1

Pathogen prevalence in ticks collected from the vegetation and 1

livestock in Nigeria 2

3

Running title: Tick-borne pathogens in Nigeria 4

5

Anna L. Reye1+, Olatunbosun G. Arinola2+, Judith M. Hübschen1 and Claude P. Muller1* 6

7

1) Institute of Immunology, Centre de Recherche Public de la Santé / National Public Health 8

Laboratory, Luxembourg, Luxembourg 9

2) Department of Chemical Pathology and Immunology, College of Medicine, University of 10

Ibadan, Ibadan, Nigeria 11

12

+ Both authors contributed equally to this work 13

14

* Corresponding Author: 15

Prof. Dr. Claude P Muller 16

Institute of Immunology, Centre de Recherche Public de la Santé / National Public 17

Health Laboratory 18

20A, rue Auguste-Lumière 19

L-1950 Luxembourg, Luxembourg 20

Tel: +352 490604 220, Fax: +352 490686 21

Email: Claude.Muller@LNS.ETAT.LU 22

23

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.06686-11 AEM Accepts, published online ahead of print on 10 February 2012

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

2

Abstract 24

Ticks are important disease vectors that can cause considerable economic losses by affecting 25

animal health and productivity, especially in tropical and subtropical regions. In this study, we 26

investigated the prevalence and diversity of bacterial and protozoal tick-borne pathogens in 27

ticks collected from the vegetation and cattle in Nigeria by PCR. The infection rates of 28

questing ticks were 3.1% for Rickettsia species, 0.1% for Coxiella burnetii and 0.4% for 29

Borrelia species. Other pathogens like Babesia, Theileria, Anaplasma and Ehrlichia species 30

were not detected in ticks from the vegetation. Feeding ticks collected from cattle displayed 31

infection rates of 12.5% for Rickettsia species, 14% for Coxiella burnetii, 5.9% for 32

Anaplasma species, 5.1% for Ehrlichia species and 2.9% for Theileria mutans. Babesia and 33

Borrelia species were not detected in ticks collected from cattle. Mixed infections were found 34

only in feeding ticks and mainly Rickettsia species and Coxiella burnetii were involved. 35

The diversity of tick-borne pathogens in Nigeria was higher in feeding than in questing ticks, 36

suggesting that cattle serve as reservoirs for at least some of the studied pathogens, in 37

particular C. burnetii. The total estimated infection rates of herds of 20.6% for a Rickettsia 38

africae-like species, 27% for Coxiella burnetii and 8.5% for Anaplasma marginale/centrale 39

suggest that these pathogens may have considerable implications for human and animal 40

health. 41

42

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

3

Introduction 43

Ticks are important disease vectors that can cause considerable economic losses by affecting 44

animal health and productivity, especially in tropical and subtropical regions (28, 32, 37). In 45

Africa, the tick fauna is remarkably diverse with about fifty endemic tick species that are 46

known to infest domestic animals (38). However, the highest impact on livestock health is 47

caused by species belonging to only three genera, namely Amblyomma, Hyalomma and 48

Rhipicephalus (28). Damage is either direct (skin lesions, impairment of animal growth) or 49

indirect by transmission of a variety of pathogens (32). Major economical impact has been 50

associated with the four tick-borne diseases anaplasmosis, heartwater, babesiosis and 51

theileriosis, all of which are prevalent in Africa (4). 52

Bovine anaplasmosis is caused by the highly pathogenic species Anaplasma marginale sensu 53

stricto and the naturally attenuated A. marginale subspecies centrale (2, 7). Anaplasma 54

species are commonly detected in cattle and seroprevalence rates between 4.6% (Kenya) to 55

98% (South Africa) from different sub-Saharan countries are reported (4, 18, 26, 31). The 56

causative agents of bovine babesiosis and theileriosis have been frequently detected in blood 57

smears of cattle in Ghana, with prevalences as high as 97% for Theileria mutans, 87% for 58

Theileria velifera and 61% for Babesia bigemina (4). Tick-borne human ehrlichiosis of 59

varying severity are caused by Ehrlichia chaffeensis and E. ewingii (24). Several human 60

pathogenic tick-borne Rickettsia species have been found in Africa including Rickettsia 61

conorii conorii, R. conorii caspia, R. africae, R. aeschlimannii, R. massiliae, R. akari and R. 62

sibirica mongolotimonae (8, 19, 27). Humans are frequently infected with Rickettsia species 63

in Senegal, Burkina Faso, Cameroon, Mali and the Ivory Coast, where seroprevalence rates 64

from 17-36% have been reported (16). Coxiella burnetii causes Q fever in humans and high 65

serological prevalences have been reported from West African countries (17). Although 66

transmission mainly occurs via contact with infected reservoir hosts (domestic goats, sheep 67

