning, and branching in Xenopus retinal growth cones. J Neurosci 21:8538-8547.

Campbell G, Kitching J, Anderson PN, Lieberman AR (2003) Different effects of astrocytes and Schwann cells on regenerating retinal axons. Neuroreport 14:2085-2088.

Cao L, Liu L, Chen ZY, Wang LM, Ye JL, Qiu HY, Lu CL, He C (2004) Olfactory ensheathing cells genetically modified to secrete GDNF to promote spinal cord repair. Brain 127:535-549.

Cao Z, Gao Y, Bryson JB, Hou J, Chaudhry N, Siddiq M, Martinez J, Spencer T, Carmel J, Hart RB, Filbin MT (2006) The cytokine Interleukin-6 is sufficient but not necessary to mimic the peripheral conditioning lesion effect on axonal growth. J Neurosci 26:5565-5573.

Cardona-Gomez GP, Mendez P, DonCarlos LL, Azcoitia I, Garcia-Segura LM (2001) Interactions of estrogens and insulin-like growth factor-I in the brain: implications for neuroprotection. Brain Res Brain Res Rev 37:320-334.

133

Cardona-Gomez GP, Mendez P, DonCarlos LL, Azcoitia I, Garcia-Segura LM (2002) Interactions of estrogen and insulin-like growth factor-I in the brain: molecular mechanisms and functional implications. J Steroid Biochem Mol Biol 83:211-217.

Caroni P, Schwab ME (1988) Antibody against myelin-associated inhibitor of neurite growth neutralizes nonpermissive substrate properties of CNS white matter. Neuron 1:85-96.

Caroni P, Savio T, Schwab ME (1988) Central nervous system regeneration: oligodendrocytes and myelin as non-permissive substrates for neurite growth. Prog Brain Res 78:363-370.

Carro E, Nunez A, Busiguina S, Torres-Aleman I (2000) Circulating insulin-like growth factor I mediates effects of exercise on the brain. J Neurosci 20:2926-2933.

Carro E, Trejo JL, Nunez A, Torres-Aleman I (2003) Brain repair and neuroprotection by serum insulin-like growth factor I. Mol Neurobiol 27:153-162.

Carter DA, Bray GM, Aguayo AJ (1989) Regenerated retinal ganglion cell axons can form well-differentiated synapses in the superior colliculus of adult hamsters. J Neurosci 9:4042-4050.

Carter DA, Aguayo AJ, Bray GM (1991) Retinal ganglion cell terminals in the hamster superior colliculus: an ultrastructural study. J Comp Neurol 311:97-107.

Carter DA, Bray GM, Aguayo AJ (1994) Long-term growth and remodeling of regenerated retino-collicular connections in adult hamsters. J Neurosci 14:590-598.

Carter DA, Bray GM, Aguayo AJ (1998) Regenerated retinal ganglion cell axons form normal numbers of boutons but fail to expand their arbors in the superior colliculus. J Neurocytol 27:187-196.

Casaccia-Bonnefil P, Gu C, Khursigara G, Chao MV (1999) p75 neurotrophin receptor as a modulator of survival and death decisions. Microsc Res Tech 45:217-224.

Castellano O, Martinez-Marti L, Gomez-Fernandez L (1998) [Nerve growth factor and diabetic neuropathy]. Rev Neurol 26:1032-1039.

Castro C, Kuffler DP (2006) Membrane-bound CSPG mediates growth cone outgrowth and substrate specificity by Schwann cell contact with the DRG neuron cell body and not via growth cone contact. Exp Neurol 200:19-25.

Cayouette M, Gravel C (1997) Adenovirus-mediated gene transfer of ciliary neurotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse. Hum Gene Ther 8:423-430.

Cellerino A, Arango-Gonzalez BA, Kohler K (1999) Effects of brain-derived neurotrophic factor on the development of NADPH-diaphorase/nitric oxide synthase-positive amacrine cells in the rodent retina. Eur J Neurosci 11:2824-2834.

Cenni MC, Bonfanti L, Martinou JC, Ratto GM, Strettoi E, Maffei L (1996) Long-term survival of retinal ganglion cells following optic nerve section in adult bcl-2 transgenic mice. Eur J Neurosci 8:1735-1745.

Chau CH, Shum DK, Li H, Pei J, Lui YY, Wirthlin L, Chan YS, Xu XM (2004) Chondroitinase ABC enhances axonal regrowth through Schwann cell-seeded guidance channels after spinal cord injury. Faseb J 18:194-196.

Chaudhry N, Filbin MT (2006) Myelin-associated inhibitory signaling and strategies to overcome inhibition. J Cereb Blood Flow Metab In Press.

Chauhan BC, Levatte TL, Garnier KL, Tremblay F, Pang IH, Clark AF, Archibald ML (2006) Semiquantitative optic nerve grading scheme for determining axonal loss in experimental optic neuropathy. Invest Ophthalmol Vis Sci 47:634-640.

Chen A, Xu XM, Kleitman N, Bunge MB (1996) Methylprednisolone administration improves axonal regeneration into Schwann cell grafts in transected adult rat thoracic spinal cord. Exp Neurol 138:261-276.

Chen C, Li M, Chai H, Yang H, Fisher WE, Yao Q (2005) Roles of Neuropilins in Neuronal Development, Angiogenesis, and Cancers. World J Surg 29:271-275.

Chen DF, Schneider GE, Martinou JC, Tonegawa S (1997) Bcl-2 promotes regeneration of severed axons in mammalian CNS. Nature 385:434-439.

Chen H, Weber AJ (2001) BDNF enhances retinal ganglion cell survival in cats with optic nerve damage. Invest Ophthalmol Vis Sci 42:966-974.

Chen H, Weber AJ (2004) Brain-derived neurotrophic factor reduces TrkB protein and mRNA in the normal retina and following optic nerve crush in adult rats. Brain Res 1011:99-106.

Chen ST, Garey LJ, Jen LS (1994) Bcl-2 proto-oncogene protein immunoreactivity in normally developing and axotomised rat retinas. Neurosci Lett 172:11-14.

Chen ZY, Chai YF, Cao L, Lu CL, He C (2001) Glial cell line-derived neurotrophic factor enhances axonal regeneration following sciatic nerve transection in adult rats. Brain Res 902:272-276.

134

Cheng H (2000) Recent development of the research for CNS repair. Proc 2nd Asia Pacific Symp Neural Regen:P8.

Cheng H, Cao Y, Olson L (1996) Spinal cord repair in adult paraplegic rats: partial restoration of hind limb function. Science 273:510-513.

Cheng H, Fu YS, Guo JW (2004) Ability of GDNF to diminish free radical production leads to protection against kainate-induced excitotoxicity in hippocampus. Hippocampus 14:77-86.

Cheng Q, Sasaki Y, Shoji M, Sugiyama Y, Tanaka H, Nakayama T, Mizuki N, Nakamura F, Takei K, Goshima Y (2003) Cdk5/p35 and Rho-kinase mediate ephrin-A5-induced signaling in retinal ganglion cells. Mol Cell Neurosci 24:632-645.

Cheung AW, Lam JS, Chan SO (2005) Selective inhibition of ventral temporal but not dorsal nasal neurites from mouse retinal explants during contact with chondroitin sulphate. Cell Tissue Res 321:9-19.

Chidlow G, Osborne NN (2003) Rat retinal ganglion cell loss caused by kainate, NMDA and ischemia correlates with a reduction in mRNA and protein of Thy-1 and neurofilament light. Brain Res 963:298-306.

Chidlow G, Casson R, Sobrado-Calvo P, Vidal-Sanz M, Osborne NN (2005) Measurement of retinal injury in the rat after optic nerve transection: an RT-PCR study. Mol Vis 11:387-396.

Chierzi S, Fawcett JW (2001) Regeneration in the mammalian optic nerve. Restor Neurol Neurosci 19:109-118.

Chierzi S, Ratto GM, Verma P, Fawcett JW (2005) The ability of axons to regenerate their growth cones depends on axonal type and age, and is regulated by calcium, cAMP and ERK. Eur J Neurosci 21:2051-2062.

Chiquet-Ehrismann R (2004) Tenascins. Int J Biochem Cell Biol 36:986-990. Chiquet-Ehrismann R, Hagios C, Matsumoto K (1994) The tenascin gene family. Perspect Dev

Neurobiol 2:3-7. Cho EY, So KF (1987) Rate of regrowth of damaged retinal ganglion cell axons regenerating in a

peripheral nerve graft in adult hamsters. Brain Res 419:369-374. Cho KS, Yang L, Lu B, Feng Ma H, Huang X, Pekny M, Chen DF (2005) Re-establishing the

regenerative potential of central nervous system axons in postnatal mice. J Cell Sci 118:863-872. Chylack LT, Jr., Fu L, Mancini R, Martin-Rehrmann MD, Saunders AJ, Konopka G, Tian D, Hedley-

Whyte ET, Folkerth RD, Goldstein LE (2004) Lens epithelium-derived growth factor (LEDGF/p75) expression in fetal and adult human brain. Exp Eye Res 79:941-948.

Cohen-Cory S, Fraser SE (1995) Effects of brain-derived neurotrophic factor on optic axon branching and remodelling in vivo. Nature 378:192-196.

Cohen S, Levi-Montalcini R (1957) Purification and properties of a nerve growth-promoting factor isolated from mouse sarcoma 180. Cancer Res 17:15-20.

Copray S, Kust B, Emmer B, Lin MY, Liem R, Amor S, de Vries H, Floris S, Boddeke E (2004) Deficient p75 low-affinity neurotrophin receptor expression exacerbates experimental allergic encephalomyelitis in C57/BL6 mice. J Neuroimmunol 148:41-53.

Cosgaya JM, Chan JR, Shooter EM (2002) The neurotrophin receptor p75NTR as a positive modulator of myelination. Science 298:1245-1248.

Coulpier M, Ibanez CF (2004) Retrograde propagation of GDNF-mediated signals in sympathetic neurons. Mol Cell Neurosci 27:132-139.

Covian-Nares F, Martinez-Cadena G, Lopez-Godinez J, Voronina E, Wessel GM, Garcia-Soto J (2004) A Rho-signaling pathway mediates cortical granule translocation in the sea urchin oocyte. Mech Dev 121:225-235.

Csillik B, Janka Z, Boncz I, Kalman J, Mihaly A, Vecsei L, Knyihar E (2003) Molecular plasticity of primary nociceptive neurons: relations of the NGF-c-jun system to neurotomy and chronic pain. Ann Anat 185:303-314.

Cui Q, Harvey AR (1994) NT-4/5 reduces naturally occurring retinal ganglion cell death in neonatal rats. Neuroreport 5:1882-1884.

Cui Q, Harvey AR (1995) At least two mechanisms are involved in the death of retinal ganglion cells following target ablation in neonatal rats. J Neurosci 15:8143-8155.

Cui Q, Harvey AR (2000) CNTF promotes the regrowth of retinal ganglion cell axons into murine peripheral nerve grafts. Neuroreport 11:3999-4002.

Cui Q, Lu Q, So KF, Yip HK (1999) CNTF, not other trophic factors, promotes axonal regeneration of axotomized retinal ganglion cells in adult hamsters. Invest Ophthalmol Vis Sci 40:760-766.

135

Cui Q, Cho KS, So KF, Yip HK (2004) Synergistic effect of Nogo-neutralizing antibody IN-1 and ciliary neurotrophic factor on axonal regeneration in adult rodent visual systems. J Neurotrauma 21:617-625.

Cui Q, Tang LS, Hu B, So KF, Yip HK (2002) Expression of trkA, trkB, and trkC in injured and regenerating retinal ganglion cells of adult rats. Invest Ophthalmol Vis Sci 43:1954-1964.

Cui Q, Yip HK, Zhao RC, So KF, Harvey AR (2003a) Intraocular elevation of cyclic AMP potentiates ciliary neurotrophic factor-induced regeneration of adult rat retinal ganglion cell axons. Mol Cell Neurosci 22:49-61.

Cui Q, Pollett MA, Symons NA, Plant GW, Harvey AR (2003b) A new approach to CNS repair using chimeric peripheral nerve grafts. J Neurotrauma 20:17-31.

Curtis R, Adryan KM, Zhu Y, Harkness PJ, Lindsay RM, DiStefano PS (1993) Retrograde axonal transport of ciliary neurotrophic factor is increased by peripheral nerve injury. Nature 365:253-255.

Dabin I, Barnstable CJ (1995) Rat retinal Muller cells express Thy-1 following neuronal cell death. Glia 14:23-32.

Danias J, Stylianopoulou F (1990) Expression of IGF-I and IGF-II genes in the adult rat eye. Curr Eye Res 9:379-386.

Danias J, Shen F, Goldblum D, Chen B, Ramos-Esteban J, Podos SM, Mittag T (2002) Cytoarchitecture of the retinal ganglion cells in the rat. Invest Ophthalmol Vis Sci 43:587-594.

Dash PK, Orsi SA, Moody M, Moore AN (2004) A role for hippocampal Rho-ROCK pathway in long-term spatial memory. Biochem Biophys Res Commun 322:893-898.

David CL, Orpiszewski J, Zhu XC, Reissner KJ, Aswad DW (1998) Isoaspartate in chrondroitin sulfate proteoglycans of mammalian brain. J Biol Chem 273:32063-32070.

David S (2002) Recruiting the immune response to promote long distance axon regeneration after spinal cord injury. Prog Brain Res 137:407-414.

David S, Aguayo AJ (1981) Axonal elongation into peripheral nervous system "bridges" after central nervous system injury in adult rats. Science 214:931-933.

David S, Ousman SS (2002) Recruiting the immune response to promote axon regeneration in the injured spinal cord. Neuroscientist 8:33-41.

David S, Lacroix S (2003) Molecular approaches to spinal cord repair. Annu Rev Neurosci 26:411-440. Davies AM (1988) The emerging generality of the neurotrophic hypothesis. Trends Neurosci 11:243-244. Davies AM (1996) The Neurotrophic Hypothesis: Where does it Stand? Philos Trans R Soc Lond B Biol

Sci 351:389-394. Davies JE, Tang X, Denning JW, Archibald SJ, Davies SJ (2004) Decorin suppresses neurocan, brevican,

phosphacan and NG2 expression and promotes axon growth across adult rat spinal cord injuries. Eur J Neurosci 19:1226-1242.

Davies SJ, Fitch MT, Memberg SP, Hall AK, Raisman G, Silver J (1997) Regeneration of adult axons in white matter tracts of the central nervous system. Nature 390:680-683.

Davis S, Aldrich TH, Valenzuela DM, Wong VV, Furth ME, Squinto SP, Yancopoulos GD (1991) The receptor for ciliary neurotrophic factor. Science 253:59-63.

Davy A, Soriano P (2005) Ephrin signaling in vivo: look both ways. Dev Dyn 232:1-10. de Toledo M, Senic-Matuglia F, Salamero J, Uze G, Comunale F, Fort P, Blangy A (2003) The

GTP/GDP cycling of rho GTPase TCL is an essential regulator of the early endocytic pathway. Mol Biol Cell 14:4846-4856.

De Winter F, Holtmaat AJ, Verhaagen J (2002) Neuropilin and class 3 semaphorins in nervous system regeneration. Adv Exp Med Biol 515:115-139.

de Winter F, Cui Q, Symons N, Verhaagen J, Harvey AR (2004) Expression of class-3 semaphorins and their receptors in the neonatal and adult rat retina. Invest Ophthalmol Vis Sci 45:4554-4562.

De Wit J, Eggers R, Evers R, Castren E, Verhaagen J (2006) Long-term adeno-associated viral vector-mediated expression of truncated TrkB in the adult rat facial nucleus results in motor neuron degeneration. J Neurosci 26:1516-1530.

DeBellard ME, Tang S, Mukhopadhyay G, Shen YJ, Filbin MT (1996) Myelin-associated glycoprotein inhibits axonal regeneration from a variety of neurons via interaction with a sialoglycoprotein. Mol Cell Neurosci 7:89-101.

DeChiara TM, Vejsada R, Poueymirou WT, Acheson A, Suri C, Conover JC, Friedman B, McClain J, Pan L, Stahl N, et al. (1995) Mice lacking the CNTF receptor, unlike mice lacking CNTF, exhibit profound motor neuron deficits at birth. Cell 83:313-322.

DeFreitas MF, McQuillen PS, Shatz CJ (2001) A novel p75NTR signaling pathway promotes survival, not death, of immunopurified neocortical subplate neurons. J Neurosci 21:5121-5129.

136

deHart AK, Schnell JD, Allen DA, Tsai JY, Hicke L (2003) Receptor internalization in yeast requires the Tor2-Rho1 signaling pathway. Mol Biol Cell 14:4676-4684.

Deiner MS, Kennedy TE, Fazeli A, Serafini T, Tessier-Lavigne M, Sretavan DW (1997) Netrin-1 and DCC mediate axon guidance locally at the optic disc: loss of function leads to optic nerve hypoplasia. Neuron 19:575-589.

Del Rio JA, Gonzalez-Billault C, Urena JM, Jimenez EM, Barallobre MJ, Pascual M, Pujadas L, Simo S, La Torre A, Wandosell F, Avila J, Soriano E (2004) MAP1B is required for Netrin 1 signaling in neuronal migration and axonal guidance. Curr Biol 14:840-850.

Deng K, He H, Mellado W, Filbin M (2005) Cyclin - dependent kinase 5, a downstream effector of neurotrophins and cyclic AMP in overcoming inhibition by MAG. Abstract Viewer/Itinerary Planner Washington, DC: Society for Neuroscience Program No. 719.4.

Deo RC, Schmidt EF, Elhabazi A, Togashi H, Burley SK, Strittmatter SM (2004) Structural bases for CRMP function in plexin-dependent semaphorin3A signaling. Embo J 23:9-22.

Dergham P, Ellezam B, Essagian C, Avedissian H, Lubell WD, McKerracher L (2002) Rho signaling pathway targeted to promote spinal cord repair. J Neurosci 22:6570-6577.

Derouet D, Rousseau F, Alfonsi F, Froger J, Hermann J, Barbier F, Perret D, Diveu C, Guillet C, Preisser L, Dumont A, Barbado M, Morel A, deLapeyriere O, Gascan H, Chevalier S (2004) Neuropoietin, a new IL-6-related cytokine signaling through the ciliary neurotrophic factor receptor. Proc Natl Acad Sci U S A 101:4827-4832.

Desagher S, Severac D, Lipkin A, Bernis C, Ritchie W, Le Digarcher A, Journot L (2005) Genes regulated in neurons undergoing transcription-dependent apoptosis belong to signaling pathways rather than the apoptotic machinery. J Biol Chem 280:5693-5702.

Desire L, Head MW, Fayein NA, Courtois Y, Jeanny JC (1998) Suppression of fibroblast growth factor 2 expression by antisense oligonucleotides inhibits embryonic chick neural retina cell differentiation and survival in vivo. Dev Dyn 212:63-74.

Dezawa M (2002) Central and peripheral nerve regeneration by transplantation of Schwann cells and transdifferentiated bone marrow stromal cells. Anat Sci Int 77:12-25.

Dezawa M, Adachi-Usami E (2000) Role of Schwann cells in retinal ganglion cell axon regeneration. Prog Retin Eye Res 19:171-204.

Dezawa M, Kawana K, Negishi H, Adachi-Usami E (1999) Glial cells in degenerating and regenerating optic nerve of the adult rat. Brain Res Bull 48:573-579.

Dezawa M, Takahashi I, Esaki M, Takano M, Sawada H (2001) Sciatic nerve regeneration in rats induced by transplantation of in vitro differentiated bone-marrow stromal cells. Eur J Neurosci 14:1771-1776.

Dezawa M, Takano M, Negishi H, Mo X, Oshitari T, Sawada H (2002) Gene transfer into retinal ganglion cells by in vivo electroporation: a new approach. Micron 33:1-6.

Di Polo A, Aigner LJ, Dunn RJ, Bray GM, Aguayo AJ (1998) Prolonged delivery of brain-derived neurotrophic factor by adenovirus-infected Muller cells temporarily rescues injured retinal ganglion cells. Proc Natl Acad Sci U S A 95:3978-3983.

Diem R, Hobom M, Grotsch P, Kramer B, Bahr M (2003) Interleukin-1 beta protects neurons via the interleukin-1 (IL-1) receptor-mediated Akt pathway and by IL-1 receptor-independent decrease of transmembrane currents in vivo. Mol Cell Neurosci 22:487-500.

Dietz F, Franken S, Yoshida K, Nakamura H, Kappler J, Gieselmann V (2002) The family of hepatoma-derived growth factor proteins: characterization of a new member HRP-4 and classification of its subfamilies. Biochem J 366:491-500.

Dietz GP, Dietz B, Bahr M (2006) Bcl-x(L) increases axonal numbers but not axonal elongation from rat retinal explants. Brain Res Bull 70:117-123.

Dietz GP, Kilic E, Bahr M, Isenmann S (2001) Bcl-2 is not required in retinal ganglion cells surviving optic nerve axotomy. Neuroreport 12:3353-3356.

Dimou L, Schnell L, Montani L, Duncan C, Simonen M, Schneider R, Liebscher T, Gullo M, Schwab ME (2006) Nogo-A-Deficient Mice Reveal Strain-Dependent Differences in Axonal Regeneration. J Neurosci 26:5591-5603.

Do Thi NA, Saillour P, Ferrero L, Dedieu JF, Mallet J, Paunio T (2004) Delivery of GDNF by an E1,E3/E4 deleted adenoviral vector and driven by a GFAP promoter prevents dopaminergic neuron degeneration in a rat model of Parkinson's disease. Gene Ther 11:746-756.

Doering LC, Roder JC, Henderson JT (1995) Ciliary neurotrophic factor promotes the terminal differentiation of v-myc immortalized sympathoadrenal progenitor cells in vivo. Brain Res Dev Brain Res 89:56-66.

137

Dolbeare D, Houle JD (2003) Restriction of axonal retraction and promotion of axonal regeneration by chronically injured neurons after intraspinal treatment with glial cell line-derived neurotrophic factor (GDNF). J Neurotrauma 20:1251-1261.

Domeniconi M, Filbin MT (2005) Overcoming inhibitors in myelin to promote axonal regeneration. J Neurol Sci 233:43-47.

Domeniconi M, Cao Z, Spencer T, Sivasankaran R, Wang K, Nikulina E, Kimura N, Cai H, Deng K, Gao Y, He Z, Filbin M (2002) Myelin-associated glycoprotein interacts with the Nogo66 receptor to inhibit neurite outgrowth. Neuron 35:283-290.

Dong JM, Leung T, Manser E, Lim L (1998) cAMP-induced morphological changes are counteracted by the activated RhoA small GTPase and the Rho kinase ROKalpha. J Biol Chem 273:22554-22562.

Donovan SL, Mamounas LA, Andrews AM, Blue ME, McCasland JS (2002) GAP-43 is critical for normal development of the serotonergic innervation in forebrain. J Neurosci 22:3543-3552.

Doster SK, Lozano AM, Aguayo AJ, Willard MB (1991) Expression of the growth-associated protein GAP-43 in adult rat retinal ganglion cells following axon injury. Neuron 6:635-647.

Dou CL, Levine JM (1994) Inhibition of neurite growth by the NG2 chondroitin sulfate proteoglycan. J Neurosci 14:7616-7628.

Dreher B, Potts RA, Bennett MR (1983) Evidence that the early postnatal reduction in the number of rat retinal ganglion cells is due to a wave of ganglion cell death. Neurosci Lett 36:255-260.

Dreher B, Sefton AJ, Ni SY, Nisbett G (1985) The morphology, number, distribution and central projections of Class I retinal ganglion cells in albino and hooded rats. Brain Behav Evol 26:10-48.

Driessens MH, Hu H, Nobes CD, Self A, Jordens I, Goodman CS, Hall A (2001) Plexin-B semaphorin receptors interact directly with active Rac and regulate the actin cytoskeleton by activating Rho. Curr Biol 11:339-344.

Duan D, Yang H, Zhang J, Xu Q (2004) Long-term restoration of nigrostriatal system function by implanting GDNF genetically modified fibroblasts in a rat model of Parkinson's disease. Exp Brain Res 161:316-324.

Dubreuil CI, Winton MJ, McKerracher L (2003) Rho activation patterns after spinal cord injury and the role of activated Rho in apoptosis in the central nervous system. J Cell Biol 162:233-243.

Dubreuil CI, Marklund N, Deschamps K, McIntosh TK, McKerracher L (2006) Activation of Rho after traumatic brain injury and seizure in rats. Exp Neurol 198:361-369.

Dudus L, Anand V, Acland GM, Chen SJ, Wilson JM, Fisher KJ, Maguire AM, Bennett J (1999) Persistent transgene product in retina, optic nerve and brain after intraocular injection of rAAV. Vision Res 39:2545-2553.

Duff E, Baile CA (2003) Ciliary neurotrophic factor: a role in obesity? Nutr Rev 61:423-426. Dumont CE, Hentz VR (1997) Enhancement of axon growth by detergent-extracted nerve grafts.

Transplantation 63:1210-1215. Dutting D, Handwerker C, Drescher U (1999) Topographic targeting and pathfinding errors of retinal

axons following overexpression of ephrinA ligands on retinal ganglion cell axons. Dev Biol 216:297-311.

Ebendal T (1992) Function and evolution in the NGF family and its receptors. J Neurosci Res 32:461-470.

Eglen SJ, Raven MA, Tamrazian E, Reese BE (2003) Dopaminergic amacrine cells in the inner nuclear layer and ganglion cell layer comprise a single functional retinal mosaic. J Comp Neurol 466:343-355.

Ellezam B, Bertrand J, Dergham P, McKerracher L (2003) Vaccination stimulates retinal ganglion cell regeneration in the adult optic nerve. Neurobiol Dis 12:1-10.

Ellezam B, Selles-Navarro I, Manitt C, Kennedy TE, McKerracher L (2001) Expression of netrin-1 and its receptors DCC and UNC-5H2 after axotomy and during regeneration of adult rat retinal ganglion cells. Exp Neurol 168:105-115.

Ellezam B, Dubreuil C, Winton M, Loy L, Dergham P, Selles-Navarro I, McKerracher L (2002) Inactivation of intracellular Rho to stimulate axon growth and regeneration. Prog Brain Res 137:371-380.

Elliott J, Cayouette M, Gravel C (2006) The CNTF/LIF signaling pathway regulates developmental programmed cell death and differentiation of rod precursor cells in the mouse retina in vivo. Dev Biol 300:583-598.

Elshamy WM, Ernfors P (1996) A local action of neurotrophin-3 prevents the death of proliferating sensory neuron precursor cells. Neuron 16:963-972.

138

Elson GC, Lelievre E, Guillet C, Chevalier S, Plun-Favreau H, Froger J, Suard I, de Coignac AB, Delneste Y, Bonnefoy JY, Gauchat JF, Gascan H (2000) CLF associates with CLC to form a functional heteromeric ligand for the CNTF receptor complex. Nat Neurosci 3:867-872.

Emerich DF, Winn SR (2004) Neuroprotective effects of encapsulated CNTF-producing cells in a rodent model of Huntington's disease are dependent on the proximity of the implant to the lesioned striatum. Cell Transplant 13:253-259.

Emerick AJ, Kartje GL (2004) Behavioral recovery and anatomical plasticity in adult rats after cortical lesion and treatment with monoclonal antibody IN-1. Behav Brain Res 152:315-325.

Emerick AJ, Neafsey EJ, Schwab ME, Kartje GL (2003) Functional reorganization of the motor cortex in adult rats after cortical lesion and treatment with monoclonal antibody IN-1. J Neurosci 23:4826-4830.

Emsley JG, Hagg T (2003) Endogenous and exogenous ciliary neurotrophic factor enhances forebrain neurogenesis in adult mice. Exp Neurol 183:298-310.

English AW (2005) Enhancing axon regeneration in peripheral nerves also increases functionally inappropriate reinnervation of targets. J Comp Neurol 490:427-441.

