Pp

Sa

b

c

ARRAA

KMVENP

1

eeior(meacNBim2te

UT

(

0d

Journal of Virological Methods 162 (2009) 179–183

Contents lists available at ScienceDirect

Journal of Virological Methods

journa l homepage: www.e lsev ier .com/ locate / jv i romet

roduction of the matrix protein of Nipah virus in Escherichia coli: Virus-likearticles and possible application for diagnosis

enthil Kumar Subramaniana, Beng Ti Teyb,c, Muhajir Hamida, Wen Siang Tana,c,∗

Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, MalaysiaDepartment of Chemical and Environmental Engineering, Faculty of Engineering, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, MalaysiaInstitute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia

rticle history:eceived 10 June 2009eceived in revised form 28 July 2009ccepted 30 July 2009

a b s t r a c t

The broad species tropism of Nipah virus (NiV) coupled with its high pathogenicity demand a rapid searchfor a new biomarker candidate for diagnosis. The matrix (M) protein was expressed in Escherichia coli andpurified using a Ni-NTA affinity column chromatography and sucrose density gradient centrifugation. Therecombinant M protein with the molecular mass (Mr) of about 43 kDa was detected by anti-NiV serum and

vailable online 8 August 2009

eywords:atrix protein

irus-like particlesscherichia coli

anti-myc antibody. About 50% of the M protein was found to be soluble and localized in cytoplasm whenthe cells were grown at 30 ◦C. Electron microscopic analysis showed that the purified M protein assembledinto spherical particles of different sizes with diameters ranging from 20 to 50 nm. The purified M proteinshowed significant reactivity with the swine sera collected during the NiV outbreak, demonstrating itspotential as a diagnostic reagent.

© 2009 Elsevier B.V. All rights reserved.

ipah virusaramyxovirus

. Introduction

Nipah virus (NiV) is a zoonotic paramyxovirus that causes fatalncephalitic and respiratory illness in humans and livestock (Chuat al., 2000; Paton et al., 1999). The outbreak in Peninsular Malaysian 1998 claimed 105 human lives and resulted in massive cullingf about 1.1 million infected swine with encephalitis and respi-atory diseases (Chua et al., 2000; Paton et al., 1999). Fruit batsflying foxes) are believed to be the natural reservoir for NiV and

ay be introduced into pig farms through their secretions (Chuat al., 2002; Field et al., 2001). Other animals such as dogs, catsnd horses can also be infected by the virus when they come inlose contact with infected pigs (Chua et al., 1999, 2000, 2002).iV outbreaks have occurred in Malaysia, Singapore, India andangladesh following various chains of transmission including

ntermediate host species (Chua et al., 2000), vehicle borne trans-

ission (Luby et al., 2006), bat to human transmission (Hsu et al.,

004) and human-to-human transmission (ICDDRB, 2004). Iden-ification of the spillover into human population has now beenxtended to Indonesia, India and Bangladesh (Chua et al., 2000;

∗ Corresponding author at: Faculty of Biotechnology and Biomolecular Sciences,niversiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.el.: +60 3 89466715; fax: +60 3 89430913.

E-mail addresses: wstan@biotech.upm.edu.my, wensiangtan@yahoo.comW.S. Tan).

166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2009.07.034

Hsu et al., 2004; ICDDRB, 2004; Luby et al., 2006). It is prob-ably much more extensive due to undiagnosed cases in manycountries. The ability of NiV to infect a variety of species alongwith its mode of transmission coupled with its high pathogenic-ity demand a rapid search for possible tools for diagnosis of earlyinfection.

NiV has pleomorphic structure ranging from 50 nm to greaterthan 600 nm in diameter (Hyatt et al., 2001). The virus contains twoenvelope glycoproteins: the G protein is responsible for binding tothe cellular receptors, Ephrin B2 and B3 (Bonaparte et al., 2005;Negrete et al., 2005) and the F protein mediates membrane fusion(Bossart et al., 2002). Lying beneath the viral envelope is the matrix(M) protein, which interacts with both the glycoproteins and thenucleocapsid (N) or ribonucleoprotein (RNP) complex (Lamb andParks, 2007; Schmitt and Lamb, 2004).

