original research ajog...leukorrhea.4 the actualprevalence in the general population is...

Original Research ajog.org

GYNECOLOGY

The diagnosis of chronic endometritis in infertileasymptomatic women: a comparative study ofhistology, microbial cultures, hysteroscopy, andmolecular microbiology
Inmaculada Moreno, PhD1; Ettore Cicinelli, MD1; Iolanda Garcia-Grau, BS1; Marta Gonzalez-Monfort, BS; Davide Bau, PhD;Felipe Vilella, PhD; Dominique De Ziegler, MD; Leonardo Resta, MD; Diana Valbuena, MD, PhD; Carlos Simon, MD, PhD
BACKGROUND: Chronic endometritis is a persistent inflammation of molecular method was compared to microbial culture, concordance was

the endometrial mucosa caused by bacterial pathogens such as

Enterobacteriaceae, Enterococcus, Streptococcus, Staphylococcus,

Mycoplasma, and Ureaplasma. Although chronic endometritis can be

asymptomatic, it is found in up to 40% of infertile patients and is

responsible for repeated implantation failure and recurrent miscarriage.

Diagnosis of chronic endometritis is based on hysteroscopy of the uterine

cavity, endometrial biopsy with plasma cells being identified histologi-

cally, while specific treatment is determined based on microbial culture.

However, not all microorganisms implicated are easily or readily

culturable needing a turnaround time of up to 1 week.

OBJECTIVE: We sought to develop a molecular diagnostic tool for

chronic endometritis based on real-time polymerase chain reaction

equivalent to using the 3 classic methods together, overcoming the bias of

using any of them alone.

STUDY DESIGN: Endometrial samples from patients assessed for

chronic endometritis (n ¼ 113) using at least 1 or several conventional

diagnostic methods namely histology, hysteroscopy, and/or microbial

culture, were blindly evaluated by real-time polymerase chain reaction for

the presence of 9 chronic endometritis pathogens: Chlamydia trachomatis,

Enterococcus, Escherichia coli, Gardnerella vaginalis, Klebsiella pneu-

moniae, Mycoplasma hominis, Neisseria gonorrhoeae, Staphylococcus,

and Streptococcus. The sensitivity and specificity of the molecular analysis

vs the classic diagnostic techniques were compared in the 65 patients

assessed by all 3 recognized classic methods.

RESULTS: The molecular method showed concordant results with

histological diagnosis in 30 samples (14 double positive and 16 double

negative) with a matching accuracy of 46.15%. Concordance of molecular

and hysteroscopic diagnosis was observed in 38 samples (37 double

positive and 1 double negative), with an accuracy of 58.46%. When the

Cite this article as: Moreno I, Cicinelli E, Garcia-Grau I,et al. The diagnosis of chronic endometritis in infertile

asymptomatic women: a comparative study of histology,

microbial cultures, hysteroscopy, and molecular micro-

biology. Am J Obstet Gynecol 2018;218:602.e1-16.

0002-9378/freeª 2018 Elsevier Inc. All rights reserved.https://doi.org/10.1016/j.ajog.2018.02.012

602.e1 American Journal of Obstetrics & Gynecology JUNE 2018

present in 37 samples (22 double positive and 15 double negative), a

matching rate of 56.92%. When cases of potential contamination and/or

noncultivable bacteria were considered, the accuracy increased to

66.15%. Of these 65 patients, only 27 patients had consistent

histological þ hysteroscopic diagnosis, revealing 58.64% of non-

concordant results. Only 13 of 65 patients (20%) had consistent

histology þ hysteroscopy þ microbial culture results. In these cases, the

molecular microbiology matched in 10 cases showing a diagnostic ac-

curacy of 76.92%. Interestingly, the molecular microbiology confirmed

over half of the isolated pathogens and provided additional detection of

nonculturable microorganisms. These results were confirmed by the

microbiome assessed by next-generation sequencing. In the endometrial

samples with concordant histology þ hysteroscopy þ microbial culture

results, the molecular microbiology diagnosis demonstrates 75% sensi-

tivity, 100% specificity, 100% positive and 25% negative predictive

values, and 0% false-positive and 25% false-negative rates.

CONCLUSION: The molecular microbiology method describe

herein is a fast and inexpensive diagnostic tool that allows for the

identification of culturable and nonculturable endometrial pathogens

associated with chronic endometritis. The results obtained were

similar to all 3 classic diagnostic methods together with a degree of

concordance of 76.92% providing an opportunity to improve the

clinical management of infertile patients with a risk of experiencing

this ghost endometrial pathology.

Key words: bacterial pathogens, chronic endometritis, endometrialmicrobiome, histology, hysteroscopy, microbial culture, molecular

microbiology diagnosis, next-generation sequencing, real-time polymer-

ase chain reaction

IntroductionThe Human Microbiome Project hashighlighted the importance of micro-organisms and their genomes in

human health and disease,1 and hasbrought to light the value of detectingdysbiotic microbiomes to facilitatethe improvement of clinical manage-ment. Chronic endometritis is apersistent inflammation of the endo-metrial mucosa caused by the presenceof bacterial pathogens in the uterinecavity. The most common infectiousagents responsible for chronic endo-metritis are Enterococcus faecalis,

Enterobacteriaceae, Streptococcus spe-cies, Staphylococcus species, Gardnerellavaginalis, and Mycoplasma species aswell as genital pathogens associatedwith sexually transmitted infections,such as Ureaplasma urealyticum,Chlamydia trachomatis, and Neisseriagonorrhoeae.2,3

Chronic endometritis is often clinicallysilent and rarely suspected and diag-nosed, although it can be accompanied bysymptoms like pelvic pain, dysfunctionaluterine bleeding, dyspareunia, and

http://crossmark.crossref.org/dialog/?doi=10.1016/j.ajog.2018.02.012&domain=pdf

https://doi.org/10.1016/j.ajog.2018.02.012

http://www.AJOG.org

http://www.AJOG.org

AJOG at a Glance

Why was this study conducted?Chronic endometritis diagnosis still depends on the method used. The aim of thisstudy is to develop a new molecular method for the diagnosis of chronic endo-metritis, overcoming the bias of the current methods.

Key findingsMolecular microbiology can be used to improve diagnosis and management ofchronic endometritis in asymptomatic infertile patients.

What does this add to what is known?Molecular microbiology can detect bacterial pathogens causing chronic endo-metritis and could be useful to guide a target therapy for this ghost endometrialcondition.

ajog.org GYNECOLOGY Original Research

leukorrhea.4 The actual prevalence in thegeneral population is ill-defined,although it has been estimated to bebetween 0.8-19%.5 Even if clinicallysilent, chronic endometritis has beensuggested to diminish the success rates ofboth spontaneous and assisted repro-ductive technology conceptions as well ascontributing to obstetric and neonatalcomplications.6-12 The prevalence ofchronic endometritis in infertile patientshas been estimated at 2.8-39%,9,13-19 butcan be as high as 60% or 66% in womendiagnosed with unexplained recurrentmiscarriage or repeated implantationfailure, respectively.20,21

The diagnosis of chronic endometritisis difficult because there are no typicalclinical or ultrasound findings. Classicdiagnostic techniques of chronic endo-metritis rely on histology, which is basedon the identification of plasma cells inthe endometrial stroma,4 but thismethod is nonspecific and dependent onthe date of the menstrual cycle whensampling occurs. Considering theselimitations, hysteroscopy and microbialculture are also often used for chronicendometritis diagnosis.3,15 Hystero-scopic diagnosis of chronic endometritisrelies on subjective characteristics iden-tified by the reproductive endoscopistsuch as stromal edema, focal or diffuseepithelial hyperemia, and/or the pres-ence of micropolyps. The identificationof endometrial pathogens by microbialculture is the only method that providesobjective information for targeted

therapy. Its use has resulted in animprovement of reproductive outcomein women with recurrent miscarriageand repeat implantation failure;20,21

however, endometrial bacterial cultureis not routinely performed because it hasa long turnaround time, and not all mi-croorganisms responsible for chronicendometritis are culturable.To improve and personalize the state of

the art for diagnosing and treating chronicendometritis, researchers must determinethe identity and pathogenicity of the mi-crobes prone to produce an endometrialinfection. Molecular methods have revo-lutionized the detection and character-ization of microorganisms in a broadrange of medical fields including virology,mycology, parasitology,microbiology, anddentistry.22 For instance, in public health,the screening of Mycobacterium tubercu-losis by polymerase chain reaction (PCR)allows for early recognition and optimizedtreatment.23 Along with conventionalPCR techniques, real-time (RT)-PCR hasan ever-increasing role in clinical di-agnostics based on its capacity to detectdifficult-to-culture bacteria and generateboth qualitative and quantitative results inan accurate and rapid manner.24 The aimof this study is to compare, in the sameinfertile patients, the diagnostic accuracyof the molecular microbiology tool withthe traditional chronic endometritisdiagnostic methods, ie, endometrial his-tology, hysteroscopy, and/or microbialculture, by assessing the presence of 9specific chronic endometritis pathogens

JUNE 2018 Ameri

by RT-PCR and next-generationsequencing (NGS).