Ernfors P, Merlio JP, Persson H (1992) Cells Expressing mRNA for Neurotrophins and their Receptors During Embryonic Rat Development. Eur J Neurosci 4:1140-1158.

Ernsberger U, Sendtner M, Rohrer H (1989) Proliferation and differentiation of embryonic chick sympathetic neurons: effects of ciliary neurotrophic factor. Neuron 2:1275-1284.

Erschbamer MK, Hofstetter CP, Olson L (2005) RhoA, RhoB, RhoC, Rac1, Cdc42, and Tc10 mRNA levels in spinal cord, sensory ganglia, and corticospinal tract neurons and long-lasting specific changes following spinal cord injury. J Comp Neurol 484:224-233.

Eslamboli A, Cummings RM, Ridley RM, Baker HF, Muzyczka N, Burger C, Mandel RJ, Kirik D, Annett LE (2003) Recombinant adeno-associated viral vector (rAAV) delivery of GDNF provides protection against 6-OHDA lesion in the common marmoset monkey (Callithrix jacchus). Exp Neurol 184:536-548.

Evans PJ, MacKinnon SE, Midha R, Wade JA, Hunter DA, Nakao Y, Hare GM (1999) Regeneration across cold preserved peripheral nerve allografts. Microsurgery 19:115-127.

Exton JH (1998) Small GTPases minireview series. J Biol Chem 273:19923. Facchiano F, Fernandez E, Mancarella S, Maira G, Miscusi M, D'Arcangelo D, Cimino-Reale G,

Falchetti ML, Capogrossi MC, Pallini R (2002) Promotion of regeneration of corticospinal tract axons in rats with recombinant vascular endothelial growth factor alone and combined with adenovirus coding for this factor. J Neurosurg 97:161-168.

Fahnestock M, Michalski B, Xu B, Coughlin MD (2001) The precursor pro-nerve growth factor is the predominant form of nerve growth factor in brain and is increased in Alzheimer's disease. Mol Cell Neurosci 18:210-220.

Fahnestock M, Garzon D, Holsinger RM, Michalski B (2002) Neurotrophic factors and Alzheimer's disease: are we focusing on the wrong molecule? J Neural Transm Suppl:241-252.

Farkas RH, Qian J, Goldberg JL, Quigley HA, Zack DJ (2004) Gene expression profiling of purified rat retinal ganglion cells. Invest Ophthalmol Vis Sci 45:2503-2513.

Farooque M, Suo Z, Arnold PM, Wulser MJ, Chou CT, Vancura RW, Fowler S, Festoff BW (2006) Gender-related differences in recovery of locomotor function after spinal cord injury in mice. Spinal Cord 44:182-187.

Fatma N, Kubo E, Chylack LT, Jr., Shinohara T, Akagi Y, Singh DP (2004) LEDGF regulation of alcohol and aldehyde dehydrogenases in lens epithelial cells: stimulation of retinoic acid production and protection from ethanol toxicity. Am J Physiol Cell Physiol 287:C508-516.

Fawcett J (2002) Repair of spinal cord injuries: where are we, where are we going? Spinal Cord 40:615-623.

Fawcett JW (2006) Overcoming inhibition in the damaged spinal cord. J Neurotrauma 23:371-383. Fawcett JW, Keynes RJ (1990) Peripheral nerve regeneration. Annu Rev Neurosci 13:43-60. Fawcett JW, Asher RA (1999) The glial scar and central nervous system repair. Brain Res Bull 49:377-391. Fawcett JW, O'Leary DD, Cowan WM (1984) Activity and the control of ganglion cell death in the rat

retina. Proc Natl Acad Sci U S A 81:5589-5593. Fayard B, Loeffler S, Weis J, Vogelin E, Kruttgen A (2005) The secreted brain-derived neurotrophic

factor precursor pro-BDNF binds to TrkB and p75NTR but not to TrkA or TrkC. J Neurosci Res 80:18-28.

Felgner JH, Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner PL (1994) Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem 269:2550-2561.

139

Feng H, Xiang H, Mao YW, Wang J, Liu JP, Huang XQ, Liu Y, Liu SJ, Luo C, Zhang XJ, Liu Y, Li DW (2004a) Human Bcl-2 activates ERK signaling pathway to regulate activating protein-1, lens epithelium-derived growth factor and downstream genes. Oncogene 23:7310-7321.

Feng SQ, Kong XH, Guo SF, Wang P, Li L, Zhong JH, Zhou XF (2004b) Treatment of spinal cord injury with co-grafts of genetically modified Schwann cells and fetal spinal cord cell suspension in the rat. Neurotox Res 7:169-178.

Feng SQ, Kong XH, Guo SF, Wang P, Li L, Zhong JH, Zhou XF (2005) Treatment of spinal cord injury with co-grafts of genetically modified Schwann cells and fetal spinal cord cell suspension in the rat. Neurotox Res 7:169-177.

Ferguson TA, Muir D (2000) MMP-2 and MMP-9 increase the neurite-promoting potential of schwann cell basal laminae and are upregulated in degenerated nerve. Mol Cell Neurosci 16:157-167.

Ferhat L, Chevassus au Louis N, Jorquera I, Niquet J, Khrestchatisky M, Ben-Ari Y, Represa A (1996) Transient increase of tenascin-C in immature hippocampus: astroglial and neuronal expression. J Neurocytol 25:53-66.

Fiedler M, Horn C, Bandtlow C, Schwab ME, Skerra A (2002) An engineered IN-1 F(ab) fragment with improved affinity for the Nogo-A axonal growth inhibitor permits immunochemical detection and shows enhanced neutralizing activity. Protein Eng 15:931-941.

Filbin MT (1995) Myelin-associated glycoprotein: a role in myelination and in the inhibition of axonal regeneration? Curr Opin Neurobiol 5:588-595.

Fine EG, Decosterd I, Papaloizos M, Zurn AD, Aebischer P (2002) GDNF and NGF released by synthetic guidance channels support sciatic nerve regeneration across a long gap. Eur J Neurosci 15:589-601.

Fischer D, Pavlidis M, Thanos S (2000) Cataractogenic lens injury prevents traumatic ganglion cell death and promotes axonal regeneration both in vivo and in culture. Invest Ophthalmol Vis Sci 41:3943-3954.

Fischer D, Heiduschka P, Thanos S (2001) Lens-injury-stimulated axonal regeneration throughout the optic pathway of adult rats. Exp Neurol 172:257-272.

Fischer D, He Z, Benowitz LI (2004a) Counteracting the Nogo receptor enhances optic nerve regeneration if retinal ganglion cells are in an active growth state. J Neurosci 24:1646-1651.

Fischer D, Petkova V, Thanos S, Benowitz LI (2004b) Switching mature retinal ganglion cells to a robust growth state in vivo: gene expression and synergy with RhoA inactivation. J Neurosci 24:8726-8740.

Flanagan JG, Vanderhaeghen P (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci 21:309-345.

Florkiewicz RZ, Sommer A (1989) Human basic fibroblast growth factor gene encodes four polypeptides: three initiate translation from non-AUG codons. Proc Natl Acad Sci U S A 86:3978-3981.

Florkiewicz RZ, Baird A, Gonzalez AM (1991) Multiple forms of bFGF: differential nuclear and cell surface localization. Growth Factors 4:265-275.

Follenzi A, Naldini L (2002) Generation of HIV-1 derived lentiviral vectors. Methods Enzymol 346:454-465.

Forcet C, Stein E, Pays L, Corset V, Llambi F, Tessier-Lavigne M, Mehlen P (2002) Netrin-1-mediated axon outgrowth requires deleted in colorectal cancer-dependent MAPK activation. Nature 417:443-447.

Foster RE, Connors BW, Waxman SG (1982) Rat optic nerve: electrophysiological, pharmacological and anatomical studies during development. Brain Res 255:371-386.

Fouad K, Klusman I, Schwab ME (2004) Regenerating corticospinal fibers in the Marmoset (Callitrix jacchus) after spinal cord lesion and treatment with the anti-Nogo-A antibody IN-1. Eur J Neurosci 20:2479-2482.

Fouad K, Schnell L, Bunge MB, Schwab ME, Liebscher T, Pearse DD (2005) Combining Schwann cell bridges and olfactory-ensheathing glia grafts with chondroitinase promotes locomotor recovery after complete transection of the spinal cord. J Neurosci 25:1169-1178.

Fournier AE, GrandPre T, Strittmatter SM (2001) Identification of a receptor mediating Nogo-66 inhibition of axonal regeneration. Nature 409:341-346.

Fournier AE, Takizawa BT, Strittmatter SM (2003) Rho kinase inhibition enhances axonal regeneration in the injured CNS. J Neurosci 23:1416-1423.

Fox IK, Jaramillo A, Hunter DA, Rickman SR, Mohanakumar T, Mackinnon SE (2005a) Prolonged cold-preservation of nerve allografts. Muscle Nerve 31:59-69.

140

Fox IK, Schwetye KE, Keune JD, Brenner MJ, Yu JW, Hunter DA, Wood PM, Mackinnon SE (2005b) Schwann-cell injection of cold-preserved nerve allografts. Microsurgery 25:502-507.

Frade JM, Barde YA (1999) Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord. Development 126:683-690.

Frank L, Wiegand WJ, Siuciak JA, Lindsay RM, Rudge JS (1997) Effects of BDNF infusion on the regulation of TrkB protein and message in adult rat brain. Exp Neurol 145:62-70.

Frankowski H, Castro-Obregon S, del Rio G, Rao RV, Bredesen DE (2002) PLAIDD, a type II death domain protein that interacts with p75 neurotrophin receptor. Neuromolecular Med 1:153-170.

Franzen R, Schoenen J, Leprince P, Joosten E, Moonen G, Martin D (1998) Effects of macrophage transplantation in the injured adult rat spinal cord: a combined immunocytochemical and biochemical study. J Neurosci Res 51:316-327.

Frerichs O, Fansa H, Schicht C, Wolf G, Schneider W, Keilhoff G (2002) Reconstruction of peripheral nerves using acellular nerve grafts with implanted cultured Schwann cells. Microsurgery 22:311-315.

Freund P, Schmidlin E, Wannier T, Bloch J, Mir A, Schwab ME, Rouiller EM (2006) Nogo-A-specific antibody treatment enhances sprouting and functional recovery after cervical lesion in adult primates. Nat Med 12:790-792.

Fruttiger M, Schachner M, Martini R (1995) Tenascin-C expression during wallerian degeneration in C57BL/Wlds mice: possible implications for axonal regeneration. J Neurocytol 24:1-14.

Fryer RH, Kaplan DR, Kromer LF (1997) Truncated trkB receptors on nonneuronal cells inhibit BDNF-induced neurite outgrowth in vitro. Exp Neurol 148:616-627.

Fryer RH, Kaplan DR, Feinstein SC, Radeke MJ, Grayson DR, Kromer LF (1996) Developmental and mature expression of full-length and truncated TrkB receptors in the rat forebrain. J Comp Neurol 374:21-40.

Fu ES, Saporta S (2005) Methylprednisolone inhibits production of interleukin-1beta and interleukin-6 in the spinal cord following compression injury in rats. J Neurosurg Anesthesiol 17:82-85.

Fuhrmann S, Grabosch K, Kirsch M, Hofmann HD (2003) Distribution of CNTF receptor alpha protein in the central nervous system of the chick embryo. J Comp Neurol 461:111-122.

Fujisawa H (2004) Discovery of semaphorin receptors, neuropilin and plexin, and their functions in neural development. J Neurobiol 59:24-33.

Fukuda Y, Sugimoto T, Shirokawa T (1982) Strain differences in quantitative analysis of the rat optic nerve. Exp Neurol 75:525-532.

Fukuda Y, Sasaki H, Adachi E, Inoue T, Morigiwa K (1990) Optic nerve regeneration by peripheral nerve transplant. Neurosci Res Suppl 13:S24-30.

Funakoshi H, Frisen J, Barbany G, Timmusk T, Zachrisson O, Verge VM, Persson H (1993) Differential expression of mRNAs for neurotrophins and their receptors after axotomy of the sciatic nerve. J Cell Biol 123:455-465.

Furlan JC, Krassioukov AV, Fehlings MG (2005) The effects of gender on clinical and neurological outcomes after acute cervical spinal cord injury. J Neurotrauma 22:368-381.

Gad JM, Keeling SL, Shu T, Richards LJ, Cooper HM (2000) The spatial and temporal expression patterns of netrin receptors, DCC and neogenin, in the developing mouse retina. Exp Eye Res 70:711-722.

Gagliardini V, Dusart I, Fankhauser C (2000) Absence of GAP-43 can protect neurons from death. Mol Cell Neurosci 16:27-33.

Gao Y, Nikulina E, Mellado W, Filbin MT (2003) Neurotrophins elevate cAMP to reach a threshold required to overcome inhibition by MAG through extracellular signal-regulated kinase-dependent inhibition of phosphodiesterase. J Neurosci 23:11770-11777.

Gao Y, Deng K, Hou J, Bryson JB, Barco A, Nikulina E, Spencer T, Mellado W, Kandel ER, Filbin MT (2004) Activated CREB is sufficient to overcome inhibitors in myelin and promote spinal axon regeneration in vivo. Neuron 44:609-621.

Garcia-Alias G, Lopez-Vales R, Fores J, Navarro X, Verdu E (2004) Acute transplantation of olfactory ensheathing cells or Schwann cells promotes recovery after spinal cord injury in the rat. J Neurosci Res 75:632-641.

Garcia-Segura LM, Azcoitia I, DonCarlos LL (2001) Neuroprotection by estradiol. Prog Neurobiol 63:29-60.

Garcia-Valenzuela E, Gorczyca W, Darzynkiewicz Z, Sharma SC (1994) Apoptosis in adult retinal ganglion cells after axotomy. J Neurobiol 25:431-438.

141

Gascon E, Vutskits L, Zhang H, Barral-Moran MJ, Kiss PJ, Mas C, Kiss JZ (2005) Sequential activation of p75 and TrkB is involved in dendritic development of subventricular zone-derived neuronal progenitors in vitro. Eur J Neurosci 21:69-80.

Gasman S, Chasserot-Golaz S, Malacombe M, Way M, Bader MF (2004) Regulated exocytosis in neuroendocrine cells: a role for subplasmalemmal Cdc42/N-WASP-induced actin filaments. Mol Biol Cell 15:520-531.

Geiger LK, Kortuem KR, Alexejun C, Levin LA (2002) Reduced redox state allows prolonged survival of axotomized neonatal retinal ganglion cells. Neuroscience 109:635-642.

Gellrich NC, Schimming R, Zerfowski M, Eysel UT (2002) Quantification of histological changes after calibrated crush of the intraorbital optic nerve in rats. Br J Ophthalmol 86:233-237.

Genden EM, Mackinnon SE, Yu S, Hunter DA, Flye MW (2001) Pretreatment with portal venous ultraviolet B-irradiated donor alloantigen promotes donor-specific tolerance to rat nerve allografts. Laryngoscope 111:439-447.

Gillespie DC, Crair MC, Stryker MP (2000) Neurotrophin-4/5 alters responses and blocks the effect of monocular deprivation in cat visual cortex during the critical period. J Neurosci 20:9174-9186.

Gillon RS, Cui Q, Dunlop SA, Harvey AR (2003) Effects of immunosuppression on regrowth of adult rat retinal ganglion cell axons into peripheral nerve allografts. J Neurosci Res 74:524-532.

Glass DJ, Yancopoulos GD (1993) The neurotrophins and their receptors. Trends Cell Biol 3:262-268. Goldberg JL (2004) Intrinsic neuronal regulation of axon and dendrite growth. Curr Opin Neurobiol

14:551-557. Goldberg JL, Barres BA (2000) The relationship between neuronal survival and regeneration. Annu Rev

Neurosci 23:579-612. Goldberg JL, Klassen MP, Hua Y, Barres BA (2002a) Amacrine-signaled loss of intrinsic axon growth

ability by retinal ganglion cells. Science 296:1860-1864. Goldberg JL, Espinosa JS, Xu Y, Davidson N, Kovacs GT, Barres BA (2002b) Retinal ganglion cells do

not extend axons by default: promotion by neurotrophic signaling and electrical activity. Neuron 33:689-702.

Golden JP, Baloh RH, Kotzbauer PT, Lampe PA, Osborne PA, Milbrandt J, Johnson EM, Jr. (1998) Expression of neurturin, GDNF, and their receptors in the adult mouse CNS. J Comp Neurol 398:139-150.

Golka B, Lewin-Kowalik J, Swiech-Sabuda E, Larysz-Brysz M, Gorka D, Malecka-Tendera E (2001) Predegenerated peripheral nerve grafts rescue retinal ganglion cells from axotomy-induced death. Exp Neurol 167:118-125.

Gonzalez AM, Berry M, Maher PA, Logan A, Baird A (1995) A comprehensive analysis of the distribution of FGF-2 and FGFR1 in the rat brain. Brain Res 701:201-226.

Gordon-Weeks PR (2004) Microtubules and growth cone function. J Neurobiol 58:70-83. Gospodarowicz D, Cheng J, Lui GM, Baird A, Bohlent P (1984) Isolation of brain fibroblast growth

factor by heparin-Sepharose affinity chromatography: identity with pituitary fibroblast growth factor. Proc Natl Acad Sci U S A 81:6963-6967.

Grandpre T, Strittmatter SM (2001) Nogo: a molecular determinant of axonal growth and regeneration. Neuroscientist 7:377-386.

GrandPre T, Li S, Strittmatter SM (2002) Nogo-66 receptor antagonist peptide promotes axonal regeneration. Nature 417:547-551.

Greenwald BD, Seel RT, Cifu DX, Shah AN (2001) Gender-related differences in acute rehabilitation lengths of stay, charges, and functional outcomes for a matched sample with spinal cord injury: a multicenter investigation. Arch Phys Med Rehabil 82:1181-1187.

Grimpe B, Silver J (2002) The extracellular matrix in axon regeneration. Prog Brain Res 137:333-349. Grimpe B, Silver J (2004) A novel DNA enzyme reduces glycosaminoglycan chains in the glial scar and

allows microtransplanted dorsal root ganglia axons to regenerate beyond lesions in the spinal cord. J Neurosci 24:1393-1397.

Groves MJ, An SF, Giometto B, Scaravilli F (1999) Inhibition of sensory neuron apoptosis and prevention of loss by NT-3 administration following axotomy. Exp Neurol 155:284-294.

Groves ML, McKeon R, Werner E, Nagarsheth M, Meador W, English AW (2005) Axon regeneration in peripheral nerves is enhanced by proteoglycan degradation. Exp Neurol 195:278-292.

Guan J, Bennet L, Gluckman PD, Gunn AJ (2003) Insulin-like growth factor-1 and post-ischemic brain injury. Prog Neurobiol 70:443-462.

Gulati AK (1988) Evaluation of acellular and cellular nerve grafts in repair of rat peripheral nerve. J Neurosurg 68:117-123.

142

Gulati AK (1995) Immunological fate of Schwann cell-populated acellular basal lamina nerve allografts. Transplantation 59:1618-1622.

Gulati AK, Cole GP (1990) Nerve graft immunogenicity as a factor determining axonal regeneration in the rat. J Neurosurg 72:114-122.

Gulati AK, Rai DR, Ali AM (1995) The influence of cultured Schwann cells on regeneration through acellular basal lamina grafts. Brain Res 705:118-124.

Guo L, Salt TE, Maass A, Luong V, Moss SE, Fitzke FW, Cordeiro MF (2006) Assessment of neuroprotective effects of glutamate modulation on glaucoma-related retinal ganglion cell apoptosis in vivo. Invest Ophthalmol Vis Sci 47:626-633.

Haastert K, Mauritz C, Matthies C, Grothe C (2006) Autologous adult Schwann cells genetically modified to provide alternative cellular transplants in perihperal nerve regeneration. J Neurosurg 104:778-786.

Habib AA, Marton LS, Allwardt B, Gulcher JR, Mikol DD, Hognason T, Chattopadhyay N, Stefansson K (1998) Expression of the oligodendrocyte-myelin glycoprotein by neurons in the mouse central nervous system. J Neurochem 70:1704-1711.

Hacein-Bey-Abina S, von Kalle C, Schmidt M, Le Deist F, Wulffraat N, McIntyre E, Radford I, Villeval JL, Fraser CC, Cavazzana-Calvo M, Fischer A (2003a) A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 348:255-256.

Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, Lim A, Osborne CS, Pawliuk R, Morillon E, Sorensen R, Forster A, Fraser P, Cohen JI, de Saint Basile G, Alexander I, Wintergerst U, Frebourg T, Aurias A, Stoppa-Lyonnet D, Romana S, Radford-Weiss I, Gross F, Valensi F, Delabesse E, Macintyre E, Sigaux F, Soulier J, Leiva LE, Wissler M, Prinz C, Rabbitts TH, Le Deist F, Fischer A, Cavazzana-Calvo M (2003b) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302:415-419.

Hafidi A, Grumet M, Sanes DH (2004) In vitro analysis of mechanisms underlying age-dependent failure of axon regeneration. J Comp Neurol 470:80-92.

Hagios C, Koch M, Spring J, Chiquet M, Chiquet-Ehrismann R (1996) Tenascin-Y: a protein of novel domain structure is secreted by differentiated fibroblasts of muscle connective tissue. J Cell Biol 134:1499-1512.

Hall KM, Horvath TL, Abonour R, Cornetta K, Srour EF (2006) Decreased homing of retrovirally transduced human bone marrow CD34(+) cells in the NOD/SCID mouse model. Exp Hematol 34:433-442.

Hall S, Berry M (1989) Electron microscopic study of the interaction of axons and glia at the site of anastomosis between the optic nerve and cellular or acellular sciatic nerve grafts. J Neurocytol 18:171-184.

Hall SM, Kent AP, Curtis R, Robertson D (1992) Electron microscopic immunocytochemistry of GAP-43 within proximal and chronically denervated distal stumps of transected peripheral nerve. J Neurocytol 21:820-831.

Hallbook F, Ibanez CF, Persson H (1991) Evolutionary studies of the nerve growth factor family reveal a novel member abundantly expressed in Xenopus ovary. Neuron 6:845-858.

Hamilton MM, Brough DE, McVey D, Bruder JT, King CR, Wei LL (2006) Repeated administration of adenovector in the eye results in efficient gene delivery. Invest Ophthalmol Vis Sci 47:299-305.

Han S, Arvai AS, Clancy SB, Tainer JA (2001) Crystal structure and novel recognition motif of rho ADP-ribosylating C3 exoenzyme from Clostridium botulinum: structural insights for recognition specificity and catalysis. J Mol Biol 305:95-107.

Hanke J (2002) Anatomical correlations of intrinsic axon repair after partial optic nerve crush in rats. Ann Anat 184:113-123.

Harada C, Harada T, Quah HM, Namekata K, Yoshida K, Ohno S, Tanaka K, Parada LF (2005) Role of neurotrophin-4/5 in neural cell death during retinal development and ischemic retinal injury in vivo. Invest Ophthalmol Vis Sci 46:669-673.

Harada C, Harada T, Quah HM, Maekawa F, Yoshida K, Ohno S, Wada K, Parada LF, Tanaka K (2003) Potential role of glial cell line-derived neurotrophic factor receptors in Muller glial cells during light-induced retinal degeneration. Neuroscience 122:229-235.

Harel NY, Strittmatter SM (2006) Can regenerating axons recapitulate developmental guidance during recovery from spinal cord injury? Nat Rev Neurosci 7:603-616.

Harrington AW, Leiner B, Blechschmitt C, Arevalo JC, Lee R, Morl K, Meyer M, Hempstead BL, Yoon SO, Giehl KM (2004) Secreted proNGF is a pathophysiological death-inducing ligand after adult CNS injury. Proc Natl Acad Sci U S A 101:6226-6230.

143

Hartmann M, Brigadski T, Erdmann KS, Holtmann B, Sendtner M, Narz F, Lessmann V (2004) Truncated TrkB receptor-induced outgrowth of dendritic filopodia involves the p75 neurotrophin receptor. J Cell Sci 117:5803-5814.

Hartmann U, Maurer P (2001) Proteoglycans in the nervous system--the quest for functional roles in vivo. Matrix Biol 20:23-35.

Hartnick CJ, Staecker H, Malgrange B, Lefebvre PP, Liu W, Moonen G, Van de Water TR (1996) Neurotrophic effects of BDNF and CNTF, alone and in combination, on postnatal day 5 rat acoustic ganglion neurons. J Neurobiol 30:246-254.

Harvey AR, Robertson D (1992) Time-course and extent of retinal ganglion cell death following ablation of the superior colliculus in neonatal rats. J Comp Neurol 325:83-94.

Harvey AR, Plant GW (1995) Schwann cells and fetal tectal tissue cografted to the midbrain of newborn rats: fate of Schwann cells and their influence on host retinal innervation of grafts. Exp Neurol 134:179-191.

Harvey AR, Hu Y, Leaver SG, Mellough CB, Park K, Verhaagen J, Plant GW, Cui Q (2006) Gene therapy and transplantation in CNS repair: the visual system. Prog Retin Eye Res 25:449-489.

Hashimoto M, Ino H, Koda M, Murakami M, Yoshinaga K, Yamazaki M, Moriya H (2004) Regulation of semaphorin 3A expression in neurons of the rat spinal cord and cerebral cortex after transection injury. Acta Neuropathol (Berl) 107:250-256.

Hata K, Fujitani M, Yasuda Y, Doya H, Saito T, Yamagishi S, Mueller BK, Yamashita T (2006) RGMa inhibition promotes axonal growth and recovery after spinal cord injury. J Cell Biol 173:47-58.

Hauben E, Schwartz M (2003) Therapeutic vaccination for spinal cord injury: helping the body to cure itself. Trends Pharmacol Sci 24:7-12.

Hauben E, Mizrahi T, Agranov E, Schwartz M (2002) Sexual dimorphism in the spontaneous recovery from spinal cord injury: a gender gap in beneficial autoimmunity? Eur J Neurosci 16:1731-1740.

Hauben E, Ibarra A, Mizrahi T, Barouch R, Agranov E, Schwartz M (2001) Vaccination with a Nogo-A-derived peptide after incomplete spinal-cord injury promotes recovery via a T-cell-mediated neuroprotective response: comparison with other myelin antigens. Proc Natl Acad Sci U S A 98:15173-15178.

Hauben E, Gothilf A, Cohen A, Butovsky O, Nevo U, Smirnov I, Yoles E, Akselrod S, Schwartz M (2003) Vaccination with dendritic cells pulsed with peptides of myelin basic protein promotes functional recovery from spinal cord injury. J Neurosci 23:8808-8819.

He MH, Cheung ZH, Yu EH, Tay DK, So KF (2004) Cytochrome c release and caspase-3 activation in retinal ganglion cells following different distance of axotomy of the optic nerve in adult hamsters. Neurochem Res 29:2153-2161.

He XL, Garcia KC (2004) Structure of nerve growth factor complexed with the shared neurotrophin receptor p75. Science 304:870-875.

Hedtjarn M, Mallard C, Arvidsson P, Hagberg H (2005) White matter injury in the immature brain: role of interleukin-18. Neurosci Lett 373:16-20.

Heiduschka P, Thanos S (2006) Cortisol promotes survival and regeneration of axotomised retinal ganglion cells and enhances effects of aurintricarboxylic acid. Graefes Arch Clin Exp Ophthalmol 244:1512-1521.

Heiduschka P, Fischer D, Thanos S (2004) [Neuroprotection and regeneration after traumatic lesion of the optic nerve]. Klin Monatsbl Augenheilkd 221:684-701.

Heine W, Conant K, Griffin JW, Hoke A (2004) Transplanted neural stem cells promote axonal regeneration through chronically denervated peripheral nerves. Exp Neurol 189:231-240.