The M protein is one of the abundant proteins in the virion andit is important in determining the virion architecture. The M geneis predicted to be 1359 nucleotides (nt) in length, with an ORF of1059 nt, encoding the M protein (352 amino acids) with a predictedmolecular mass (Mr) about 39.93 kDa. The first available AUG codonis predicted to have more probabilities to be the initiator rather thanthe other in-frame initiation codon at nucleotide 36 downstream of

the first codon. Its high hydrophobic nature coupled with high netpositive charge attribute to its property of association with mem-branes (Harcourt et al., 2000; Takimoto and Portner, 2004). The Mprotein is localized in the cytoplasm, predominantly at the plasmamembrane when it was expressed in mammalian cells (Ciancanelli

1 Virolo

apo(E

2

2

iIt

2

(masbauratbw

2

ccp(u5P(

2

tewU

2

wlUs1oabT2ca

ing step, the enzyme substrate solution containing p-nitrophenylphosphate (0.1%; Sigma) in diethanolamine (1 M; Sigma), pH 9.5,

80 S.K. Subramanian et al. / Journal of

nd Basler, 2006). However, there is no information available on theroduction of the M protein in bacteria. Therefore, the objectivesf the study were: (i) to express the M protein in Escherichia coli;ii) to purify and characterize the M protein and; (iii) to develop anLISA for detecting anti-M antibody in swine serum samples.

. Materials and methods

.1. Serum samples

Swine anti-NiV serum samples, with known serum neutral-zation titer (SNT), were obtained from the Veterinary Researchnstitute, Ipoh, Malaysia. The serum samples were collected duringhe 1998–1999 NiV outbreaks in Malaysia.

.2. Construction of recombinant plasmids

Total RNA was extracted from NiV infected cell culture medium250 �l) using the TRI-REAGENT (Sigma, Missouri, USA) as recom-

ended by the manufacturer. The extracted total RNA was useds a template for cDNA synthesis using the M-MLV Reverse Tran-criptase (Promega, Madison, USA). The NiV M gene was amplifiedy using primers NiV-M-6 FD (CCATGGCCATGGAGCCGGACATC)nd NiV-M-5 RV (GTAAGCTTCGCCCTTTAGAATTCTCCCTGT). Thenderlined nucleotides represent NcoI and HindIII restriction sites,espectively. The PCR products were digested with NcoI and HindIIInd subsequently cloned into the corresponding restriction sites ofhe pTrcHis2 vector (Invitrogen, Carlsbad, USA) to produce recom-inant plasmid, pTrcNiVM. The insert of the recombinant plasmidas confirmed to be in frame by DNA sequencing.

.3. Expression of the M protein in E. coli

Shake flask cultures (50 ml) of transformed E. coli BL21(DE3)ells were grown in Luria Bertani (LB) medium containing ampi-illin (50 �g/ml) at 25, 30 and 37 ◦C to an A600 of about 0.6–0.8 androtein expression was induced with IPTG (0.5 mM). The cultures1 ml) were centrifuged at 11,500 × g for 30 s and cells were lysedsing lysis buffer [50 mM Tris–HCl, pH7.4, 100 �g/ml lysozyme,mM EDTA, pH 8, 1 mM phenyl methane sulfonyl fluoride (PMSF)].rotein concentration was determined with the Bradford assayBradford, 1976).

.4. Localization and solubility analyses

Localization and solubility analyses of the recombinant M pro-ein produced in E. coli cells were carried out according to Coligant al. (2000). The percentage of soluble M protein was measuredith the Quantity One Quantitation Software (Bio-Rad, Hercules,SA) as described by Tan et al. (2004).

.5. SDS-PAGE and Western blotting

Proteins were separated by SDS-PAGE and were either stainedith Commassie Brilliant Blue or transferred onto nitrocellu-

ose membranes using a semidry transfer cell (Bio-Rad, Hercules,SA) for Western blotting. The membranes were blocked with 5%

kimmed milk in TBS (50 mM Tris–HCl, 150 mM NaCl; pH 7.5) forh at room temperature (RT). Swine anti-NiV sera (1:200 dilution)r anti-His monoclonal antibody (GE healthcare, Pittsburg, USA) ornti-myc monoclonal antibody (1:5000 dilution; Invitrogen, Carls-

ad, USA) was added to the membranes and shaken for overnight.he membranes were then washed with TBS-T (TBS + 0.01% Tween0). Secondary antibody either anti-swine or anti-mouse antibodyonjugated to alkaline phosphatase (1:5000 dilution; Kirkegardnd Perry Laboratories, Gaithersburg, USA) was then added and

gical Methods 162 (2009) 179–183

incubated for another 1 h. After washing, the colour developmentwas performed by adding 5-bromo-4-chloro-3′-indolyl phosphatep-toluidine salt (BCIP; Fermentas, Glen Burnie, USA) and nitro-blue tetrazolium chloride (NBT; Fermentas, Glen Burnie, USA)substrate.