Materials and MethodsStudy designEndometrial samples from 113 patientssubjected to chronic endometritis diag-nosis using endometrial histology, hys-teroscopy, and/or microbial culture wereblindly evaluated for the presence of 9chronic endometritis pathogens byRT-PCR using paired endometrial sam-ples. Then, sensitivity and specificity ofthe molecular analysis and the classicdiagnostic techniques were compared in65 patients with chronic endometritisresults assessed by all 3 recognized classicmethods (Figure 1). In parallel, endo-metrial samples of negative controlsbased on histology andmicrobial culture(n¼ 10) were evaluated for the presenceof chronic endometritis pathogens bymolecular microbiology.

Study participantsParticipants involved in this study were21- to 53-year-old infertile patientsrecruited (E.C.) at the Second Unit ofObstetrics and Gynecology, Departmentof Biomedical and Human OncologicalScience, University of Bari, Bari, Italy,undergoing in vitro fertilization treat-ment. Patients were diagnosed andtreated for chronic endometritis usingeither a single or various classic diag-nostic techniques. Frozen endometrialbiopsy specimens were sent blindly toIgenomix SL for molecular microbiologydiagnosis by RT-PCR. Also, endometrialtissue from women with negative resultsfor chronic endometritis was analyzedusing RT-PCR. This group of negativecontrols consisted of women undergoingsurgery for benign ovarian conditions(oophorectomy for dermoid cyst withexclusion of endometriosis) or operatedon due to myomas (myomectomy)(n ¼ 6), and women treated with anti-biotics for previous chronic endometritiswith no current signs of the disease at thetime of sample collection by either his-tology andmicrobial culture (n = 4). Theethical committee of the Second Unit ofObstetrics and Gynecology, Departmentof Biomedical and Human Oncological

can Journal of Obstetrics & Gynecology 602.e2

http://www.AJOG.org

FIGURE 1Diagram of study and distribution of population investigated

Molecular diagnosis of chronic endometritis (CE) performed by real-time (RT) polymerase chainreaction (PCR). Classic diagnosis of CE includes histology, hysteroscopy, and microbial culture.

Moreno et al. Molecular microbiology for diagnosing chronic endometritis. Am J Obstet Gynecol 2018.

Original Research GYNECOLOGY ajog.org

Science, University of Bari, Bari, Italy,approved the study (register number4880). All women signed an informedconsent form agreeing to the compara-tive analysis of the techniques performedfor the routine diagnosis of chronicendometritis vs the molecular diagnosis.

Histological diagnosisPatients underwent endometrial sam-pling using a 3-mm Novak curette con-nected to a 20-mL syringe. To minimizethe risk that endometrial cultures mightbe contaminated by the vaginal flora,after placing a vaginal speculum, theNovak cannula was inserted under visualcontrol into the uterine cavity avoidingany contact with the vaginal walls. His-tological examination was performedblindly by 2 pathologists who were un-aware of the results of the other diag-nostic techniques. Paraffin-embeddedendometrial specimens were used for thestudy. Samples were fixed overnight in4% formaldehyde (in phosphate buffer,

602.e3 American Journal of Obstetrics & Gynecol

pH 7.3, Nacalai Tesque, Kyoto, Japan)and embedded in paraffin (Nacalai Tes-que). Microsections of 5 mmwere stainedwith hematoxylin-eosin. The inflamma-tory status of the endometrium wasgraded based on the presence of stromalinfiltrate dominated by lymphocytes andplasma cells, and a spindle cell change ofstromal cells.25 Infiltration showingaggressive behavior against glands, in-flammatory cell-gathering inside glands,or a more structured infiltration was alsorelevant. Micropolypoid vegetationsformed in the endometrium are macro-scopic evidence of an inflammation-related process and can be used asmarkers for this pathology. All casesdiagnosed with chronic endometritis byhistological criteria were confirmed byantisyndecan-1 (CD138) immunohisto-chemistry as previously described.25

HysteroscopyAll hysteroscopies were performed by 2physicians using a lens-based 2.7-mm

ogy JUNE 2018

outer diameter mini-telescope with a105-degree angle of visual field equippedwith a 4.5-mm outer diameter double-flow operative sheath (Karl Storz,Tuttlingen, Germany). Hysteroscopieswere performed in the follicular phase(cycle day 7-12). Saline was employed todistend the uterine cavity at a pressuregenerated by a simple drip from a bagsuspended 1 m above the patient. A 300-W light source with a xenon bulb and ahigh-definition digital camera (KarlStorz) were used. During hysteroscopy,both the anterior and posterior uterinewalls were thoroughly examined bypassing the hysteroscope parallel to theendometrial surface to identify anysurface irregularity.

The following criteriawere used for thehysteroscopic diagnosis of chronic endo-metritis: the presence of stromal edema,focal or diffuse periglandular hyperemia,and micropolyps of <1 mm in size.21-26

The hysteroscopic images were reviewedin the patient database at the SecondUnit of Obstetrics and Gynecology,Department of Biomedical and HumanOncological Science, University of Bari,Bari, Italy.

Microbial cultureEndometrial samples were processedaccording to the current standard formicrobiological culture using a sepa-rate test to detect the presence of themost prevalent chronic endometritispathogens. In particular, to detect C.trachomatis, N. gonorrhoeae, U. ure-alyticum, U. parvum, and Mycoplasmahominis, all of which are noncultivablestrains recoverable from the genitaltract, a multiplex RT method (Any-plexTM II STI-7 Detection [V1.1];Seegene, Seoul, Republic of Korea) wasused according to the manufacturer’sinstructions. To detect the presence ofculturable microorganisms (E. faecalis,Escherichia coli, Staphylococcus epi-dermidis, Staphylococcus aureus, Strep-tococcus agalactiae, Streptococcus mitis,and yeasts), the endometrial sampleswere inoculated onto culture mediaeither directly or following enrichmentin brain heart infusion medium. Thesemedia consisted of columbia-colistin-nalidix acid agar with 5% sheep

http://www.AJOG.org


blood, which is a selective and differ-ential medium commonly used in theisolation of gram-positive organismsfrom mixed clinical specimens, andMacConkey agar and mannitol saltagar for the isolation of gram-negativebacteria and Staphylococcus aureus.Consequently, the growth of the bac-teria indicated above was consideredpositive when>10,000 colony-formingunits were isolated from the culture. Inthe case of a positive culture, antibioticsensitivity and resistance were tested byVitek 2 (BioMérieux). According tomicrobiology guidelines, the presenceof Staphylococcus epidermidis wasconsidered to indicate contamination.

Molecular diagnosisFrozen endometrial specimens were sentto Igenomix SL for the blind identifica-tion of chronic endometritis pathogens byRT-PCR using specific primers for the 9most common bacteria responsible forcausing chronic endometritis (C. tracho-matis, Enterococcus species, E. coli, G.vaginalis, Klebsiella pneumoniae, M.hominis, N. gonorrhoeae, Staphylococcusspecies, and Streptococcus species). Aliterature search was conducted to iden-tify species- and genus-specific primersfor the bacteria of interest, plus 1 primerfor the family Enterobacteriaceaeincluding E. coli and K. pneumoniae(Table 1). The primers used were reeval-uated and subjected to Basic LocalAlignment Search Tool searches using theNational Center for Biotechnology In-formation genomic database. All primerswere purchased from Integrated DNATechnologies (Skokie, IL).

Total DNA was isolated using aQIAamp cador pathogen mini kit (Qia-gen, Hilden, Germany) from endome-trial biopsies previously treated withenzymatic digestion for difficult-to-lysebacteria. For this digestion, 25 mg oftissue were cut into small pieces andtreated with proteinase K at 56�C for 3hours under agitation or until the tissuewas completely lysed. Then, the samplewas mixed with ATL buffer (Qiagen) anddisrupted mechanically in a TissueLyserLT (Qiagen) for 5 minutes at 50 Hz, us-ing stainless-steel beads. After thesepretreatments, bacterial nucleic acids

were purified following the manufac-turer’s instructions.