Hempstead BL (2006) Dissecting the diverse actions of pro- and mature neurotrophins. Curr Alzheimer Res 3:19-24.

Henderson CE, Phillips HS, Pollock RA, Davies AM, Lemeulle C, Armanini M, Simmons L, Moffet B, Vandlen RA, Simpson LC, et al. (1994) GDNF: a potent survival factor for motoneurons present in peripheral nerve and muscle. Science 266:1062-1064.

Henke-Fahle S, Wild K, Sierra A, Monnier PP (2001) Characterization of a new brain-derived proteoglycan inhibiting retinal ganglion cell axon outgrowth. Mol Cell Neurosci 18:541-556.

Henley JR, Huang KH, Wang D, Poo MM (2004) Calcium mediates bidirectional growth cone turning induced by myelin-associated glycoprotein. Neuron 44:909-916.

Herdegen T, Bastmeyer M, Bahr M, Stuermer C, Bravo R, Zimmermann M (1993) Expression of JUN, KROX, and CREB transcription factors in goldfish and rat retinal ganglion cells following optic nerve lesion is related to axonal sprouting. J Neurobiol 24:528-543.

Hesse S, Werner C, Bardeleben A (2004) Electromechanical gait training with functional electrical stimulation: case studies in spinal cord injury. Spinal Cord 42:346-352.

144

Heumann R (1987) Regulation of the synthesis of nerve growth factor. J Exp Biol 132:133-150. Himes BT, Liu Y, Solowska JM, Snyder EY, Fischer I, Tessler A (2001) Transplants of cells genetically

modified to express neurotrophin-3 rescue axotomized Clarke's nucleus neurons after spinal cord hemisection in adult rats. J Neurosci Res 65:549-564.

Hirschberg DL, Yoles E, Belkin M, Schwartz M (1994) Inflammation after axonal injury has conflicting consequences for recovery of function: rescue of spared axons is impaired but regeneration is supported. J Neuroimmunol 50:9-16.

Hoffmann V, Hardt C (2002) A null mutation in the CNTF gene is not associated with early onset of multiple sclerosis. Arch Neurol 59:1974; author reply 1974-1975.

Hoffmann V, Pohlau D, Przuntek H, Epplen JT, Hardt C (2002) A null mutation within the ciliary neurotrophic factor (CNTF)-gene: implications for susceptibility and disease severity in patients with multiple sclerosis. Genes Immun 3:53-55.

Hohn A, Leibrock J, Bailey K, Barde YA (1990) Identification and characterization of a novel member of the nerve growth factor/brain-derived neurotrophic factor family. Nature 344:339-341.

Hoke A (2005) Proteoglycans in axonal regeneration. Exp Neurol 195:273-277. Holgert H (1995) Developmental expression of GAP43 mRNA in chromaffin cells and intra-adrenal

neurons. Neuroreport 6:2581-2584. Honjo M, Tanihara H, Kido N, Inatani M, Okazaki K, Honda Y (2000) Expression of ciliary

neurotrophic factor activated by retinal Muller cells in eyes with NMDA- and kainic acid-induced neuronal death. Invest Ophthalmol Vis Sci 41:552-560.

Hopker VH, Shewan D, Tessier-Lavigne M, Poo M, Holt C (1999) Growth-cone attraction to netrin-1 is converted to repulsion by laminin-1. Nature 401:69-73.

Hou B, You SW, Wu MM, Kuang F, Liu HL, Jiao XY, Ju G (2004a) Neuroprotective effect of inosine on axotomized retinal ganglion cells in adult rats. Invest Ophthalmol Vis Sci 45:662-667.

Hou X, Hu D, Hui Y (2004b) Adenovirally delivered brain-derived neurotrophic factor to rat retina. Yan Ke Xue Bao 20:187-190.

Houle JD, Tom VJ, Mayes D, Wagoner G, Phillips N, Silver J (2006) Combining an Autologous Peripheral Nervous System "Bridge" and Matrix Modification by Chondroitinase Allows Robust, Functional Regeneration beyond a Hemisection Lesion of the Adult Rat Spinal Cord. J Neurosci 26:7405-7415.

Howe CL, Mobley WC (2004) Signaling endosome hypothesis: A cellular mechanism for long distance communication. J Neurobiol 58:207-216.

Howe CL, Mobley WC (2005) Long-distance retrograde neurotrophic signaling. Curr Opin Neurobiol 15:40-48.

Howe CL, Valletta JS, Rusnak AS, Mobley WC (2001) NGF signaling from clathrin-coated vesicles: evidence that signaling endosomes serve as a platform for the Ras-MAPK pathway. Neuron 32:801-814.

Hsieh SH, Ferraro GB, Fournier AE (2006) Myelin-associated inhibitors regulate cofilin phosphorylation and neuronal inhibition through LIM kinase and Slingshot phosphatase. J Neurosci 26:1006-1015.

Hu J, Saito T, Abe K, Deguchi T (1997) Increase of ciliary neurotrophic factor (CNTF) in the ischemic rat brain as determined by a sensitive enzyme-linked immunoassay. Neurol Res 19:593-598.

Hu P, Kalb RG (2003) BDNF heightens the sensitivity of motor neurons to excitotoxic insults through activation of TrkB. J Neurochem 84:1421-1430.

Hu Y, Cui Q, Harvey AR (2007) Interactive effects of C3, cyclic AMP and ciliary neurotrophic factor on adult retinal ganglion cell survival and axonal regeneration. Mol Cell Neurosci 34:88-98.

Hu Y, Leaver SG, Plant GW, Hendriks WT, Niclou SP, Verhaagen J, Harvey AR, Cui Q (2005) Lentiviral-mediated transfer of CNTF to schwann cells within reconstructed peripheral nerve grafts enhances adult retinal ganglion cell survival and axonal regeneration. Mol Ther 11:906-915.

Huang DW, McKerracher L, Braun PE, David S (1999a) A therapeutic vaccine approach to stimulate axon regeneration in the adult mammalian spinal cord. Neuron 24:639-647.

Huang JK, Phillips GR, Roth AD, Pedraza L, Shan W, Belkaid W, Mi S, Fex-Svenningsen A, Florens L, Yates Iii JR, Colman DR (2005) Glial Membranes at the Node of Ranvier Prevent Neurite Outgrowth. Science 310:1813-1817.

Huang SP, Lin PK, Liu JH, Khor CN, Lee YJ (2004) Intraocular Gene Transfer of Ciliary Neurotrophic Factor Rescues Photoreceptor Degeneration in RCS Rats. J Biomed Sci 11:37-48.

Huang W, Wang L, Hui Y, Zhang M (2000) [Protective effects of brain-derived neurotrophic factor on injured retinal ganglion cells of rats]. Yan Ke Xue Bao 16:231-234.

145

Huang W, Fileta J, Guo Y, Grosskreutz CL (2006) Downregulation of thy1 in retinal ganglion cells in experimental glaucoma. Curr Eye Res 31:265-271.

Huang X, Wu DY, Chen G, Manji H, Chen DF (2003) Support of retinal ganglion cell survival and axon regeneration by lithium through a Bcl-2-dependent mechanism. Invest Ophthalmol Vis Sci 44:347-354.

Huang ZJ, Kirkwood A, Pizzorusso T, Porciatti V, Morales B, Bear MF, Maffei L, Tonegawa S (1999b) BDNF regulates the maturation of inhibition and the critical period of plasticity in mouse visual cortex. Cell 98:739-755.

Huber AB, Weinmann O, Brosamle C, Oertle T, Schwab ME (2002) Patterns of Nogo mRNA and protein expression in the developing and adult rat and after CNS lesions. J Neurosci 22:3553-3567.

Hudson TW, Liu SY, Schmidt CE (2004) Engineering an improved acellular nerve graft via optimized chemical processing. Tissue Eng 10:1346-1358.

Hull M, Bahr M (1994a) Regulation of immediate-early gene expression in rat retinal ganglion cells after axotomy and during regeneration through a peripheral nerve graft. J Neurobiol 25:92-105.

Hull M, Bahr M (1994b) Differential regulation of c-JUN expression in rat retinal ganglion cells after proximal and distal optic nerve transection. Neurosci Lett 178:39-42.

Hunt D, Mason MR, Campbell G, Coffin R, Anderson PN (2002) Nogo receptor mRNA expression in intact and regenerating CNS neurons. Mol Cell Neurosci 20:537-552.

Hunt D, Coffin RS, Prinjha RK, Campbell G, Anderson PN (2003) Nogo-A expression in the intact and injured nervous system. Mol Cell Neurosci 24:1083-1102.

Huot J (2004) Ephrin signaling in axon guidance. Prog Neuropsychopharmacol Biol Psychiatry 28:813-818.

Hutson LD, Bothwell M (2001) Expression and function of Xenopus laevis p75(NTR) suggest evolution of developmental regulatory mechanisms. J Neurobiol 49:79-98.

Huxlin KR, Goodchild AK (1997) Retinal ganglion cells in the albino rat: revised morphological classification. J Comp Neurol 385:309-323.

Hwang JJ, Park MH, Choi SY, Koh JY (2005) Activation of the Trk signaling pathway by extracellular zinc: Role of metalloproteinases. J Biol Chem 280:11995-12001.

Hynds DL, Snow DM (1999) Neurite outgrowth inhibition by chondroitin sulfate proteoglycan: stalling/stopping exceeds turning in human neuroblastoma growth cones. Exp Neurol 160:244-255.

Iannotti C, Li H, Yan P, Lu X, Wirthlin L, Xu XM (2003) Glial cell line-derived neurotrophic factor-enriched bridging transplants promote propriospinal axonal regeneration and enhance myelination after spinal cord injury. Exp Neurol 183:379-393.

Ibanez CF (2002) Jekyll-Hyde neurotrophins: the story of proNGF. Trends Neurosci 25:284-286. Ibanez CF, Hallbook F, Godeau F, Persson H (1992) Expression of neurotrophin-4 mRNA during

oogenesis in Xenopus laevis. Int J Dev Biol 36:239-245. Ichikawa H, Yabuuchi T, Jin HW, Terayama R, Yamaai T, Deguchi T, Kamioka H, Takano-Yamamoto

T, Sugimoto T (2006) Brain-derived neurotrophic factor-immunoreactive primary sensory neurons in the rat trigeminal ganglion and trigeminal sensory nuclei. Brain Res 1081:113-118

Ide C (1996) Peripheral nerve regeneration. Neurosci Res 25:101-121. Ikeda O, Murakami M, Ino H, Yamazaki M, Nemoto T, Koda M, Nakayama C, Moriya H (2001) Acute

up-regulation of brain-derived neurotrophic factor expression resulting from experimentally induced injury in the rat spinal cord. Acta Neuropathol (Berl) 102:239-245.

Ikegami T, Nakamura M, Yamane J, Katoh H, Okada S, Iwanami A, Watanabe K, Ishii K, Kato F, Fujita H, Takahashi T, Okano HJ, Toyama Y, Okano H (2005) Chondroitinase ABC combined with neural stem/progenitor cell transplantation enhances graft cell migration and outgrowth of growth-associated protein-43-positive fibers after rat spinal cord injury. Eur J Neurosci 22:3036-3046.

Imondi R, Wideman C, Kaprielian Z (2000) Complementary expression of transmembrane ephrins and their receptors in the mouse spinal cord: a possible role in constraining the orientation of longitudinally projecting axons. Development 127:1397-1410.

Inatani M, Honjo M, Otori Y, Oohira A, Kido N, Tano Y, Honda Y, Tanihara H (2001) Inhibitory effects of neurocan and phosphacan on neurite outgrowth from retinal ganglion cells in culture. Invest Ophthalmol Vis Sci 42:1930-1938.

Inomata Y, Hirata A, Koga T, Kimura A, Singh DP, Shinohara T, Tanihara H (2003) Lens epithelium-derived growth factor: neuroprotection on rat retinal damage induced by N-methyl-D-aspartate. Brain Res 991:163-170.

146

Inoue T, Hosokawa M, Morigiwa K, Ohashi Y, Fukuda Y (2002) Bcl-2 overexpression does not enhance in vivo axonal regeneration of retinal ganglion cells after peripheral nerve transplantation in adult mice. J Neurosci 22:4468-4477.

Ip NY, Yancopoulos GD (1996) The neurotrophins and CNTF: two families of collaborative neurotrophic factors. Annu Rev Neurosci 19:491-515.

Ip NY, Stitt TN, Tapley P, Klein R, Glass DJ, Fandl J, Greene LA, Barbacid M, Yancopoulos GD (1993) Similarities and differences in the way neurotrophins interact with the Trk receptors in neuronal and nonneuronal cells. Neuron 10:137-149.

Ip NY, Ibanez CF, Nye SH, McClain J, Jones PF, Gies DR, Belluscio L, Le Beau MM, Espinosa R, 3rd, Squinto SP, et al. (1992) Mammalian neurotrophin-4: structure, chromosomal localization, tissue distribution, and receptor specificity. Proc Natl Acad Sci U S A 89:3060-3064.

Isenmann S, Kretz A, Cellerino A (2003) Molecular determinants of retinal ganglion cell development, survival, and regeneration. Prog Retin Eye Res 22:483-543.

Isenmann S, Klocker N, Gravel C, Bahr M (1998) Short communication: protection of axotomized retinal ganglion cells by adenovirally delivered BDNF in vivo. Eur J Neurosci 10:2751-2756.

Isenmann S, Engel S, Gillardon F, Bahr M (1999) Bax antisense oligonucleotides reduce axotomy-induced retinal ganglion cell death in vivo by reduction of Bax protein expression. Cell Death Differ 6:673-682.

Ishikawa H, Takano M, Matsumoto N, Sawada H, Ide C, Mimura O, Dezawa M (2005) Effect of GDNF gene transfer into axotomized retinal ganglion cells using in vivo electroporation with a contact lens-type electrode. Gene Ther 12:289-298.

Ishizaki T (2003) [Rho-mediated signal transduction and its physiological roles]. Nippon Yakurigaku Zasshi 121:153-162.

Ito Y, Yamamoto M, Mitsuma N, Li M, Hattori N, Sobue G (2001) Expression of mRNAs for ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6 (IL-6), and their receptors (CNTFR alpha, LIFR beta, IL-6R alpha, and gp130) in human peripheral neuropathies. Neurochem Res 26:51-58.

Iwase T, Jung CG, Bae H, Zhang M, Soliven B (2005) Glial cell line-derived neurotrophic factor-induced signaling in Schwann cells. J Neurochem 94:1488-1499.

Jain A, Brady-Kalnay SM, Bellamkonda RV (2004) Modulation of Rho GTPase activity alleviates chondroitin sulfate proteoglycan-dependent inhibition of neurite extension. J Neurosci Res 77:299-307.

Jakobsson J, Lundberg C (2006) Lentiviral vectors for use in the central nervous system. Mol Ther 13:484-493.

Jeffery G (1984) Retinal ganglion cell death and terminal field retraction in the developing rodent visual system. Brain Res 315:81-96.

Jezernik S, Wassink RG, Keller T (2004) Sliding mode closed-loop control of FES: controlling the shank movement. IEEE Trans Biomed Eng 51:263-272.

Ji B, Li M, Wu WT, Yick LW, Lee X, Shao Z, Wang J, So KF, McCoy JM, Blake Pepinsky R, Mi S, Relton JK (2006) LINGO-1 antagonist promotes functional recovery and axonal sprouting after spinal cord injury. Mol Cell Neurosci 33:311-320.

Ji JZ, Elyaman W, Yip HK, Lee VW, Yick LW, Hugon J, So KF (2004) CNTF promotes survival of retinal ganglion cells after induction of ocular hypertension in rats: the possible involvement of STAT3 pathway. Eur J Neurosci 19:265-272.

Jiao J, Huang X, Feit-Leithman RA, Neve RL, Snider W, Dartt DA, Chen DF (2005) Bcl-2 enhances Ca(2+) signaling to support the intrinsic regenerative capacity of CNS axons. Embo J 24:1068-1078.

Jin G, Omori N, Li F, Nagano I, Manabe Y, Shoji M, Abe K (2003) Protection against ischemic brain damage by GDNF affecting cell survival and death signals. Neurol Res 25:249-253.

Jin Y, Tessler A, Fischer I, Houle JD (2000) Fibroblasts genetically modified to produce BDNF support regrowth of chronically injured serotonergic axons. Neurorehabil Neural Repair 14:311-317.

Jing S, Yu Y, Fang M, Hu Z, Holst PL, Boone T, Delaney J, Schultz H, Zhou R, Fox GM (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem 272:33111-33117.

Jo SA, Wang E, Benowitz LI (1999) Ciliary neurotrophic factor is and axogenesis factor for retinal ganglion cells. Neuroscience 89:579-591.

Johnson JE, Barde YA, Schwab M, Thoenen H (1986) Brain-derived neurotrophic factor supports the survival of cultured rat retinal ganglion cells. J Neurosci 6:3031-3038.

147

Johnston TE, Finson RL, Smith BT, Bonaroti DM, Betz RR, Mulcahey MJ (2003) Functional electrical stimulation for augmented walking in adolescents with incomplete spinal cord injury. J Spinal Cord Med 26:390-400.

Jones LL, Tuszynski MH (2002) Spinal cord injury elicits expression of keratan sulfate proteoglycans by macrophages, reactive microglia, and oligodendrocyte progenitors. J Neurosci 22:4611-4624.

Jones LL, Margolis RU, Tuszynski MH (2003) The chondroitin sulfate proteoglycans neurocan, brevican, phosphacan, and versican are differentially regulated following spinal cord injury. Exp Neurol 182:399-411.

Jones LL, Oudega M, Bunge MB, Tuszynski MH (2001) Neurotrophic factors, cellular bridges and gene therapy for spinal cord injury. J Physiol 533:83-89.

Jones LL, Yamaguchi Y, Stallcup WB, Tuszynski MH (2002) NG2 is a major chondroitin sulfate proteoglycan produced after spinal cord injury and is expressed by macrophages and oligodendrocyte progenitors. J Neurosci 22:2792-2803.

Joosten EA, Houweling DA (2004) Local acute application of BDNF in the lesioned spinal cord anti-inflammatory and anti-oxidant effects. Neuroreport 15:1163-1166.

Ju WK, Kim KY, Lee MY, Hofmann HD, Kirsch M, Cha JH, Oh SJ, Chun MH (2000) Up-regulated CNTF plays a protective role for retrograde degeneration in the axotomized rat retina. Neuroreport 11:3893-3896.

Jubran M, Widenfalk J (2003) Repair of peripheral nerve transections with fibrin sealant containing neurotrophic factors. Exp Neurol 181:204-212.

Kalb R (2005) The protean actions of neurotrophins and their receptors on the life and death of neurons. Trends Neurosci 28:5-11.

Kalra S, Genge A, Arnold DL (2003) A prospective, randomized, placebo-controlled evaluation of corticoneuronal response to intrathecal BDNF therapy in ALS using magnetic resonance spectroscopy: feasibility and results. Amyotroph Lateral Scler Other Motor Neuron Disord 4:22-26.

Kanekura K, Hashimoto Y, Kita Y, Sasabe J, Aiso S, Nishimoto I, Matsuoka M (2005) A Rac1/phosphatidylinositol 3-kinase/Akt3 anti-apoptotic pathway, triggered by AlsinLF, the product of the ALS2 gene, antagonizes Cu/Zn-superoxide dismutase (SOD1) mutant-induced motoneuronal cell death. J Biol Chem 280:4532-4543.

Kanning KC, Hudson M, Amieux PS, Wiley JC, Bothwell M, Schecterson LC (2003) Proteolytic processing of the p75 neurotrophin receptor and two homologs generates C-terminal fragments with signaling capability. J Neurosci 23:5425-5436.

Kao HT, Song HJ, Porton B, Ming GL, Hoh J, Abraham M, Czernik AJ, Pieribone VA, Poo MM, Greengard P (2002) A protein kinase A-dependent molecular switch in synapsins regulates neurite outgrowth. Nat Neurosci 5:431-437.

Kaplan DR, Miller FD (2003) Axon growth inhibition: signals from the p75 neurotrophin receptor. Nat Neurosci 6:435-436.

Kasarskis EJ, Scarlata D, Hill R, Fuller C, Stambler N, Cedarbaum JM (1999) A retrospective study of percutaneous endoscopic gastrostomy in ALS patients during the BDNF and CNTF trials. J Neurol Sci 169:118-125.

Kato S, Devadas M, Okada K, Shimada Y, Ohkawa M, Muramoto K, Takizawa N, Matsukawa T (1999) Fast and slow recovery phases of goldfish behavior after transection of the optic nerve revealed by a computer image processing system. Neuroscience 93:907-914.

Katoh-Semba R, Matsuda M, Kato K, Oohira A (1995) Chondroitin sulphate proteoglycans in the rat brain: candidates for axon barriers of sensory neurons and the possible modification by laminin of their actions. Eur J Neurosci 7:613-621.

Katoh-Semba R, Takeuchi IK, Semba R, Kato K (1997) Distribution of brain-derived neurotrophic factor in rats and its changes with development in the brain. J Neurochem 69:34-42.

Katoh-Semba R, Ichisaka S, Hata Y, Tsumoto T, Eguchi K, Miyazaki N, Matsuda M, Takeuchi IK, Kato K (2003) NT-4 protein is localized in neuronal cells in the brain stem as well as the dorsal root ganglion of embryonic and adult rats. J Neurochem 86:660-668.

Kawamoto Y, Nakamura S, Kawamata T, Akiguchi I, Kimura J (1999) Cellular localization of brain-derived neurotrophic factor-like immunoreactivity in adult monkey brain. Brain Res 821:341-349.

Kawamoto Y, Nakamura S, Nakano S, Oka N, Akiguchi I, Kimura J (1996) Immunohistochemical localization of brain-derived neurotrophic factor in adult rat brain. Neuroscience 74:1209-1226.

Kay MA, Nakai H (2003) Looking into the safety of AAV vectors. Nature 424:251.

148

Kay MA, Glorioso JC, Naldini L (2001) Viral vectors for gene therapy: the art of turning infectious agents into vehicles of therapeutics. Nat Med 7:33-40.

Keirstead SA, Vidal-Sanz M, Rasminsky M, Aguayo AJ, Levesque M, So KF (1985) Responses to light of retinal neurons regenerating axons into peripheral nerve grafts in the rat. Brain Res 359:402-406.

Keirstead SA, Rasminsky M, Fukuda Y, Carter DA, Aguayo AJ, Vidal-Sanz M (1989) Electrophysiologic responses in hamster superior colliculus evoked by regenerating retinal axons. Science 246:255-257.

Kells AP, Fong DM, Dragunow M, During MJ, Young D, Connor B (2004) AAV-mediated gene delivery of BDNF or GDNF is neuroprotective in a model of Huntington disease. Mol Ther 9:682-688.

Kermer P, Klocker N, Labes M, Bahr M (2000) Insulin-like growth factor-I protects axotomized rat retinal ganglion cells from secondary death via PI3-K-dependent Akt phosphorylation and inhibition of caspase-3 In vivo. J Neurosci 20:2-8.

Kicic A, Shen WY, Wilson AS, Constable IJ, Robertson T, Rakoczy PE (2003) Differentiation of marrow stromal cells into photoreceptors in the rat eye. J Neurosci 23:7742-7749.

Kielczewski JL, Pease ME, Quigley HA (2005) The effect of experimental glaucoma and optic nerve transection on amacrine cells in the rat retina. Invest Ophthalmol Vis Sci 46:3188-3196.

Kikuchi M, Tenneti L, Lipton SA (2000) Role of p38 mitogen-activated protein kinase in axotomy-induced apoptosis of rat retinal ganglion cells. J Neurosci 20:5037-5044.

Kim BG, Dai HN, Lynskey JV, McAtee M, Bregman BS (2006a) Degradation of chondroitin sulfate proteoglycans potentiates transplant-mediated axonal remodeling and functional recovery after spinal cord injury in adult rats. J Comp Neurol 497:182-198.

Kim BS, Yoo JJ, Atala A (2004a) Peripheral nerve regeneration using acellular nerve grafts. J Biomed Mater Res A 68:201-209.

Kim CI, Lee SH, Seong GJ, Kim YH, Lee MY (2006b) Nuclear translocation and overexpression of GAPDH by the hyper-pressure in retinal ganglion cell. Biochem Biophys Res Commun 341:1237-1243.

Kim DH, Gutin PH, Noble LJ, Nathan D, Yu JS, Nockels RP (1996) Treatment with genetically engineered fibroblasts producing NGF or BDNF can accelerate recovery from traumatic spinal cord injury in the adult rat. Neuroreport 7:2221-2225.

Kim JE, Liu BP, Park JH, Strittmatter SM (2004b) Nogo-66 receptor prevents raphespinal and rubrospinal axon regeneration and limits functional recovery from spinal cord injury. Neuron 44:439-451.

Kim JE, Li S, GrandPre T, Qiu D, Strittmatter SM (2003) Axon regeneration in young adult mice lacking Nogo-A/B. Neuron 38:187-199.

King C, Lacey R, Rodger J, Bartlett C, Dunlop S, Beazley L (2004) Characterisation of tectal ephrin-A2 expression during optic nerve regeneration in goldfish: implications for restoration of topography. Exp Neurol 187:380-387.

Kipnis J, Mizrahi T, Hauben E, Shaked I, Shevach E, Schwartz M (2002) Neuroprotective autoimmunity: naturally occurring CD4+CD25+ regulatory T cells suppress the ability to withstand injury to the central nervous system. Proc Natl Acad Sci U S A 99:15620-15625.

Kirsch M, Terheggen U, Hofmann HD (2003) Ciliary neurotrophic factor is an early lesion-induced retrograde signal for axotomized facial motoneurons. Mol Cell Neurosci 24:130-138.

Kirsch M, Lee MY, Meyer V, Wiese A, Hofmann HD (1997) Evidence for multiple, local functions of ciliary neurotrophic factor (CNTF) in retinal development: expression of CNTF and its receptors and in vitro effects on target cells. J Neurochem 68:979-990.

Kitaoka Y, Kumai T, Lam TT, Kuribayashi K, Isenoumi K, Munemasa Y, Motoki M, Kobayashi S, Ueno S (2004) Involvement of RhoA and possible neuroprotective effect of fasudil, a Rho kinase inhibitor, in NMDA-induced neurotoxicity in the rat retina. Brain Res 1018:111-118.

Kittlerova P, Valouskova V (2000) Retinal ganglion cells regenerating through the peripheral nerve graft retain their electroretinographic responses and mediate light-induced behavior. Behav Brain Res 112:187-194.

Klein R, Conway D, Parada LF, Barbacid M (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell 61:647-656.

Klein R, Lamballe F, Bryant S, Barbacid M (1992) The trkB tyrosine protein kinase is a receptor for neurotrophin-4. Neuron 8:947-956.

Klimaschewski L, Meisinger C, Grothe C (1999) Localization and regulation of basic fibroblast growth factor (FGF-2) and FGF receptor-1 in rat superior cervical ganglion after axotomy. J Neurobiol 38:499-506.

149

Klocker N, Cellerino A, Bahr M (1998) Free radical scavenging and inhibition of nitric oxide synthase potentiates the neurotrophic effects of brain-derived neurotrophic factor on axotomized retinal ganglion cells In vivo. J Neurosci 18:1038-1046.

Klocker N, Braunling F, Isenmann S, Bahr M (1997) In vivo neurotrophic effects of GDNF on axotomized retinal ganglion cells. Neuroreport 8:3439-3442.

Klocker N, Zerfowski M, Gellrich NC, Bahr M (2001) Morphological and functional analysis of an incomplete CNS fiber tract lesion: graded crush of the rat optic nerve. J Neurosci Methods 110:147-153.

Klocker N, Kermer P, Weishaupt JH, Labes M, Ankerhold R, Bahr M (2000) Brain-derived neurotrophic factor-mediated neuroprotection of adult rat retinal ganglion cells in vivo does not exclusively depend on phosphatidyl-inositol-3'-kinase/protein kinase B signaling. J Neurosci 20:6962-6967.