2.6. Purification of NiV M protein and VLPs

Protein synthesis in E. coli was induced with IPTG (0.5 mM)for 2 h at 37 ◦C. The cells were centrifuged at 3440 × g for 10 minand the pellets were resuspended in lysis buffer (20 mM Na3PO4,150 mM NaCl; pH 7.5) containing lysozyme (100 �g/ml) and incu-bated on ice for 30 min. The cell suspension was then lysed bysonication after adding PMSF (1 mM) and DNase (7 �g/ml) andincubated on ice for 15 min. The lysate, obtained after centrifuga-tion at 39,200 × g for 30 min, was loaded onto a pre-equilibratedNi-NTA agarose (Amersham biosciences, Pittsburg, USA) columnand was incubated for 1 h at room temperature. The protein-boundresin was first washed with buffer A (20 mM Na3PO4, 150 mM NaCl;pH 7.5) followed by washing with buffer B (20 mM Na3PO4, 500 mMNaCl; pH 6). The bound recombinant M protein was eluted with elu-tion buffer (20 mM Na3PO4, 500 mM NaCl, 500 mM imidazole; pH7.4) and elute was analysed by SDS-PAGE and Western blotting.

The purified recombinant protein was dialyzed against dialy-sis buffer (50 mM Tris–HCl; pH 7.5, 150 mM NaCl). The dialyzedprotein was concentrated with a 30 kDa cut-off polyethersulfonemembrane (VIVASPIN6; Vivascience, Stonehouse, UK) at 4500 × g,4 ◦C. The concentrated protein was layered on a step sucrose gradi-ent 10, 20, 30, 40 and 60% (w/v) and centrifuged (rotor SW40Ti, at36,000 rpm) for 5 h at 4 ◦C. Fractions (0.5 ml) were collected andanalysed on SDS-PAGE. Positive fractions were then pooled anddialyzed against dialysis buffer.

2.7. Electron microscopy

The purified M protein (15 �l) was absorbed to carbon-coatedgrids (200 meshes) and stained with uranyl acetate (2%). The gridswere viewed under a TEM (HITACHI-T-700) and micrographs weretaken at appropriate magnifications (Tan et al., 2004).

2.8. ELISA

All washing steps were carried out five times with TBS-T buffer(TBS + 0.05% Tween 20). All antigens were diluted in TBS whereasantibodies were diluted in TBS-T buffer. U-shape polysterenemicrotiter plates were used as the solid-phase adsorbents. Sucrosegradient fractions (50 �l) or the purified recombinant M protein(100 ng/well; 100 �l) was added to the wells. After incubating for18 h at 4 ◦C, the plates were washed and then blocked with 10% BSA(200 �l) in TBS and incubated for 2 h at RT. Subsequently, the plateswere washed and incubated for 1 h at RT with either anti-myc mon-oclonal antibody (1:5000) or with the appropriate dilution (1:20)of the swine sera from infected and non-infected animals. Afterwashing with TBS-T, either anti-mouse antibody (1:5000 dilution)or anti-swine immunoglobin IgG (1:3000 dilution) conjugated toalkaline phosphatase (KPL, Gaithersburg, USA) was added and theplates were incubated further for 1 h at RT. Following another wash-

was added. The reaction was stopped after 30 min incubation at RT,and the A405 values were measured with a microtiter plate reader(Bio-Tek, ELX 800, Winooski, USA). The significance of the readingsbetween positive and negative sera was calculated using the T-Teststatistical analysis.