Bacterial DNA templateA panel of DNA templates of bacteriacausing chronic endometritis wasselected to evaluate the specificity of theRT-PCR assays. A total of 11 DNA tem-plates were obtained from DeutscheSammlung von Mikroorganismen undZellkulturen (DSMZ, Braunschweig,Germany), including templates of com-mon microorganisms of the disease,Enterococcus faecalis (DSMZ 2570),Escherichia coli (DSMZ 1116),G vaginalis (DSMZ 4944), K pneumoniae(DSMZ 30104), Mycoplasma hominis(DSMZ 25592), Staphylococcus epi-dermidis (DSMZ 1798), Staphylococcushaemolyticus (DSMZ 20263), Strepto-coccus agalactiae (DSMZ 2134), andStreptococcus gallolyticus (DSMZ 20065),as well as templates of sexually trans-mitted disease pathogens, Chlamydiatrachomatis (DSMZ 19411) and N gon-orrhoeae (DSMZ 15130).

RT-PCR assaysAll RT-PCR reactions were performed ona LightCycler 480 II (Roche Diagnostics,Almere, The Netherlands). Reactionmixtures contained 200 ng of DNA iso-lated from endometrial biopsies orcommercial purified bacterial DNA as thetemplate, 2.5 mmol/L MgCl2, 0.25 mmol/L forward and reverse primers, and 1 mLof the LightCycler FastStar DNA MasterSYBR Green I 10x (Roche Applied Sci-ence, Mannheim, Germany) resulting ina final reaction volume of 20 mL. Thecycling program was as follows: an initialdenaturation at 95�C for 10 minutes;amplification for 45 cycles of 10 secondsat 95�C, 10 seconds at 57�C, and 50 sec-onds at 72�C;melting curve analysis for 5seconds at 95�C, 15 seconds at 65�C and atemperature continuous acquisition upto 95�C (ramp rate of 0.11�C/s); andcooling for 30 seconds at 40�C.Each experiment included negative

and positive controls to determine anypossible contamination and unspecificamplification. Positive controls includeda mix of all the bacterial DNA templatesat a concentration of 10,000 genomeseach. Negative controls included all

JUNE 2018 Ameri

DNA templates except the microor-ganism to be evaluated for each assay.The genome size of each bacterium wasused for the calculation of genomes/ngof DNA.27

A melting curve analysis was madeafter amplification to distinguish thetargeted PCR products from nonspecificPCR products. The concentration ofmicroorganism in each sample wascalculated comparing the crossing point-PCR-cycle (Cp) values obtained from thesample with the Cp values of the positivecontrol.

16S ribosomal RNA sequencingEndometrial microbiome profiles wereobtained by NGS of the bacterialgene encoding for the 16S ribosomalRNA (rRNA) using the Ion 16S meta-genomics kit (ThermoFisher Scientific,Waltham, MA), which includes 2 primersets (V2-4-8 and V3-6, 7-9) that selec-tively amplify the hypervariable regions(V2-4-8 and V3-6, 7-9) of the 16S ri-bosomal subunit. The amplified frag-ments were sequenced on the Ion S5 XLsystem (ThermoFisher Scientific). Theresults were analyzed using the Meta-genomics application of Ion Reportersoftware 5.0 (ThermoFisher Scientific)using default parameters as previouslydescribed.28 Briefly, the QIIME package(http://qiime.org/) and Greengenesdatabase, Version 13_8 (http://qiime.org/home_static/dataFiles.html), wereused for taxonomic assignment. QIIMEwas used to calculate alpha diversity andrarefaction curves before filtering.Shannon methods were employed toanalyze the biodiversity within a groupof samples. Positive controls of E. coliDNA and negative controls wereincluded to detect any contaminationfrom reagents.

Statistical analysisThe comparative assessment of the mo-lecular test vs the classic diagnosticsmethods considered (individually orcombined) to be the gold standard werecalculated as follows29:

� Sensitivity: percentage of true-positive cases among the total posi-tives in the gold standard test.


http://qiime.org/

http://qiime.org/home_static/dataFiles.html

http://qiime.org/home_static/dataFiles.html

http://www.AJOG.org

TABLE 1List of primers used for polymerase chain reaction amplification of selected microorganisms

Bacteria Target gene Primers Amplicon length, bp Reference

Chlamydia trachomatis 16S rRNA F: GGATCCGTAAGTTAGACGAAATTTTGR: TTTAATGCGAAAGGAAATCTGATTG

83 41

Enterobacteriaceae rpoB F: CAGGTCGTCACGGTAACAAGR: GTGGTTCAGTTTCAGCATGTAC

512 42

Enterococcus species rpoB F: AGAGAGTAAGGTCCGATTGAACR: GGTTGTTTCCCGTATTATGC

370 42

Escherichia coli 16S rRNA F: AGAAGCTTGCTCTTTGCTGAR: CTTTGGTCTTGCGACGTTAT

120 43

Gardnerella vaginalis 16S rRNA F: TTACTGGTGTATCACTGTAAGGR: CCGTCACAGGCTGAACAGT

320 27

Klebsiella pneumoniae gltA F: ACGGCCGAATATGACGAATTCR: AGAGTGATCTGCTCATGAA

68 44

Mycoplasma hominis 16S rRNA F: CATGCATGTCGAGCGAGGTTR: CCATGCGGTTCCATGCGT

129 45

Neisseria gonorrhoeae 16S rRNA F: GTTTCAGCGGCAGCATTCAR: CCGGAACTGGTTTCATCTGATT

102 46

Staphylococcus species rpoB F: CAGGAGAAGTTAAAGAACAAGAAGR: GTGAACGAACTAATTGAGATACG

118 42

Streptococcus species tuf F: GTACAGTTGCTTCAGGACGTATCR: ACGTTCGATTTCATCACGTTG

197 47

rRNA, ribosomal RNA.



� Specificity: percentage of true-negative cases among the total nega-tives in the gold standard test.

� Accuracy: percentage of correct as-sessments on the total assessments.

� Positive predictive value: percentageof true-positive cases among the totalpositives in the molecular test.

� Negative predictive value: percentageof true-negative cases among the totalnegatives in the molecular test.

� False-positive rate: percentage offalse-positive cases among the totalnegatives in the gold standard test.

� False-negative rate: percentage ofnegative cases among the total posi-tives in the gold standard test.

ResultsAnalytical specificity of RT-PCRassaysThe analytical specificity of the molecu-lar microbiology assay was verified usingspecific primers for the most commonbacteria causing chronic endometritisusing 30 ng of commercial bacterialDNA isolated from chronic endometritis


bacteria as a template. All primer setsresulted in specific amplification of theirown bacterial DNA templates, with Cpvalues ranging from 12-20 compared tothe negative control of ultrapure waterwith the lowest Cp value at 35 for N.gonorrhoeae, while the majority of themdid not amplify after 40 amplificationcycles. When each primer pair was testedagainst the other bacterial DNAs, insig-nificant cross-reactivity was detectedbetween them, with a minimum differ-ence of 10 amplification cycles betweenthe specific and nonspecific amplifica-tions (Figure 2, A). Then, the minimumdetection limit of eachmicroorganism inthe RT-PCR was assessed by amplifyingincreasing amounts of each templateDNA (0-1,000,000 genomes) alone or ina complex mixture of bacterial DNAconsisting of 1,000,000 genomes fromthe other microorganisms included inthe molecular method. The detectionlimits of these RT-PCR reactions showedthe high sensitivity of the molecularmethod for the different bacteria testedranging from 10-1000 genomes for all

ogy JUNE 2018

microorganisms, except for staphylo-cocci, which showed a minimum detec-tion limit of 10,000 genomes, equivalentto the microbial culture technique inwhich >10,000 colony-forming unit isconsidered a positive test (Figure 2, B).

To minimize possible bias introducedby the cross-reactions in subsequent ex-periments, the positive control wasdefined as a mix of all the bacterial DNAtemplates at a concentration of 10,000genomes each, while the negative controlwas amix of all DNA templates except forthe bacterial DNA to be detected. Then,for each independent assay, the meltingpeak profile and melting temperaturewere determined, defining a specificmelting temperature value for eachamplicon, thus discriminating betweenspecific (positive) and unspecific (nega-tive) amplification signals (Figure 2, C).

Molecular diagnosis of chronicendometritis using RT-PCRDNAwas isolated from 113 endometrialspecimens of women being assessed forchronic endometritis using any of the

http://www.AJOG.org

FIGURE 2Analytical specificity of molecular microbiology


JUNE 2018 American Journal of Obstetrics & Gynecology 602.e6

http://www.AJOG.org

=


classic methods. From these, 18 samplesdid not yield enough standard-qualityDNA for analysis. The remaining 95(set 1) were assessed by RT-PCR withthe primers indicated in Table 1 forthe microorganisms Enterobacteriaceae,Enterococcus species, E. coli, G. vaginalis,K. pneumoniae, M. hominis, Staphylo-coccus species, and Streptococcus species.Additionally, other pathogens causingsexually transmitted diseases, such as C.trachomatis and N. gonorrhoeae, wereincluded in the analysis. The amplifiedsignal for each microorganism wasconsidered positive when the thresholdcross-point value (Cp) obtained wasequal or lower than the Cp value of thepositive control and the melting tem-perature matched with that establishedin the positive control.

