P38-Nrf-2 Signaling Pathway of Oxidative Stress in MiceCaused by Nanoparticulate TiO2

Jue Wang & Na Li & Lei Zheng & Sisi Wang & Ying Wang &Xiaoyang Zhao & Yanmei Duan & Yaling Cui &Min Zhou & Jingwei Cai & Songjie Gong & Han Wang &Fashui Hong

Received: 19 January 2010 /Accepted: 24 February 2010 /Published online: 27 April 2010# Springer Science+Business Media, LLC 2010

Abstract Some recent studies have been previously suggested that nanoparticulatetitanium dioxide (TiO2) damaged liver function and decreased immunity of mice, but thespleen injury and its oxidative stress mechanism are still unclear. To understand the spleeninjury induced by intragastric administration of nanoparticulate anatase TiO2 forconsecutive 30 days, the spleen pathological changes, the oxidative stress, and p38 andc-Jun N-terminal kinase signaling pathways, along with nuclear factor-B and nuclearfactor-E2-related factor-2 (Nrf-2), were investigated as the upstream events of oxidativestress in the mouse spleen from exposure to nanoparticulate TiO2. The results suggestedthat nanoparticulate TiO2 caused congestion and lymph nodule proliferation of spleentissue, which might exert its toxicity through oxidative stress, as it caused significantincreases in the mouse spleen reactive oxygen species accumulations, subsequently leadingto the strong lipid peroxidation and the significant expression of heme oxygenase-1 via thep38-Nrf-2 signaling pathway. The studies on the mechanism by which nanoparticulate TiO2induced the p38-Nrf-2 signaling pathway are helpful to a better understanding of thenanoparticulate TiO2-induced oxidative stress and reduction of immune capacity.

Keywords Nanoparticulate TiO2 . Spleen . Oxidative stress . p38MAP kinases .

Nuclear factor-E2-related factor-2 . Heme oxygenase-1

Introduction

Nanoparticles and materials are being rapidly produced in large quantities throughout theworld. Widespread application of nanomaterials confers enormous potential for humanexposure and environmental release. Recently, however, scientists and organizations haveraised the environmental and other safety concerns about nanotechnology [13]. As newtypes of photo-catalyst, anti-ultraviolet light agents, and photoelectric effect agents,

Biol Trace Elem Res (2011) 140:186197DOI 10.1007/s12011-010-8687-0

Jue Wang, Na Li, Lei Zheng and Ying Wang contributed equally to this work.

J. Wang : N. Li : L. Zheng : S. Wang :Y. Wang :X. Zhao :Y. Duan : Y. Cui :M. Zhou : J. Cai :S. Gong :H. Wang : F. Hong (*)Medical College, Soochow University, Suzhou 215123, Peoples Republic of Chinae-mail: Hongfsh_cn@sina.com

titanium dioxide (TiO2) nanoparticles are used in a variety of consumer products (such astoothpastes, sunscreens, cosmetics, food products) [4], paints and surface coatings [5], andin the environmental decontamination of air, soil, and water [6, 7]. As an ultrafine-sizedmaterial, the nanoparticulate TiO2 can enter the human body through various routes such asinhalation (respiratory tract), ingestion (gastrointestinal tract), dermal penetration (skin),and injection (blood circulation) [8, 9].

Although little is known about nanoparticulate TiO2 toxicity, oxidative stress, whichelicits a wide variety of cellular events, such as apoptosis, cell cycle arrest, and theinduction of antioxidant enzymes, has often been reported as nanoparticulate TiO2- inducedtoxicity. Numerous previous studies on nanoparticulate TiO2 toxicity, with various animalorgan types, such as lung, gill, brain, liver, and kidney, have reported that oxidative stress isone of the most important toxicity mechanisms related to the exposure to nanoparticulateTiO2 [1014]. Nanoparticulate TiO2 was demonstrated to damage the haemostasis bloodsystem and immune responses in mice [15]. The reduction of immune responses of micecaused by nanoparticulate anatase TiO2 may be due to the spleen damage. Spleen is thelargest immune organ in humans, participating in immune response, generating lympho-cytes, eliminating aging erythrocytes, and storing blood. However, we need to be focusedon whether nanoparticulate TiO2 induces pathological changes to spleen and hownanoparticulate TiO2 damages spleen.