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

4

and cows), C. burnetii can also be transmitted by ticks. The most important borrelial infection 68

of humans in Africa is relapsing fever transmitted either by lice (louse-borne relapsing fever) 69

or soft ticks (tick-borne relapsing fever, TBRF). TBRF is caused by at least 16 Borrelia 70

species, of which Borrelia crocidura seems to be of increasing importance in West Africa 71

(36). In Ghana, 15% of blood smears from cattle were positive for Borrelia species (4). 72

Pathogens belonging to the genera of Anaplasma, Ehrlichia, Coxiella, Rickettsia, Babesia, 73

Theileria and Borrelia have been reported in ticks from some West African countries. In 74

Mali, Niger, Mauretania and Cameroon, feeding ticks from cattle were analysed for Rickettsia 75

species and prevalence rates ranging from 7.4 to 75% were observed (21, 27). In Cameroon, 76

the prevalence of Ehrlichia species in ticks removed from dogs was found to be 56% for E. 77

chaffeensis, and 6% for E. canis (24). However, it is important that these studies on feeding 78

ticks are complemented by pathogen prevalence studies in unfed (questing) ticks collected 79

from the vegetation to estimate the risk of infection after tick bites during the next blood 80

meal. So far, throughout West Africa only a single study investigated questing Amblyomma 81

variegatum ticks from Burkina Faso for Ehrlichia ruminantium and reported a prevalence rate 82

of 3.7% (1). 83

Thus, studies on tick-borne pathogens in ticks are fairly limited in West Africa. Here we 84

present the first comprehensive study on the diversity of bacterial and protozoal tick-borne 85

pathogens in questing and feeding ticks from Nigeria. 86

87

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

5

Materials and Methods 88

In 2009, questing and feeding ticks were collected in Oyo State, Southwestern Nigeria. The 89

field collection sites were located within a 65 km radius of Ibadan, while the collection sites 90

of feeding ticks were located within a 20 km radius. Questing ticks were collected from the 91

vegetation at seven locations (Elepo, Alowo-nle, Fuleni, Orisunbare, Lanlate, Maya, Igbo-92

Ora) by cloth dragging and by direct hand-picking from their questing location. Collection 93

sites included rain forest, derived savannah, shrubs and herbaceous (mainly graminoid) plant 94

cover and displayed no notable topographical or climatic differences. Feeding ticks were 95

obtained from 11 herds comprising of 1 to 13 cattle at four locations (Moniya, Alakia, Bodija, 96

Mokola). Collection was performed throughout the year, but intensified in the wet season for 97

questing ticks, especially in June and July (67.6%; 473/700). The collection of feeding ticks 98

was most intense from January to March (80.9%; 110/136). 99

Ticks were stored in 70% ethanol at 4°C until further processing. For molecular analysis, 700 100

ticks from the vegetation (100 ticks per region) and 136 ticks from 62 cows were randomly 101

selected and morphologically identified to the species level (38). The ticks were washed three 102

times in phosphate buffered saline, rinsed with distilled water and dried on sterile filter paper 103

before disruption and homogenization. Ticks were crushed individually in 300μl lysis buffer 104

from the InviMag Tissue DNA Mini kit (Invitek, Berlin, Germany) using the TissueLyser II 105

(Qiagen, Venlo, Netherlands) and DNA extraction was performed with the KingFisher 96 106

Magnetic Particle Processor (Thermo Scientific, Waltham, Massachusetts, USA) following 107

the manufacturers’ instructions. 108

Detection PCRs were carried out using family-specific primers for members of the 109

Rickettsiaceae and Piroplasmidae and species-specific primers for Coxiella burnetii as 110

described before (references given in Table 1). The primers for the detection of 111

Anaplasmataceae were modified to be genus specific for Anaplasma and Ehrlichia. The 112

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

6

Borrelia spp. primers were adapted to allow amplification of Relapsing Fever Group and 113

Lyme Disease Spirochetes (Table 1). Primers directed against the flagellar B gene of Borrelia 114

burgdorferi sensu lato group were used for further characterization of detected Borrelia 115

species (Table 1). The resulting PCR amplicons of the right fragment size were either directly 116

purified (Jet Quick PCR Purification Spin kit, Genomed, Loehne, Germany) or excised from a 117

1.5% agarose gel (QIAquick Gel Extraction Kit, Qiagen, Venlo, NL). Sequencing was 118

performed as described before (30). Neighbour-joining phylogenetic analyses using the 119