Using this molecular analysis, 42 of the95 endometrial samples were negative forchronic endometritis (44.21%), while 53were positive (55.79%) for �1 of thepathogens tested (58.5% and 41.5%,respectively) (Figure 3, A). The pathogensmost commonly represented in the sam-ples analyzed by RT-PCR were strepto-cocci, while C. trachomatis andN. gonorrhoeae were undetectable in alltested samples (Figure 3, B).

Comparison of chronic endometritisdiagnosis based on molecularmicrobiology vs classic methodsThe results of the molecular microbi-ology of chronic endometritis werecompared with the classic diagnosticmethods: histology, hysteroscopy, andmicrobial culture (Figure 1). For thiscomparison, 30 patients were excludedfor lacking results from�1 of the 3 classicmethods, so the comparison was finallyperformed for 65 patients (set 2) with achronic endometritis diagnosis derivedfrom classic techniques (Table 2).

A, Represents amplification cycles (Cp) of commeprimers for these bacteria. B, Detection limit of eacbacterial DNA (0; 1; 10; 100; 1000; 10,000; 100genomes of each remaining bacterial species includpeak profile and melting temperature (Tm) for eacCT, Chlamydia trachomatis; EC, Escherichia coli; EF, Enterococcus faagalactiae; SB, Streptococcus bovis; SE, Staphylococcus epidermidi

Moreno et al. Molecular microbiology for diagnosing chronic en


Using molecular analysis, 27 of the 65endometrial samples were negative forchronic endometritis (41.54%) while 38were positive (58.46%) for �1 of thepathogens tested (32.31% and 26.15%,respectively) (Figure 3, A). The mostcommonly represented bacteria in theendometria analyzed by RT-PCR werestreptococci, which accounted for45.78% of the total pathogens detected(Figure 3, C).

Molecular microbiology vshistologyHistological diagnosis alone was posi-tive in 25 of 65 patients investigated(38.46%) while the molecular microbi-ology was positive in 38 cases (58.46%).Concordant results were observed in 30samples (14 double positives and 16double negatives) giving a matchingaccuracy of 46.15%. Interestingly, in 24(68.57%) of 35 samples with contra-dictory results, bacterial DNA wasclearly identified by RT-PCR while thehistological analysis was negative(Table 2).

Molecular microbiology vshysteroscopyHysteroscopic-based diagnosis was posi-tive in 63 of 65 patients investi-gated (96.92%), while the molecularmicrobiology was positive in 38 cases.Concordance was observed in 38 samples(37 double positives and 1 double nega-tive) showing a matching accuracy of58.46%. In 26 (96.29%) of 27 discordantpatients, bacterial DNAwas not identifiedin the paired endometrial sampleobtained after positive hysteroscopicdiagnosis of chronic endometritis. Inter-estingly, only 1 sample with no signs ofchronic endometritis in the hysteroscopywas positive for Streptococcus species(Table 2).

rcial bacterial DNA (30 ng) of most common bacteh bacterial DNA in molecular method. Each set of p,000, and 1,000,000 genomes) alone or in compleed in molecular method. C, Graphs obtained from reh amplicon, discriminating specific (positive) and unecalis; GV, Gardnerella vaginalis; KP, Klebsiella pneumoniae; MH, Mycs; SH, Staphylococcus hominis; -ve, negative control.

dometritis. Am J Obstet Gynecol 2018.

ogy JUNE 2018

Molecular microbiology vsmicrobial cultureMicrobiological culture was positive in 34of 65 patients tested for chronic endo-metritis by either histology or hysteros-copy (52.30%) while molecular diagnosiswas positive in 38 of these cases (58.46%).Concordance between molecular micro-biology and microbial culture was pre-sent in 37 patients (22 double positiveand 15 double negative) showing amatching rate of 56.92%. However, whenmicrobiological results were analyzed indetail, we found several cases inwhich theculture was either contaminated by S.epidermidis (case 28), or presented mi-croorganisms that were not tested in themolecular diagnosis: Ureaplasma speciesand Candida albicans (specifically cases20 and 48). Also, the molecular micro-biology allowed for the identification ofG. vaginalis, which is seldom cultured,causes chronic endometritis, and was notidentified by classic microbial culture insome samples (cases 2 and 5). Takingthese cases into account, the comparisonof these 2 methods demonstrated anaccuracy of 66.15% (Table 2). From these22 double-positive cases, 11 RT-PCRcases were confirmed by isolation of thesame pathogens. Moreover, in 4 cases, G.vaginalis DNA was identified, providingadditional information over the classicmicrobial culture.

Molecular microbiology vshistology D hysteroscopyBecause histology and hysteroscopy aresubjective methods with the highestdiscordant results, we compared themolecular diagnostic method to both.From the 65 patients analyzed by allmethods (histology, hysteroscopy, andmicrobial culture), only 27 presentedwith consistent histologyþ hysteroscopyresults (41.54% concordance rate), with

ria causing chronic endometritis using specificrimers was tested against increasing amounts ofx mix of microorganisms containing 1,000,000al-time polymerase chain reaction show meltingspecific (negative) amplification signals.oplasma hominis; NG, Neisseria gonorrhoeae; SA, Streptococcus

http://www.AJOG.org

FIGURE 3Molecular diagnosis of chronic endometritis (CE)

A, Proportion of positive and negative cases of CE using molecular method and percentage of positivecases with detection of�1 microorganisms in samples from set 1 (95 samples analyzed by real-timepolymerase chain reaction), set 2 (65 samples used for comparison with classic diagnosis), and set 3(13 samples with concordant results by 3 classic methods). Number of cases in which each targetedpathogen is detected alone or in combination with other bacteria in B, set 1; C, set 2; and D, set 3.Moreno et al. Molecular microbiology for diagnosing chronic endometritis. Am J Obstet Gynecol 2018.


25 double-positive and 2 double-negative results (Table 2). In this group,13 cases were also consistent with mi-crobial culture, while 14 differed frommicrobial culture (Figure 1). From those27 patients, RT-PCR showed concordantresults in 15 cases (14 positives and only1 negative) with an accuracy of 55.55%.Interestingly, 38 of 65 patients (58.46%)presented with opposite results betweenhistology and hysteroscopy, and in allnegative cases for histology were positivebased on hysteroscopy. In these cases, thedetection of bacterial DNA by RT-PCR(23 of 38 cases) was always coincidentwith positive hysteroscopy, while nega-tive diagnosis of chronic endometritisusing the molecular method (15 of 38samples) always matched with thenegative histological diagnosis.

Molecular microbiology vshistology D hysteroscopy Dmicrobial cultureFrom the 65 samples with chronicendometritis results from all 3 classic

methods, only 13 (20%) had concordantresults from all 3 (Figure 1). The mo-lecular analysis of this set of samplesshowed that 4 of the 13 endometrialsamples were negative for chronicendometritis (30.8%), while 9 werepositive (69.2%) for�1 of the pathogenstested (66.7% and 33.3%, respectively)(Figure 3, A). The most detected path-ogen in these samples was Streptococcusspecies, followed by Enterococcus speciesand G. vaginalis (Figure 3, D).The only patient diagnosed as nega-

tive based on the 3 classic methodswas also negative for the molecularevaluation of chronic endometritis(Figure 4, A). From the remaining 12that were positive for chronic endome-tritis based on all 3 classic methods, 9were also positive based on RT-PCR,while 3 showed discordant results. Intotal, 10 of 13 cases presented withsimilar results with an accuracy of76.92% (Table 2). In 5 of the 9 cases withpositive results for microbial culture andRT-PCR, the microorganisms detected