Virological Methods 162 (2009) 179–183 181

3

3

fwHNpwbw2t

F(appwc

Fig. 2. A Western blot of the localization study of the M protein expressed in E. coliBL21 (DE3) cells. Protein samples were separated on a 12% polyacrylamide gel, elec-

S.K. Subramanian et al. / Journal of

. Results

.1. Expression and purification of the M protein

Expression of the M protein was achieved in E. coli cells trans-ormed with the recombinant plasmid pTrcNiVM. The M proteinas expressed as a fusion protein harbouring both the myc andis-tag at its C-terminus. The calculated Mr of the full lengthiV M protein including the tags is about 43 kDa. The expectedrotein band of 43 kDa could not be detected in the cell lysate

hen analysed with a polyacrylamide gel stained with coomassie

lue (Fig. 1A, lane 1), but the band was observed after purifyingith Ni-NTA column and sucrose density gradient (Fig. 1A, lanesand 3). A contaminating band of about 60 kDa was observed

o be co-purified with the M protein (Fig. 1A), but it was not

ig. 1. Expression and purification of the NiV M protein expressed in E. coli BL21DE3) cells. SDS-PAGE and coomassie blue staining (A), Western blot analysis [withnti-myc monoclonal antibody (B) and with swine anti-NiV serum (C)] of the Mrotein. Lane M, molecular weight markers in kDa; lane 1, E. coli cells harbouringTrcNiVM plasmid (IPTG induced bacterial cell lysate); lane 2, the M protein purifiedith Ni-NTA column; lane 3, the M protein purified with sucrose density gradient

entrifugation. Arrows indicate the position of the expected protein bands.

trotransferred to a nitrocellulose membrane and probed with the anti-His antibody.T: total cell lysate, P: periplasmic fractions; and C: cytoplasmic fractions. The growthtemperatures are indicated on top of the lanes.

detected by the anti-myc antibody and swine anti-NiV serum inthe Western blots (Fig. 1B and C). The unpurified and purifiedM protein with the Mr of about 43 kDa was detected by boththe anti-myc antibody and swine anti-NiV serum (Fig. 1B andC).

3.2. Solubility and localization of the M protein in E. coli

To study the distribution and extent of solubility of the M pro-tein produced in E. coli, protein expression was induced at varioustemperatures. An immunoblot of the localization study is shownin Fig. 2. The presence of the M protein in cellular fraction andits complete absence in periplasm suggest that irrespective of thedifference in the culture growth temperature, the M protein waslocalized in cytoplasm and did not appear in periplasmic space.The solubility of the M protein produced in E. coli was found to be48.8 ± 2.2% and 39.6 ± 3.8% at 30 and 37 ◦C, respectively.

3.3. The M protein assembles into VLPs

To determine whether the NiV M protein expressed in E. colican form particles, the Ni-NTA column purified M protein was sep-arated on sucrose density gradient centrifugation. The fractionscollected were analysed by Western blotting and ELISA (Fig. 3).Analysis of the fractions revealed that the M protein migrated intothe gradient forming a bell shape peak from fractions 2 to 10.

Electron microscopic examination of the fractionated M proteinshowed that it assembled into spherical particles with sizes rang-ing from 20 to 50 nm in diameter (Fig. 4). These results demonstratethat the M protein produced in E. coli assembles into VLPs.

Fig. 3. Separation of the M protein with sucrose density gradient centrifugation.The M protein purified with the Ni-NTA affinity column was separated on a sucrosegradient. Western blot (A) and ELISA (B) results of the gradient fractions detectedwith anti-myc antibody (1:5000). For ELISA, 50 �l of each fraction was used to coatthe wells. Fractions correspond to the theoretical percentage of sucrose are indicatedon top of the bars.

182 S.K. Subramanian et al. / Journal of Virolo

Ft

3

aptdrla

4

bYcaf

FsTfi

ig. 4. Transmission electron micrograph showing the formation of spherical struc-ures in the purified NiV M protein. Bar represents 200 nm.

.4. ELISA

To evaluate the antigenicity of the M protein and its possiblepplication as a diagnostic antigen, a total of 18 predefined sera (15ositives and 3 negatives) were analysed using the purified M pro-ein for the detection of anti-M antibody in the swine sera obtaineduring the outbreak. All the positive serum samples showed highereadings when compared to the negative samples with the P valueess than 0.05 (Fig. 5), demonstrating the potential of the M proteins a diagnostic reagent.