Kimura 2-parameter model with 1,000 bootstrap replicates and pairwise deletion were 120

performed using MEGA v.4.0.2 software (13). Statistical analyses of differences in the 121

prevalence rates between feeding and questing ticks were performed with Fisher’s exact test 122

(in case of sampling number < 5) or Pearson's goodness of fit Chi-square (GFX) test (P values 123

are given in Table 3 and 4). 124

Sequences are available at NCBI under accession numbers JN871727 - JN871848 for 125

Rickettsia species, JN871849 - JN871863 for Coxiella burnetii, JN871864 - JN871869 for 126

Anaplasma species, JN871870 - JN871872 for Borrelia species, JN871873 - JN871879 for 127

Ehrlichia species and JN871880 - JN871883 for Theileria mutans. 128

Results 129

The 836 analysed ticks were comprised of four species. The predominant species on cattle 130

were Rhipicephalus (Boophilus) annulatus (37.5%, n = 51) and Amblyomma variegatum 131

(33.8%, n = 46), followed by Hyalomma impeltatum (14.7%, n = 20) and Rhipicephalus 132

evertsi (14%, n = 19). From the vegetation, only Rh. evertsi (n = 700) was collected. Mainly 133

adult ticks were collected from both environmental sources (males: 45.1%, females: 53.5%, 134

nymphs: 1.4%). 135

Anaplasmataceae. Members of the Anaplasmataceae were detected in 11% (15/136) of ticks 136

removed from cattle, with Anaplasma marginale subspecies being the most prevalent (53.3%; 137

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

7

8/15). Both Ehrlichia ewingii and Ehrlichia chaffeensis were detected in a single tick only 138

(Figure 1A). In five ticks, not clearly identifiable Ehrlichia species with 99% sequence 139

homology to Ehrlichia ewingii (3/5) or Ehrlichia ruminantium (2/5) were found. All four tick 140

species were found to harbour Anaplasmataceae (Rh. [Bo.] annulatus: A. marginale ssp. 141

[n = 7] and E. ewingii [n = 1]; Hy. impeltatum: A. marginale ssp. [n = 1], E. chaffeensis 142

[n = 1] and Ehrlichia sp. [n = 1], Am. variegatum: Ehrlichia sp. [n = 1] and Rh. evertsi: 143

Ehrlichia sp. [n = 3]). In total, 45.5% (5/11) of cattle herds were infected with A. marginale 144

subspecies, 45.5% (5/11) with Ehrlichia sp., 9.1% (1/11) with E. chaffeensis and 9.1% (1/11) 145

with E. ewingii (see also Table 2). In most cases, only one tick from one cow per herd was 146

infected, except for A. marginale subspecies. 147

Ticks from the vegetation were not found to be infected with Anaplasmataceae bacteria. 148

However, two sequences with highest nucleotide similarity of 99% to an uncultured alpha 149

proteobacterium (GenBank accession number AY254690) were recovered from two questing 150

Rh. evertsi ticks collected in Lanlate (Figure 1A, Table 3). 151

Rickettsiaceae. Rickettsia species were detected in 12.5% (17/136) of ticks from cattle and in 152

3.1% (22/700) of ticks from the vegetation. In feeding ticks, a Rickettsia africae-like species 153

(RAL) was predominant (82.4%; 14/17), all sequences of which showed a nucleotide 154

homology of 99 to 100% to Rickettsia africae. Rickettsia aeschlimannii was the second 155

predominant Rickettsia species (17.6%; 3/17). In at least one tick of each species, members of 156

the Rickettsiaceae were detected: Am. variegatum (RAL, n = 10; R. aeschlimannii, n = 1), Rh. 157

(Bo.) annulatus (RAL, n = 1; R. aeschlimannii, n = 1), Rh. evertsi (RAL, n = 1; R. 158

aeschlimannii, n = 1) and Hy. impeltatum (RAL, n = 2). In 63.6% (7/11) of herds, RAL was 159

detected in ticks. In most cases, more than one tick from more than one cattle per herd was 160

positive and the estimated infection rate of cattle in positive herds ranged from 15.4 to 50% 161

(Table 2). R. aeschlimannii was detected in 27.3% (3/11) of herds. Two nymphal 162

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

8

Am. variegatum ticks were infected with Rickettsia species, namely RAL (8.3%; 1/12) and 163

R. aeschlimannii (8.3%; 1/12). 164

The predominant species Rickettsia massiliae was detected in 3% (21/700) of questing 165