Kluck RM, Bossy-Wetzel E, Green DR, Newmeyer DD (1997) The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science 275:1132-1136.

Knoll B, Isenmann S, Kilic E, Walkenhorst J, Engel S, Wehinger J, Bahr M, Drescher U (2001) Graded expression patterns of ephrin-As in the superior colliculus after lesion of the adult mouse optic nerve. Mech Dev 106:119-127.

Knoller N, Auerbach G, Fulga V, Zelig G, Attias J, Bakimer R, Marder JB, Yoles E, Belkin M, Schwartz M, Hadani M (2005) Clinical experience using incubated autologous macrophages as a treatment for complete spinal cord injury: phase I study results. J Neurosurg Spine 3:173-181.

Kobayashi K, Takahashi M, Matsushita N, Miyazaki J, Koike M, Yaginuma H, Osumi N, Kaibuchi K (2004) Survival of developing motor neurons mediated by Rho GTPase signaling pathway through Rho-kinase. J Neurosci 24:3480-3488.

Koda M, Hashimoto M, Murakami M, Yoshinaga K, Ikeda O, Yamazaki M, Koshizuka S, Kamada T, Moriya H, Shirasawa H, Sakao S, Ino H (2004) Adenovirus vector-mediated in vivo gene transfer of brain-derived neurotrophic factor (BDNF) promotes rubrospinal axonal regeneration and functional recovery after complete transection of the adult rat spinal cord. J Neurotrauma 21:329-337.

Koeberle PD, Ball AK (1998) Effects of GDNF on retinal ganglion cell survival following axotomy. Vision Res 38:1505-1515.

Koeberle PD, Ball AK (2002) Neurturin enhances the survival of axotomized retinal ganglion cells in vivo: combined effects with glial cell line-derived neurotrophic factor and brain-derived neurotrophic factor. Neuroscience 110:555-567.

Kohno T, Inomata H, Taniguchi Y (1982) Identification of microglia cell of the rat retina by light and electron microscopy. Jpn J Ophthalmol 26:53-68.

Kokoeva MV, Yin H, Flier JS (2005) Neurogenesis in the hypothalamus of adult mice: potential role in energy balance. Science 310:679-683.

Koprivica V, Cho KS, Park JB, Yiu G, Atwal J, Gore B, Kim JA, Lin E, Tessier-Lavigne M, Chen DF, He Z (2005) EGFR activation mediates inhibition of axon regeneration by myelin and chondroitin sulfate proteoglycans. Science 310:106-110.

Kordower JH, Emborg ME, Bloch J, Ma SY, Chu Y, Leventhal L, McBride J, Chen EY, Palfi S, Roitberg BZ, Brown WD, Holden JE, Pyzalski R, Taylor MD, Carvey P, Ling Z, Trono D, Hantraye P, Deglon N, Aebischer P (2000) Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science 290:767-773.

Kottis V, Thibault P, Mikol D, Xiao ZC, Zhang R, Dergham P, Braun PE (2002) Oligodendrocyte-myelin glycoprotein (OMgp) is an inhibitor of neurite outgrowth. J Neurochem 82:1566-1569.

Kotulska K, Lewin-Kowalik J, Larysz-Brysz M, Marcol W, Fus Z (2003) Bcl-2 deficiency deprives peripheral nerves of neurotrophic activity against injured optic nerve. J Neurosci Res 73:846-852.

Kotzbauer PT, Holtzman DM (2006) Expectations and challenges in the therapeutic use of neurotrophic factors. Ann Neurol 59:444-447.

Krekoski CA, Neubauer D, Zuo J, Muir D (2001) Axonal regeneration into acellular nerve grafts is enhanced by degradation of chondroitin sulfate proteoglycan. J Neurosci 21:6206-6213.

Kretz A, Schmeer C, Tausch S, Isenmann S (2005) Simvastatin promotes heat shock protein 27 expression and Akt activation in the rat retina and protects axotomized retinal ganglion cells in vivo. Neurobiol Dis 21:421-430.

Kretz A, Kugler S, Happold C, Bahr M, Isenmann S (2004) Excess Bcl-XL increases the intrinsic growth potential of adult CNS neurons in vitro. Mol Cell Neurosci 26:63-74.

150

Kretz A, Jacob AM, Tausch S, Straten G, Isenmann S (2006) Regulation of GDNF and its receptor components GFR-alpha1, -alpha2 and Ret during development and in the mature retino-collicular pathway. Brain Res 1090:1-14.

Kreutz MR, Bien A, Vorwerk CK, Bockers TM, Seidenbecher CI, Tischmeyer W, Sabel BA (1999) Co-expression of c-Jun and ATF-2 characterizes the surviving retinal ganglion cells which maintain axonal connections after partial optic nerve injury. Brain Res Mol Brain Res 69:232-241.

Krieglstein K (2004) Factors promoting survival of mesencephalic dopaminergic neurons. Cell Tissue Res 318:73-80.

Krimm RF, Davis BM, Albers KM (2000) Cutaneous overexpression of neurotrophin-3 (NT3) selectively restores sensory innervation in NT3 gene knockout mice. J Neurobiol 43:40-49.

Kruth HS, Jones NL, Huang W, Zhao B, Ishii I, Chang J, Combs CA, Malide D, Zhang WY (2004) Macropinocytosis is the endocytic pathway that mediates macrophage foam cell formation with native LDL. J Biol Chem 280:2352-2360.

Kudo H, Nakazawa T, Shimura M, Takahashi H, Fuse N, Kashiwagi K, Tamai M (2006) Neuroprotective effect of latanoprost on rat retinal ganglion cells. Graefes Arch Clin Exp Ophthalmol:1-7.

Kullander K, Croll SD, Zimmer M, Pan L, McClain J, Hughes V, Zabski S, DeChiara TM, Klein R, Yancopoulos GD, Gale NW (2001) Ephrin-B3 is the midline barrier that prevents corticospinal tract axons from recrossing, allowing for unilateral motor control. Genes Dev 15:877-888.

Kuo LT, Simpson A, Schanzer A, Tse J, An SF, Scaravilli F, Groves MJ (2005) Effects of systemically administered NT-3 on sensory neuron loss and nestin expression following axotomy. J Comp Neurol 482:320-332.

Kuramoto H, Hozumi I, Inuzuka T, Sato S (1997) Occurrence of myelin-associated glycoprotein (MAG)-like immunoreactivity in some nervous, endocrine, and immune-related cells of the rat. An immunohistochemical study. Mol Chem Neuropathol 31:85-94.

Kurimoto T, Ishii M, Tagami Y, Nishimura M, Miyoshi T, Tsukamoto Y, Mimura O (2006) Xylazine promotes axonal regeneration in the crushed optic nerve of adult rats. Neuroreport 17:1525-1529.

Laabs T, Carulli D, Geller HM, Fawcett JW (2005) Chondroitin sulfate proteoglycans in neural development and regeneration. Curr Opin Neurobiol 15:116-120.

Labombarda F, Gonzalez SL, Deniselle MC, Vinson GP, Schumacher M, De Nicola AF, Guennoun R (2003) Effects of injury and progesterone treatment on progesterone receptor and progesterone binding protein 25-Dx expression in the rat spinal cord. J Neurochem 87:902-913.

Lachyankar MB, Condon PJ, Quesenberry PJ, Litofsky NS, Recht LD, Ross AH (1997) Embryonic precursor cells that express Trk receptors: induction of different cell fates by NGF, BDNF, NT-3, and CNTF. Exp Neurol 144:350-360.

Lai EC, Felice KJ, Festoff BW, Gawel MJ, Gelinas DF, Kratz R, Murphy MF, Natter HM, Norris FH, Rudnicki SA (1997) Effect of recombinant human insulin-like growth factor-I on progression of ALS. A placebo-controlled study. The North America ALS/IGF-I Study Group. Neurology 49:1621-1630.

Lang P, Gesbert F, Delespine-Carmagnat M, Stancou R, Pouchelet M, Bertoglio J (1996) Protein kinase A phosphorylation of RhoA mediates the morphological and functional effects of cyclic AMP in cytotoxic lymphocytes. Embo J 15:510-519.

Lange DJ, Felice KJ, Festoff BW, Gawel MJ, Gelinas DF, Kratz R, Lai EC, Murphy MF, Natter HM, Norris FH, Rudnicki S (1996) Recombinant human insulin-like growth factor-I in ALS: description of a double-blind, placebo-controlled study. North American ALS/IGF-I Study Group. Neurology 47:S93-94; discussion S94-95.

Langenhan T (2006) Ciliary neurotrophic factor (CNTF) in the olfactory system of rats and mice. Annals of Anatomy - Anatomischer Anzeiger 188:411-413.

Lapointe NP, Ung RV, Bergeron M, Cote M, Guertin PA (2006) Strain-Dependent Recovery of Spontaneous Hindlimb Movement in Spinal Cord Transected Mice (CD1, C57BL/6, BALB/c). Behav Neurosci 120:826-834.

Lawrence JM, Keegan DJ, Muir EM, Coffey PJ, Rogers JH, Wilby MJ, Fawcett JW, Lund RD (2004) Transplantation of Schwann cell line clones secreting GDNF or BDNF into the retinas of dystrophic Royal College of Surgeons rats. Invest Ophthalmol Vis Sci 45:267-274.

Lazarov-Spiegler O, Solomon AS, Schwartz M (1998) Peripheral nerve-stimulated macrophages simulate a peripheral nerve-like regenerative response in rat transected optic nerve. Glia 24:329-337.

151

Lazarov-Spiegler O, Solomon AS, Zeev-Brann AB, Hirschberg DL, Lavie V, Schwartz M (1996) Transplantation of activated macrophages overcomes central nervous system regrowth failure. Faseb J 10:1296-1302.

Leaver SG, Harvey AR, Plant GW (2006a) Adult olfactory ensheathing glia promote the long-distance growth of adult retinal ganglion cell neurites in vitro. Glia 53:467-476.

Leaver SG, Cui Q, Bernard O, Harvey AR (2006b) Cooperative effects of Bcl-2 and AAV-mediated expression of CNTF on retinal ganglion cell survival and axonal regeneration in adult transgenic mice. Eur J Neurosci 24:3323-3332.

Leaver SG, Cui Q, Plant GW, Arulpragasam A, Hisheh S, Verhaagen J, Harvey AR (2006c) AAV-mediated expression of CNTF promotes long-term survival and regeneration of adult rat retinal ganglion cells. Gene Ther 13:1328-1341.

Leclere PG, Panjwani A, Docherty R, Berry M, Pizzey J, Tonge DA (2005) Effective gene delivery to adult neurons by a modified form of electroporation. J Neurosci Methods 142:137-143.

Lee DA, Zurawel RH, Windebank AJ (1995) Ciliary neurotrophic factor expression in Schwann cells is induced by axonal contact. J Neurochem 65:564-568.

Lee EJ, Song MC, Kim HJ, Lim EJ, Kim IB, Oh SJ, Moon JI, Chun MH (2005) Brain-derived neurotrophic factor modulates the dopaminergic network in the rat retina after axotomy. Cell Tissue Res:1-9.

Lee JG, Kay EP (2006) Cross-talk among Rho GTPases acting downstream of PI 3-kinase induces mesenchymal transformation of corneal endotherial cells mediated by FGF-2. Invest Ophthalmol Vis Sci 47:2358-2368.

Lee JK, Kim JE, Sivula M, Strittmatter SM (2004) Nogo receptor antagonism promotes stroke recovery by enhancing axonal plasticity. J Neurosci 24:6209-6217.

Lee R, Kermani P, Teng KK, Hempstead BL (2001) Regulation of cell survival by secreted proneurotrophins. Science 294:1945-1948.

Lehmann M, Fournier A, Selles-Navarro I, Dergham P, Sebok A, Leclerc N, Tigyi G, McKerracher L (1999) Inactivation of Rho signaling pathway promotes CNS axon regeneration. J Neurosci 19:7537-7547.

Lemons ML, Howland DR, Anderson DK (1999) Chondroitin sulfate proteoglycan immunoreactivity increases following spinal cord injury and transplantation. Exp Neurol 160:51-65.

Lemons ML, Sandy JD, Anderson DK, Howland DR (2003) Intact aggrecan and chondroitin sulfate-depleted aggrecan core glycoprotein inhibit axon growth in the adult rat spinal cord. Exp Neurol 184:981-990.

Leon S, Yin Y, Nguyen J, Irwin N, Benowitz LI (2000) Lens injury stimulates axon regeneration in the mature rat optic nerve. J Neurosci 20:4615-4626.

Leonardo ED, Hinck L, Masu M, Keino-Masu K, Ackerman SL, Tessier-Lavigne M (1997) Vertebrate homologues of C. elegans UNC-5 are candidate netrin receptors. Nature 386:833-838.

Lessmann V, Gottmann K, Malcangio M (2003) Neurotrophin secretion: current facts and future prospects. Prog Neurobiol 69:341-374.

Levi-Montalcini R (1987) The nerve growth factor 35 years later. Science 237:1154-1162. Levi-Montalcini R, Hamburger V (1951) Selective growth stimulating effects of mouse sarcoma on the

sensory and sympathetic nervous system of the chick embryo. J Exp Zool 116:321-361. Levi-Montalcini R, Meyer H, Hamburger V (1954) In vitro experiments on the effects of mouse sarcomas

180 and 37 on the spinal and sympathetic ganglia of the chick embryo. Cancer Res 14:49-57. Levin LA, Schlamp CL, Spieldoch RL, Geszvain KM, Nickells RW (1997) Identification of the bcl-2

family of genes in the rat retina. Invest Ophthalmol Vis Sci 38:2545-2553. Levkovitch-Verbin H, Quigley HA, Martin KR, Zack DJ, Pease ME, Valenta DF (2003) A model to

study differences between primary and secondary degeneration of retinal ganglion cells in rats by partial optic nerve transection. Invest Ophthalmol Vis Sci 44:3388-3393.

Levkovitch-Verbin H, Dardik R, Vander S, Nisgav Y, Kalev-Landoy M, Melamed S (2006) Experimental Glaucoma and Optic Nerve Transection Induce Simultaneous Upregulation of Proapoptotic and Prosurvival Genes. Invest Ophthalmol Vis Sci 47:2491-2497.

Li G, Crang AJ, Rundle JL, Blakemore WF (2002a) Oligodendrocyte progenitor cells in the adult rat CNS express myelin oligodendrocyte glycoprotein (MOG). Brain Pathol 12:463-471.

Li Q, Ping P, Jiang H, Liu K (2006) Nerve conduit filled with GDNF gene-modified schwann cells enhances regeneration of the peripheral nerve. Microsurgery 26:116-121.

Li S, Strittmatter SM (2003) Delayed systemic Nogo-66 receptor antagonist promotes recovery from spinal cord injury. J Neurosci 23:4219-4227.

152

Li S, Hu B, Tay D, So KF, Yip HK (2004a) Intravitreal transplants of Schwann cells and fibroblasts promote the survival of axotomized retinal ganglion cells in rats. Brain Res 1029:56-64.

Li S, Liu BP, Budel S, Li M, Ji B, Walus L, Li W, Jirik A, Rabacchi S, Choi E, Worley D, Sah DW, Pepinsky B, Lee D, Relton J, Strittmatter SM (2004b) Blockade of Nogo-66, myelin-associated glycoprotein, and oligodendrocyte myelin glycoprotein by soluble Nogo-66 receptor promotes axonal sprouting and recovery after spinal injury. J Neurosci 24:10511-10520.

Li W, Lee J, Vikis HG, Lee SH, Liu G, Aurandt J, Shen TL, Fearon ER, Guan JL, Han M, Rao Y, Hong K, Guan KL (2004c) Activation of FAK and Src are receptor-proximal events required for netrin signaling. Nat Neurosci 7:1213-1221.

Li X, Saint-Cyr-Proulx E, Aktories K, Lamarche-Vane N (2002b) Rac1 and Cdc42 but not RhoA or Rho kinase activities are required for neurite outgrowth induced by the Netrin-1 receptor DCC (deleted in colorectal cancer) in N1E-115 neuroblastoma cells. J Biol Chem 277:15207-15214.

Li Y, Irwin N, Yin Y, Lanser M, Benowitz LI (2003a) Axon regeneration in goldfish and rat retinal ganglion cells: differential responsiveness to carbohydrates and cAMP. J Neurosci 23:7830-7838.

Li Y, Sauve Y, Li D, Lund RD, Raisman G (2003b) Transplanted olfactory ensheathing cells promote regeneration of cut adult rat optic nerve axons. J Neurosci 23:7783-7788.

Liang FQ, Dejneka NS, Cohen DR, Krasnoperova NV, Lem J, Maguire AM, Dudus L, Fisher KJ, Bennett J (2001) AAV-mediated delivery of ciliary neurotrophic factor prolongs photoreceptor survival in the rhodopsin knockout mouse. Mol Ther 3:241-248.

Lieven CJ, Hoegger MJ, Schlieve CR, Levin LA (2006) Retinal ganglion cell axotomy induces an increase in intracellular superoxide anion. Invest Ophthalmol Vis Sci 47:1477-1485.

Lin H, Hikawa N, Takenaka T, Ishikawa Y (2000) Interleukin-12 promotes neurite outgrowth in mouse sympathetic superior cervical ganglion neurons. Neurosci Lett 278:129-132.

Lin LF, Doherty DH, Lile JD, Bektesh S, Collins F (1993) GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 260:1130-1132.

Lin LF, Mismer D, Lile JD, Armes LG, Butler ET, 3rd, Vannice JL, Collins F (1989) Purification, cloning, and expression of ciliary neurotrophic factor (CNTF). Science 246:1023-1025.

Lindqvist N, Peinado-Ramonn P, Vidal-Sanz M, Hallbook F (2004) GDNF, Ret, GFRalpha1 and 2 in the adult rat retino-tectal system after optic nerve transection. Exp Neurol 187:487-499.

Lingor P, Koeberle P, Kugler S, Bahr M (2005) Down-regulation of apoptosis mediators by RNAi inhibits axotomy-induced retinal ganglion cell death in vivo. Brain 128:550-558.

Linker RA, Maurer M, Gaupp S, Martini R, Holtmann B, Giess R, Rieckmann P, Lassmann H, Toyka KV, Sendtner M, Gold R (2002) CNTF is a major protective factor in demyelinating CNS disease: a neurotrophic cytokine as modulator in neuroinflammation. Nat Med 8:620-624.

Liu BP, Strittmatter SM (2001) Semaphorin-mediated axonal guidance via Rho-related G proteins. Curr Opin Cell Biol 13:619-626.

Liu BP, Fournier A, GrandPre T, Strittmatter SM (2002a) Myelin-associated glycoprotein as a functional ligand for the Nogo-66 receptor. Science 297:1190-1193.

Liu X, Hawkes E, Ishimaru T, Tran T, Sretavan DW (2006) EphB3: an endogenous mediator of adult axonal plasticity and regrowth after CNS injury. J Neurosci 26:3087-3101.

Liu XH, Collier RJ, Youle RJ (2001) Inhibition of axotomy-induced neuronal apoptosis by extracellular delivery of a Bcl-XL fusion protein. J Biol Chem 276:46326-46332.

Liu Y, Himes BT, Murray M, Tessler A, Fischer I (2002b) Grafts of BDNF-producing fibroblasts rescue axotomized rubrospinal neurons and prevent their atrophy. Exp Neurol 178:150-164.

Liu Y, Kim D, Himes BT, Chow SY, Schallert T, Murray M, Tessler A, Fischer I (1999) Transplants of fibroblasts genetically modified to express BDNF promote regeneration of adult rat rubrospinal axons and recovery of forelimb function. J Neurosci 19:4370-4387.

Liu Z, Chen J (2000) [The research advance of brain derived neurotrophic factor]. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi 17:454-456, 460.

Lodovichi C, Di Cristo G, Cenni MC, Maffei L (2001) Bcl-2 overexpression per se does not promote regeneration of neonatal crushed optic fibers. Eur J Neurosci 13:833-838.

Logan A, Ahmed Z, Baird A, Gonzalez AM, Berry M (2006) Neurotrophic factor synergy is required for neuronal survival and disinhibited axon regeneration after CNS injury. Brain 129:490-502.

Loh NK, Woerly S, Bunt SM, Wilton SD, Harvey AR (2001) The regrowth of axons within tissue defects in the CNS is promoted by implanted hydrogel matrices that contain BDNF and CNTF producing fibroblasts. Exp Neurol 170:72-84.

Lohof AM, Quillan M, Dan Y, Poo MM (1992) Asymmetric modulation of cytosolic cAMP activity induces growth cone turning. J Neurosci 12:1253-1261.

153

Lom B, Hopker V, McFarlane S, Bixby JL, Holt CE (1998) Fibroblast growth factor receptor signaling in Xenopus retinal axon extension. J Neurobiol 37:633-641.

Lorber B, Berry M, Logan A (2005) Lens injury stimulates adult mouse retinal ganglion cell axon regeneration via both macrophage- and lens-derived factors. Eur J Neurosci 21:2029-2034.

Lorber B, Berry M, Logan A, Tonge D (2002) Effect of lens lesion on neurite outgrowth of retinal ganglion cells in vitro. Mol Cell Neurosci 21:301-311.

Lou H, Kim SK, Zaitsev E, Snell CR, Lu B, Loh YP (2005) Sorting and activity-dependent secretion of BDNF require interaction of a specific motif with the sorting receptor carboxypeptidase e. Neuron 45:245-255.

Loucks FA, Le SS, Zimmermann AK, Ryan KR, Barth H, Aktories K, Linseman DA (2006) Rho family GTPase inhibition reveals opposing effects of mitogen-activated protein kinase kinase/extracellular signal-regulated kinase and Janus kinase/signal transducer and activator of transcription signaling cascades on neuronal survival. J Neurochem 97:957-967.

Lu KW, Chen ZY, Hou TS (2004a) Protective effect of liposome-mediated glial cell line-derived neurotrophic factor gene transfer in vivo on motoneurons following spinal cord injury in rats. Chin J Traumatol 7:275-279.

Lu KW, Chen ZY, Jin DD, Hou TS, Cao L, Fu Q (2002) Cationic liposome-mediated GDNF gene transfer after spinal cord injury. J Neurotrauma 19:1081-1090.

Lu P, Jones LL, Tuszynski MH (2005) BDNF-expressing marrow stromal cells support extensive axonal growth at sites of spinal cord injury. Exp Neurol 191:344-360.

Lu P, Yang H, Jones LL, Filbin MT, Tuszynski MH (2004b) Combinatorial therapy with neurotrophins and cAMP promotes axonal regeneration beyond sites of spinal cord injury. J Neurosci 24:6402-6409.

Lu Q, Cui Q, Yip HK, So KF (2003) c-Jun expression in surviving and regenerating retinal ganglion cells: effects of intravitreal neurotrophic supply. Invest Ophthalmol Vis Sci 44:5342-5348.

Luo Y, Raible D, Raper JA (1993) Collapsin: a protein in brain that induces the collapse and paralysis of neuronal growth cones. Cell 75:217-227.

MacDonald JF, Barker JL, Paul SM, Marangos PJ, Skolnick P (1979) Inosine may be an endogenous ligand for benzodiazepine receptors on cultured spinal neurons. Science 205:715-717.

Machesky LM, Hall A (1996) Rho: a connection between membrane receptor signalling and the cytoskeleton. Trends Cell Biol 6:304-310.

Machida S, Chaudhry P, Shinohara T, Singh DP, Reddy VN, Chylack LT, Jr., Sieving PA, Bush RA (2001) Lens epithelium-derived growth factor promotes photoreceptor survival in light-damaged and RCS rats. Invest Ophthalmol Vis Sci 42:1087-1095.

Maclaren RE, Buch PK, Smith AJ, Balaggan KS, Macneil A, Taylor JS, Osborne NN, Ali RR (2006) CNTF gene transfer protects ganglion cells in rat retinae undergoing focal injury and branch vessel occlusion. Experimental Eye Research 83:1118-1127.

Madison RD, Zomorodi A, Robinson GA (2000) Netrin-1 and peripheral nerve regeneration in the adult rat. Exp Neurol 161:563-570.

Madura T, Yamashita T, Kubo T, Fujitani M, Hosokawa K, Tohyama M (2004) Activation of Rho in the injured axons following spinal cord injury. EMBO Rep 5:412-417.

Mahalik TJ, Carrier A, Owens GP, Clayton G (1992) The expression of GAP43 mRNA during the late embryonic and early postnatal development of the CNS of the rat: an in situ hybridization study. Brain Res Dev Brain Res 67:75-83.

Maisonpierre PC, Belluscio L, Squinto S, Ip NY, Furth ME, Lindsay RM, Yancopoulos GD (1990) Neurotrophin-3: a neurotrophic factor related to NGF and BDNF. Science 247:1446-1451.

Majdan M, Miller FD (1999) Neuronal life and death decisions functional antagonism between the Trk and p75 neurotrophin receptors. Int J Dev Neurosci 17:153-161.

Malik JM, Shevtsova Z, Bahr M, Kugler S (2005) Long-term in vivo inhibition of CNS neurodegeneration by Bcl-XL gene transfer. Mol Ther 11:373-381.

Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C (2006) Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther 13:463-483.

Manitt C, Kennedy TE (2002) Where the rubber meets the road: netrin expression and function in developing and adult nervous systems. Prog Brain Res 137:425-442.

Manitt C, Colicos MA, Thompson KM, Rousselle E, Peterson AC, Kennedy TE (2001) Widespread expression of netrin-1 by neurons and oligodendrocytes in the adult mammalian spinal cord. J Neurosci 21:3911-3922.

154

Mann F, Harris WA, Holt CE (2004) New views on retinal axon development: a navigation guide. Int J Dev Biol 48:957-964.

Mansour-Robaey S, Clarke DB, Wang YC, Bray GM, Aguayo AJ (1994) Effects of ocular injury and administration of brain-derived neurotrophic factor on survival and regrowth of axotomized retinal ganglion cells. Proc Natl Acad Sci U S A 91:1632-1636.

Manthorpe M, Davis GE, Varon S (1985) Purified proteins acting on cultured chick embryo ciliary ganglion neurons. Fed Proc 44:2753-2759.

Manthorpe M, Skaper S, Adler R, Landa K, Varon S (1980) Cholinergic neuronotrophic factors: fractionation properties of an extract from selected chick embryonic eye tissues. J Neurochem 34:69-75.

Marcinkiewicz M, Seidah NG, Chretien M (1996) Implications of the subtilisin/kexin-like precursor convertases in the development and function of nervous tissues. Acta Neurobiol Exp (Wars) 56:287-298.

Margolis RK, Rauch U, Maurel P, Margolis RU (1996) Neurocan and phosphacan: two major nervous tissue-specific chondroitin sulfate proteoglycans. Perspect Dev Neurobiol 3:273-290.

Maric D, Maric I, Chang YH, Barker JL (2003) Prospective cell sorting of embryonic rat neural stem cells and neuronal and glial progenitors reveals selective effects of basic fibroblast growth factor and epidermal growth factor on self-renewal and differentiation. J Neurosci 23:240-251.

Marinova T, Velikova K, Philipov S, Stankulov I, Chaldakov G, Aloe L (2003) Cellular localization of NGF and NGF receptors in aged human thymus. Folia Biol (Praha) 49:160-164.

Marmur R, Kessler JA, Zhu G, Gokhan S, Mehler MF (1998) Differentiation of oligodendroglial progenitors derived from cortical multipotent cells requires extrinsic signals including activation of gp130/LIFbeta receptors. J Neurosci 18:9800-9811.

Marotte LR, Vidovic M, Wheeler E, Jhaveri S (2004) Brain-derived neurotrophic factor is expressed in a gradient in the superior colliculus during development of the retinocollicular projection. Eur J Neurosci 20:843-847.