In order to further elucidate the molecular mechanism of nanoparticulate TiO2-inducedoxidative stress in the mouse spleen, the evaluation in the toxicity needs to be focused oninvolving the oxidative stress responding signal transduction pathway and transcriptionfactors caused by nanoparticulate TiO2. The studies of the upstream signaling mechanismresponsible for regulating oxidative stress have been focused on the mitogen-activatedprotein (MAP) kinase cascades, including p38 and c-Jun N-terminal kinase (JNK) [16].However, the upstream signaling mechanism responsible for regulating the oxidative stressinvolved in nanoparticulate TiO2 toxicity is rarely reported. The previous studiesdemonstrated that JNKs and p38 MAP kinases involving MAP kinase cascades arepreferentially activated by various stresses, such as X-ray or UV irradiation, heat or osmoticshock, and oxidative or nitrosative stress [1720]. Moreover, redox-sensitive transcriptionfactors, such as nuclear factor kB (NF-B) and nuclear factor-E2-related factor-2 (Nrf-2),can also be evaluated as target transcription factors of nanoparticulate TiO2 toxicities. NF-B, activated by oxidative stress, induces the expression of a variety of proteins thatfunction in the immunological and cellular detoxifying defense systems [21, 22] and hasbeen identified as a transcription factor regulated by the intracellular redox status [23].When activated by oxidative stress, Nrf-2 breaks free from Kelchlike ECH-associatedprotein 1 (Keap1) and translocates into the nucleus, where it binds to an antioxidantresponse factor, a cis-acting enhancer sequence that mediates the transcriptional activationof genes in response to oxidative stress, including heme oxygenase-1 (HO-1) [24]. Hemeoxygenases (HO) are rate-limiting enzymes that catalyze the conversion of heme intocarbon monoxide and biliverdin [25]. They have antioxidant capacity and therefore act aspotent anti-inflammatory proteins whenever oxidative injury takes place [26]. HO-2 isconstitutively produced within the brain and testes, whereas HO-1 is produced ubiquitously,but only marginally in the resting state [27]. Rapid induction of HO-1 follows variousstresses [2830]. The previous studies have suggested protective roles of HO-1 in variousinflammatory conditions [31, 32]. Many studies have suggested that the transcription factorNrf-2 plays an essential role in the antioxidant response factor-mediated expression ofphase II detoxifying and antioxidant enzymes, as well as other stress-inducible genes, inresponse to oxidative stress [3338].

P38-Nrf-2 Signaling Pathway of Oxidative Stress 187

In this article, the spleen pathological changes, the oxidative stress, the expression levelsof the oxidative stress genes and their proteins including p38, JNK, NF-B, Nrf-2, and HO-1in the mouse spleen were investigated to further understand mechanism of the splenic injuryin mice caused by nanoparticulate TiO2.

Materials and Methods

Chemicals and Preparation

TiO2 (100% anatase, CAS #:13463-67-7, VK-TA05) was purchased from HangzhouWanjing New Material Co. Ltd. (Hangzhou,China) (the particle characteristics are shownin Table 1) and the particles were used in this experiment.

A 0.5% hydroxypropyl-methylcellulose K4M (HPMC, K4M) was used as a suspendingagent. Each TiO2 powder was dispersed onto the surface of 0.5%, w/v HPMC solution, andthen the suspending solutions containing TiO2 particles were treated by ultrasonic for 1520 min and mechanically vibrated for 2 or 3 min.

Animals and Treatment

Eighty CD-1 (ICR) female mice (222 g) were purchased from the Animal Center ofSoochow University. Animals were housed in stainless steel cages in a ventilated animalroom. Room temperature was maintained at 202C, relative humidity at 6010%, and a12-h light/dark cycle. Distilled water and sterilized food for mice were available ad libitum.They were acclimated to this environment for 5 days prior to dosing. All animal procedureswere performed in compliance with the regulations and guidelines of the internationalethics committee on animal welfare. Animals were randomly divided into four groups:control group (treated with 0.5% HPMC) and three experimental groups (5, 50, and150 mg/kg BW nano-anatase TiO2). Nanoparticulate anatase TiO2 (5, 50, and 150 mg/kgBW) suspensions were given to mice by intragastric administration every day for 30 days,respectively. The control group was treated with 0.5% HPMC. The symptom and mortalitywere observed and recorded carefully everyday for 30 days. After 30 days, all animals werefirst weighed and then sacrificed after being anesthetized by ether. The spleens were excisedand weighed.

Histopathological Examination of Spleen

Histological observations were performed according to the standard laboratory procedures.Mice (four mice/control and three treatment groups) at the end of day 30 were dissected forhistology. A small piece of spleen, fixed in 10% (v/v) formalin, was embedded in a paraffinblock, sliced into 5 m thicknesses and then placed onto glass slides. The section wasstained with hematoxylineosin (HE) and examined by optica microscopy (Nikon U-III

Table 1 Particle Characteristics of Nanoparticulate TiO2

Sample Crystallite size Phase Surface area (m2/g) Composition

TiO2 7.5 nm Anatase 160 Ti,O

188 Wang et al.

Multi-point Sensor System: Biodirect-Inc., Nikon, USA), and the identity and analysis ofthe pathology slides were blind to the pathologist.