. Discussion

The M proteins of paramyxoviruses are moderately hydropho-ic and contain many basic residues (Takimoto and Portner, 2004;

usoff and Tan, 2001). Many studies have shown that these proteinsan be produced in animal cell lines, but there is little informationvailable on their expression in bacteria. Like other members in theamily of Paramyxoviridae, the M protein of NiV is non-glycosylated,

ig. 5. Immunoreactivity of a panel of 18 sera against NiV M protein purified withucrose density gradient centrifugation. 1–3: negative sera and 4–18: positive sera.he error bars represent standard deviations from the means. The assay was per-ormed in triplicates. The P value of the readings between positive and negative seras less than 0.05.

gical Methods 162 (2009) 179–183

therefore bacteria would provide an alternative means for the pro-duction of this protein. In this study, the NiV M gene was amplifiedsuccessfully from the viral RNA and cloned into pTrcHis2 vector. Therecombinant M protein was expressed in E. coli and purified usinga His-tag based affinity chromatography. The Mr of the expressedM protein was as predicted demonstrating that the full length Mprotein can be expressed in E. coli. The purified M protein showedreactivity towards the swine anti-NiV positive serum in Westernblotting revealing its antigenic nature.

The M protein produced in E. coli is mainly found in insolubleform. The solubility of the M protein increased from 39% to about50% by lowering the growth temperature. This could be due to thefact that when the protein synthesis rate is reduced at a lower tem-perature, it can be folded efficiently as the protein folding rate of asoluble protein is a slow process (Chalmers et al., 1990; Slabaughet al., 1993; Thomas and Baneyx, 1996).

A nickel affinity chromatography was employed to purify theM protein from the cell lysate. The binding and washing of lysatewas done without imidazole as it was found that the presence of10–20 mM imidazole reduced dramatically the binding of the targetprotein (data not shown). Hence, large volume of wash buffer with-out imidazole was used to improve the purity of the target protein.However, the elute still contained some host proteins (Fig. 1A, lane2). The M proteins of paramyxoviruses are rich in basic residuesand have tendency to bind to membrane (Bellini et al., 1998; Lamband Kolakofsky, 1996; Sanderson et al., 1994; Stricker et al., 1994;Takimoto and Portner, 2004; Yu et al., 1992). When the proteinwas purified further using sucrose density gradient centrifuga-tion, a band of approximately 60 kDa comigrated along with theM protein (Fig. 1A, lane 3). However, it did not react with the anti-myc monoclonal antibody and swine anti-NiV serum (Fig. 1B andC).

The M protein purified by a nickel affinity chromatography gaverise to spherical VLPs with diameters ranging from 20 to 50 nm asdetermined by electron microscopy. The size of the VLPs producedin E. coli is smaller than those produced from cell culture system(100–700 nm) (Ciancanelli and Basler, 2006; Patch et al., 2007) andauthentic NiV virion (40–1900 nm) (Hyatt et al., 2001). It is unclearat this stage whether the NiV M protein had assembled to formspherical particles inside the bacteria or during the preparation andpurification of the protein. Theoretically, ultra thin sectioning of E.coli cells expressing the M protein followed by immunolabelling-electron microscopic analysis may provide a clearer picture of thisprocess. To the best of our knowledge, this study is the first todemonstrate that a paramyxovirus M protein can be expressed inE. coli and the purified M protein can assemble into VLPs.

The potential diagnostic application of the sucrose gradientpurified M protein has been explored and it is clear that the antigenfacilitates the detection of anti-M antibodies in swine infected nat-urally with NiV. However, further studies are needed to assess theuse of the M protein based ELISA in routine diagnosis, since properstandardization of the ELISA requires sera from experimentallyinfected animals followed by testing a more significant number offield serum samples. Nevertheless, based on this study, it shouldbe possible to develop an immunoassay for detecting NiV anti-Mantibody.

In conclusion, this is the first report to demonstrate that the NiVM protein can be expressed as a full length soluble protein in E. coliand the purified M protein can assemble into spherical VLPs. Thepurified M protein is antigenic and it is a potential candidate forserodiagnosis.