Martin KR, Quigley HA, Zack DJ, Levkovitch-Verbin H, Kielczewski J, Valenta D, Baumrind L, Pease ME, Klein RL, Hauswirth WW (2003) Gene therapy with brain-derived neurotrophic factor as a protection: retinal ganglion cells in a rat glaucoma model. Invest Ophthalmol Vis Sci 44:4357-4365.

Martini R, Xin Y, Schachner M (1994) Restricted localization of L1 and N-CAM at sites of contact between Schwann cells and neurites in culture. Glia 10:70-74.

Mason JL, Suzuki K, Chaplin DD, Matsushima GK (2001) Interleukin-1beta promotes repair of the CNS. J Neurosci 21:7046-7052.

Mason MR, Campbell G, Caroni P, Anderson PN, Lieberman AR (2000) Overexpression of GAP-43 in thalamic projection neurons of transgenic mice does not enable them to regenerate axons through peripheral nerve grafts. Exp Neurol 165:143-152.

Massey JM, Hubscher CH, Wagoner MR, Decker JA, Amps J, Silver J, Onifer SM (2006) Chondroitinase ABC digestion of the perineuronal net promotes functional collateral sprouting in the cuneate nucleus after cervical spinal cord injury. J Neurosci 26:4406-4414.

Masure S, Cik M, Pangalos MN, Bonaventure P, Verhasselt P, Lesage AS, Leysen JE, Gordon RD (1998) Molecular cloning, expression and tissue distribution of glial-cell-line-derived neurotrophic factor family receptor alpha-3 (GFRalpha-3). Eur J Biochem 251:622-630.

Matsui F, Watanabe E, Oohira A (1994) Immunological identification of two proteoglycan fragments derived from neurocan, a brain-specific chondroitin sulfate proteoglycan. Neurochem Int 25:425-431.

Matsukawa T, Arai K, Koriyama Y, Liu Z, Kato S (2004a) Axonal regeneration of fish optic nerve after injury. Biol Pharm Bull 27:445-451.

Matsukawa T, Sugitani K, Mawatari K, Koriyama Y, Liu Z, Tanaka M, Kato S (2004b) Role of Purpurin as a Retinol-Binding Protein in Goldfish Retina during the Early Stage of Optic Nerve Regeneration: Its Priming Action on Neurite Outgrowth. J Neurosci 24:8346-8353.

Matsuura R, Tanaka H, Go MJ (2004) Distinct functions of Rac1 and Cdc42 during axon guidance and growth cone morphogenesis in Drosophila. Eur J Neurosci 19:21-31.

Mattson MP, Scheff SW (1994) Endogenous neuroprotection factors and traumatic brain injury: mechanisms of action and implications for therapy. J Neurotrauma 11:3-33.

Mattson MP, Maudsley S, Martin B (2004) BDNF and 5-HT: a dynamic duo in age-related neuronal plasticity and neurodegenerative disorders. Trends Neurosci 27:589-594.

155

McCann T, Katagiri Y, Wang H, Geller HM (2006) Differential sulfation pattern of secreted chondroitin sulfate by activated astrocytes and its effect on neuron-astrocyte interaction. Program No. 540.8/N2 Abstract Viewer/Itinerary Planner. Washington, DC: Society for Neuroscience.

McCarty DM, Young SM, Jr., Samulski RJ (2004) Integration of adeno-associated virus (AAV) and recombinant AAV vectors. Annu Rev Genet 38:819-845.

McDonald NQ, Panayotatos N, Hendrickson WA (1995) Crystal structure of dimeric human ciliary neurotrophic factor determined by MAD phasing. Embo J 14:2689-2699.

McFarlane S, McNeill L, Holt CE (1995) FGF signaling and target recognition in the developing Xenopus visual system. Neuron 15:1017-1028.

McGee Sanftner LH, Abel H, Hauswirth WW, Flannery JG (2001) Glial cell line derived neurotrophic factor delays photoreceptor degeneration in a transgenic rat model of retinitis pigmentosa. Mol Ther 4:622-629.

McKeon RJ, Schreiber RC, Rudge JS, Silver J (1991) Reduction of neurite outgrowth in a model of glial scarring following CNS injury is correlated with the expression of inhibitory molecules on reactive astrocytes. J Neurosci 11:3398-3411.

McKernan DP, Caplis C, Donovan M, O'Brien C J, Cotter TG (2006) Age-dependent susceptibility of the retinal ganglion cell layer to cell death. Invest Ophthalmol Vis Sci 47:807-814.

McKerracher L (2001) Spinal cord repair: strategies to promote axon regeneration. Neurobiol Dis 8:11-18.

McKerracher L (2002) Ganglioside rafts as MAG receptors that mediate blockade of axon growth. Proc Natl Acad Sci U S A 99:7811-7813.

McKerracher L, Higuchi H (2006) Targeting rho to stimulate repair after spinal cord injury. J Neurotrauma 23:309-317.

McKerracher L, David S, Jackson DL, Kottis V, Dunn RJ, Braun PE (1994) Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth. Neuron 13:805-811.

McPhee SW, Janson CG, Li C, Samulski RJ, Camp AS, Francis J, Shera D, Lioutermann L, Feely M, Freese A, Leone P (2006) Immune responses to AAV in a phase I study for Canavan disease. J Gene Med 8:577-588.

McQuarrie IG, Brady ST, Lasek RJ (1986) Diversity in the axonal transport of structural proteins: major differences between optic and spinal axons in the rat. J Neurosci 6:1593-1605.

Meakin SO, Shooter EM (1992) The nerve growth factor family of receptors. Trends Neurosci 15:323-331.

Mears S, Schachner M, Brushart TM (2003) Antibodies to myelin-associated glycoprotein accelerate preferential motor reinnervation. J Peripher Nerv Syst 8:91-99.

Meier S, Brauer AU, Heimrich B, Schwab ME, Nitsch R, Savaskan NE (2003) Molecular analysis of Nogo expression in the hippocampus during development and following lesion and seizure. Faseb J 17:1153-1155.

Meijs MF, Timmers L, Pearse DD, Tresco PA, Bates ML, Joosten EA, Bunge MB, Oudega M (2004) Basic fibroblast growth factor promotes neuronal survival but not behavioral recovery in the transected and Schwann cell implanted rat thoracic spinal cord. J Neurotrauma 21:1415-1430.

Melendez-Vasquez CV, Einheber S, Salzer JL (2004) Rho kinase regulates schwann cell myelination and formation of associated axonal domains. J Neurosci 24:3953-3963.

Mellough CB, Cui Q, Spalding KL, Symons NA, Pollett MA, Snyder EY, Macklis JD, Harvey AR (2004) Fate of multipotent neural precursor cells transplanted into mouse retina selectively depleted of retinal ganglion cells. Exp Neurol 186:6-19.

Mendez P, Wandosell F, Garcia-Segura LM (2006) Cross-talk between estrogen receptors and insulin-like growth factor-I receptor in the brain: Cellular and molecular mechanisms. Frontiers in Neuroendocrinology 27:391-403.

Mendonca Torres PM, de Araujo EG (2001) Interleukin-6 increases the survival of retinal ganglion cells in vitro. J Neuroimmunol 117:43-50.

Menei P, Montero-Menei C, Whittemore SR, Bunge RP, Bunge MB (1998) Schwann cells genetically modified to secrete human BDNF promote enhanced axonal regrowth across transected adult rat spinal cord. Eur J Neurosci 10:607-621.

Merighi A, Carmignoto G, Gobbo S, Lossi L, Salio C, Vergnano AM, Zonta M (2004) Neurotrophins in spinal cord nociceptive pathways. Prog Brain Res 146:291-321.

Mey J, Thanos S (1993) Intravitreal injections of neurotrophic factors support the survival of axotomized retinal ganglion cells in adult rats in vivo. Brain Res 602:304-317.

156

Meyer-Franke A, Kaplan MR, Pfrieger FW, Barres BA (1995) Characterization of the signaling interactions that promote the survival and growth of developing retinal ganglion cells in culture. Neuron 15:805-819.

Meyer-Franke A, Wilkinson GA, Kruttgen A, Hu M, Munro E, Hanson MG, Jr., Reichardt LF, Barres BA (1998) Depolarization and cAMP elevation rapidly recruit TrkB to the plasma membrane of CNS neurons. Neuron 21:681-693.

Mi S, Lee X, Shao Z, Thill G, Ji B, Relton J, Levesque M, Allaire N, Perrin S, Sands B, Crowell T, Cate RL, McCoy JM, Pepinsky RB (2004) LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex. Nat Neurosci 7:221-228.

Middlemas DS, Lindberg RA, Hunter T (1991) trkB, a neural receptor protein-tyrosine kinase: evidence for a full-length and two truncated receptors. Mol Cell Biol 11:143-153.

Mikol DD, Stefansson K (1988) A phosphatidylinositol-linked peanut agglutinin-binding glycoprotein in central nervous system myelin and on oligodendrocytes. J Cell Biol 106:1273-1279.

Miller B, Sheppard AM, Bicknese AR, Pearlman AL (1995) Chondroitin sulfate proteoglycans in the developing cerebral cortex: the distribution of neurocan distinguishes forming afferent and efferent axonal pathways. J Comp Neurol 355:615-628.

Miller NR (2001) Optic nerve protection, regeneration, and repair in the 21st century: LVIII Edward Jackson Memorial lecture. Am J Ophthalmol 132:811-818.

Miller RG, Bryan WW, Dietz MA, Munsat TL, Petajan JH, Smith SA, Goodpasture JC (1996a) Toxicity and tolerability of recombinant human ciliary neurotrophic factor in patients with amyotrophic lateral sclerosis. Neurology 47:1329-1331.

Miller RG, Petajan JH, Bryan WW, Armon C, Barohn RJ, Goodpasture JC, Hoagland RJ, Parry GJ, Ross MA, Stromatt SC (1996b) A placebo-controlled trial of recombinant human ciliary neurotrophic (rhCNTF) factor in amyotrophic lateral sclerosis. rhCNTF ALS Study Group. Ann Neurol 39:256-260.

Miller TM, Tansey MG, Johnson EM, Jr., Creedon DJ (1997) Inhibition of phosphatidylinositol 3-kinase activity blocks depolarization- and insulin-like growth factor I-mediated survival of cerebellar granule cells. J Biol Chem 272:9847-9853.

Mimura F, Yamagishi S, Arimura N, Fujitani M, Kubo T, Kaibuchi K, Yamashita T (2006) MAG inhibits microtubule assembly by a Rho-kinase dependent mechanism. J Biol Chem 281:15970-15979.

Misantone LJ, Gershenbaum M, Murray M (1984) Viability of retinal ganglion cells after optic nerve crush in adult rats. J Neurocytol 13:449-465.

Mitsuda S, Yoshii C, Ikegami Y, Araki M (2005) Tissue interaction between the retinal pigment epithelium and the choroid triggers retinal regeneration of the newt Cynops pyrrhogaster. Dev Biol 280:122-132.

Mittoux V, Joseph JM, Conde F, Palfi S, Dautry C, Poyot T, Bloch J, Deglon N, Ouary S, Nimchinsky EA, Brouillet E, Hof PR, Peschanski M, Aebischer P, Hantraye P (2000) Restoration of cognitive and motor functions by ciliary neurotrophic factor in a primate model of Huntington's disease. Hum Gene Ther 11:1177-1187.

Miura T, Tanaka S, Seichi A, Arai M, Goto T, Katagiri H, Asano T, Oda H, Nakamura K (2000) Partial functional recovery of paraplegic rat by adenovirus-mediated gene delivery of constitutively active MEK1. Exp Neurol 166:115-126.

Mo X, Yokoyama A, Oshitari T, Negishi H, Dezawa M, Mizota A, Adachi-Usami E (2002) Rescue of axotomized retinal ganglion cells by BDNF gene electroporation in adult rats. Invest Ophthalmol Vis Sci 43:2401-2405.

Molliver DC, Lindsay J, Albers KM, Davis BM (2005) Overexpression of NGF or GDNF alters transcriptional plasticity evoked by inflammation. Pain 113:277-284.

Monnier PP, Sierra A, Schwab JM, Henke-Fahle S, Mueller BK (2003) The Rho/ROCK pathway mediates neurite growth-inhibitory activity associated with the chondroitin sulfate proteoglycans of the CNS glial scar. Mol Cell Neurosci 22:319-330.

Monsul NT, Geisendorfer AR, Han PJ, Banik R, Pease ME, Skolasky RL, Jr., Hoffman PN (2004) Intraocular injection of dibutyryl cyclic AMP promotes axon regeneration in rat optic nerve. Exp Neurol 186:124-133.

Monteggia LM, Barrot M, Powell CM, Berton O, Galanis V, Gemelli T, Meuth S, Nagy A, Greene RW, Nestler EJ (2004) Essential role of brain-derived neurotrophic factor in adult hippocampal function. Proc Natl Acad Sci U S A 101:10827-10832.

157

Monville C, Fages C, Feyens AM, D'Hondt V, Guillet C, Vernallis A, Gascan H, Peschanski M (2002) Astroglial expression of the P-glycoprotein is controlled by intracellular CNTF. BMC Cell Biol 3:20.

Moon LD, Asher RA, Rhodes KE, Fawcett JW (2001) Regeneration of CNS axons back to their target following treatment of adult rat brain with chondroitinase ABC. Nat Neurosci 4:465-466.

Moore S, Thanos S (1996) Differential increases in rat retinal ganglion cell size with various methods of optic nerve lesion. Neurosci Lett 207:117-120.

Morgenstern DA, Asher RA, Fawcett JW (2002) Chondroitin sulphate proteoglycans in the CNS injury response. Prog Brain Res 137:313-332.

Morgenstern DA, Asher RA, Naidu M, Carlstedt T, Levine JM, Fawcett JW (2003) Expression and glycanation of the NG2 proteoglycan in developing, adult, and damaged peripheral nerve. Mol Cell Neurosci 24:787-802.

Morrissey TK, Kleitman N, Bunge RP (1991) Isolation and functional characterization of Schwann cells derived from adult peripheral nerve. J Neurosci 11:2433-2442.

Muir D, Engvall E, Varon S, Manthorpe M (1989) Schwannoma cell-derived inhibitor of the neurite-promoting activity of laminin. J Cell Biol 109:2353-2362.

Mukhopadhyay G, Doherty P, Walsh FS, Crocker PR, Filbin MT (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron 13:757-767.

Murai KK, Pasquale EB (2003) 'Eph'ective signaling: forward, reverse and crosstalk. J Cell Sci 116:2823-2832.

Murphy JA, Clarke DB (2006) Target-derived neurotrophins may influence the survival of adult retinal ganglion cells when local neurotrophic support is disrupted: Implications for glaucoma. Med Hypotheses 67:1208-1212.

Murray M, Kim D, Liu Y, Tobias C, Tessler A, Fischer I (2002) Transplantation of genetically modified cells contributes to repair and recovery from spinal injury. Brain Res Brain Res Rev 40:292-300.

Nakagawa S, Brennan C, Johnson KG, Shewan D, Harris WA, Holt CE (2000) Ephrin-B regulates the Ipsilateral routing of retinal axons at the optic chiasm. Neuron 25:599-610.

Nakai H, Montini E, Fuess S, Storm TA, Grompe M, Kay MA (2003) AAV serotype 2 vectors preferentially integrate into active genes in mice. Nat Genet 34:297-302.

Nakamura F, Kalb RG, Strittmatter SM (2000a) Molecular basis of semaphorin-mediated axon guidance. J Neurobiol 44:219-229.

Nakamura M, Singh DP, Kubo E, Chylack LT, Jr., Shinohara T (2000b) LEDGF: survival of embryonic chick retinal photoreceptor cells. Invest Ophthalmol Vis Sci 41:1168-1175.

Nakazawa T, Tamai M, Mori N (2002) Brain-derived neurotrophic factor prevents axotomized retinal ganglion cell death through MAPK and PI3K signaling pathways. Invest Ophthalmol Vis Sci 43:3319-3326.

Nakazawa T, Takahashi H, Shimura M (2006) Estrogen has a neuroprotective effect on axotomized RGCs through ERK signal transduction pathway. Brain Res 1093:141-149.

Nakazawa T, Morii H, Tamai M, Mori N (2005) Selective upregulation of RB3/stathmin4 by ciliary neurotrophic factor following optic nerve axotomy. Brain Res 1061:97-106.

Naldini L, Blomer U, Gage FH, Trono D, Verma IM (1996a) Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc Natl Acad Sci U S A 93:11382-11388.

Naldini L, Blomer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, Trono D (1996b) In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267.

Namikawa K, Honma M, Abe K, Takeda M, Mansur K, Obata T, Miwa A, Okado H, Kiyama H (2000) Akt/protein kinase B prevents injury-induced motoneuron death and accelerates axonal regeneration. J Neurosci 20:2875-2886.

Nash HH, Borke RC, Anders JJ (2002) Ensheathing cells and methylprednisolone promote axonal regeneration and functional recovery in the lesioned adult rat spinal cord. J Neurosci 22:7111-7120.

Nawa H, Takei N (2001) BDNF as an anterophin; a novel neurotrophic relationship between brain neurons. Trends Neurosci 24:683-684; discussion 684-685.

Negishi H, Dezawa M, Oshitari T, Adachi-Usami E (2001) Optic nerve regeneration within artificial Schwann cell graft in the adult rat. Brain Res Bull 55:409-419.

Neufeld G, Shraga-Heled N, Lange T, Guttmann-Raviv N, Herzog Y, Kessler O (2005) Semaphorins in cancer. Front Biosci 10:751-760.

158

Neumann H, Schweigreiter R, Yamashita T, Rosenkranz K, Wekerle H, Barde YA (2002a) Tumor necrosis factor inhibits neurite outgrowth and branching of hippocampal neurons by a rho-dependent mechanism. J Neurosci 22:854-862.

Neumann S, Bradke F, Tessier-Lavigne M, Basbaum AI (2002b) Regeneration of sensory axons within the injured spinal cord induced by intraganglionic cAMP elevation. Neuron 34:885-893.

Ng J, Luo L (2004) Rho GTPases Regulate Axon Growth through Convergent and Divergent Signaling Pathways. Neuron 44:779-793.

Ng TF, So KF, Chung SK (1995) Influence of peripheral nerve grafts on the expression of GAP-43 in regenerating retinal ganglion cells in adult hamsters. J Neurocytol 24:487-496.

Nguyen TA, Takemoto LJ, Takemoto DJ (2004) Inhibition of gap junction activity through the release of the C1B domain of protein kinase Cgamma (PKCgamma) from 14-3-3: identification of PKCgamma-binding sites. J Biol Chem 279:52714-52725.

Nguyen TA, Boyle DL, Wagner LM, Shinohara T, Takemoto DJ (2003) LEDGF activation of PKC gamma and gap junction disassembly in lens epithelial cells. Exp Eye Res 76:565-572.

Nickells RW (2004) The molecular biology of retinal ganglion cell death: caveats and controversies. Brain Res Bull 62:439-446.

Nicole Bodeutsch ST (2000) Migration of phagocytotic cells and development of the murine intraretinal microglial network: An in vivo study using fluorescent dyes. Glia 32:91-101.

Niederost B, Oertle T, Fritsche J, McKinney RA, Bandtlow CE (2002) Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac1. J Neurosci 22:10368-10376.

Nikulina E, Tidwell JL, Dai HN, Bregman BS, Filbin MT (2004) The phosphodiesterase inhibitor rolipram delivered after a spinal cord lesion promotes axonal regeneration and functional recovery. Proc Natl Acad Sci U S A 101:8786-8790.

Nishio Y, Koda M, Kitajo K, Seto M, Hata K, Taniguchi J, Moriya H, Fujitani M, Kubo T, Yamashita T (2006) Delayed treatment with Rho-kinase inhibitor does not enhance axonal regeneration or functional recovery after spinal cord injury in rats. Exp Neurol 200:392-397.

Nitzan A, Kermer P, Shirvan A, Bahr M, Barzilai A, Solomon AS (2006) Examination of cellular and molecular events associated with optic nerve axotomy. Glia 54:545-556.

Nomura H, Tator CH, Shoichet MS (2006) Bioengineered strategies for spinal cord repair. J Neurotrauma 23:496-507.

Nonner D, Barrett EF, Barrett JN (1996) Neurotrophin effects on survival and expression of cholinergic properties in cultured rat septal neurons under normal and stress conditions. J Neurosci 16:6665-6675.

Nosrat CA, Fried K, Lindskog S, Olson L (1997) Cellular expression of neurotrophin mRNAs during tooth development. Cell Tissue Res 290:569-580.

Nykjaer A, Willnow TE, Petersen CM (2005) p75(NTR) - live or let die. Curr Opin Neurobiol 15:49-57. Nykjaer A, Lee R, Teng KK, Jansen P, Madsen P, Nielsen MS, Jacobsen C, Kliemannel M, Schwarz E,

Willnow TE, Hempstead BL, Petersen CM (2004) Sortilin is essential for proNGF-induced neuronal cell death. Nature 427:843-848.

O'Leary DD, McLaughlin T (2005) Mechanisms of retinotopic map development: Ephs, ephrins, and spontaneous correlated retinal activity. Prog Brain Res 147:43-65.

Oakley RA, Lefcort FB, Plouffe P, Ritter A, Frank E (2000) Neurotrophin-3 promotes the survival of a limited subpopulation of cutaneous sensory neurons. Dev Biol 224:415-427.

Obata K, Noguchi K (2006) BDNF in sensory neurons and chronic pain. Neurosci Res 55:1-10. Oertle T, van der Haar ME, Bandtlow CE, Robeva A, Burfeind P, Buss A, Huber AB, Simonen M,

Schnell L, Brosamle C, Kaupmann K, Vallon R, Schwab ME (2003) Nogo-A inhibits neurite outgrowth and cell spreading with three discrete regions. J Neurosci 23:5393-5406.

Ohira K, Shimizu K, Hayashi M (1999) Change of expression of full-length and truncated TrkBs in the developing monkey central nervous system. Brain Res Dev Brain Res 112:21-29.

Ohira K, Kumanogoh H, Sahara Y, Homma KJ, Hirai H, Nakamura S, Hayashi M (2005) A truncated tropo-myosine-related kinase B receptor, T1, regulates glial cell morphology via Rho GDP dissociation inhibitor 1. J Neurosci 25:1343-1353.

Ohlsson M, Westerlund U, Langmoen IA, Svensson M (2004a) Methylprednisolone treatment does not influence axonal regeneration or degeneration following optic nerve injury in the adult rat. J Neuroophthalmol 24:11-18.

Ohlsson M, Mattsson P, Wamil BD, Hellerqvist CG, Svensson M (2004b) Macrophage stimulation using a group B-streptococcus exotoxin (CM101) leads to axonal regrowth in the injured optic nerve. Restor Neurol Neurosci 22:33-41.

159

Ohta K, Hara H, Hayashi K, Itoh N, Ohi T, Ohta M (1995) Tissue expression of rat ciliary neurotrophic factor (CNTF) mRNA and production of the recombinant CNTF. Biochem Mol Biol Int 35:283-290.

Ohta M, Ohi T, Nishimura M, Itoh N, Hayashi K, Ohta K (1996) Distribution of and age-related changes in ciliary neurotrophic factor protein in rat tissues. Biochem Mol Biol Int 40:671-678.

Olmarker K, Stromberg J, Blomquist J, Zachrisson P, Nannmark U, Nordborg C, Rydevik B (1996) Chondroitinase ABC (pharmaceutical grade) for chemonucleolysis. Functional and structural evaluation after local application on intraspinal nerve structures and blood vessels. Spine 21:1952-1956.

Oppenheim RW, Prevette D, Yin QW, Collins F, MacDonald J (1991) Control of embryonic motoneuron survival in vivo by ciliary neurotrophic factor. Science 251:1616-1618.

Orike N, Thrasivoulou C, Wrigley A, Cowen T (2001) Differential regulation of survival and growth in adult sympathetic neurons: an in vitro study of neurotrophin responsiveness. J Neurobiol 47:295-305.

Orlando KA, Stone NL, Pittman RN (2006) Rho kinase regulates fragmentation and phagocytosis of apoptotic cells. Exp Cell Res 312:5-15.

Orrell RW, King AW, Lane RJ, de Belleroche JS (1995) Investigation of a null mutation of the CNTF gene in familial amyotrophic lateral sclerosis. J Neurol Sci 132:126-128.

Oshitari T, Adachi-Usami E (2003) The effect of caspase inhibitors and neurotrophic factors on damaged retinal ganglion cells. Neuroreport 14:289-292.

Oshitari T, Okada S, Tokuhisa T, Adachi-Usami E (2003) Adenovirus-mediated gene transfer of Bcl-xL impedes neurite regeneration in vitro. Neuroreport 14:1159-1162.

Oster SF, Sretavan DW (2003) Connecting the eye to the brain: the molecular basis of ganglion cell axon guidance. Br J Ophthalmol 87:639-645.

Oster SF, Deiner M, Birgbauer E, Sretavan DW (2004) Ganglion cell axon pathfinding in the retina and optic nerve. Semin Cell Dev Biol 15:125-136.

Ota T, Hara H, Miyawaki N (2002) Brain-derived neurotrophic factor inhibits changes in soma-size of retinal ganglion cells following optic nerve axotomy in rats. J Ocul Pharmacol Ther 18:241-249.

Oyesiku NM, Wigston DJ (1996) Ciliary neurotrophic factor stimulates neurite outgrowth from spinal cord neurons. J Comp Neurol 364:68-77.

Ozdinler PH, Macklis JD (2006) IGF-I specifically enhances axon outgrowth of corticospinal motor neurons. Nat Neurosci 9:1371-1381.

Pachnis V, Mankoo B, Costantini F (1993) Expression of the c-ret proto-oncogene during mouse embryogenesis. Development 119:1005-1017.

Paino CL, Bunge MB (1991) Induction of axon growth into Schwann cell implants grafted into lesioned adult rat spinal cord. Exp Neurol 114:254-257.

Pan JZ, Jornsten R, Hart RP (2004) Screening anti-inflammatory compounds in injured spinal cord with microarrays: A comparison of bioinformatics analysis approaches. Physiol Genomics 17:201-214.

Papadopoulos CM, Tsai SY, Alsbiei T, O'Brien TE, Schwab ME, Kartje GL (2002) Functional recovery and neuroanatomical plasticity following middle cerebral artery occlusion and IN-1 antibody treatment in the adult rat. Ann Neurol 51:433-441.

Park CM, Hollenberg MJ (1989) Basic fibroblast growth factor induces retinal regeneration in vivo. Dev Biol 134:201-205.

Park JB, Yiu G, Kaneko S, Wang J, Chang J, He Z (2005) A TNF Receptor Family Member, TROY, Is a Coreceptor with Nogo Receptor in Mediating the Inhibitory Activity of Myelin Inhibitors. Neuron 45:345-351.

Park K, Luo JM, Hisheh S, Harvey AR, Cui Q (2004a) Cellular mechanisms associated with spontaneous and ciliary neurotrophic factor-cAMP-induced survival and axonal regeneration of adult retinal ganglion cells. J Neurosci 24:10806-10815.

Park K, Hisheh S, Turnley AM, Cui Q, Harvey AR (2006) Supressor of cytokine signaling (SOCS) mRNA expression in axotomized retina subjected to peripheral nerve graft and ciliary neurotrophic factor (CNTF). Proc Aus Neurosci Soc 17:155.

Park KW, Crouse D, Lee M, Karnik SK, Sorensen LK, Murphy KJ, Kuo CJ, Li DY (2004b) The axonal attractant Netrin-1 is an angiogenic factor. Proc Natl Acad Sci U S A 101:16210-16215.

Pasterkamp RJ, Anderson PN, Verhaagen J (2001) Peripheral nerve injury fails to induce growth of lesioned ascending dorsal column axons into spinal cord scar tissue expressing the axon repellent Semaphorin3A. Eur J Neurosci 13:457-471.