ROS and Lipid Peroxidation Assay

ROS Assay

Superoxide ion (O2) in spleen tissue was measured as described previously by Oliveira et

al. [39], by determining the reduction of 3-[1-[phenylamino-carbonyl]-3,4- tetrzolium]-bis(4-methoxy-6-nitro) benzenesulfonic acid hydrate (XTT) in the presence of O2

, with somemodifications. The spleen was homogenized with 2 mL of 50 mM TrisHCl buffer (pH 7.5)and centrifuged at 5,000g for 10 min. The reaction mixture (1 mL) contained 50 mM TrisHCl buffer (pH 7.5), 20 g spleen proteins, and 0.5 mM XTT. The reaction of XTT wasdetermined at 470 nm for 5 min. Corrections were made for the background absorbance inthe presence of 50 units of superoxide dismutase (SOD). The production rate of O2

wascalculated using an extinction coefficient of 2.16104 M1 cm1.

The detection of H2O2 contents in the liver tissues was carried out by the xylenol orangeassay [40], with minor modifications. In short, after the preincubation of P2 with mercurialsand/or quercetin/catalase (30 min at 25C), the reaction medium was centrifuged at17,500g for 10 min at 4C and the supernatant was incubated for 30 min in a reactionmedium containing 250 mM perchloric acid, 2.5 mM ammonium iron (II) sulfatehexahydrate, and 1 mM xylenol orange. Hydroperoxide levels were determined at560 nm using a hydrogen peroxide curve as standard.

Lipid Peroxidation

Spleen lipid peroxidation was determined as the concentration of malondialdehyde (MDA)generated by the thiobarbituric acid (TBA) reaction as described by Buege and Aust [41], butwith the introduction of an isobutanol extraction step for the removal of interferingcompounds. For analysis, a subsample of tissue was thawed, homogenized, and cells lysedusing a 4% TBA solution in 0.2M HCl. The reaction mixture was then incubated at 90C for45 min. The resulting TBAMDA adduct was phase-extracted using isobutanol. Theisobutanol phase was then read at a wavelength of 535 nm on a UV-3010 spectrophotometer.MDA standard curves were prepared by acid hydrolysis of 1,1,3,3-tetramethoxypropane.

Expression Assay of Oxidative Stress Genes and Proteins

The mRNA expression of regulating the oxidative stress genes, including p38, JNK, NFR2, NF-B, and HO-1, were determined by real-time quantitative reverse transcriptasepolymerasechain reaction (RT-PCR) [4244]. Spleens in the same growth period from the three differenttreatments were used. The right spleens from mice with or without nano-anatase TiO2 treatmentwere homogenized using QIAzol lysis reagent with a Tissue Ruptor (Roche, Indianapolis, IN).Total RNA from the homogenates was isolated using Tripure Isolation Reagent (Roche)according to the manufacturers instructions. The RT reagent (ShineGene: Shanghai ShinegeneCo., China) of 30 Lwas prepared bymixing 15 L of 2 RT buffer, 1 L random primer in aconcentration of 100 pmolL1, 1 L of RTase, 5 L RNA, and 8 L DEPC water together.The reaction condition was 25C for 10 min, 40C for 60 min, and 70C for 10 min.

Synthesized cDNAwas used for the real-time PCR. Primers were designed using PrimerExpress Software according to the software guidelines (Table 2).

P38-Nrf-2 Signaling Pathway of Oxidative Stress 189

All primers were purchased from ShineGene. For the 50-L PCR reaction, 25 L 2PCR buffer, 0.6 L 2 primers (25 pmolL1), 0.3 L probe (25 pmolL1), 1 L cDNA,and 22.8 L DEPC water (Sigma) were mixed together. The parameters for a two-step PCRwere 94C for 3 min, 94C for 20 s, 60C for 20 s, then 72C for 20 s, 35 cycles.

The gene expression analysis and experimental system evaluation were performedaccording to the standard curve and quantitation reports.

To determine p38, JNK, NF-B, Nfr2, and HO-1 levels of the spleen, enzyme-linkedimmunosorbent assay (ELISA) was performed by using commercial kits that are selective forthe mouse spleen p38, JNK, NF-B, Nfr2, and HO-1 (RD Systems, Minneapolis, USA). Themanufacturers instruction was followed. The absorbance was measured on a microplatereader at 450 nm (Varioskan Flash, Thermo Electron, Finland), and the p38, JNK, NF-B,Nfr2, and HO-1 concentration of samples was calculated from a standard curve.