JUNE 2018 Ameri

were the same, and in 2 of them, G.vaginalis was also detected by RT-PCRtogether with other pathogens (cases 8and 15), providing additional informa-tion to the microbial culture (Figure 4,A). To confirm these results, endometrialbiopsies from these 13 diagnosticconcordant patients were subjected tobacterial 16S rRNA sequencing to assesstheir full endometrial microbiome. Theresults of NGS for the bacterial 16SrRNA gene confirmed the detection ofbacterial DNA in 12 of 13 endometrialsamples, since 1 sample did not yieldsequencing results (case 24). The num-ber of mapped reads per sample wasbetween 27,178 and maximum of231,538, with an average value of117,369. The data of mapped sequencesand Shannon index for each sample aredetailed in Table 3. The overall analysisof the endometrial microbiome in those12 samples showed that the mostrepresented genus was Lactobacillus,followed by 2 bacterial pathogens asso-ciated with chronic endometritis: Strep-tococcus and Gardnerella. Also, in the 20most abundant genera present in this setof samples, other bacteria previouslyreported to colonize the reproductivetract such as Bifidobacterium, Mega-sphaera, Parvimonas, Prevotella, Propio-nibacterium, and Veillonella were found(Figure 5, A).30,31 The microbiome re-sults using NGS were concordant withRT-PCR in 11 of 12 cases and coincidedwith the microbial culture in 9 of 12cases, showing an accuracy of 91.67%and 75%, respectively (Table 3). Inter-estingly, in 2 cases in which the RT-PCRwas negative and culture method waspositive (cases 17 and 26), the taxonomicassignment obtained in the microbiotaconfirmed the results of the RT-PCR,with no detection of bacterial DNA ofthe pathogens isolated in the microbialculture (Figure 5, B). To better clarifythis, the percentage of lactobacilli inthese samples was also considered, basedon previous reports demonstrating that apercentage of Lactobacillus species in theuterine cavity are associated with ahealthy endometrial status.31 This anal-ysis showed a low percentage of lacto-bacilli in all those samples with a positivediagnosis of chronic endometritis by all


http://www.AJOG.org

TABLE 2Results of chronic endometritis diagnosis by molecular and classic methods

Patient RT-PCR Histology Hysteroscopy Microbial culture

1 Enterococcus species, Staphylococcusspecies

Negative Positive Negative

2 Gardnerella vaginalis Negative Positive Negative

3 Negative Positive Positive Negative

4 Negative Negative Positive Negative

5 Gardnerella vaginalis Negative Positive Negative


7 Negative Negative Positive Enterococcus faecalis

8 Streptococcus species, Gardnerellavaginalis

Positive Positive Streptococcus agalactiae

9 Streptococcus species Negative Positive Enterococcus faecalis

10 Negative Negative Negative Negative

11 Streptococcus species Negative Positive Streptococcus agalactiae

12 Streptococcus species Negative Positive Staphylococcus epidermidis, Ureaplasma

13 Staphylococcus species Positive Positive Negative

14 Streptococcus species, Enterobacteriaceae Negative Positive Streptococcus agalactiae, Ureaplasma

15 Gardnerella vaginalis, Escherichia coli Positive Positive Escherichia coli

16 Negative Negative Positive Enterococcus faecalis, Escherichia coli

17 Negative Positive Positive Enterococcus faecalis, Ureaplasma

18 Streptococcus species Positive Positive Streptococcus agalactiae

19 Streptococcus species Positive Positive Escherichia coli

20 Streptococcus species, Enterococcusspecies

Negative Positive Ureaplasma

21 Streptococcus species, Enterococcusspecies, Escherichia coli

Negative Positive Enterococcus faecalis


23 Streptococcus species, Escherichia coli,Klebsiella pneumoniae

Positive Positive Negative

24 Klebsiella pneumoniae Positive Positive Ureaplasma

25 Streptococcus species Negative Positive Negative

26 Negative Positive Positive Enterococcus faecium


28 Negative Negative Positive Staphylococcus epidermidis


30 Enterococcus species Positive Positive Enterococcus faecalis, Streptococcus mitis

31 Streptococcus species Positive Positive Klebsiella pneumoniae


33 Negative Negative Positive Staphylococcus aureus


35 Negative Positive Positive Staphylococcus aureus

36 Mycoplasma hominis Negative Positive Negative

Moreno et al. Molecular microbiology for diagnosing chronic endometritis. Am J Obstet Gynecol 2018. (continued)


602.e9 American Journal of Obstetrics & Gynecology JUNE 2018

http://www.AJOG.org

TABLE 2Results of chronic endometritis diagnosis by molecular and classic methods (continued)

Patient RT-PCR Histology Hysteroscopy Microbial culture

37 Streptococcus species, Enterobacteriaceae Negative Positive Negative

38 Negative Negative Positive Ureaplasma

39 Streptococcus species Positive Positive Streptococcus agalactiae

40 Negative Negative Positive Enterococcus gallinarum

41 Streptococcus species, Escherichia coli Positive Positive Negative

42 Streptococcus species, Enterobacteriaceae Negative Positive Negative

43 Enterococcus species, Enterobacteriaceae,Escherichia coli

Negative Positive Staphylococcus aureus, Ureaplasma

44 Enterococcus species, Streptococcusspecies

Positive Positive Escherichia coli

45 Streptococcus species Positive Positive Negative

46 Enterococcus species, Streptococcusspecies, Escherichia coli

Negative Positive Enterococcus faecalis

47 Enterococcus species, Streptococcusspecies, Enterobacteriaceae

Negative Positive Negative

48 Streptococcus species, Klebsiellapneumoniae

Negative Positive Candida albicans, Ureaplasma


50 Streptococcus species Negative Positive Escherichia coli


52 Enterococcus species, Streptococcusspecies

Positive Positive Negative





57 Negative Negative Positive Enterococcus faecalis


59 Enterobacteria Negative Positive Negative

60 Streptococcus species, Escherichia coli Negative Positive Streptococcus agalactiae

61 Negative Negative Positive Staphylococcus aureus, Ureaplasma parvum

62 Negative Negative Positive Streptococcus gallolyticus

63 Streptococcus species Negative Negative Ureaplasma


65 Streptococcus species Negative Positive Streptococcus agalactiae

PCR, polymerase chain reaction; RT, real-time.



the methods analyzed, with the excep-tion of 1 sample with 93.2% of Lacto-bacillus and a very low percentage of thepathogens detected by either microbialculture or RT-PCR (case 30). Moreover,in the 2 cases (cases 8 and 15) in which

we detected G. vaginalis by RT-PCR,the sequencing results confirmed itspresence in the samples (Figure 5).By contrast, a high percentage of lac-

tobacilli was detected in the samples thatproved negative for the molecular

JUNE 2018 Americ

diagnosis of chronic endometritis (cases10, 17, 26, and 35), supporting the re-sults previously obtained from the RT-PCR analysis (Figure 5, A).

Finally, sensitivity, specificity, positiveand negative predictive values, and

an Journal of Obstetrics & Gynecology 602.e10

http://www.AJOG.org

FIGURE 4Histological and hysteroscopic diagnosis of chronic endometritis

A, Concordant chronic endometritis results in patients/samples analyzed by 4 methods comparedin this study (3 classic methods and real-time [RT] polymerase chain reaction method [PCR]).B, Discordant chronic endometritis results in patients/samples analyzed by 4 methods compared inthis study. Black arrows show CD138þ cells.



false-positive and -negative rates wereassessed for each individual classicmethod and their combination in com-parison to the RT-PCR diagnosis(Table 4), with the best results obtainedwhen both RT-PCR and NGS diagnosisof chronic endometritis was comparedto the 3 concordant classic methods.

Molecular microbiology in patientswithout chronic endometritisFrom the 65 samples analyzed for the3 classic methods, only 1 presentedconcordant negative results for all thetechniques. Then, to evaluate the effi-cacy of the RT-PCR method to detectnegative cases of chronic endometritis,

602.e11 American Journal of Obstetrics & Gynec

endometrial samples from 10 controlsubjects, that proved negative for his-tology and microbial culture, weresubjected to the molecular method.The results of these samples showednegative results for the 9 pathogenicbacteria tested (Table 5) consistent withtheir negative results for the classicmethods analyzed. However, RT-PCRwas able to detect very small amountsof DNA from G. vaginalis (case C2) andM. hominis (case C5), but their levelswere below the threshold of positivecontrols. These data support the effi-cacy of molecular microbiology todiscriminate between positive andnegative cases of chronic endometritis,

ology JUNE 2018

based on the detection of 9 pathogensusually causing the disease.

CommentSurprisingly, diagnosis of chronicendometritis still depends upon themethod used. The current diagnosticgold standard for chronic endometritisis histological examination although issubjective based on different criteriadepending on the authors, while hys-teroscopy and endometrial culture pre-sent controversial reliability in thediagnosis of such condition. Whetherhistological examination of endometrialtissue, hysteroscopic observation ofthe uterine cavity, or microbial cultureare used has a significant impact ondiagnostic accuracy and the differenttechniques applied to the samepatient/sample may yield contradictoryresults and misleading conclusions(Figure 4, B). The concordant resultsamong the 3 classic techniques in thediagnosis of chronic endometritis in ourstudy was only 20%. Histology andhysteroscopy are highly subjective,unspecific, and rely on the individualobservations of the pathologist orendoscopic surgeon.12 Also, they cannotdiscriminate the causal agent of chronicendometritis, which in turn leads tobroad-range therapy and likely resultsin recurrent chronic endometritis. Un-like them, microbial culture is able toidentify the culturable microorganismspresent in the endometrial tissue.However, some chronic endometritis-causing bacteria such as Ureaplasmaspecies,M. hominis, and G. vaginalis arenot culturable in standard laboratoryconditions, which leads to false-negativeresults and/or contamination bias. Forthe aforementioned reasons, a reliablemethod for the diagnosis of chronicendometritis based on moleculardetection and quantification of DNAfrom pathogens present in the endo-metrium is needed to improve clinicalmanagement.