160

Pastrana E, Moreno-Flores MT, Gurzov EN, Avila J, Wandosell F, Diaz-Nido J (2006) Genes associated with adult axon regeneration promoted by olfactory ensheathing cells: A new role for matrix metallproteinase 2. J Neurosci 26:5347-5359.

Patel NK, Bunnage M, Plaha P, Svendsen CN, Heywood P, Gill SS (2005) Intraputamenal infusion of glial cell line-derived neurotrophic factor in PD: A two-year outcome study. Ann Neurol 57:298-302.

Patil K, Sharma SC (2004) Broad spectrum caspase inhibitor rescues retinal ganglion cells after ischemia. Neuroreport 15:981-984.

Pearse DD, Pereira FC, Marcillo AE, Bates ML, Berrocal YA, Filbin MT, Bunge MB (2004) cAMP and Schwann cells promote axonal growth and functional recovery after spinal cord injury. Nat Med 10:610-616.

Peden CS, Burger C, Muzyczka N, Mandel RJ (2004) Circulating anti-wild-type adeno-associated virus type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)-mediated, but not rAAV5-mediated, gene transfer in the brain. J Virol 78:6344-6359.

Pedraza CE, Podlesniy P, Vidal N, Arevalo JC, Lee R, Hempstead B, Ferrer I, Iglesias M, Espinet C (2005) Pro-NGF isolated from the human brain affected by Alzheimer's disease induces neuronal apoptosis mediated by p75NTR. Am J Pathol 166:533-543.

Peinado-Ramon P, Salvador M, Villegas-Perez MP, Vidal-Sanz M (1996) Effects of axotomy and intraocular administration of NT-4, NT-3, and brain-derived neurotrophic factor on the survival of adult rat retinal ganglion cells. A quantitative in vivo study. Invest Ophthalmol Vis Sci 37:489-500.

Penkowa M, Giralt M, Carrasco J, Hadberg H, Hidalgo J (2000) Impaired inflammatory response and increased oxidative stress and neurodegeneration after brain injury in interleukin-6-deficient mice. Glia 32:271-285.

Penn RD, Kroin JS, York MM, Cedarbaum JM (1997) Intrathecal ciliary neurotrophic factor delivery for treatment of amyotrophic lateral sclerosis (phase I trial). Neurosurgery 40:94-99; discussion 99-100.

Pennica D, Shaw KJ, Swanson TA, Moore MW, Shelton DL, Zioncheck KA, Rosenthal A, Taga T, Paoni NF, Wood WI (1995) Cardiotrophin-1. Biological activities and binding to the leukemia inhibitory factor receptor/gp130 signaling complex. J Biol Chem 270:10915-10922.

Pernet V, Di Polo A (2006) Synergistic action of brain-derived neurotrophic factor and lens injury promotes retinal ganglion cell survival, but leads to optic nerve dystrophy in vivo. Brain 129:1014-1026.

Pernet V, Hauswirth WW, Di Polo A (2005) Extracellular signal-regulated kinase 1/2 mediates survival, but not axon regeneration, of adult injured central nervous system neurons in vivo. J Neurochem 93:72-83.

Perrone L, Paladino S, Mazzone M, Nitsch L, Gulisano M, Zurzolo C (2005) Functional interaction between p75NTR and TrkA: the endocytic trafficking of p75NTR is driven by TrkA and regulates TrkA-mediated signalling. Biochem J 385:233-241.

Perry VH (1981) Evidence for an amacrine cell system in the ganglion cell layer of the rat retina. Neuroscience 6:931-944.

Perry VH, Cowey A (1979) The effects of unilateral cortical and tectal lesions on retinal ganglion cells in rats. Exp Brain Res 35:85-95.

Perry VH, Walker M (1980) Amacrine cells, displaced amacrine cells and interplexiform cells in the retina of the rat. Proc R Soc Lond B Biol Sci 208:415-431.

Perry VH, Cowey A (1982) A sensitive period for ganglion cell degeneration and the formation of aberrant retino-fugal connections following tectal lesions in rats. Neuroscience 7:583-594.

Perry VH, Hayes L (1985) Lesion-induced myelin formation in the retina. J Neurocytol 14:297-307. Perry VH, Henderson Z, Linden R (1983) Postnatal changes in retinal ganglion cell and optic axon

populations in the pigmented rat. J Comp Neurol 219:356-368. Petrausch B, Jung M, Leppert CA, Stuermer CA (2000a) Lesion-induced regulation of netrin receptors

and modification of netrin-1 expression in the retina of fish and grafted rats. Mol Cell Neurosci 16:350-364.

Petrausch B, Tabibiazar R, Roser T, Jing Y, Goldman D, Stuermer CA, Irwin N, Benowitz LI (2000b) A purine-sensitive pathway regulates multiple genes involved in axon regeneration in goldfish retinal ganglion cells. J Neurosci 20:8031-8041.

Pierucci A, de Oliveira AL (2006) Increased sensory neuron apoptotic death 2 weeks after peripheral axotomy in C57BL/6J mice compared to A/J mice. Neurosci Lett 396:127-131.

161

Ping P, Li QF, Zhang DS (2003) [An experiment study on repair of peripheral nerve defects by GDNF gene modified Schwann cells]. Zhonghua Zheng Xing Wai Ke Za Zhi 19:369-372.

Pizzi MA, Elam JS (2004) Characterization of a chondroitin sultate proteoglycan associated with regeneration in goldfish optic tract. Neurochem Res 29:719-728.

Plant GW, Harvey AR (2000) A new type of biocompatible bridging structure supports axon regrowth after implantation into the lesioned rat optic tract. Cell Transplant 9:759-772.

Plant GW, Currier PF, Cuervo EP, Bates ML, Pressman Y, Bunge MB, Wood PM (2002) Purified adult ensheathing glia fail to myelinate axons under culture conditions that enable Schwann cells to form myelin. J Neurosci 22:6083-6091.

Porciatti V, Pizzorusso T, Cenni MC, Maffei L (1996) The visual response of retinal ganglion cells is not altered by optic nerve transection in transgenic mice overexpressing Bcl-2. Proc Natl Acad Sci U S A 93:14955-14959.

Porritt MJ, Batchelor PE, Howells DW (2005) Inhibiting BDNF expression by antisense oligonucleotide infusion causes loss of nigral dopaminergic neurons. Exp Neurol 192:226-234.

Potts RA, Dreher B, Bennett MR (1982) The loss of ganglion cells in the developing retina of the rat. Brain Res 255:481-486.

Priestley JV, Ramer MS, King VR, McMahon SB, Brown RA (2002) Stimulating regeneration in the damaged spinal cord. J Physiol Paris 96:123-133.

Probstmeier R, Stichel CC, Muller HW, Asou H, Pesheva P (2000) Chondroitin sulfates expressed on oligodendrocyte-derived tenascin-R are involved in neural cell recognition. Functional implications during CNS development and regeneration. J Neurosci Res 60:21-36.

Probstmeier R, Nellen J, Gloor S, Wernig A, Pesheva P (2001) Tenascin-R is expressed by Schwann cells in the peripheral nervous system. J Neurosci Res 64:70-78.

Properzi F, Fawcett JW (2004) Proteoglycans and brain repair. News Physiol Sci 19:33-38. Properzi F, Asher RA, Fawcett JW (2003) Chondroitin sulphate proteoglycans in the central nervous

system: changes and synthesis after injury. Biochem Soc Trans 31:335-336. Properzi F, Carulli D, Asher RA, Muir E, Camargo LM, van Kuppevelt TH, Ten Dam GB, Furukawa

Y, Mikami T, Sugahara K, Toida T, Geller HM, Fawcett JW (2005) Chondroitin 6-sulphate synthesis is up-regulated in injured CNS, induced by injury-related cytokines and enhanced in axon-growth inhibitory glia. Eur J Neurosci 21:378-390.

Qin Q, Patil K, Sharma SC (2004) The role of Bax-inhibiting peptide in retinal ganglion cell apoptosis after optic nerve transection. Neurosci Lett 372:17-21.

Qiu J, Cafferty WB, McMahon SB, Thompson SW (2005) Conditioning injury-induced spinal axon regeneration requires signal transducer and activator of transcription 3 activation. J Neurosci 25:1645-1653.

Qiu J, Cai D, Dai H, McAtee M, Hoffman PN, Bregman BS, Filbin MT (2002) Spinal axon regeneration induced by elevation of cyclic AMP. Neuron 34:895-903.

Quartu M, Serra MP, Manca A, Follesa P, Lai ML, Del Fiacco M (2003) Neurotrophin-like immunoreactivity in the human pre-term newborn, infant, and adult cerebellum. Int J Dev Neurosci 21:23-33.

Rabacchi SA, Bonfanti L, Liu XH, Maffei L (1994) Apoptotic cell death induced by optic nerve lesion in the neonatal rat. J Neurosci 14:5292-5301.

Raineteau O, Fouad K, Bareyre FM, Schwab ME (2002) Reorganization of descending motor tracts in the rat spinal cord. Eur J Neurosci 16:1761-1771.

Raizada MK (1991) Insulin-like growth factor I: a possible modulator of intercellular communication in the brain. Adv Exp Med Biol 293:493-505.

Rajan P, Symes AJ, Fink JS (1996) STAT proteins are activated by ciliary neurotrophic factor in cells of central nervous system origin. J Neurosci Res 43:403-411.

Rakowicz WP, Staples CS, Milbrandt J, Brunstrom JE, Johnson EM, Jr. (2002) Glial cell line-derived neurotrophic factor promotes the survival of early postnatal spinal motor neurons in the lateral and medial motor columns in slice culture. J Neurosci 22:3953-3962.

Ramer MS, Bishop T, Dockery P, Mobarak MS, O'Leary D, Fraher JP, Priestley JV, McMahon SB (2002) Neurotrophin-3-mediated regeneration and recovery of proprioception following dorsal rhizotomy. Mol Cell Neurosci 19:239-249.

Ramirez JJ, Caldwell JL, Majure M, Wessner DR, Klein RL, Meyer EM, King MA (2003) Adeno-associated virus vector expressing nerve growth factor enhances cholinergic axonal sprouting after cortical injury in rats. J Neurosci 23:2797-2803.

162

Rapalino O, Lazarov-Spiegler O, Agranov E, Velan GJ, Yoles E, Fraidakis M, Solomon A, Gepstein R, Katz A, Belkin M, Hadani M, Schwartz M (1998) Implantation of stimulated homologous macrophages results in partial recovery of paraplegic rats. Nat Med 4:814-821.

Rattenholl A, Ruoppolo M, Flagiello A, Monti M, Vinci F, Marino G, Lilie H, Schwarz E, Rudolph R (2001) Pro-sequence assisted folding and disulfide bond formation of human nerve growth factor. J Mol Biol 305:523-533.

Regulier E, Pereira de Almeida L, Sommer B, Aebischer P, Deglon N (2002) Dose-dependent neuroprotective effect of ciliary neurotrophic factor delivered via tetracycline-regulated lentiviral vectors in the quinolinic acid rat model of Huntington's disease. Hum Gene Ther 13:1981-1990.

Reh TA, Tetzlaff W, Ertlmaier A, Zwiers H (1993) Developmental study of the expression of B50/GAP-43 in rat retina. J Neurobiol 24:949-958.

Reier PJ, Houle JD (1988) The glial scar: its bearing on axonal elongation and transplantation approaches to CNS repair. Adv Neurol 47:87-138.

Reiness CG, Seppa MJ, Dion DM, Sweeney S, Foster DN, Nishi R (2001) Chick ciliary neurotrophic factor is secreted via a nonclassical pathway. Mol Cell Neurosci 17:931-944.

Richardson PM, McGuinness UM, Aguayo AJ (1980) Axons from CNS neurons regenerate into PNS grafts. Nature 284:264-265.

Rivero F, Somesh BP (2002) Signal transduction pathways regulated by Rho GTPases in Dictyostelium. J Muscle Res Cell Motil 23:737-749.

Robinson RC, Radziejewski C, Spraggon G, Greenwald J, Kostura MR, Burtnick LD, Stuart DI, Choe S, Jones EY (1999) The structures of the neurotrophin 4 homodimer and the brain-derived neurotrophic factor/neurotrophin 4 heterodimer reveal a common Trk-binding site. Protein Sci 8:2589-2597.

Rodger J, Goto H, Cui Q, Chen PB, Harvey AR (2005) cAMP regulates axon outgrowth and guidance during optic nerve regeneration in goldfish. Mol Cell Neurosci 30:452-464.

Rodger J, Vitale PN, Tee LB, King CE, Bartlett CA, Fall A, Brennan C, O'Shea JE, Dunlop SA, Beazley LD (2004) EphA/ephrin-A interactions during optic nerve regeneration: restoration of topography and regulation of ephrin-A2 expression. Mol Cell Neurosci 25:56-68.

Rohm B, Rahim B, Kleiber B, Hovatta I, Puschel AW (2000) The semaphorin 3A receptor may directly regulate the activity of small GTPases. FEBS Lett 486:68-72.

Rohrer B, Matthes MT, LaVail MM, Reichardt LF (2003) Lack of p75 receptor does not protect photoreceptors from light-induced cell death. Exp Eye Res 76:125-129.

Romero MI, Rangappa N, Garry MG, Smith GM (2001) Functional regeneration of chronically injured sensory afferents into adult spinal cord after neurotrophin gene therapy. J Neurosci 21:8408-8416.

Romero MI, Rangappa N, Li L, Lightfoot E, Garry MG, Smith GM (2000) Extensive sprouting of sensory afferents and hyperalgesia induced by conditional expression of nerve growth factor in the adult spinal cord. J Neurosci 20:4435-4445.

Rose CR, Blum R, Pichler B, Lepier A, Kafitz KW, Konnerth A (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature 426:74-78.

Rosenstiel P, Schramm P, Isenmann S, Brecht S, Eickmeier C, Burger E, Herdegen T, Sievers J, Lucius R (2003) Differential effects of immunophilin-ligands (FK506 and V-10,367) on survival and regeneration of rat retinal ganglion cells in vitro and after optic nerve crush in vivo. J Neurotrauma 20:297-307.

Ross MH, Kaye GI, Pawlina W (2003) Histology : a text and atlas : with cell and molecular biology, 4th Edition. Philadelphia, Pa.: Lippincott Williams & Wilkins.

Rossi FM, Sala R, Maffei L (2002) Expression of the nerve growth factor receptors TrkA and p75NTR in the visual cortex of the rat: development and regulation by the cholinergic input. J Neurosci 22:912-919.

Rost B, Hanf G, Ohnemus U, Otto-Knapp R, Groneberg DA, Kunkel G, Noga O (2005) Monocytes of allergics and non-allergics produce, store and release the neurotrophins NGF, BDNF and NT-3. Regul Pept 124:19-25.

Roussa E, Krieglstein K (2004) GDNF promotes neuronal differentiation and dopaminergic development of mouse mesencephalic neurospheres. Neurosci Lett 361:52-55.

Rousseau V, Sabel BA (2001) Restoration of vision IV: role of compensatory soma swelling of surviving retinal ganglion cells in recovery of vision after optic nerve crush. Restor Neurol Neurosci 18:177-189.

163

Royo NC, Conte V, Saatman KE, Shimizu S, Belfield CM, Soltesz KM, Davis JE, Fujimoto ST, McIntosh TK (2006) Hippocampal vulnerability following traumatic brain injury: a potential role for neurotrophin-4/5 in pyramidal cell neuroprotection. Eur J Neurosci 23:1089-1102.

Ruitenberg MJ, Levison DB, Lee SV, Verhaagen J, Harvey AR, Plant GW (2005) NT-3 expression from engineered olfactory ensheathing glia promotes spinal sparing and regeneration. Brain 128:839-853.

Ruitenberg MJ, Plant GW, Christensen CL, Blits B, Niclou SP, Harvey AR, Boer GJ, Verhaagen J (2002) Viral vector-mediated gene expression in olfactory ensheathing glia implants in the lesioned rat spinal cord. Gene Ther 9:135-146.

Ruitenberg MJ, Plant GW, Hamers FP, Wortel J, Blits B, Dijkhuizen PA, Gispen WH, Boer GJ, Verhaagen J (2003) Ex vivo adenoviral vector-mediated neurotrophin gene transfer to olfactory ensheathing glia: effects on rubrospinal tract regeneration, lesion size, and functional recovery after implantation in the injured rat spinal cord. J Neurosci 23:7045-7058.

Ruitenberg MJ, Blits B, Dijkhuizen PA, te Beek ET, Bakker A, van Heerikhuize JJ, Pool CW, Hermens WT, Boer GJ, Verhaagen J (2004) Adeno-associated viral vector-mediated gene transfer of brain-derived neurotrophic factor reverses atrophy of rubrospinal neurons following both acute and chronic spinal cord injury. Neurobiol Dis 15:394-406.

Ryden M, Ibanez CF (1996) Binding of neurotrophin-3 to p75LNGFR, TrkA, and TrkB mediated by a single functional epitope distinct from that recognized by trkC. J Biol Chem 271:5623-5627.

Ryoke K, Ochi M, Iwata A, Uchio Y, Yamamoto S, Yamaguchi H (2000) A conditioning lesion promotes in vivo nerve regeneration in the contralateral sciatic nerve of rats. Biochem Biophys Res Commun 267:715-718.

Sabel BA (1999) Restoration of vision I: Neurobiological mechanisms of restoration and plasticity after brain damage - a review. Restor Neurol Neurosci 15:177-200.

Sahai E, Marshall CJ (2002) RHO-GTPases and cancer. Nat Rev Cancer 2:133-142. Sahenk Z, Seharaseyon J, Mendell JR (1994) CNTF potentiates peripheral nerve regeneration. Brain Res

655:246-250. Saito K, Shiotani A, Watabe K, Moro K, Fukuda H, Ogawa K (2003) Adenoviral GDNF gene transfer

prevents motoneuron loss in the nucleus ambiguus. Brain Res 962:61-67. Saito Y (1997) [Analysis of the cellular functions of the small GTP-binding protein rho p21 with

Clostridium botulinum C3 exoenzyme]. Nippon Yakurigaku Zasshi 109:13-17. Sakakibara T, Nemoto Y, Nukiwa T, Takeshima H (2004) Identification and characterization of a novel

Rho GTPase activating protein implicated in receptor-mediated endocytosis. FEBS Lett 566:294-300.

Sakamoto T, Kawazoe Y, Shen JS, Takeda Y, Arakawa Y, Ogawa J, Oyanagi K, Ohashi T, Watanabe K, Inoue K, Eto Y, Watabe K (2003) Adenoviral gene transfer of GDNF, BDNF and TGF beta 2, but not CNTF, cardiotrophin-1 or IGF1, protects injured adult motoneurons after facial nerve avulsion. J Neurosci Res 72:54-64.

Salonen V, Aho H, Roytta M, Peltonen J (1988) Quantitation of Schwann cells and endoneurial fibroblast-like cells after experimental nerve trauma. Acta Neuropathol (Berl) 75:331-336.

Sanchez RN, Chan CK, Garg S, Kwong JM, Wong MJ, Sadun AA, Lam TT (2003) Interleukin-6 in retinal ischemia reperfusion injury in rats. Invest Ophthalmol Vis Sci 44:4006-4011.

Sanders FK (1959) The preservation of nerve grafts. London, UK: J&A Churchill Ltd. Sandvig A, Berry M, Barrett LB, Butt A, Logan A (2004) Myelin-, reactive glia-, and scar-derived CNS

axon growth inhibitors: expression, receptor signaling, and correlation with axon regeneration. Glia 46:225-251.

Sapieha PS, Hauswirth WW, Di Polo A (2006) Extracellular signal-regulated kinases 1/2 are required for adult retinal ganglion cell axon regeneration induced by fibroblast growth factor-2. J Neurosci Res 83:985-995.

Sapieha PS, Peltier M, Rendahl KG, Manning WC, Di Polo A (2003) Fibroblast growth factor-2 gene delivery stimulates axon growth by adult retinal ganglion cells after acute optic nerve injury. Mol Cell Neurosci 24:656-672.

Sappington RM, Chan M, Calkins DJ (2006) Interleukin-6 protects retinal ganglion cells from pressure-induced death. Invest Ophthalmol Vis Sci 47:2932-2942.

Sarabi A, Hoffer BJ, Olson L, Morales M (2003) Glial cell line neurotrophic factor-family receptor alpha-1 is present in central neurons with distinct phenotypes. Neuroscience 116:261-273.

Sariola H, Saarma M (2003) Novel functions and signalling pathways for GDNF. J Cell Sci 116:3855-3862.

164

Sarup V, Patil K, Sharma SC (2004) Ciliary neurotrophic factor and its receptors are differentially expressed in the optic nerve transected adult rat retina. Brain Res 1013:152-158.

Sasaki H, Inoue T, Iso H, Fukuda Y, Hayashi Y (1993) Light-dark discrimination after sciatic nerve transplantation to the sectioned optic nerve in adult hamsters. Vision Res 33:877-880.

Sautter J, Sabel BA (1993) Recovery of brightness discrimination in adult rats despite progressive loss of retrogradely labelled retinal ganglion cells after controlled optic nerve crush. Eur J Neurosci 5:680-690.

Sauve Y, Sawai H, Rasminsky M (1995) Functional synaptic connections made by regenerated retinal ganglion cell axons in the superior colliculus of adult hamsters. J Neurosci 15:665-675.

Sauve Y, Sawai H, Rasminsky M (2001) Topological specificity in reinnervation of the superior colliculus by regenerated retinal ganglion cell axons in adult hamsters. J Neurosci 21:951-960.

Sawai H, Clarke DB, Kittlerova P, Bray GM, Aguayo AJ (1996) Brain-derived neurotrophic factor and neurotrophin-4/5 stimulate growth of axonal branches from regenerating retinal ganglion cells. J Neurosci 16:3887-3894.

Saxena S, Howe CL, Cosgaya JM, Hu M, Weis J, Kruttgen A (2004) Differences in the surface binding and endocytosis of neurotrophins by p75NTR. Mol Cell Neurosci 26:292-307.

Sayer FT, Kronvall E, Nilsson OG (2006) Methylprednisolone treatment in acute spinal cord injury: the myth challenged through a structured analysis of published literature. Spine J 6:335-343.

Schaar DG, Sieber BA, Dreyfus CF, Black IB (1993) Regional and cell-specific expression of GDNF in rat brain. Exp Neurol 124:368-371.

Schaden H, Stuermer CA, Bahr M (1994) GAP-43 immunoreactivity and axon regeneration in retinal ganglion cells of the rat. J Neurobiol 25:1570-1578.

Schafer M, Fruttiger M, Montag D, Schachner M, Martini R (1996) Disruption of the gene for the myelin-associated glycoprotein improves axonal regrowth along myelin in C57BL/Wlds mice. Neuron 16:1107-1113.

Schlamp CL, Johnson EC, Li Y, Morrison JC, Nickells RW (2001) Changes in Thy1 gene expression associated with damaged retinal ganglion cells. Mol Vis 7:192-201.

Schlichtenbrede FC, MacNeil A, Bainbridge JW, Tschernutter M, Thrasher AJ, Smith AJ, Ali RR (2003) Intraocular gene delivery of ciliary neurotrophic factor results in significant loss of retinal function in normal mice and in the Prph2Rd2/Rd2 model of retinal degeneration. Gene Ther 10:523-527.

Schlieve CR, Tam A, Nilsson BL, Lieven CJ, Raines RT, Levin LA (2006) Synthesis and characterization of a novel class of reducing agents that are highly neuroprotective for retinal ganglion cells. Exp Eye Res 83:1252-1259.

Schmeer C, Straten G, Kugler S, Gravel C, Bahr M, Isenmann S (2002) Dose-dependent rescue of axotomized rat retinal ganglion cells by adenovirus-mediated expression of glial cell-line derived neurotrophic factor in vivo. Eur J Neurosci 15:637-643.

Schmid E, Leierer J, Doblinger A, Laslop A, Fischer-Colbrie R, Humpel C, Theodorsson E, Teuchner B, Lalehabbasi D, Dragosits E, Kunze C, Philipp W, Gottinger W, Troger J (2005) Neurokinin a is a main constituent of sensory neurons innervating the anterior segment of the eye. Invest Ophthalmol Vis Sci 46:268-274.

Schmidt CE, Leach JB (2003) Neural tissue engineering: strategies for repair and regeneration. Annu Rev Biomed Eng 5:293-347.

Schnaar RL, Collins BE, Wright LP, Kiso M, Tropak MB, Roder JC, Crocker PR (1998) Myelin-associated glycoprotein binding to gangliosides. Structural specificity and functional implications. Ann N Y Acad Sci 845:92-105.

Schnell L, Schwab ME (1990) Axonal regeneration in the rat spinal cord produced by an antibody against myelin-associated neurite growth inhibitors. Nature 343:269-272.

Schnell L, Schneider R, Kolbeck R, Barde YA, Schwab ME (1994) Neurotrophin-3 enhances sprouting of corticospinal tract during development and after adult spinal cord lesion. Nature 367:170-173.

Schnepp BC, Jensen RL, Chen CL, Johnson PR, Clark KR (2005) Characterization of adeno-associated virus genomes isolated from human tissues. J Virol 79:14793-14803.

Schubert T, Friede RL (1981) The role of endoneurial fibroblasts in myelin degradation. J Neuropathol Exp Neurol 40:134-154.

Schuettauf F, Naskar R, Vorwerk CK, Zurakowski D, Dreyer EB (2000) Ganglion cell loss after optic nerve crush mediated through AMPA-kainate and NMDA receptors. Invest Ophthalmol Vis Sci 41:4313-4316.

165

Schuettauf F, Rejdak R, Thaler S, Bolz S, Lehaci C, Mankowska A, Zarnowski T, Junemann A, Zagorski Z, Zrenner E, Grieb P (2006) Citicoline and lithium rescue retinal ganglion cells following partial optic nerve crush in the rat. Experimental Eye Research 83:1128-1134.

Schweigreiter R, Bandtlow CE (2006) Nogo in the injured spinal cord. J Neurotrauma 23:384-396. Schweigreiter R, Walmsley AR, Niederost B, Zimmermann DR, Oertle T, Casademunt E, Frentzel S,

Dechant G, Mir A, Bandtlow CE (2004) Versican V2 and the central inhibitory domain of Nogo-A inhibit neurite growth via p75NTR/NgR-independent pathways that converge at RhoA. Mol Cell Neurosci 27:163-174.

Scivoletto G, Morganti B, Molinari M (2004) Sex-related differences of rehabilitation outcomes of spinal cord lesion patients. Clin Rehabil 18:709-713.

Scott G, Leopardi S, Parker L, Babiarz L, Seiberg M, Han R (2003) The proteinase-activated receptor-2 mediates phagocytosis in a Rho-dependent manner in human keratinocytes. J Invest Dermatol 121:529-541.

Sefton AJ, Horsburgh GM, Lam K (1985) The development of the optic nerve in rodents. Aust N Z J Ophthalmol 13:135-145.

Seidah NG, Benjannet S, Pareek S, Chretien M, Murphy RA (1996) Cellular processing of the neurotrophin precursors of NT3 and BDNF by the mammalian proprotein convertases. FEBS Lett 379:247-250.

Seki M, Nawa H, Fukuchi T, Abe H, Takei N (2003) BDNF is upregulated by postnatal development and visual experience: quantitative and immunohistochemical analyses of BDNF in the rat retina. Invest Ophthalmol Vis Sci 44:3211-3218.

Selles-Navarro I, Ellezam B, Fajardo R, Latour M, McKerracher L (2001) Retinal ganglion cell and nonneuronal cell responses to a microcrush lesion of adult rat optic nerve. Exp Neurol 167:282-289.

Semkova I, Haberlein C, Krieglstein J (1999) Ciliary neurotrophic factor protects hippocampal neurons from excitotoxic damage. Neurochem Int 35:1-10.