Statistical Analysis

Statistical analyses were done using SPSS11.5 software. Data were expressed as means SE. One-way analysis of variance was carried out to compare the differences of meansamong multigroup data. Dunnetts test was carried out when each group of experimentaldata was compared with solvent-control data. Statistical significance for all tests was judgedat a probability level of 0.05.

Result

Histopathological Evaluation

The histological photomicrographs of the spleen sections are shown in Fig. 1. No severedamages of spleen tissue were reflected in the 5 mg/kg nanoparticulate anatase TiO2-treatedgroup (Fig. 1b) compared to the control (Fig. 1a), while the congestion of the spleen tissuewas showed in the 50 mg/kg nanoparticulate anatase TiO2 group (Fig. 1c) and lymph

Table 2 Real-time PCR Primer Pairs

Gene name Description Primer sequence Primer size (bp)

Refer-actin mactin F GAGACCTTCAACACCCCAGC 263

mactin R ATGTCACGCACGATTTCCC

p38 mp38 F GGAGAAGATGCTCGTTTTGGA 211

mp38 R TTGGTCAAGGGGTGGTGG

jnk mjnk F TCTCCAGCACCCATACATCAA 150

mjnk R TCCTCCAAATCCATTACCTCC

nf-b mnf-b F GGTGGAGGCATGTTCGGTA 142

mnf-b R TGACCCCTGCGTTGGATT

nfr2 mnfr2 F CTTCCATTTACGGAGACCCACC 176

mnfr2 R GGATTCACGCATAGGAGCACTG

HO-1 mHO-1 F GACAGAAGAGGCTAAGACCGC 213

mHO-1 R TGGAGGAGCGGTGTCTGG

PCR primers used in the gene expression analysis

190 Wang et al.

nodule proliferation was observed in the 150 mg/kg nanoparticulate anatase TiO2-treatedgroup (Fig. 1d). We observed histological photomicrographs of the spleens of four mice ofeach group, indicating that the 50 and 150 mg/kg nanoparticulate anatase TiO2 causedhistological changes in the same manner.

ROS Production and Lipid Peroxidation

The effects of treatments with various doses of nanoparticulate TiO2 on the accumulationof O2

, H2O2, and the MDA content in the mouse spleen are shown in Figs. 2 and 3,respectively. The significant differences were observed the production rate of ROS and theMDA content of the spleen caused by nanoparticulate TiO2 (p

JNK, NF-B, Nrf-2, and HO-1 in the nanoparticulate TiO2-induced spleen injury, real-timequantitative RT-PCR and ELISAwere used to demonstrate the changes of the oxidative stressgenes and their proteins levels in the nanoparticulate TiO2-treated mice (Tables 3 and 4). InTables 3 and 4, we observed that nanoparticulate TiO2 induced a dramatic increase of p38,JNK, NF-B, Nrf-2, and HO-1 expression in the treated mouse spleen (P

2 weeks. However, Chen et al., by histopathological examinations, observed that nano-TiO2particles caused a severe lesion of spleen and a mass of neutrophilic cells in spleen tissuesby intraperitoneal injection, revealing that inflammation in spleen tissues was very serious[46]. Our researches also observed that the coefficients of the spleen of mice significantlyincreased by intragastric administration or intraperitoneal injection of higher doses ofnanoparticulate TiO2 (5 nm) for 30 or 14 days [15, 47]. The results of this study indicatethat the intragastric administration of higher doses of nanoparticulate anatase TiO2 caninduce histopathological changes of spleen, including the congestion and lymph noduleproliferation, suggesting an inflammation in spleen tissues (Fig. 1). The present studyindicates that the spleen lesion of mice is triggered by nanoparticulate TiO2 oxidative stressgeneration and activation of the oxidative stress genes that resulted in inflammation ofspleen tissue.