Acknowledgements

We thank the Veterinary Research Institute (Ipoh, Malaysia) forproviding the swine anti-NiV sera. The technical assistance from

Virolo

Lt

R

B

B

B

B

C

C

C

C

C

C

F

H

H

S.K. Subramanian et al. / Journal of

ip Nam Loh is greatly appreciated. This study was supported byhe Ministry of Science, Technology and Innovation, Malaysia.

eferences

ellini, W.J., Rota, P.A., Anderson, L.J., 1998. Paramyxoviruses. In: Collier, L., Balows,A., Sussman, M. (Eds.), Microbiology and Microbial Infections, vol. 1. Arnold,London, pp. 435–461.

onaparte, M.J., Dimitrov, A.S., Bossart, K.N., Crameri, G., Mungall, B.A., Bishop, K.A.,Choudhry, V., Dimitrov, D.S., Wang, L.F., Eaton, B.T., Broder, C.C., 2005. Ephrin-B2ligand is a functional receptor for Hendra virus and Nipah virus. Proc. Natl. Acad.Sci. U.S.A. 102, 10652–10657.

ossart, K.N., Wang, L.F., Flora, M.N., Chua, K.B., Lam, S.K., Eaton, B.T., Broder,C.C., 2002. Membrane fusion tropism and heterotypic functional activities ofthe Nipah virus and Hendra virus envelope glycoproteins. J. Virol. 76, 11186–11198.

radford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein–dye binding. Anal.Biochem. 72, 248–254.

halmers, J.J., Kim, E., Telford, J.N., Wong, E.Y., Tacon, W.C., Shuler, M.L., Wilson,D.B., 1990. Effects of temperature on Escherichia coli overproducing �-lactamase or human epidermal growth factor. Appl. Environ. Microbiol. 56, 104–111.

hua, K.B., Goh, K.J., Wong, K.T., Kamarulzaman, A., Tan, P.S., Ksiazek, T.G., Zaki, S.R.,Paul, G., Lam, S.K., Tan, C.T., 1999. Fatal encephalitis due to Nipah virus amongpig-farmers in Malaysia. Lancet 354, 1257–1259.

hua, K.B., Bellini, W.J., Rota, P.A., Harcourt, B.A., Tamin, A., Lam, S.K., Ksiazek, T.G.,Rollin, P.E., Zaki, S.R., Shieh, W.J., Goldsmith, C.S., Gubler, D.J., Roehrig, J.T., Eaton,B., Gould, A.R., Olson, J., Field, H., Daniels, P., Ling, A.E., Peters, C.J., Anderson,L.J., Mahy, W.J., 2000. Nipah virus: a recently emergent deadly paramyxovirus.Science 288, 1432–1435.

hua, K.B., Koh, C.L., Hooi, P.S., Wee, K.F., Khong, J.H., Chua, B.H., Chan, T.P., Lim,M.E., Lam, S.K., 2002. Isolation of Nipah virus from Malaysian island flying-foxes.Microbes Infect. 4, 145–151.

iancanelli, M.J., Basler, C.F., 2006. Mutation of YMYL in the Nipah virus matrixprotein abrogates budding and alters subcellular localization. J. Virol. 80,12070–12078.

oligan, J.E., Dunn, B.M., Plooegh, H.L., Speicheir, D.W., Wingfield, P.T., 2000. Cur-rent Protocols in Protein Science. John Wiley & Sons, Inc., New York, pp. 5.2.10–5.2.11.

ield, H.E., Young, P., Yob, J.M., Mills, J., Hall, L., Mackenzie, J., 2001. The naturalhistory of Hendra and Nipah viruses. Microbes Infect. 3, 307–314.

arcourt, B.H., Tamin, A., Ksiazek, T.G., Rollin, P.E., Anderson, L.J., Bellini, W.J.,Rota, P.A., 2000. Molecular characterization of Nipah virus, a newly emergentparamyxovirus. Virology 271, 334–349.

su, V.P., Hossain, M.J., Parashar, U.D., Ali, M.M., Ksiazek, T.G., Kuzmin, I., Niez-goda, M., Rupprecht, C., Bresee, J., Breiman, R.F., 2004. Nipah virus encephalitisreemergence, Bangladesh. Emerg. Infect. Dis. 10, 2082–2087.

gical Methods 162 (2009) 179–183 183

Hyatt, A.D., Zaki, S.R., Goldsmith, C.S., Wise, T.G., Hengstberger, S.G., 2001. Ultrastructure of Hendra virus and Nipah virus within cultured cells and host animals.Microbes Infect. 3, 297–306.