Shao Z, Browning JL, Lee X, Scott ML, Shulga-Morskaya S, Allaire N, Thill G, Levesque M, Sah D, McCoy JM, Murray B, Jung V, Pepinsky RB, Mi S (2005) TAJ/TROY, an Orphan TNF Receptor Family Member, Binds Nogo-66 Receptor 1 and Regulates Axonal Regeneration. Neuron 45:353-359.

Sharma P, Singh DP, Fatma N, Chylack LT, Jr., Shinohara T (2000) Activation of LEDGF gene by thermal-and oxidative-stresses. Biochem Biophys Res Commun 276:1320-1324.

Sharma P, Fatma N, Kubo E, Shinohara T, Chylack LT, Jr., Singh DP (2003) Lens epithelium-derived growth factor relieves transforming growth factor-beta1-induced transcription repression of heat shock proteins in human lens epithelial cells. J Biol Chem 278:20037-20046.

Shearer MC, Niclou SP, Brown D, Asher RA, Holtmaat AJ, Levine JM, Verhaagen J, Fawcett JW (2003) The astrocyte/meningeal cell interface is a barrier to neurite outgrowth which can be overcome by manipulation of inhibitory molecules or axonal signalling pathways. Mol Cell Neurosci 24:913-925.

Shekarabi M, Kennedy TE (2002) The netrin-1 receptor DCC promotes filopodia formation and cell spreading by activating Cdc42 and Rac1. Mol Cell Neurosci 19:1-17.

Shekarabi M, Moore SW, Tritsch NX, Morris SJ, Bouchard JF, Kennedy TE (2005) Deleted in colorectal cancer binding netrin-1 mediates cell substrate adhesion and recruits Cdc42, Rac1, Pak1, and N-WASP into an intracellular signaling complex that promotes growth cone expansion. J Neurosci 25:3132-3141.

Shelton DL (1996) Are there more members of the CNTF-GPA family? Perspect Dev Neurobiol 4:101-107.

Shen H, Chen GJ, Harvey BK, Bickford PC, Wang Y (2005) Inosine reduces ischemic brain injury in rats. Stroke 36:654-659.

Shen S, Wiemelt AP, McMorris FA, Barres BA (1999) Retinal ganglion cells lose trophic responsiveness after axotomy. Neuron 23:285-295.

Shen YJ, DeBellard ME, Salzer JL, Roder J, Filbin MT (1998) Myelin-associated glycoprotein in myelin and expressed by Schwann cells inhibits axonal regeneration and branching. Mol Cell Neurosci 12:79-91.

Sheng Y, Zhu Y, Wu L (2004) Effect of high dosage of methylprednisolone on rat retinal ganglion cell apoptosis after optic nerve crush. Yan Ke Xue Bao 20:181-186.

Shewan D, Dwivedy A, Anderson R, Holt CE (2002) Age-related changes underlie switch in netrin-1 responsiveness as growth cones advance along visual pathway. Nat Neurosci 5:955-962.

166

Shi L, Tang GP, Gao SJ, Ma YX, Liu BH, Li Y, Zeng JM, Ng YK, Leong KW, Wang S (2003) Repeated intrathecal administration of plasmid DNA complexed with polyethylene glycol-grafted polyethylenimine led to prolonged transgene expression in the spinal cord. Gene Ther 10:1179-1188.

Shin EY, Shin KS, Lee CS, Woo KN, Quan SH, Soung NK, Kim YG, Cha CI, Kim SR, Park D, Bokoch GM, Kim EG (2002) Phosphorylation of p85 beta PIX, a Rac/Cdc42-specific guanine nucleotide exchange factor, via the Ras/ERK/PAK2 pathway is required for basic fibroblast growth factor-induced neurite outgrowth. J Biol Chem 277:44417-44430.

Shirakura M, Fukumura M, Inoue M, Fujikawa S, Maeda M, Watabe K, Kyuwa S, Yoshikawa Y, Hasegawa M (2003) Sendai virus vector-mediated gene transfer of glial cell line-derived neurotrophic factor prevents delayed neuronal death after transient global ischemia in gerbils. Exp Anim 52:119-127.

Shirvan A, Kimron M, Holdengreber V, Ziv I, Ben-Shaul Y, Melamed S, Melamed E, Barzilai A, Solomon AS (2002) Anti-semaphorin 3A antibodies rescue retinal ganglion cells from cell death following optic nerve axotomy. J Biol Chem 277:49799-49807.

Shoge K, Mishima HK, Mukai S, Shinya M, Ishihara K, Kanno M, Sasa M (1999) Rat retinal ganglion cells culture enriched with the magnetic cell sorter. Neurosci Lett 259:111-114.

Shumsky JS, Tobias CA, Tumolo M, Long WD, Giszter SF, Murray M (2003) Delayed transplantation of fibroblasts genetically modified to secrete BDNF and NT-3 into a spinal cord injury site is associated with limited recovery of function. Exp Neurol 184:114-130.

Shuto T, Horie H, Hikawa N, Sango K, Tokashiki A, Murata H, Yamamoto I, Ishikawa Y (2001) IL-6 up-regulates CNTF mRNA expression and enhances neurite regeneration. Neuroreport 12:1081-1085.

Sicotte M, Tsatas O, Jeong SY, Cai CQ, He Z, David S (2003) Immunization with myelin or recombinant Nogo-66/MAG in alum promotes axon regeneration and sprouting after corticospinal tract lesions in the spinal cord. Mol Cell Neurosci 23:251-263.

Siddiq M, Filbin M (2005) Metallothionein I/II can overcome MAG and myelin - mediated inhibition. Abstract Viewer/Itinerary Planner Washington, DC: Society for Neuroscience Program No. 719.3.

Sievers J, Hausmann B, Berry M (1989) Fetal brain grafts rescue adult retinal ganglion cells from axotomy-induced cell death. J Comp Neurol 281:467-478.

Simon P, Thanos S (1998) Combined methods of retrograde staining, layer-separation and viscoelastic cell stabilization to isolate retinal ganglion cells in adult rats. J Neurosci Methods 83:113-124.

Simon PD, Vorwerk CK, Mansukani SS, Chen SJ, Wilson JM, Zurakowski D, Bennett J, Dreyer EB (1999) bcl-2 gene therapy exacerbates excitotoxicity. Hum Gene Ther 10:1715-1720.

Simonen M, Pedersen V, Weinmann O, Schnell L, Buss A, Ledermann B, Christ F, Sansig G, van der Putten H, Schwab ME (2003) Systemic deletion of the myelin-associated outgrowth inhibitor Nogo-A improves regenerative and plastic responses after spinal cord injury. Neuron 38:201-211.

Singh DP, Ohguro N, Chylack LT, Jr., Shinohara T (1999) Lens epithelium-derived growth factor: increased resistance to thermal and oxidative stresses. Invest Ophthalmol Vis Sci 40:1444-1451.

Singh DP, Kimura A, Chylack LT, Jr., Shinohara T (2000a) Lens epithelium-derived growth factor (LEDGF/p75) and p52 are derived from a single gene by alternative splicing. Gene 242:265-273.

Singh DP, Fatma N, Kimura A, Chylack LT, Jr., Shinohara T (2001) LEDGF binds to heat shock and stress-related element to activate the expression of stress-related genes. Biochem Biophys Res Commun 283:943-955.

Singh DP, Ohguro N, Kikuchi T, Sueno T, Reddy VN, Yuge K, Chylack LT, Jr., Shinohara T (2000b) Lens epithelium-derived growth factor: effects on growth and survival of lens epithelial cells, keratinocytes, and fibroblasts. Biochem Biophys Res Commun 267:373-381.

Sipski ML, Jackson AB, Gomez-Marin O, Estores I, Stein A (2004) Effects of gender on neurologic and functional recovery after spinal cord injury. Arch Phys Med Rehabil 85:1826-1836.

Sivasankaran R, Pei J, Wang KC, Zhang YP, Shields CB, Xu XM, He Z (2004) PKC mediates inhibitory effects of myelin and chondroitin sulfate proteoglycans on axonal regeneration. Nat Neurosci 7:261-268.

Sleeman MW, Anderson KD, Lambert PD, Yancopoulos GD, Wiegand SJ (2000) The ciliary neurotrophic factor and its receptor, CNTFR alpha. Pharm Acta Helv 74:265-272.

Sleeman MW, Garcia K, Liu R, Murray JD, Malinova L, Moncrieffe M, Yancopoulos GD, Wiegand SJ (2003) Ciliary neurotrophic factor improves diabetic parameters and hepatic steatosis and increases basal metabolic rate in db/db mice. Proc Natl Acad Sci U S A 100:14297-14302.

167

Smith AD, Zigmond MJ (2003) Can the brain be protected through exercise? Lessons from an animal model of parkinsonism. Exp Neurol 184:31-39.

Smith GM, Strunz C (2005) Growth factor and cytokine regulation of chondroitin sulfate proteoglycans by astrocytes. Glia 52:209-218.

Smith GV, Stevenson JA (1988) Peripheral nerve grafts lacking viable Schwann cells fail to support central nervous system axonal regeneration. Exp Brain Res 69:299-306.

Snider WD, Zhou FQ, Zhong J, Markus A (2002) Signaling the pathway to regeneration. Neuron 35:13-16.

So KF, Aguayo AJ (1985) Lengthy regrowth of cut axons from ganglion cells after peripheral nerve transplantation into the retina of adult rats. Brain Res 328:349-354.

So KF, Ho LS, Tay DK, Lee TM (2005) Light delays synaptic deafferentation and potentiates the survival of axotomized retinal ganglion cells. Neurosci Lett 395:255-260.

Sofroniew MV, Howe CL, Mobley WC (2001) Nerve growth factor signaling, neuroprotection, and neural repair. Annu Rev Neurosci 24:1217-1281.

Song H, Ming G, He Z, Lehmann M, McKerracher L, Tessier-Lavigne M, Poo M (1998) Conversion of neuronal growth cone responses from repulsion to attraction by cyclic nucleotides. Science 281:1515-1518.

Song XY, Zhong JH, Wang X, Zhou XF (2004) Suppression of p75NTR does not promote regeneration of injured spinal cord in mice. J Neurosci 24:542-546.

Sorokina EM, Chernoff J (2005) Rho-GTPases: new members, new pathways. J Cell Biochem 94:225-231.

Soto I, Marie B, Baro DJ, Blanco RE (2003) FGF-2 modulates expression and distribution of GAP-43 in frog retinal ganglion cells after optic nerve injury. J Neurosci Res 73:507-517.

Soto I, Rosenthal JJ, Blagburn JM, Blanco RE (2005) Fibroblast growth factor 2 applied to the optic nerve after axotomy up-regulates BDNF and TrkB in ganglion cells by activating the ERK and PKA signaling pathways. J Neurochem 96:82-96.

Spalding KL, Rush RA, Harvey AR (2004) Target-derived and locally derived neurotrophins support retinal ganglion cell survival in the neonatal rat retina. J Neurobiol 60:319-327.

Spalding KL, Cui Q, Harvey AR (2005a) Retinal ganglion cell neurotrophin receptor levels and trophic requirements following target ablation in the neonatal rat. Neuroscience 131:387-395.

Spalding KL, Dharmarajan AM, Harvey AR (2005b) Caspase-independent retinal ganglion cell death after target ablation in the neonatal rat. Eur J Neurosci 21:33-45.

Spalding KL, Tan MM, Hendry IA, Harvey AR (2002) Anterograde transport and trophic actions of BDNF and NT-4/5 in the developing rat visual system. Mol Cell Neurosci 19:485-500.

Spencer T, Filbin MT (2004) A role for cAMP in regeneration of the adult mammalian CNS. J Anat 204:49-55.

Sperry RW (1944) Optic nerve regeneration with return of vision in anurans. J Neurophysiol 7:57-69. Sperry RW (1950) Neural basis of the spontaneous optokinetic response produced by visual inversion. J

Comp Physiol Psychol 43:482-489. Springer JE, Mu X, Bergmann LW, Trojanowski JQ (1994) Expression of GDNF mRNA in rat and

human nervous tissue. Exp Neurol 127:167-170. Squinto SP, Aldrich TH, Lindsay RM, Morrissey DM, Panayotatos N, Bianco SM, Furth ME,

Yancopoulos GD (1990) Identification of functional receptors for ciliary neurotrophic factor on neuronal cell lines and primary neurons. Neuron 5:757-766.

Squinto SP, Stitt TN, Aldrich TH, Davis S, Bianco SM, Radziejewski C, Glass DJ, Masiakowski P, Furth ME, Valenzuela DM, et al. (1991) trkB encodes a functional receptor for brain-derived neurotrophic factor and neurotrophin-3 but not nerve growth factor. Cell 65:885-893.

Stahl N, Yancopoulos GD (1994) The tripartite CNTF receptor complex: activation and signaling involves components shared with other cytokines. J Neurobiol 25:1454-1466.

Stahl N, Farruggella TJ, Boulton TG, Zhong Z, Darnell JE, Jr., Yancopoulos GD (1995) Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science 267:1349-1353.

Stahl N, Boulton TG, Farruggella T, Ip NY, Davis S, Witthuhn BA, Quelle FW, Silvennoinen O, Barbieri G, Pellegrini S, et al. (1994) Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL-6 beta receptor components. Science 263:92-95.

Stankoff B, Aigrot MS, Noel F, Wattilliaux A, Zalc B, Lubetzki C (2002) Ciliary neurotrophic factor (CNTF) enhances myelin formation: a novel role for CNTF and CNTF-related molecules. J Neurosci 22:9221-9227.

168

Steinsapir KD, Goldberg RA, Sinha S, Hovda DA (2000) Methylprednisolone exacerbates axonal loss following optic nerve trauma in rats. Restor Neurol Neurosci 17:157-163.

Stichel CC, Muller HW (1998) The CNS lesion scar: new vistas on an old regeneration barrier. Cell Tissue Res 294:1-9.

Stichel CC, Hermanns S, Luhmann HJ, Lausberg F, Niermann H, D'Urso D, Servos G, Hartwig HG, Muller HW (1999) Inhibition of collagen IV deposition promotes regeneration of injured CNS axons. Eur J Neurosci 11:632-646.

Stockli KA, Lottspeich F, Sendtner M, Masiakowski P, Carroll P, Gotz R, Lindholm D, Thoenen H (1989) Molecular cloning, expression and regional distribution of rat ciliary neurotrophic factor. Nature 342:920-923.

Storer PD, Dolbeare D, Houle JD (2003) Treatment of chronically injured spinal cord with neurotrophic factors stimulates betaII-tubulin and GAP-43 expression in rubrospinal tract neurons. J Neurosci Res 74:502-511.

Straten G, Schmeer C, Kretz A, Gerhardt E, Kugler S, Schulz JB, Gravel C, Bahr M, Isenmann S (2002) Potential synergistic protection of retinal ganglion cells from axotomy-induced apoptosis by adenoviral administration of glial cell line-derived neurotrophic factor and X-chromosome-linked inhibitor of apoptosis. Neurobiol Dis 11:123-133.

Strittmatter SM, Fankhauser C, Huang PL, Mashimo H, Fishman MC (1995) Neuronal pathfinding is abnormal in mice lacking the neuronal growth cone protein GAP-43. Cell 80:445-452.

Stuermer CA, Bastmeyer M (2000) The retinal axon's pathfinding to the optic disk. Prog Neurobiol 62:197-214.

Stuermer CA, Bastmeyer M, Bahr M, Strobel G, Paschke K (1992) Trying to understand axonal regeneration in the CNS of fish. J Neurobiol 23:537-550.

Stupp T, Thanos S (2005) Can lenticular factors improve the posttrauma fate of neurons? Prog Retin Eye Res 24:241-257.

Stupp T, Pavlidis M, Busse H, Thanos S (2005) Lens epithelium supports axonal regeneration of retinal ganglion cells in a coculture model in vitro. Exp Eye Res 81:530-538.

Su GH, Ye JX, You SW (2001) [Transplantation of peripheral nerves and their tissue constituents to repair axotomized retinal ganglion cells in adult mammals]. Sheng Li Ke Xue Jin Zhan 32:101-106.

Su HX, Cho EY (2003) Sprouting of axon-like processes from axotomized retinal ganglion cells induced by normal and preinjured intravitreal optic nerve grafts. Brain Res 991:150-162.

Sucher NJ, Aizenman E, Lipton SA (1991) N-methyl-D-aspartate antagonists prevent kainate neurotoxicity in rat retinal ganglion cells in vitro. J Neurosci 11:966-971.

Sucher NJ, Lipton SA, Dreyer EB (1997) Molecular basis of glutamate toxicity in retinal ganglion cells. Vision Res 37:3483-3493.

Sugiura S, Kitagawa K, Tanaka S, Todo K, Omura-Matsuoka E, Sasaki T, Mabuchi T, Matsushita K, Yagita Y, Hori M (2005) Adenovirus-Mediated Gene Transfer of Heparin-Binding Epidermal Growth Factor-Like Growth Factor Enhances Neurogenesis and Angiogenesis After Focal Cerebral Ischemia in Rats. Stroke 36:859-864.

Sun M, Kong L, Wang X, Lu X-g, Gao Q, Geller AI (2005) Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease. Brain Res 1052:119-129.

Sun W, Li N, He S (2002) Large-scale morophological survey of rat retinal ganglion cells. Vis Neurosci 19:483-493.

Tai MH, Cheng H, Wu JP, Liu YL, Lin PR, Kuo JS, Tseng CJ, Tzeng SF (2003) Gene transfer of glial cell line-derived neurotrophic factor promotes functional recovery following spinal cord contusion. Exp Neurol 183:508-515.

Takahashi R (1995) [Deficiency of human ciliary neurotropic factor (CNTF) is not causally related to amyotrophic lateral sclerosis (ALS)]. Rinsho Shinkeigaku 35:1543-1545.

Takahashi R, Kawamura K, Hu J, Hayashi M, Deguchi T (1996) Ciliary neurotrophic factor (CNTF) genotypes and CNTF contents in human sciatic nerves as measured by a sensitive enzyme-linked immunoassay. J Neurochem 67:525-529.

Takahashi T (2004) [Treatment of lumbar intervertebral disc displacement with chondroitinase ABC--experimental basis for clinical application]. Clin Calcium 14:85-89.

Takahata K, Katsuki H, Kume T, Nakata D, Ito K, Muraoka S, Yoneda F, Kashii S, Honda Y, Akaike A (2003) Retinal neuronal death induced by intraocular administration of a nitric oxide donor and its rescue by neurotrophic factors in rats. Invest Ophthalmol Vis Sci 44:1760-1766.

169

Tan AM, Colletti M, Rorai AT, Skene JH, Levine JM (2006) Antibodies against the NG2 proteoglycan promote the regeneration of sensory axons within the dorsal columns of the spinal cord. J Neurosci 26:4729-4739.

Tang X, Davies JE, Davies SJ (2003) Changes in distribution, cell associations, and protein expression levels of NG2, neurocan, phosphacan, brevican, versican V2, and tenascin-C during acute to chronic maturation of spinal cord scar tissue. J Neurosci Res 71:427-444.

Tang XQ, Wang Y, Huang ZH, Han JS, Wan Y (2004) Adenovirus-mediated delivery of GDNF ameliorates corticospinal neuronal atrophy and motor function deficits in rats with spinal cord injury. Neuroreport 15:425-429.

Taylor JS, Jack JL, Easter SS (1989) Is the Capacity for Optic Nerve Regeneration Related to Continued Retinal Ganglion Cell Production in the Frog? Eur J Neurosci 1:626-638.

Tenenbaum L, Chtarto A, Lehtonen E, Velu T, Brotchi J, Levivier M (2004) Recombinant AAV-mediated gene delivery to the central nervous system. J Gene Med 6 Suppl 1:S212-222.

Tetzlaff W, Zwiers H, Lederis K, Cassar L, Bisby MA (1989) Axonal transport and localization of B-50/GAP-43-like immunoreactivity in regenerating sciatic and facial nerves of the rat. J Neurosci 9:1303-1313.

Thanos S (1988) Alterations in the morphology of ganglion cell dendrites in the adult rat retina after optic nerve transection and grafting of peripheral nerve segments. Cell Tissue Res 254:599-609.

Thanos S (1991) Specific transcellular carbocyanine-labelling of rat retinal microglia during injury-induced neuronal degeneration. Neurosci Lett 127:108-112.

Thanos S (1992) Adult Retinofugal Axons Regenerating Through Peripheral Nerve Grafts Can Restore the Light-induced Pupilloconstriction Reflex. Eur J Neurosci 4:691-699.

Thanos S (1997) Neurobiology of the regenerating retina and its functional reconnection with the brain by means of peripheral nerve transplants in adult rats. Surv Ophthalmol 42 Suppl 1:S5-26.

Thanos S, Naskar R, Heiduschka P (1997) Regenerating ganglion cell axons in the adult rat establish retinofugal topography and restore visual function. Exp Brain Res 114:483-491.

Thanos S, Pavlidis C, Mey J, Thiel HJ (1992) Specific transcellular staining of microglia in the adult rat after traumatic degeneration of carbocyanine-filled retinal ganglion cells. Exp Eye Res 55:101-117.

Thanos S, Kacza J, Seeger J, Mey J (1994) Old dyes for new scopes: the phagocytosis-dependent long-term fluorescence labelling of microglial cells in vivo. Trends Neurosci 17:177-182.

Themis M, Waddington SN, Schmidt M, von Kalle C, Wang Y, Al-Allaf F, Gregory LG, Nivsarkar M, Themis M, Holder MV, Buckley SM, Dighe N, Ruthe AT, Mistry A, Bigger B, Rahim A, Nguyen TH, Trono D, Thrasher AJ, Coutelle C (2005) Oncogenesis following delivery of a nonprimate lentiviral gene therapy vector to fetal and neonatal mice. Mol Ther 12:763-771.

Thomas GJ, Bayliss MT, Harper K, Mason RM, Davies M (1994) Glomerular mesangial cells in vitro synthesize an aggregating proteoglycan immunologically related to versican. Biochem J 302 ( Pt 1):49-56.

Thome J, Durany N, Harsanyi A, Foley P, Palomo A, Kornhuber J, Weijers HG, Baumer A, Rosler M, Cruz-Sanchez FF, Beckmann H, Riederer P (1996) A null mutation allele in the CNTF gene and schizophrenic psychoses. Neuroreport 7:1413-1416.

Thompson DM, Buettner HM (2006) Neurite outgrowth is directed by schwann cell alignment in the absence of other guidance cues. Ann Biomed Eng 34:161-168.

Thompson J, Doxakis E, Pinon LG, Strachan P, Buj-Bello A, Wyatt S, Buchman VL, Davies AM (1998) GFRalpha-4, a new GDNF family receptor. Mol Cell Neurosci 11:117-126.

Timmer M, Muller-Ostermeyer F, Kloth V, Winkler C, Grothe C, Nikkhah G (2004) Enhanced survival, reinnervation, and functional recovery of intrastriatal dopamine grafts co-transplanted with Schwann cells overexpressing high molecular weight FGF-2 isoforms. Exp Neurol 187:118-136.

Tobias CA, Shumsky JS, Shibata M, Tuszynski MH, Fischer I, Tessler A, Murray M (2003) Delayed grafting of BDNF and NT-3 producing fibroblasts into the injured spinal cord stimulates sprouting, partially rescues axotomized red nucleus neurons from loss and atrophy, and provides limited regeneration. Exp Neurol 184:97-113.

Tom VJ, Coleman C, Shumsky JS, Houle JD (2006) Digestion of chondroitin sulfate protoglycans with high concentrations of chondroitinase ABC after spinal cord injury augments tissue damage and increases functional deficits. Program No. 383.18/NN71 Abstract Viewer/Itinerary Planner. Washington, DC: Society for Neuroscience.

170

Tonra JR (1999) Classical and novel directions in neurotrophin transport and research: anterograde transport of brain-derived neurotrophic factor by sensory neurons. Microsc Res Tech 45:225-232.

Tonra JR, Curtis R, Wong V, Cliffer KD, Park JS, Timmes A, Nguyen T, Lindsay RM, Acheson A, DiStefano PS (1998) Axotomy upregulates the anterograde transport and expression of brain-derived neurotrophic factor by sensory neurons. J Neurosci 18:4374-4383.

Torigoe K, Lundborg G (1998) Selective inhibition of early axonal regeneration by myelin-associated glycoprotein. Exp Neurol 150:254-262.

Trezise AE, Palazon L, Davies WL, Colledge WH (2003) In vivo gene expression: DNA electrotransfer. Curr Opin Mol Ther 5:397-404.

Tropea D, Caleo M, Maffei L (2003) Synergistic effects of brain-derived neurotrophic factor and chondroitinase ABC on retinal fiber sprouting after denervation of the superior colliculus in adult rats. J Neurosci 23:7034-7044.

Trotter J, Crang J, Schachner M, Blakemore W (1991) Repair of central nervous system lesions by glial cells immortalised with an oncogene-carrying retrovirus. Schweiz Arch Neurol Psychiatr 142:102-104.

Tsai EC, Dalton PD, Shoichet MS, Tator CH (2004) Synthetic hydrogel guidance channels facilitate regeneration of adult rat brainstem motor axons after complete spinal cord transection. J Neurotrauma 21:789-804.

Tsai HH, Backlin WB, Miller RH (2006) Netrin-1 is required for the normal development of spinal cord oligodendrocytes. J Neurosci 26:1913-1922.

Tucker RP, Hagios C, Chiquet-Ehrismann R (1999) Tenascin-Y in the developing and adult avian nervous system. Dev Neurosci 21:126-133.

Turner JE, Delaney RK, Johnson JE (1980) Retinal ganglion cell response to nerve growth factor in the regenerating and intact visual system of the goldfish (Carassius auratus). Brain Res 197:319-330.

Turnley AM, Bartlett PF (1998) MAG and MOG enhance neurite outgrowth of embryonic mouse spinal cord neurons. Neuroreport 9:1987-1990.

Tuszynski MH, Grill R, Jones LL, McKay HM, Blesch A (2002) Spontaneous and augmented growth of axons in the primate spinal cord: effects of local injury and nerve growth factor-secreting cell grafts. J Comp Neurol 449:88-101.

Tuszynski MH, Peterson DA, Ray J, Baird A, Nakahara Y, Gage FH (1994) Fibroblasts genetically modified to produce nerve growth factor induce robust neuritic ingrowth after grafting to the spinal cord. Exp Neurol 126:1-14.

Tuszynski MH, Weidner N, McCormack M, Miller I, Powell H, Conner J (1998) Grafts of genetically modified Schwann cells to the spinal cord: survival, axon growth, and myelination. Cell Transplant 7:187-196.

Tuszynski MH, Grill R, Jones LL, Brant A, Blesch A, Low K, Lacroix S, Lu P (2003) NT-3 gene delivery elicits growth of chronically injured corticospinal axons and modestly improves functional deficits after chronic scar resection. Exp Neurol 181:47-56.

Ughrin YM, Chen ZJ, Levine JM (2003) Multiple regions of the NG2 proteoglycan inhibit neurite growth and induce growth cone collapse. J Neurosci 23:175-186.

Ullian EM, Barkis WB, Chen S, Diamond JS, Barres BA (2004) Invulnerability of retinal ganglion cells to NMDA excitotoxicity. Mol Cell Neurosci 26:544-557.

Urcola JH, Hernandez M, Vecino E (2006) Three experimental glaucoma models in rats: Comparison of the effects of intraocular pressure elevation on retinal ganglion cell size and death. Exp Eye Res 83:429-437.

Valter K, Bisti S, Stone J (2003) Location of CNTFRalpha on outer segments: evidence of the site of action of CNTF in rat retina. Brain Res 985:169-175.

van Adel BA, Kostic C, Deglon N, Ball AK, Arsenijevic Y (2003) Delivery of ciliary neurotrophic factor via lentiviral-mediated transfer protects axotomized retinal ganglion cells for an extended period of time. Hum Gene Ther 14:103-115.

van Adel BA, Arnold JM, Phipps J, Doering LC, Ball AK (2005) Ciliary neurotrophic factor protects retinal ganglion cells from axotomy-induced apoptosis via modulation of retinal glia in vivo. J Neurobiol 63:215-234.