In modern medicine, nucleic acidamplification tests that are highly sensi-tive and specific, and in some casesminimally invasive, are recommended toscreen for infectious diseases in menand women.32 Neither histology nor

http://www.AJOG.org

TABLE 3Microbiota profile of endometrial samples by 16S ribosomal RNA gene sequencing

Patient Microbial culture RT-PCR

16s rRNA sequencing

Lactobacillus,%

Enterococcus,%

Staphylococcus,

%

Streptococcus,%

Mycoplasm

a,%

Enterobacteriaceae,%

Escherichia,

%

Klebsiella,%

Gardnerella,%

Ureaplasm

a,%

Chlam

ydia,%

Neisseria,%

No.

ofmappedreads

Alpha

diversity

(Shannon

index)

8 Streptococcus agalactiae Streptococcus species,Gardnerella vaginalis

13.75 2.52 4.46 30.87 0.00 1.00 0.00 0.00 1.48 0.00 0.00 0.00 121,624 7.32

10 Negative Negative 99.94 0.00 0.00 0.00 0.00 0.01 0.00 0.00 0.01 0.00 0.00 0.00 218,076 2.94

15 Escherichia coli Gardnerella vaginalis,Escherichia coli

74.40 0.36 1.97 0.68 0.02 1.00 0.00 0.00 1.34 0.00 0.00 0.00 96,697 6.12

17 Enterococcus faecalis,Ureaplasma

Negative 96.49 0.00 0.11 0.11 0.00 0.30 0.00 0.00 0.43 0.00 0.00 0.00 62,033 3.79

18 Streptococcus agalactiae Streptococcus species 0.32 0.00 0.25 81.53 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 102,443 3.63

19 Escherichia coli Streptococcus species 69.21 0.03 2.65 1.06 0.03 3.00 0.00 0.02 2.39 0.01 0.00 0.00 231,538 7.78

24 Ureaplasma Klebsiella pneumoniae ND

26 Enterococcus faecium Negative 98.75 0.00 0.11 0.25 0.00 0.02 0.00 0.00 0.04 0.00 0.00 0.00 207,848 3.41

30 Enterococcus faecalis,Streptococcus mitis

Enterococcus species 95.21 0.17 0.05 0.04 0.00 0.50 0.00 0.00 0.00 0.00 0.00 0.00 27,178 4.67

31 Klebsiella pneumoniae Streptococcus species 6.07 0.00 7.93 1.91 0.00 3.00 0.00 1.25 0.00 0.00 0.00 0.00 36,673 8.03

35 Staphylococcus aureus Negative 91.54 0.00 0.10 0.69 0.00 0.02 0.00 0.00 7.18 0.00 0.00 0.00 149,621 4.14

39 Streptococcus agalactiae Streptococcus species 1.33 0.00 0.04 97.54 0.00 0.01 0.00 0.00 0.00 0.00 0.00 0.00 91,595 2.88

44 Escherichia coli Enterococcus species,Streptococcus species

1.03 0.00 0.12 6.49 0.00 0.01 0.00 0.00 91.39 0.00 0.00 0.00 177,273 4.06

ND, not determined; PCR, polymerase chain reaction; rRNA, ribosomal RNA; RT, real-time.


ajog.o

rgGYNECOLO

GYOrigin

alResearch

JUNE2018

American

JournalofObstetrics

&Gynecology

602.e12

http://www.AJOG.org

FIGURE 5Endometrial microbiome assessed by 16S ribosomal RNA gene sequencing

A, Microbiome composition profiles showing 20 most-abundant genera and their relative abun-dances in endometrial samples of patients with consistent chronic endometritis (CE) diagnosis by3 classic methods. B, Relative abundance of most frequent bacteria causing CE: Ureaplasma,Neisseria, Chlamydia, Staphylococcus, Streptococcus, Gardnerella, Enterococcus, Klebsiella,Escherichia, and Mycoplasma in endometrial samples of patients with consistent CE diagnosis by3 classic methods.



endoscopy are being used as part ofroutine diagnosis for infectious diseasesin organs and/or tissues except for theuterine cavity. Chronic endometritis isunderdiagnosed and thus rarely consid-ered, although clinically relevant inreproductive medicine because it hasbeen associated with repeated implanta-tion failure and recurrent pregnancyloss.17,20,21,33-35 The high prevalence ofcommon bacteria is not surprising


considering that 60% of women withpelvic inflammatory disease havenongonococcal/nonchlamydial infec-tion.36 Our panel for molecular micro-biology was selected to cover >80% ofclinical cases of chronic endometritis.The bacteria primarily responsible for thedisease are streptococci, E. faecalis, E. coli,and staphylococci, accounting for 38.5%,19.3%, 16.3%, and 5.9% of cases,respectively.3 Recently, dysbiosis of the

ology JUNE 2018

endometrial cavity has been associatedwith poor reproductive outcomes inassisted reproductive treatment patients,suggesting that pathogenic deviations ofthe Lactobacillus endometrial content(a signature of chronic endometritis)could play a role in infertility.31

Principal findings of the studyOur study demonstrates the usefulnessof a simple RT-PCR test for the molec-ular diagnosis of chronic endometritis inendometrial samples using a compre-hensive panel of primers to detect themost common microorganismsinvolved.

Our results show that RT-PCR is arobust and specific technique able todiscriminate targeted bacterial DNAeven in challenging conditions such asfrozen endometrial biopsies. The mo-lecular analysis had a degree of agree-ment of 76.92% when endometrialsamples showed concordant results by all3 classic methods. In this subset of 13samples, molecular microbiology had75% sensitivity and 100% specificitycompared to concordant histology þhysteroscopy þ microbial culture diag-nosis (Table 4). Among them, Strepto-coccus species were the most abundantbacteria detected (47%), followed byEnterococcus species (15%), E. coli(12%), K. pneumoniae (5%), Staphylo-coccus species (3%), and M. hominis(2%); these findings are consistent withpreviously reported microbial culturedata.3 Interestingly, G. vaginalis, areproductive tract pathogen usuallyneglected in chronic endometritis diag-nosis, was detected in 7% of the samplesanalyzed using the molecular method. Incontrast, C. trachomatis and N. gonor-rhoeae were undetectable in all testedsamples, which is in agreement withother works describing a limited role forC. trachomatis and sexually transmittedinfection pathogens in the origin ofchronic endometritis.37

Clinical implications of the studySingle use of classic chronic endometritisdiagnostic techniques (histology, hys-teroscopy, or microbial culture) showedpoor diagnostic accuracies (46.15%,58.46%, and 66.15%, respectively)

http://www.AJOG.org

TABLE 4Molecular diagnosis compared to classic diagnostic methods of chronic endometritis

Sensitivity (%) Specificity (%) Accuracy (%) PPV (%) NPV (%) FPR (%) FNR (%)

Histology (n ¼ 65) 56.00 40.00 46.15 36.84 59.26 60.00 44.00

Hysteroscopy (n ¼ 65) 58.73 50.00 58.46 97.37 3.70 50.00 41.27

Microbial culture (n ¼ 65) 71.43 56.67 66.15 65.79 62.96 43.33 28.57

Histology þ hysteroscopy (concordantresults, n ¼ 27)

56.00 50.00 55.56 93.33 8.33 50.00 44.00

Histology þ hysteroscopy þ microbialculture (concordant results, n ¼ 13)

75.00 100.00 76.92 100.00 25.00 0.00 25.00

FNR, false-negative rate; FPR, false-positive rate; NPV, negative predictive value; PPV, positive predictive value.



(Table 4). Moreover, when the overallresults were analyzed in detail, weobserved that histology and hysterosco-py, the 2 most subjective methods forchronic endometritis diagnosis, yieldedcontradictory results in 58.46% ofcases (Figure 1 and Table 2). In all theinconsistent cases, histology showednegative results while hysteroscopyshowed positive results for the samepatient, confirming that, comparedto other methods, histopathologicalevaluation usually underdiagnoseschronic endometritis, and hysteroscopy

TABLE 5Molecular diagnosis of endometrial pa

Subject Surgery indication/treatment

C1 Myomectomy; usual technique

C2 Oophorectomy (dermoid cyst);technique with Novak





T1 Previous chronic endometritis,antibiotics




PCR, polymerase chain reaction; RT, real-time.