To prove spleen oxidative stress of mice, we detected ROS and MDA contents. Thestudies showed that the obvious production of ROS (such as O2

. and H2O2) and lipidperoxidation (MDA content increased) occurred in the mouse spleen treated with highernanoparticulate anatase TiO2 doses (Figs. 2 and 3), indicating that these nanoparticulateanatase TiO2-treated mouse spleen underwent severe oxidative stress. Similarly, nano-particulate anatase TiO2 was reported to cause oxidative stress in the mouse brain, liver and

Table 3 Effect of Nanoparticulate TiO2 on the Amplification of Regulating the Oxidative Stress GenemRNA of Mouse Spleen by Real-time PCR Analysis After Intragastric Administration with NanoparticulateTiO2 for 30 days

Nanoparticulate TiO2 (mg/kg BW)

0 5 50 150

p38/actin 0.1200.006 0.1950.010* 0.3670.018** 0.4980.025**

jnk/actin 0.1100.006 0.1410.007 0.1910.010* 0.3570.018**

nf-b/actin 0.0110.001 0.0170.001 0.0500.003* 0.0670.003**

nfr2/actin 0.9930.050 1.1160.056 1.9330.097** 4.5130.226**

HO-1/actin 1.2150.061 1.3140.066 5.3720.269* 10.2940.515*

Ranks marked with an asterisk or double asterisk indicate significant difference from the control (nonanoparticules) at the 5% or 1% confidence level, respectively. Values represent means SE, n=5

Table 4 Effect of Nanoparticulate TiO2 on Regulating the Oxidative Stress-Protein Level of Mouse Spleenby ELISA ANalysis After Intragastric Administration with Nanoparticulate TiO2 for 30 days

Nanoparticulate TiO2 (mg/kg BW)

0 5 50 150

P38 (pg/mL) 6.330.32 8.970.45* 14.120.71** 19.510.98**

JNK (pg/mL) 4.420.22 6.260.31* 9.770.49** 16.460.82**

NF-B (pg/mL) 2.080.10 2.310.12 3.210.16* 3.690.18**

Nrf2 (pg/mL) 31.491.57 37.201.86 48.922.45** 78.573.93**

HO-1 (pg/mL) 43.622.18 48.732.44 69.933.50** 105.895.29**

Ranks marked with an asterisk or double asterisk indicate significant difference from the control (nonanoparticules) at the 5% or 1% confidence level, respectively. Values represent means SE, n=5

P38-Nrf-2 Signaling Pathway of Oxidative Stress 193

kidney [1214]. It has been demonstrated that nanoparticules are mediating their toxicitythrough production of ROS and that the level of ROS depends on the chemistry andstructure of the nanoparticules [4, 9, 10, 48, 49]. The overproduction of ROS would breakdown the balance of the oxidative/antioxidative system in the spleen, resulting in the lipidperoxidation, which is closely related to the reduction of the antioxidative capacity. In ourprevious studies, nanoparticulate anatase TiO2 inhibited the activities of SOD, catalase,ascorbic acid peroxidase, and glutathione peroxidase, and decreased ascorbic acid andreduced glutathione in the mouse brain, liver, and kidney [1214]. In fact, any chemicaldamage is based on the physical binding interaction. Some intermolecular actionmechanisms were also demonstrated to be related to the oxidative stress [50, 51].

To further understand the mechanism of oxidative stress due to exposure to nano-particulate TiO2, the detection of molecular events, such as MAP kinase signaltransduction and subsequent transcription factor activation (Tables 3 and 4), wasundertaken. The expressions of p38 and JNK were significantly induced by nano-particulate TiO2. The overall results for ROS formation and on MAP kinase signalingstudies suggested that nanoparticulate TiO2 provokes oxidative stress, and in response tothis, mainly the p38 and JNK MAP kinase signaling pathway seems to be activated. As adownstream event of MAP kinase signaling, NF-B and Nrf-2 transcription factors,which are known to respond to oxidative stress, were examined in the mouse spleentreated with nanoparticulate TiO2 (Tables 3 and 4). Nanoparticulate TiO2 induced theexpressions of NF-B and Nrf-2. To further investigate the cellular consequences ofoxidative stress signaling through p38-Nrf-2 activation by nanoparticulate TiO2 exposure,representative antioxidant enzymes, such as HO-1, were examined (Tables 3 and 4). HO-1is a relatively novel enzyme, with potent anti-inflammatory and cytoprotectiveantioxidant effects [5255]. The expression of HO-1 protein was dramatically increasedin nanoparticulate TiO2-treated mice. The induction of HO-1 due to exposure tonanoparticulate TiO2 may be mediated through p38 MAP kinase and the Nrf-2 signaltransduction pathway. Recently, Lim et al. reported that the cyclopentenone prostaglandincompound stimulates HO-1 expression through the p38 MAP kinase and Nrf-2 pathwayin rat vascular smooth muscle cells [56, 57]. Induction of HO-1 can be interpreted as acellular defense mechanism against oxidative stress; it is well known that HO-1 inductionis regulated by Nrf-2 activation [24]. In this study, nanoparticulate TiO2-induced NF-Bactivation was not observed, which was unexpected, as NF-B is the major stressresponse transcription factor and has been reported to respond to a wide variety ofenvironment stressors.