Varon S, Manthorpe M, Adler R (1979) Cholinergic neuronotrophic factors: I. Survival, neurite outgrowth and choline acetyltransferase activity in monolayer cultures from chick embryo ciliary ganglia. Brain Res 173:29-45.

171

Venkatesh K, Chivatakarn O, Lee H, Joshi PS, Kantor DB, Newman BA, Mage R, Rader C, Giger RJ (2005) The Nogo-66 receptor homolog NgR2 is a sialic acid-dependent receptor selective for myelin-associated glycoprotein. J Neurosci 25:808-822.

Verhaagen J, Zhang Y, Hamers FP, Gispen WH (1993) Elevated expression of B-50 (GAP-43)-mRNA in a subpopulation of olfactory bulb mitral cells following axotomy. J Neurosci Res 35:162-169.

Verma IM, Weitzman MD (2004) Gene Therapy: Twenty-First Century Medicine. Annu Rev Biochem. Verma P, Chierzi S, Codd AM, Campbell DS, Meyer RL, Holt CE, Fawcett JW (2005) Axonal protein

synthesis and degradation are necessary for efficient growth cone regeneration. J Neurosci 25:331-342.

Vidal-Sanz M, Bray GM, Aguayo AJ (1991) Regenerated synapses persist in the superior colliculus after the regrowth of retinal ganglion cell axons. J Neurocytol 20:940-952.

Vidal-Sanz M, Bray GM, Villegas-Perez MP, Thanos S, Aguayo AJ (1987) Axonal regeneration and synapse formation in the superior colliculus by retinal ganglion cells in the adult rat. J Neurosci 7:2894-2909.

Vidal-Sanz M, Aviles-Trigueros M, Whiteley SJ, Sauve Y, Lund RD (2002) Reinnervation of the pretectum in adult rats by regenerated retinal ganglion cell axons: anatomical and functional studies. Prog Brain Res 137:443-452.

Vikis HG, Li W, He Z, Guan KL (2000) The semaphorin receptor plexin-B1 specifically interacts with active Rac in a ligand-dependent manner. Proc Natl Acad Sci U S A 97:12457-12462.

Villegas-Perez MP, Vidal-Sanz M, Bray GM, Aguayo AJ (1988) Influences of peripheral nerve grafts on the survival and regrowth of axotomized retinal ganglion cells in adult rats. J Neurosci 8:265-280.

Villegas-Perez MP, Vidal-Sanz M, Rasminsky M, Bray GM, Aguayo AJ (1993) Rapid and protracted phases of retinal ganglion cell loss follow axotomy in the optic nerve of adult rats. J Neurobiol 24:23-36.

Villoslada P, Genain CP (2004) Role of nerve growth factor and other trophic factors in brain inflammation. Prog Brain Res 146:403-414.

Vinson M, Strijbos PJ, Rowles A, Facci L, Moore SE, Simmons DL, Walsh FS (2001) Myelin-associated glycoprotein interacts with ganglioside GT1b. A mechanism for neurite outgrowth inhibition. J Biol Chem 276:20280-20285.

Vogelaar CF, Hoekman MF, Gispen WH, Burbach JP (2003) Homeobox gene expression in adult dorsal root ganglia during sciatic nerve regeneration: is regeneration a recapitulation of development? Eur J Pharmacol 480:233-250.

Volosin M, Song W, Almeida RD, Kaplan DR, Hempstead BL, Friedman WJ (2006) Interaction of Survival and Death Signaling in Basal Forebrain Neurons: Roles of Neurotrophins and Proneurotrophins. J Neurosci 26:7756-7766.

Vorwerk CK, Zurakowski D, McDermott LM, Mawrin C, Dreyer EB (2004) Effects of axonal injury on ganglion cell survival and glutamate homeostasis. Brain Res Bull 62:485-490.

Vourc'h P, Andres C (2004) Oligodendrocyte myelin glycoprotein (OMgp): evolution, structure and function. Brain Res Brain Res Rev 45:115-124.

Vourc'h P, Dessay S, Mbarek O, Marouillat Vedrine S, Muh JP, Andres C (2003) The oligodendrocyte-myelin glycoprotein gene is highly expressed during the late stages of myelination in the rat central nervous system. Brain Res Dev Brain Res 144:159-168.

Vyas AA, Blixt O, Paulson JC, Schnaar RL (2005) Potent glycan inhibitors of myelin-associated glycoprotein enhance axon outgrowth in vitro. J Biol Chem 280:16305-16310.

Vyas AA, Patel HV, Fromholt SE, Heffer-Lauc M, Vyas KA, Dang J, Schachner M, Schnaar RL (2002) Gangliosides are functional nerve cell ligands for myelin-associated glycoprotein (MAG), an inhibitor of nerve regeneration. Proc Natl Acad Sci U S A 99:8412-8417.

Wahlin KJ, Campochiaro PA, Zack DJ, Adler R (2000) Neurotrophic factors cause activation of intracellular signaling pathways in Muller cells and other cells of the inner retina, but not photoreceptors. Invest Ophthalmol Vis Sci 41:927-936.

Walker DG, Terai K, Matsuo A, Beach TG, McGeer EG, McGeer PL (1998) Immunohistochemical analyses of fibroblast growth factor receptor-1 in the human substantia nigra. Comparison between normal and Parkinson's disease cases. Brain Res 794:181-187.

Wang GY, Hirai K, Shimada H, Taji S, Zhong SZ (1992) Behavior of axons, Schwann cells and perineurial cells in nerve regeneration within transplanted nerve grafts: effects of anti-laminin and anti-fibronectin antisera. Brain Res 583:216-226.

Wang KC, Kim JA, Sivasankaran R, Segal R, He Z (2002a) P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 420:74-78.

172

Wang KC, Koprivica V, Kim JA, Sivasankaran R, Guo Y, Neve RL, He Z (2002b) Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite outgrowth. Nature 417:941-944.

Wang W, Redecker C, Bidmon HJ, Witte OW (2004) Delayed neuronal death and damage of GDNF family receptors in CA1 following focal cerebral ischemia. Brain Res 1023:92-101.

Wang X, Baughman KW, Basso DM, Strittmatter SM (2006) Delayed Nogo receptor therapy improves recovery from spinal cord contusion. Ann Neurol 60:540-549.

Wang X, Chun SJ, Treloar H, Vartanian T, Greer CA, Strittmatter SM (2002c) Localization of Nogo-A and Nogo-66 receptor proteins at sites of axon-myelin and synaptic contact. J Neurosci 22:5505-5515.

Watabe-Uchida M, Govek E-E, Van Aelst L (2006) Regulators of Rho GTPases in Neuronal Development. J Neurosci 26:10633-10635.

Watanabe M, Sawai H, Fukuda Y (1997) Survival of axotomized retinal ganglion cells in adult mammals. Clin Neurosci 4:233-239.

Watanabe M, Inukai N, Fukuda Y (1999) Environmental light enhances survival and axonal regeneration of axotomized retinal ganglion cells in adult cats. Exp Neurol 160:133-141.

Watanabe M, Tokita Y, Yata T (2006) Axonal regeneration of cat retinal ganglion cells is promoted by nipradilol, an anti-glaucoma drug. Neuroscience 140:517-528.

Watt MJ, Hevener A, Lancaster GI, Febbraio MA (2006a) Ciliary neurotrophic factor prevents acute lipid-induced insulin resistance by attenuating ceramide accumulation and phosphorylation of JNK in peripheral tissues. Endocrinology 147:2077-2085.

Watt MJ, Dzamko N, Thomas WG, Rose-John S, Ernst M, Carling D, Kemp BE, Febbraio MA, Steinberg GR (2006b) CNTF reverses obesity-induced insulin resistance by activating skeletal muscle AMPK. Nat Med 12:541-548.

Webster HD (1997) Growth factors and myelin regeneration in multiple sclerosis. Mult Scler 3:113-120. Wehrle R, Caroni P, Sotelo C, Dusart I (2001) Role of GAP-43 in mediating the responsiveness of

cerebellar and precerebellar neurons to axotomy. Eur J Neurosci 13:857-870. Weibel D, Cadelli D, Schwab ME (1994) Regeneration of lesioned rat optic nerve fibers is improved after

neutralization of myelin-associated neurite growth inhibitors. Brain Res 642:259-266. Weibel D, Kreutzberg GW, Schwab ME (1995) Brain-derived neurotrophic factor(BDNF) prevents

lesion-induced axonal die-back in young rat optic nerve. Brain Res 679:249-254. Weidner N, Blesch A, Grill RJ, Tuszynski MH (1999) Nerve growth factor-hypersecreting Schwann cell

grafts augment and guide spinal cord axonal growth and remyelinate central nervous system axons in a phenotypically appropriate manner that correlates with expression of L1. J Comp Neurol 413:495-506.

Weinelt S, Peters S, Bauer P, Mix E, Haas SJ, Dittmann A, Wree A, Cattaneo E, Knoblich R, Strauss U, Rolfs A (2003) Ciliary neurotrophic factor overexpression in neural progenitor cells (ST14A) increases proliferation, metabolic activity, and resistance to stress during differentiation. J Neurosci Res 71:228-236.

Weinmann O, Schnell L, Ghosh A, Montani L, Wiessner C, Wannier T, Rouiller E, Mir A, Schwab ME (2006) Intrathecally infused antibodies against Nogo-A penetrate the CNS and downregulate the endogenous neurite growth inhibitor Nogo-A. Mol Cell Neurosci 32:161-173.

Weise J, Isenmann S, Bahr M (2001) Increased expression and activation of poly(ADP-ribose) polymerase (PARP) contribute to retinal ganglion cell death following rat optic nerve transection. Cell Death Differ 8:801-807.

Weise J, Isenmann S, Klocker N, Kugler S, Hirsch S, Gravel C, Bahr M (2000) Adenovirus-mediated expression of ciliary neurotrophic factor (CNTF) rescues axotomized rat retinal ganglion cells but does not support axonal regeneration in vivo. Neurobiol Dis 7:212-223.

Welsh CF (2004) Rho GTPases as key transducers of proliferative signals in g1 cell cycle regulation. Breast Cancer Res Treat 84:33-42.

Wen R, Cheng T, Song Y, Matthes MT, Yasumura D, LaVail MM, Steinberg RH (1998) Continuous exposure to bright light upregulates bFGF and CNTF expression in the rat retina. Curr Eye Res 17:494-500.

Wenk MB, Midwood KS, Schwarzbauer JE (2000) Tenascin-C suppresses Rho activation. J Cell Biol 150:913-920.

Werther GA, Russo V, Baker N, Butler G (1998) The role of the insulin-like growth factor system in the developing brain. Horm Res 49 Suppl 1:37-40.

173

Wetmore C, Cao YH, Pettersson RF, Olson L (1991) Brain-derived neurotrophic factor: subcellular compartmentalization and interneuronal transfer as visualized with anti-peptide antibodies. Proc Natl Acad Sci U S A 88:9843-9847.

Whalley K, O'Neill P, Ferretti P (2006) Changes in response to spinal cord injury with development: Vascularization, hemorrhage and apoptosis. Neuroscience 137:821-832.

Wilkins A, Majed H, Layfield R, Compston A, Chandran S (2003) Oligodendrocytes promote neuronal survival and axonal length by distinct intracellular mechanisms: a novel role for oligodendrocyte-derived glial cell line-derived neurotrophic factor. J Neurosci 23:4967-4974.

Wilkinson DG (2001) Multiple roles of EPH receptors and ephrins in neural development. Nat Rev Neurosci 2:155-164.

Willcox BJ, Scott JN (2004) Growth-associated proteins and regeneration-induced gene expression in the aging neuron. Mech Ageing Dev 125:513-516.

Williams SE, Mann F, Erskine L, Sakurai T, Wei S, Rossi DJ, gale NW, Holt CE, Mason CA, Henskemeyer M (2003) Ephrin-B2 and EphB1 mediate Retinal Axon Divergence at the Optic Chinasm. Neuron 39:919-935.

Wilson-Gerwing TD, Dmyterko MV, Zochodne DW, Johnston JM, Verge VM (2005) Neurotrophin-3 suppresses thermal hyperalgesia associated with neuropathic pain and attenuates transient receptor potential vanilloid receptor-1 expression in adult sensory neurons. J Neurosci 25:758-767.

Winberg JO, Berg E, Kolset SO, Uhlin-Hansen L (2003) Calcium-induced activation and truncation of promatrix metalloproteinase-9 linked to the core protein of chondroitin sulfate proteoglycans. Eur J Biochem 270:3996-4007.

Windle WF, Clemente CD, Chambers WW (1952) Inhibition of formation of a glial barrier as a means of permitting a peripheral nerve to grow into the brain. J Comp Neurol 96:359-369.

Winton MJ, Dubreuil CI, Lasko D, Leclerc N, McKerracher L (2002) Characterization of new cell permeable C3-like proteins that inactivate Rho and stimulate neurite outgrowth on inhibitory substrates. J Biol Chem 277:32820-32829.

Wishingrad MA, Koshlukova S, Halvorsen SW (1997) Ciliary neurotrophic factor stimulates the phosphorylation of two forms of STAT3 in chick ciliary ganglion neurons. J Biol Chem 272:19752-19757.

Wong EV, David S, Jacob MH, Jay DG (2003) Inactivation of myelin-associated glycoprotein enhances optic nerve regeneration. J Neurosci 23:3112-3117.

Wong LF, Ralph GS, Walmsley LE, Bienemann AS, Parham S, Kingsman SM, Uney JB, Mazarakis ND (2005) Lentiviral-mediated delivery of Bcl-2 or GDNF protects against excitotoxicity in the rat hippocampus. Mol Ther 11:89-95.

Wong ST, Henley JR, Kanning KC, Huang KH, Bothwell M, Poo MM (2002) A p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelin-associated glycoprotein. Nat Neurosci 5:1302-1308.

Wong V, Pearsall D, Arriaga R, Ip NY, Stahl N, Lindsay RM (1995) Binding characteristics of ciliary neurotrophic factor to sympathetic neurons and neuronal cell lines. J Biol Chem 270:313-318.

Wong WK, Cheung AW, Cho EY (2006) Lens epithelial cells promote regrowth of retinal ganglion cells in culture and in vivo. Neuroreport 17:699-704.

Woo S, Gomez TM (2006) Rac1 and RhoA promote neurite outgrowth through formation and stabilization of growth cone point contacts. J Neurosci 26:1418-1428.

Wood N, Bottero V, Schimidt M, Kalle C, Verma IM (2006) Therapeutic gene causing lymphoma. Nature 440:1123.

Woodworth A, Pesheva P, Fiete D, Baenziger JU (2004) Neuronal-specific synthesis and glycosylation of tenascin-R. J Biol Chem 279:10413-10421.

Woolf CJ (2003) No Nogo: now where to go? Neuron 38:153-156. Wu K, Meyers CA, Guerra NK, King MA, Meyer EM (2004a) The effects of rAAV2-mediated NGF

gene delivery in adult and aged rats. Mol Ther 9:262-269. Wu MM, You SW, Hou B, Jiao XY, Li YY, Ju G (2003a) Effects of inosine on axonal regeneration of

axotomized retinal ganglion cells in adult rats. Neurosci Lett 341:84-86. Wu W, Li L, Yick LW, Chai H, Xie Y, Yang Y, Prevette DM, Oppenheim RW (2003b) GDNF and

BDNF alter the expression of neuronal NOS, c-Jun, and p75 and prevent motoneuron death following spinal root avulsion in adult rats. J Neurotrauma 20:603-612.

Wu WC, Lai CC, Chen SL, Sun MH, Xiao X, Chen TL, Tsai RJ, Kuo SW, Tsao YP (2004b) GDNF gene therapy attenuates retinal ischemic injuries in rats. Mol Vis 10:93-102.

174

Xiang M, Zhou L, Macke JP, Yoshioka T, Hendry SH, Eddy RL, Shows TB, Nathans J (1995) The Brn-3 family of POU-domain factors: primary structure, binding specificity, and expression in subsets of retinal ganglion cells and somatosensory neurons. J Neurosci 15:4762-4785.

Xu XM, Guenard V, Kleitman N, Aebischer P, Bunge MB (1995) A combination of BDNF and NT-3 promotes supraspinal axonal regeneration into Schwann cell grafts in adult rat thoracic spinal cord. Exp Neurol 134:261-272.

Xu XM, Chen A, Guenard V, Kleitman N, Bunge MB (1997) Bridging Schwann cell transplants promote axonal regeneration from both the rostral and caudal stumps of transected adult rat spinal cord. J Neurocytol 26:1-16.

Xu XM, Zhang SX, Li H, Aebischer P, Bunge MB (1999) Regrowth of axons into the distal spinal cord through a Schwann-cell-seeded mini-channel implanted into hemisected adult rat spinal cord. Eur J Neurosci 11:1723-1740.

Yamashita T (2005) Structural and biochemical properties of fibroblast growth factor 23. Ther Apher Dial 9:313-318.

Yamashita T, Tohyama M (2003) The p75 receptor acts as a displacement factor that releases Rho from Rho-GDI. Nat Neurosci 6:461-467.

Yamashita T, Higuchi H, Tohyama M (2002) The p75 receptor transduces the signal from myelin-associated glycoprotein to Rho. J Cell Biol 157:565-570.

Yan H, Newgreen DF, Young HM (2003) Developmental changes in neurite outgrowth responses of dorsal root and sympathetic ganglia to GDNF, neurturin, and artemin. Dev Dyn 227:395-401.

Yan Q, Wang J, Matheson CR, Urich JL (1999) Glial cell line-derived neurotrophic factor (GDNF) promotes the survival of axotomized retinal ganglion cells in adult rats: comparison to and combination with brain-derived neurotrophic factor (BDNF). J Neurobiol 38:382-390.

Yanez-Munoz RJ, Balaggan KS, Macneil A, Howe SJ, Schmidt M, Smith AJ, Buch P, Maclaren RE, Anderson PN, Barker SE, Duran Y, Bartholomae C, von Kalle C, Heckenlively JR, Kinnon C, Ali RR, Thrasher AJ (2006) Effective gene therapy with nonintegrating lentiviral vectors. Nat Med 12:348-353.

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP, Wang X (1997) Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275:1129-1132.

Yang K, Perez-Polo JR, Mu XS, Yan HQ, Xue JJ, Iwamoto Y, Liu SJ, Dixon CE, Hayes RL (1996) Increased expression of brain-derived neurotrophic factor but not neurotrophin-3 mRNA in rat brain after cortical impact injury. J Neurosci Res 44:157-164.

Yang LJ, Lorenzini I, Vajn K, Mountney A, Schramm LP, Schnaar RL (2006) Sialidase enhances spinal axon outgrowth in vivo. Proc Natl Acad Sci U S A 103:11057-11062.

Yao LY, Moody C, Schonherr E, Wight TN, Sandell LJ (1994) Identification of the proteoglycan versican in aorta and smooth muscle cells by DNA sequence analysis, in situ hybridization and immunohistochemistry. Matrix Biol 14:213-225.

Yasuhara T, Shingo T, Muraoka K, Kobayashi K, Takeuchi A, Yano A, Wenji Y, Kameda M, Matsui T, Miyoshi Y, Date I (2005) Early transplantation of an encapsulated glial cell line-derived neurotrophic factor-producing cell demonstrating strong neuroprotective effects in a rat model of Parkinson disease. J Neurosurg 102:80-89.

Yates PA, Roskies AL, McLaughlin T, O'Leary DD (2001) Topographic-specific axon branching controlled by ephrin-As is the critical event in retinotectal map development. J Neurosci 21:8548-8563.

Ye J, Cao L, Cui R, Huang A, Yan Z, Lu C, He C (2004) The effects of ciliary neurotrophic factor on neurological function and glial activity following contusive spinal cord injury in the rats. Brain Res 997:30-39.

Ye JH, Houle JD (1997) Treatment of the chronically injured spinal cord with neurotrophic factors can promote axonal regeneration from supraspinal neurons. Exp Neurol 143:70-81.

Yick LW, Cheung PT, So KF, Wu W (2003) Axonal regeneration of Clarke's neurons beyond the spinal cord injury scar after treatment with chondroitinase ABC. Exp Neurol 182:160-168.

Yick LW, Wu W, So KF, Yip HK, Shum DK (2000) Chondroitinase ABC promotes axonal regeneration of Clarke's neurons after spinal cord injury. Neuroreport 11:1063-1067.

Yin Y, Cui Q, Li Y, Irwin N, Fischer D, Harvey AR, Benowitz LI (2003) Macrophage-derived factors stimulate optic nerve regeneration. J Neurosci 23:2284-2293.

Yin Y, Henzl MT, Lorber B, Nakazawa T, Thomas TT, Jiang F, Langer R, Benowitz LI (2006) Oncomodulin is a macrophage-derived signal for axon regeneration in retinal ganglion cells. Nat Neurosci 9:843-852.

Yiu G, He Z (2006) Glial inhibition of CNS axon regeneration. Nat Rev Neurosci 7:617-627.

175

Yokoyama A, Oshitari T, Negishi H, Dezawa M, Mizota A, Adachi-Usami E (2001) Protection of retinal ganglion cells from ischemia-reperfusion injury by electrically applied Hsp27. Invest Ophthalmol Vis Sci 42:3283-3286.

Yoles E, Schwartz M (1998) Elevation of intraocular glutamate levels in rats with partial lesion of the optic nerve. Arch Ophthalmol 116:906-910.

Yoon SO, Casaccia-Bonnefil P, Carter B, Chao MV (1998) Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival. J Neurosci 18:3273-3281.

Yoshida J, Wakabayashi T, Okamoto S, Kimura S, Washizu K, Kiyosawa K, Mokuno K (1994) Tenascin in cerebrospinal fluid is a useful biomarker for the diagnosis of brain tumour. J Neurol Neurosurg Psychiatry 57:1212-1215.

You SW, So KF, Yip HK (2000) Axonal regeneration of retinal ganglion cells depending on the distance of axotomy in adult hamsters. Invest Ophthalmol Vis Sci 41:3165-3170.

Zala D, Bensadoun JC, Pereira de Almeida L, Leavitt BR, Gutekunst CA, Aebischer P, Hayden MR, Deglon N (2004) Long-term lentiviral-mediated expression of ciliary neurotrophic factor in the striatum of Huntington's disease transgenic mice. Exp Neurol 185:26-35.

Zhang J, Lineaweaver WC, Oswald T, Chen Z, Zhang F (2004) Ciliary neurotrophic factor for acceleration of peripheral nerve regeneration: an experimental study. J Reconstr Microsurg 20:323-327.

Zhang SX, Geddes JW, Owens JL, Holmberg EG (2005) X-irradiation reduces lesion scarring at the contusion site of adult rat spinal cord. Histol Histopathol 20:519-530.

Zhang X, Chintala SK (2004) Influence of interleukin-1 beta induction and mitogen-activated protein kinase phosphorylation on optic nerve ligation-induced matrix metalloproteinase-9 activation in the retina. Exp Eye Res 78:849-860.

Zhang Y, Dijkhuizen PA, Anderson PN, Lieberman AR, Verhaagen J (1998) NT-3 delivered by an adenoviral vector induces injured dorsal root axons to regenerate into the spinal cord of adult rats. J Neurosci Res 54:554-562.

Zhang Y, Campbell G, Anderson PN, Martini R, Schachner M, Lieberman AR (1995) Molecular basis of interactions between regenerating adult rat thalamic axons and Schwann cells in peripheral nerve grafts. II. Tenascin-C. J Comp Neurol 361:210-224.

Zhang YH, Nicol GD (2004) NGF-mediated sensitization of the excitability of rat sensory neurons is prevented by a blocking antibody to the p75 neurotrophin receptor. Neurosci Lett 366:187-192.

Zhang ZF, Liao WH, Yang QF, Li HY, Wu YM, Zhou XF (2003) Protective effects of adenoviral cardiotrophin-1 gene transfer on rubrospinal neurons after spinal cord injury in adult rats. Neurotox Res 5:539-548.

Zhao LX, Zhang J, Cao F, Meng L, Wang DM, Li YH, Nan X, Jiao WC, Zheng M, Xu XH, Pei XT (2004a) Modification of the brain-derived neurotrophic factor gene: a portal to transform mesenchymal stem cells into advantageous engineering cells for neuroregeneration and neuroprotection. Exp Neurol 190:396-406.

Zhao Z, Alam S, Oppenheim RW, Prevette DM, Evenson A, Parsadanian A (2004b) Overexpression of glial cell line-derived neurotrophic factor in the CNS rescues motoneurons from programmed cell death and promotes their long-term survival following axotomy. Exp Neurol 190:356-372.

Zheng B, Ho C, Li S, Keirstead H, Steward O, Tessier-Lavigne M (2003) Lack of enhanced spinal regeneration in Nogo-deficient mice. Neuron 38:213-224.

Zheng B, Atwal J, Ho C, Case L, He XL, Garcia KC, Steward O, Tessier-Lavigne M (2005) Genetic deletion of the Nogo receptor does not reduce neurite inhibition in vitro or promote corticospinal tract regeneration in vivo. Proc Natl Acad Sci U S A 102:1205-1210.

Zhou FQ, Zhong J, Snider WD (2003a) Extracellular crosstalk: when GDNF meets N-CAM. Cell 113:814-815.

Zhou L, Baumgartner BJ, Hill-Felberg SJ, McGowen LR, Shine HD (2003b) Neurotrophin-3 expressed in situ induces axonal plasticity in the adult injured spinal cord. J Neurosci 23:1424-1431.

Zhou XF, Rush RA (1994) Localization of neurotrophin-3-like immunoreactivity in the rat central nervous system. Brain Res 643:162-172.

Zhou XF, Rush RA (1996) Functional roles of neurotrophin 3 in the developing and mature sympathetic nervous system. Mol Neurobiol 13:185-197.

Zhou XF, Parada LF, Soppet D, Rush RA (1993) Distribution of trkB tyrosine kinase immunoreactivity in the rat central nervous system. Brain Res 622:63-70.

Zhou XF, Song XY, Zhong JH, Barati S, Zhou FH, Johnson SM (2004) Distribution and localization of pro-brain-derived neurotrophic factor-like immunoreactivity in the peripheral and central nervous system of the adult rat. J Neurochem 91:704-715.

176

Zuo J, Hernandez YJ, Muir D (1998a) Chondroitin sulfate proteoglycan with neurite-inhibiting activity is up-regulated following peripheral nerve injury. J Neurobiol 34:41-54.

Zuo J, Neubauer D, Dyess K, Ferguson TA, Muir D (1998b) Degradation of chondroitin sulfate proteoglycan enhances the neurite-promoting potential of spinal cord tissue. Exp Neurol 154:654-662.

Zuo J, Ferguson TA, Hernandez YJ, Stetler-Stevenson WG, Muir D (1998c) Neuronal matrix metalloproteinase-2 degrades and inactivates a neurite-inhibiting chondroitin sulfate proteoglycan. J Neurosci 18:5203-5211.

Zuo J, Neubauer D, Graham J, Krekoski CA, Ferguson TA, Muir D (2002) Regeneration of axons after nerve transection repair is enhanced by degradation of chondroitin sulfate proteoglycan. Exp Neurol 176:221-228.

Zupanc GK (2001) Adult neurogenesis and neuronal regeneration in the central nervous system of teleost fish. Brain Behav Evol 58:250-275.

Zupanc GK, Ott R (1999) Cell proliferation after lesions in the cerebellum of adult teleost fish: time course, origin, and type of new cells produced. Exp Neurol 160:78-87.

Zvonic S, Cornelius P, Stewart WC, Mynatt RL, Stephens JM (2003) The regulation and activation of ciliary neurotrophic factor signaling proteins in adipocytes. J Biol Chem 278:2228-2235.