Moreno et al. Molecular microbiology for diagnosing chroni

overdiagnoses. The main limitations ofhistology result from: (1) dependence onthe piece of endometrial sampleanalyzed, (2) variability of staining, (3)observer experience, (4) phase of themenstrual cycle in which the sample wascollected,38 and (5) unknown clinicalrelevance of a small amount of plasmacells (below the positive threshold) in theendometrium. In this regard, RT-PCRmay be useful for the detection ofintrauterine germs when histology isnegative, as well as for the decision of atarget therapy when histology is positive.

thogens in negative cases

RT-PCR

with Novak Negative

usual Negative (low detection ofGardnerella vaginalis)

with Novak Negative

with Novak Negative

with Novak Negative (low detection ofMycoplasma hominis)

with Novak Negative

treated with Negative




c endometritis. Am J Obstet Gynecol 2018.

JUNE 2018 Americ

Hysteroscopic diagnosis is based onthe presence of hyperemia, edema, and/or micropolyps, all of which are endo-metrial symptoms that could be due toother pathophysiological conditions or anoninfectious inflammation of the uter-ine cavity, as observed in case 55 thatwas negative for all the methods usedexcept for hysteroscopy in which the onlysign of chronic endometritis was thepresence of micropolyps (Figure 4, B).Microbial culture, the most reliable of the3 classic methods, also presents somelimitations mainly represented by

Histology Microbial culture

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative

Negative Negative


http://www.AJOG.org


contamination of the microbial culturewith skin or environmental bacteria (ie,S. epidermidis) and the inability to growand isolate nonculturable bacteria. Thelimitations of chronic endometritisdiagnosis using individual classic tech-niques and their misleading results areevident in this study in which only 13 of65 (20%) of the samples/patientsanalyzed presented concordant resultsusing all 3 diagnostic methods (Figure 1and Table 2).

Strengths and limitationsThese results indicate that molecularmicrobiology provides similar results tousing the 3 classic methods together,overcoming the bias of using any ofthe classic methods alone. Other ad-vantages of the molecular method are:(1) RT-PCR is highly sensitive and canidentify and quantify very small amountsof bacterial DNA, regardless of theirculturable or nonculturable nature, andmay be useful in estimating the severityof chronic endometritis; (2) it quantifiesbacterial DNA instead of live bacteria, soit is able to detect chronic endometritispathogens in frozen or fixed samples,facilitating sample collection and storagewhile avoiding contamination duringsample transportation/manipulation;27

and (3) RT-PCR is a rapid assay thathas comparable results to bacterial cul-ture with turnaround times of hoursrather than days.39

While the results of this study showthat the molecular detection of bacterialDNA in endometrial samples is a reliablemethod for the diagnosis of chronicendometritis, with a degree of agreementof 76.92%, several limitations must beaddressed to improve the validity of thismolecular test. The main limitation ofmolecular microbiology is the relativelylow negative predictive value, estimatedat 25%, compared to concordant histo-logyþ hysteroscopy þ microbiology.This could be biased by the vast amountof positive chronic endometritis casesdetermined by hysteroscopy, as thenegative predictive value of the molecu-lar method compared to histology ormicrobial culture alone was 59% and63%, respectively. Also, molecularmethods do not guarantee that DNA


comes from viable bacteria, and theestablishment of the minimum amountof bacterial DNA that causes the diseaseshould be determined, as the presence ofsuch DNA in some women could beinnocuous depending on the hostresponse to those pathogens and wouldnot discriminate between acute andchronic endometritis. The copynumbers for the interrogated gene couldbe variable between different bacterialgenera/species and could cause a slightdeviation on the number of bacteriaestimated by either RT-PCR or 16SrRNA NGS. Also, the topological locali-zation of bacterial growth should beconsidered; for example, G. vaginalisforms biofilms at the apical surface of theepithelial layer.40 This could explain thedifferential detection of G. vaginalis bythe 2 molecular methods obtained inpatients 35 and 44, which may dependon the presence of bacterial biofilm onthe specific sample of tissue analyzed(Table 3). To overcome these limitations,future work could address the technicaland clinical improvement of thismolecular tool by increasing the numberof microorganisms included in thepanel, as well as the transition tomolecular microbiology diagnosis ofchronic endometritis in endometrialfluid samples for minimally invasivedetection of this disease.

ConclusionIn conclusion, this study demonstratesthat compared to the commonly usedhysteroscopy, histology, or microbialculture diagnostic methods, RT-PCReffectively detects and quantifies bacte-rial DNA from chronic endometritis-causing pathogens in endometrial sam-ples providing a feasible, faster, andcheaper method for the diagnosis ofchronic endometritis.Furthermore, the microbiome results

using NGS were concordant withRT-PCR in 91.67% of cases and coincidewith the microbial culture in 75% ofsamples because it allows for the detec-tion of both culturable and non-culturable bacteria. The high sensitivityof molecular microbiology allows for thedetection of endometrial colonization inpatients without histological signs of

ology JUNE 2018

chronic endometritis, providing addi-tional information to improve the cur-rent detection of this invisibleendometrial pathology in asymptomaticinfertile patients. n

AcknowledgmentWe thank Sheila M. Cherry, PhD, ELS, Presidentand Senior Editor from Fresh Eyes Editing LLC,for her excellent work editing this manuscript.

References

1. Human Microbiome Project Consortium.Structure, function and diversity of the healthyhuman microbiome. Nature 2012;486:207-14.2. Cicinelli E, De Ziegler D, Nicoletti R, et al.Chronic endometritis: correlation among hys-teroscopic, histologic, and bacteriologic findingsin a prospective trial with 2190 consecutive of-fice hysteroscopies. Fertil Steril 2008;89:677-84.3. Cicinelli E, De Ziegler D, Nicoletti R, et al. Poorreliability of vaginal and endocervical cultures forevaluating microbiology of endometrial cavity inwomen with chronic endometritis. GynecolObstet Invest 2009;68:108-15.4. Greenwood SM, Moran JJ. Chronic endo-metritis: morphologic and clinical observations.Obstet Gynecol 1981;58:176-84.5. Farooki MA. Epidemiology and pathology ofchronic endometritis. Int Surg 1967;48:566-73.6. Romero R, Mazor M. Infection and pretermlabor. Clin Obstet Gynecol 1988;31:553-84.7. Taylor S, Frydman R. Hysteroscopy andsperm infection [in French]. Contracept Fertil Sex1996;24:549-51.8. Gravett MG, Hitti J, Hess DL,Eschenbach DA. Intrauterine infection and pre-term delivery: evidence for activation of the fetalhypothalamic-pituitary-adrenal axis. Am JObstet Gynecol 2000;182:1404-13.9. Féghali J, Bakar J, Mayenga JM, et al. Sys-tematic hysteroscopy prior to in vitro fertilization[in French]. Gynecol Obstet Fertil 2003;31:127-31.10. Espinoza J, Erez O, Romero R. Pre-conceptional antibiotic treatment to preventpreterm birth in women with a previous pretermdelivery. Am J Obstet Gynecol 2006;194:630-7.11. Knudtson EJ, Shellhaas C, Stephens JA,Senokozlieff M, Ye H, Iams JD. The associationof chronic endometritis with preterm birth. Am JObstet Gynecol 2007;196:337.e1-4.12. Kitaya K, Matsubayashi H, Yamaguchi K,et al. Chronic endometritis: potential cause ofinfertility and obstetric and neonatal complica-tions. Am J Reprod Immunol 2015;75:13-22.13. Polisseni F, Bambirra EA, Camargos AF.Detection of chronic endometritis by diagnostichysteroscopy in asymptomatic infertile patients.Gynecol Obstet Invest 2003;55:205-10.14. Oliveira FG, Abdelmassih VG, Diamond MP,Dozortsev D, Nagy ZP, Abdelmassih R. Uterinecavity findings and hysteroscopic interventionsin patients undergoing in vitro fertilization-