Conclusion

Overall, the results of experimental studies suggest that nanoparticulate TiO2 may exerttheir toxicity through oxidative stress. Nanoparticulate TiO2 causes congestion and lymphnodule proliferation of spleen tissue of mice and a significant increase in the spleen ROSproductions, and subsequently leads to a strong induction of HO-1 via the p38-Nrf-2signaling pathway. The tested oxidative stress parameters in this study were rather limitedin terms of allowing a full understanding of the oxidative stress and spleen response due toexposure to nanoparticulate TiO2. Further studies on the mechanism by which nano-particulate TiO2 induce the p38-Nrf-2 signaling pathway to better understand thenanoparticulate TiO2-induced oxidative stress, as well as with concentration responseand time-course analyses, are warranted.

194 Wang et al.

Acknowledgements This work was supported by the National Natural Science Foundation of China (grantno. 30901218), the Medical Development Foundation of Soochow University (grant no. EE120701, China),the National Bringing New Ideas Foundation of Student of China (grant nos. 57315427, 57315927), and theBringing New Ideas Foundation of Postgraduate of Medical College of Soochow University (China) and theSoochow University Start-up Fund (grant no. Q4134918, China).

References

1. Dagani R (2003) Nanomaterials: safe or unsafe? Chem Eng News 81:30332. Service RF (2003) American Chemical Society meeting. Nanomaterials show signs of toxicity. Science

300:2433. Warheit DB (2004) Nanoparticles: health impacts? Mater Today 7:32354. Gurr J, Wang ASS, Chen C, Jan K (2005) Ultrafine titanium dioxide particle in the absence of

photoactivation can induce oxidative damage to human bronchial epithelial cells. Toxicol 213:66735. J Fisher, T Egerton (2001) Kirk-Othmer encyclopedia of chemical technology. New York: John Wiley &

Sons, Titanium Compounds, Inorganic6. Choi H, Stathatos E, Dionysiou DD (2006) Solgel preparation of mesoporous photocatalytic TiO2 films

and TiO2/Al2O3 composite membranes for environmental applications. Appl Catal B-Environ 63:60677. Esterkin CR, Negro AC, Alfano OM, Cassano AE (2005) Air pollution remediation in a fixed bed

photocatalytic reactor coated with TiO2. AIChE J 51:229823108. Jin CY, Zhu BS, Wang XF, Lu QH (2008) Cytotoxicity of titanium dioxide nanoparticles in mouse

fibroblast cells. Chem Res Toxicol 21(9):187118779. Oberdrster G, Oberdrster E, Oberdrster J (2005) Nanotoxicology: an emerging discipline evolving

from studies of ultrafine particles. Environ Health Perspect 113(7):82383910. Afaq F, Abidi P, Matin R, Rahman Q (1998) Cytotoxicity, pro-oxidant effects and antioxidant depletion

in rat lung alveolar macrophages exposed to ultrafine titanium dioxide. J Appl Toxicol 18:30731211. Federici G, Shaw BJ, Handy RD (2007) Toxicity of titanium dioxide nanoparticles to rainbow trout

(Oncorhynchus mykiss): gill injury, oxidative stress, and other physiological effects. Aquat Toxicol84:415430

12. Ma LL, Liu J, Li N, Wang J, Duan YM, Yan JY, Liu HT, Wang H, Hong FS (2010) Oxidative stress inthe brain of mice caused by translocated nanoparticulate TiO2 delivered to the abdominal cavity.Biomaterials 31:99105

13. Liu HT, Ma LL, Liu J, Zhao JF, Yan JY, Hong FS (2010) Toxicity of nano-anatase TiO2 to mice: liverinjury, oxidative stress. Toxicol Environ Chem 92(1):175186

14. Zhao JF, Wang J, Wang SS, Zhao XY, Yan JY, Ruan J, Li N, Duan YM, Wang H, Hong FS (2010) Themechanism of oxidative damage in nephrotoxicity of mice caused by nano-anatase TiO2. J ExpNanoscience doi:10.1080/17458081003628931, 2010 in press

15. Duan YM, Liu J, Ma LL, Li N, Liu HT, Wang J, Zheng L, Liu C, Wang XF, Zhang XG, Yan JY, WangH, Hong FS (2010) Toxicological characteristics of nanoparticulate anatase titanium dioxide in mice.Biomaterials 31:894899

16. Kyriakis JM, Avruch J (2001) Mammalian mitogen-activated protein kinase signal transductionpathways activated by stress and inflammation. Physiol Rev 81:807869

17. Takeda K, Matsuzawa A, Nishitoh H, Ichijo H (2003) Roles of MAPKKK ASK1 in stress-induced celldeath. Cell Struct Funct 28:2329