ICDDRB, 2004. Nipah encephalitis outbreak over wide area of Western Bangladesh.Health Sci. Bull. 2, 7–11.

Lamb, R.A., Kolakofsky, D., 1996. Paramyxoviridae: the viruses and their replication.In: Fields, B.N., Knipe, D.M., Howley, P.M., Chanock, R.M., Melnick, J.L., Monath,T.P., Roizman, B., Straus, S.E. (Eds.), Fields Virology, third ed. Lippincott-Raven,Philadelphia, pp. 1177–1204.

Lamb, R.A., Parks, G.D., 2007. Paramyxoviridae: the viruses and their replication. In:Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B.,Straus, S.E. (Eds.), Fields virology. Lippincott Williams & Wilkins, Philadelphia,pp. 1449–1496.

Luby, S.P., Rahman, M., Hossain, M.J., Blum, L.S., Husain, M.M., Gurley, E., Khan,R., Ahmed, B.N., Rahman, S., Nahar, N., Kenah, E., Comer, J.A., Ksiazek, T.G.,2006. Foodborne transmission of Nipah virus. Bangladesh. Emerg. Infect. Dis.12, 1888–1894.

Negrete, O.A., Levroney, E.L., Aguilar, H.C., Bertolotti-Ciarlet, A., Nazarian, R., Tajyar,S., Lee, B., 2005. Ephrin B2 is the entry receptor for Nipah virus, an emergentdeadly paramyxovirus. Nature 436, 401–405.

Patch, J.R., Crameri, G., Wang, L.F., Eaton, B.T., Broder, C.C., 2007. Quantitative analysisof Nipah virus proteins released as virus-like particles reveals central role for thematrix protein. Virol. J. 4, 1.

Paton, N.I., Leo, Y.S., Zaki, S.R., Auchus, A.P., Lee, K.E., Ling, A.E., Chew, S.K., Ang, B.,Rollin, P.E., Umapathi, T.S., Sng, I., Lee, C.C., Lim, E., Ksiazek, T.G., 1999. Out-break of Nipah virus infection among abattoir workers in Singapore. Lancet 354,1253–1257.

Sanderson, C.M., Wu, H.H., Nayak, D.P., 1994. Sendai virus M protein binds indepen-dently to either the F or the HN glycoprotein in vivo. J. Virol. 68, 69–76.

Schmitt, A.P., Lamb, R.A., 2004. Escaping from the cell: assembly and budding ofnegative-strand RNA viruses. Curr. Top. Microbiol. Immunol. 283, 145–196.

Slabaugh, M.B., Davis, R.E., Roseman, N.A., Mathews, C.K., 1993. Vaccinia virusribonucleotide reductase expression and isolation of the recombinant large sub-unit. J. Biol. Chem. 268, 17803–17810.

Stricker, R., Mottet, G., Roux, L., 1994. The Sendai virus matrix protein appears to berecruited in the cytoplasm by the viral nucleocapsid to function in viral assemblyand budding. J. Gen. Virol. 75, 1031–1042.

Takimoto, T., Portner, A., 2004. Molecular mechanism of paramyxovirus budding.Virus Res. 106, 133–145.

Tan, W.S., Ong, S.T., Eshagi, M., Foo, S.S., Yusoff, K., 2004. Solubility, immunogenicityand physical properties of the nucleocapsid protein of Nipah virus produced inEscherichia coli. J. Med. Virol. 73, 105–112.

Thomas, J.G., Baneyx, F., 1996. Protein misfolding and inclusion body formation in

recombinant Escherichia coli. J. Biol. Chem. 271, 11141–11147.

Yu, Q., Davis, P.J., Li, J., Cavanagh, D., 1992. Cloning and sequencing of the matrixprotein (M) gene of turkey rhinotracheitis virus reveal a gene order differentfrom that of Respiratory Syncytial Virus. Virology 186, 426–434.

Yusoff, K., Tan, W.S., 2001. Newcastle disease virus: macromolecules and opportu-nities. Avian Pathology 30, 439–455.