http://refhub.elsevier.com/S0002-9378(18)30156-X/sref1





















































http://www.AJOG.org


embryo transfer who repeatedly cannotconceive. Fertil Steril 2003;80:1371-5.15. Cicinelli E, Resta L, Nicoletti R, et al. Detec-tion of chronic endometritis at fluid hysterosco-py. J Minim Invasive Gynecol 2005;12:514-8.16. Matteo M, Cicinelli E, Greco P, et al.Abnormal pattern of lymphocyte subpopulationsin the endometrium of infertile women withchronic endometritis. Am J Reprod Immunol2009;61:322-9.17. Johnston-MacAnanny EB, Hartnett J,Engmann LL, Nulsen JC, Sanders M,Benadiva CA. Chronic endometritis is a frequentfinding in women with recurrent implantationfailure after in vitro fertilization. Fertil Steril2010;93:437-41.18. Kasius JC, Fatemi HM, Bourgain C, et al.The impact of chronic endometritis on repro-ductive outcome. Fertil Steril 2011;96:1451-6.19. Kasius JC, Broekmans FJM, Sie-Go DMDS,et al. The reliability of the histological diagnosis ofendometritis in asymptomatic IVF cases: amulticenter observer study. Hum Reprod2012;27:153-8.20. Cicinelli E, Matteo M, Tinelli R, et al. Chronicendometritis due to commonbacteria is prevalentin women with recurrent miscarriage asconfirmed by improved pregnancy outcome afterantibiotic treatment. Reprod Sci 2014;21:640-7.21. Cicinelli E, Matteo M, Tinelli R, et al. Preva-lence of chronic endometritis in repeated unex-plained implantation failure and the IVF successrate after antibiotic therapy. Hum Reprod2015;30:323-30.22. ValonesMAA,GuimarãesRL, Brandão LAC,de Souza PRE, de Albuquerque TavaresCarvalho A, Crovela S. Principles and applica-tions of polymerase chain reaction in medicaldiagnostic fields: a review. Braz J Microbiol2009;40:1-11.23. Yang S, Rothman RE. PCR-based di-agnostics for infectious diseases: uses, limita-tions, and future applications in acute-caresettings. Lancet Infect Dis 2004;4:337-48.24. Espy MJ, Uhl JR, Sloan LM, et al. Real-timePCR in clinical microbiology: applications forroutine laboratory testing. Clin Microbiol Rev2006;19:165-256.25. Resta L, Palumbo M, Rossi R, Piscitelli D,Grazia Fiore M, Cicinelli E. Histology of micropolyps in chronic endometritis. Histopathology2012;60:670-4.26. Cicinelli E, Tinelli R, Lepera A, Pinto V,Fucci M, Resta L. Correspondence betweenhysteroscopic and histologic findings in womenwith chronic endometritis. Acta Obstet GynecolScand 2010;89:1061-5.27. Zariffard MR, Saifuddin M, Sha BE, Spear GT.Detection of bacterial vaginosis-related organismsby real-time PCR for lactobacilli, Gardnerellavaginalis and Mycoplasma hominis. FEMSImmunol Med Microbiol 2002;34:277-81.28. Franasiak JM,Werner MD, Juneau CR, et al.Endometrial microbiome at the time of embryotransfer: next-generation sequencing of the 16S

ribosomal subunit. J Assist Reprod Genet2016;33:129-36.29. Pewsner D, Battaglia M, Minder C, Marx A,Bucher HC, EggerM. Ruling a diagnosis in or outwith “SpPIn” and “SnNOut”: a note of caution.BMJ 2004;329:209-13.30. Ravel J, Gajer P, Abdo Z, et al. Vaginalmicrobiome of reproductive-age women. ProcNatl Acad Sci U S A 2011;108(Suppl):4680-7.31. Moreno I, Codoñer FM, Vilella F, et al. Evi-dence that the endometrial microbiota has aneffect on implantation success or failure. Am JObstet Gynecol 2016;215:684-703.32. Centers for Disease Control and Prevention.Recommendations for the laboratory-baseddetection of Chlamydia trachomatis and Neis-seria gonorrhoeae. MMWR Recomm Rep2014;63:1-19.33. Kitaya K. Prevalence of chronic endometritisin recurrent miscarriages. Fertil Steril 2011;95:1156-8.34. Kitaya K, Yasuo T. Inter-observer and intra-observer variability in immunohistochemicaldetection of endometrial stromal plasmacytes inchronic endometritis. Exp Ther Med 2012;5:485-8.35. McQueen DB, Perfetto CO, Hazard FK,Lathi RB. Pregnancy outcomes in women withchronic endometritis and recurrent pregnancyloss. Fertil Steril 2015;104:927-31.36. Ness RB, Soper DE, Holley RL, et al. Effec-tiveness of inpatient and outpatient treatmentstrategies for women with pelvic inflammatorydisease: results from the pelvic inflammatorydisease evaluation and clinical health (PEACH)randomized trial. Am J Obstet Gynecol2002;186:929-37.37. Stern RA, Svoboda-Newman SM, Frank TS.Analysis of chronic endometritis for Chlamydiatrachomatis by polymerase chain reaction. HumPathol 1996;27:1085-8.38. Punnonen R, Lehtinen M, Teisala K, et al.The relation between serum sex steroid levelsand plasma cell infiltrates in endometritis. ArchGynecol Obstet 1989;244:185-91.39. Cunningham SA, Mandrekar JN,Rosenblatt JE, Patel R. Rapid PCR detection ofMycoplasma hominis, Ureaplasma urealyticum,and Ureaplasma parvum. Int J Bacteriol2013;2013:1-7.40. Swidsinski A, Verstraelen H, Loening-Baucke V, Swidsinski S, MendlingW, Halwani Z.Presence of a polymicrobial endometrial biofilmin patients with bacterial vaginosis. PLoS One2013;8:e53997.41.Westh H, Jensen JS. Low prevalence of thenew variant of Chlamydia trachomatis inDenmark. Sex Transm Infect 2008;84:546-7.42. Arabestani MR, Fazzeli H, Nasr Esfahani B.Identification of the most common pathogenicbacteria in patients with suspected sepsis bymultiplex PCR. J Infect Dev Ctries 2014;8:461-8.43. Lee DH. Quantitative detection of residual Ecoli host cell DNA by real-time PCR. J MicrobiolBiotechnol 2010;20:1463-70.

JUNE 2018 Americ

44. Clifford RJ, Milillo M, Prestwood J, et al.Detection of bacterial 16S rRNA and iden-tification of four clinically important bacteriaby real-time PCR. PLoS One 2012;7:e48558.45. Datcu R, Gesink D, Mulvad G, et al.Vaginal microbiome in women fromGreenland assessed by microscopy andquantitative PCR. BMC Infect Dis 2013;13:480.46. Hjelmevoll SO, Olsen ME, Sollid JUE,Haaheim H, Unemo M, Skogen V. A fast real-time polymerase chain reaction method forsensitive and specific detection of the Neisseriagonorrhoeae porA pseudogene. J Mol Diagn2006;8:574-81.47. Picard FJ, Ke D, Boudreau DK, et al. Use oftuf sequences for genus-specific PCR detec-tion and phylogenetic analysis of 28 strepto-coccal species. J Clin Microbiol 2004;42:3686-95.

Author and article informationFrom the Departments of Research (Drs Moreno, Val-

buena, and Ms Gonzalez-Monfort), Bioinformatics (Dr

Bau) and Scientific director (Dr Simon) Igenomix SL;

Igenomix Foundation-Instituto de Investigacion Sanitaria

INCLIVA (Drs Vilella and Simon); Department of Pediat-

rics, Obstetrics and Gynecology, University of Valencia (Dr

Simon and Ms Garcia-Grau), Valencia, Spain; Department

of Obstetrics and Gynecology, School of Medicine,

Stanford University, Stanford, CA (Drs Moreno, Vilella,

and Simon); Second Unit of Obstetrics and Gynecology,

Department of Biomedical and Human Oncological Sci-

ence (Dr Cicinelli), and Department of Emergency and

Organ Transplantation, Pathological Anatomy (Dr Resta),

University of Bari, Bari, Italy; and Center of Reproductive

Medicine, Hospital Foch, Suresnes, France (Dr De

Ziegler).1These authors contributed equally to this article.

Received Nov. 10, 2017; revised Feb. 7, 2018;

accepted Feb. 15, 2018.

This work was partially supported by Igenomix SL

and the grant Instituto Valenciano de Competitividad

Empresarial (IMIDTA/2017/70) from Generalitat

Valenciana. Drs Moreno (Ayudas para contratos Torres

Quevedo-13-06133) and Bau (Ayudas para contratos

Torres Quevedo-16-08454) are supported by Torres-

Quevedo grants from the Spanish Ministry of Economy

and Competitiveness. Ms Garcia-Grau is supported by a

Formacion de Profesorado Universitario grant (FPU15/

01923) from the Spanish Ministry of Education, Culture,

and Sport. Dr Vilella is supported by Miguel Servet

program type I (CP13/00038) and Fondo de Inves-

tigacion Sanitaria project (PI14/00545) of Spanish

Instituto de Salud Carlos III.

Disclosure: Drs Moreno, Bau, Valbuena, and Simon,

and Ms Gonzalez are employed by Igenomix SL. The

remaining authors report no conflict of interest.

Preliminary results were presented at the 33rd annual

meeting of the European Society of Human Reproduction

and Embryology, Geneva, Switzerland, July 2-5, 2017.

Corresponding author: Carlos Simon, MD, PhD.

[email protected]

























































































































































mailto:[email protected]

http://www.AJOG.org

original research ajog...leukorrhea.4 the actualprevalence in the general population is...

Documents