18. Hagemann C, Blank JL (2001) The ups and downs of MEK kinase interactions. Cell Signall 13(12):86387519. Qadri I, Iwahashi M, Capasso JM, Hopken MW, Flores S, Schaack J, Simon FR (2004) Induced

oxidative stress and activated expression of manganese superoxide dismutase during hepatitis C virusreplication: role of JNK, p38 MAPK and AP-1. Biochem J 378:919928

20. Camacho-Barquero L, Villegas I, Snchez-Calvo JM, Talero E, Snchez-Fidalgo S, Motilva V, Alarcnde la Lastra C (2007) Curcumin, a Curcuma longa constituent, acts on MAPK p38 pathway modulatingCOX-2 and iNOS expression in chronic experimental colitis. Int Immunopharmacol 7:333342

21. Janssen YM, Barchowsky A, Treadwell M, Driscoll KE, Mossman BT (1995) Asbestos induces nuclearfactor kappa B (NF-kappa B) DNA-binding activity and NF-kappa B-dependent gene expression intracheal epithelial cells. Proc Natl Acad Sci USA 92:84588462

22. Pinkus R, Weiner LM, Daniel V (1996) Role of oxidants and antioxidants in the induction of AP-1, NF-kappaB, and glutathione S-transferase gene expression. J Biol Chem 271:1342213429

23. Sen CK, Packer L (1996) Antioxidant and redox regulation of gene transcription. FASEB J 10:709720

P38-Nrf-2 Signaling Pathway of Oxidative Stress 195

24. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Oconnor T, Yamamoto M (2003) Keap1 regulates bothcytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 8:379391

25. Maines MD (1988) Heme oxygenase: function, multiplicity, regulatory mechanism, and clinicalapplications. FASEB J 2:25572568

26. Choi AM, Alam J (1996) Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am J Respir Cell Mol Biol 15(1):919

27. Maines MD (1997) The heme oxygenase system: a regulator of second messenger gases. Annu RevPharmacol Toxicol 37:517554

28. Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, Sasaki H, Shibahara S (1996) Regulation ofhuman heme oxygenase-1 gene expression under thermal stress. Blood 87:50745084

29. Cantoni L, Rossi C, Rizzardini M, Gardina M, Ghezzi P (1991) Interleukin-1 and tumor necrosis factorinduce hepatic haeme oxygenase. Biochem J 279:891894

30. Chen K, Gunter K, Maines MD (2002) Neurons overexpressing heme oxygenase-1 resist oxidativestress-mediated cell death. J Neurochem 75(1):304313

31. Willis D, Moore AR, Frederick R, Willoughby DA (1996) Heme oxygenase: a novel target for themodulation of the inflammatory response. Nat Med 2:8790

32. Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, Ohta K, Kasahara Y, Koizumi S (1999)Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. ClinInvest 103(1):129135

33. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, Oyake T, Hayashi N, Satoh K, Hatayama I,Yamamoto M, Nabeshima Y (1997) An Nrf2/small Maf heterodimer mediates the induction of phase IIdetoxifying enzyme genes through antioxidant response elements. Biochem Biophy Res Commun236:313322

34. Chan K, Kan YW (1999) Nrf2 is essential for protection against acute pulmonary injury in mice. ProcNatl Acad Sci USA 96:1273112736

35. Hayes JD, Chanas SA, Henderson CJ, McMahon M, Sun C, Moffat GJ, Wolf CR, Yamamoto M (2000)The Nrf2 transcription factor contributes both to the basal expression of glutathione S-transferases inmouse liver and to their induction by the chemopreventive synthetic antioxidants, butylatedhydroxyanisole and ethoxyquin. Biochem Soc Trans 28:3341

36. Chan K, Han XD, Kan YW (2001) An important function of Nrf2 in combating oxidative stress:detoxification of acetaminophen. Proc Natl Acad Sci USA 98:46114616

37. Kim YC, Masutani H, Yamaguchi Y, Itoh K, Yamamoto M, Yodoi J (2110) Hemin induced activation ofthe thioredoxin gene by Nrf2. A differential regulation of the antioxidant responsive element by a switchof its binding factors. J Biol Chem 276:1839918406

38. Kwak MK, Itoh K, Yamamoto M, Kensler TW (2002) Enhanced expression of the transcription factorNrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2promoter. Mol Cell Biol 22:28832892

39. Oliveira CP, Lopasso FP, Laurindo FR, Leitao RM, Laudanna A (2001) Protection against liverischemia-reperfusion injury in rats by silymarin or verapamil. Transplant Proc 33:30103014

40. Nourooz-Zadeh J, Tajaddini-Sarmadi J, Wolff SP (1994) Measurement of plasma hydroperoxideconcentrations by the ferrous oxidation-xylenol orange assay in conjunction with triphenylphosphine.Anal Biochem 220:403409

41. Buege JA, Aust SD (1978) Microsomal lipid peroxidation. Meth Enzymol 52:30231042. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative

PCR and the 2(-Delta Delta C(T)) Method. Methods 25:40240843. Ke LD, Chen Z (2000) A reliability test of standard-based quantitative PCR: exogenous vs endogenous

standards. Mol Cell Probes 14(2):12713544. Liu WH, David Saint A (2002) Validation of a quantitative method for real time PCR kinetics. Biochem

Biophys Res Commun 294:34735345. Wang JX, Zhou GQ, Chen CY, Yu HW, Wang TC, Ma YM, Jia G, Gao YX, Li B, Sun J, Li YF, Jia F,

Zhao YL, Chai ZF (2007) Acute toxicity and biodistribution of different sized titanium dioxide particlesin mice after oral administration. Toxicol Lett 168:176185

46. Chen JY, Dong X, Zhao J, Tang GP (2009) In vivo acute toxicity of titanium dioxide nanoparticles tomice after intraperitioneal injection. J Appl Toxicol 29:330337

47. Liu HT, Ma LL, Zhao JF, Liu J, Yan JY, Ruan J, Hong FS (2009) Biochemical toxicity of nano-anataseTiO2 particles in mice. Biol Trace Elem Res 129(1):170180

48. Long TC, Saleh N, Tilton RD, Lowry G, Veronesi B (2006) Titanium dioxide (P25) produces reactiveoxygen species in immortalized brain microglia (BV2): implications for nanoparticle neurotoxicity.Environ Sci Technol 40:43464352

196 Wang et al.

49. Long TC, Tajuba J, Sama P, Sale N, Swartz C, Parker J, Hester S, Lowry GV, Veronesi B (2007) Nano-TiO2 stimulates ROS in brain microglia and damages neurons in vitro. Environ Health Perspect115:16311637

50. Gao HW, Xu Q, Chen L, Wang SL, Wang Y, Wu LL, Yuan Y (2008) Potential protein toxicity ofsynthetic pigments, binding of poncean S to human serum albumin. Biophys J 94:906917

51. Xu Z, Liu XW, Ma YS, Gao HW (2010) Interactions of nano-TiO2 with lysozyme: insights into theenzyme toxicity of nanosized particles. Environ Sci Pollut Res 17:798806

52. Maines MD (1988) Hemeoxygenase: function, multiplicity, regulatory mechanisms, and clinicalapplications. FASEB J 2:25572568

53. Morse D, Choi AM (2002) Heme oxygenase-1: the emerging molecule has arrived. Am J Respir CellMol Biol 27:816

54. Otterbein LE, Soares MP, Yamashita K, Bach FH (2003) Heme oxygenase-1: unleashing the protectiveproperties of heme. Trends Immunol 24:449455

55. Chen CY, Jang JH, Li MH, Surh YJ (2005) Resveratrol upregulates heme oxygenase-1 expression viaactivation of NF-E2-related factor 2 in PC12 cells. Biochem Biophys Res Commun 331:9931000

56. Lee JS, Surh YJ (2005) Nrf2 as a novel molecular target for chemoprevention. Cancer Lett 224:17118457. Lim HJ, Lee KS, Lee S, Park JH, Choi HE, Go SH, Kwak HJ, Park HY (2007) 15d-PGJ2 stimulates HO-1

expression through p38 MAP kinase and Nrf-2 pathway in rat vascular smooth muscle cells. Toxicol ApplPharmacol 223:2027

P38-Nrf-2 Signaling Pathway of Oxidative Stress 197

P38-Nrf-2 Signaling Pathway of Oxidative Stress in Mice Caused by Nanoparticulate TiO2AbstractIntroductionMaterials and MethodsChemicals and PreparationAnimals and TreatmentHistopathological Examination of SpleenROS and Lipid Peroxidation AssayROS AssayLipid Peroxidation

Expression Assay of Oxidative Stress Genes and ProteinsStatistical Analysis

ResultHistopathological EvaluationROS Production and Lipid PeroxidationMAP Kinase Signal Transduction and Transcription Factors

DiscussionConclusionReferences

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 150 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 150 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 600 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles true /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PreserveEditing false /UntaggedCMYKHandling /UseDocumentProfile /UntaggedRGBHandling /UseDocumentProfile /UseDocumentBleed false >> ]>> setdistillerparams> setpagedevice