Rh. evertsi ticks from all locations (Table 3). In 0.1% (1/700) of ticks, a Rickettsia species 166

belonging to the Rickettsia rickettsii group was detected (Figure 1B, Table 3). 167

Piroplasmidae. Theileria mutans was the only species of Piroplasmidae detected in ticks 168

from Nigeria (Figure 1C). It was exclusively detected in feeding ticks and its prevalence 169

ranged from 0.7% (1/136) in Hy. impeltatum to 2.2% (3/136) in Rh. (Bo.) annulatus. The 170

infected ticks originated from three cattle of the same herd in Moniya (Table 2). 171

Coxiella burnetii. In 14% (19/136) of feeding ticks, Coxiella burnetii was detected (Figure 172

1D). Again, at least one tick of each species was found to harbour C. burnetii (Am. 173

variegatum, n = 9; Rh. (Bo.) annulatus, n = 5; Hy. impeltatum, n = 2; Rh. evertsi, n = 3). In 174

total, 63.6% (7/11) of herds were infested with ticks positive for Coxiella and in most cases 175

more than on cattle per herd was involved (Table 2). Three Am. variegatum nymphs from 176

different cattle of the same herd in Moniya and one from Bodija were found to harbour 177

C. burnetii (33.3%, 4/12). The only C. burnetii infected questing tick (0.1%; 1/700) was 178

collected in Orisunbare (Table 3). 179

Borrelia species. Borrelia species were only found in questing Rh. evertsi ticks (0.4%; 3/700) 180

collected in Maya (Table 3). Borrelia species identification was not possible with the 181

sequence obtained from the 16S rRNA gene, which showed a nucleotide homology of 99% to 182

members of the Borrelia burgdorferi sensu lato complex (Figure 1E). Further characterization 183

of the Borrelia species using primers directed against the flagellar gene was also 184

unsuccessful. In addition, 16S rRNA sequences from unknown organisms were detected in 185

nine DNA extracts from questing Rh. evertsi. Three of these sequences had highest nucleotide 186

similarity of 94 to 97% to the soil bacterium Conexibacter woesei; the remaining six 187

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

9

sequences formed a separate cluster with 83 to 85% nucleotide homology to C. woesei 188

(Figure 1F). 189

Mixed Infections. All mixed infections (1.3%; 11/836) were detected in feeding ticks and 190

were predominantly formed by RAL and C. burnetii (36.4%; 4/11) as well as T. mutans and 191

A. marginale ssp. (18.2%; 2/11; see also Table 4). Pathogen combinations found only once 192

were E. chaffeensis and C. burnetii, Ehrlichia sp. and C. burnetii, as well as Ehrlichia sp. and 193

RAL. Two triple infections formed by C. burnetii, T. mutans and A. marginale ssp. as well as 194

C. burnetii, RAL and Ehrlichia sp. were found. Tick species, in which multiple infections 195

were detected, included Am. variegatum (n = 5), Hy. impeltatum (n = 3), Rh. (Bo.) annulatus 196

(n = 2) and Rh. evertsi (n = 1). Mixed infections mainly occurred in adult ticks (90.9%), but 197

one nymphal Am. variegatum was found to be coinfected with RAL and C. burnetii. 198

Discussion 199

The tick species found in this study are known to commonly infest livestock in West African 200

countries (38). The exclusive finding of Rh. evertsi from the vegetation can be explained by 201

differences in life cycles and host-seeking behaviour of the identified tick species. Rh. evertsi 202

has a two-host life cycle, in which larval and adult instars display questing behaviour (38). 203

Am. variegatum and Hy. impeltatum have a three-host cycle, in which all instars feed on 204

different vertebrate hosts. Larval ticks of both species display questing behaviour, whereas the 205

adults are active hunters (38). Rh. (Bo.) annulatus is a one-host tick species and only larval 206

instars quest on the vegetation. Since the collection of questing larval ticks by cloth dragging 207

can be difficult, it is likely that even though other tick species than Rh. evertsi may have been 208

present at the field collection sites, they have been neglected due to limitations of the 209

collection methods. 210

This is the first comprehensive study on the diversity of bacterial and protozoal tick-borne 211

pathogens in both questing and feeding ticks not only in Nigeria, but sub-Saharan Africa. All 212

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

10

of the investigated pathogens are widespread throughout Africa and represent a threat to both 213

human and animal health (4, 19-25, 27). As expected, the infection rate for most of the 214

pathogens was significantly higher in feeding than in questing ticks (Table 2), suggesting that 215

a number of these pathogens originated from the cattle blood ingested before tick collection 216

rather than from transstadially maintained infections acquired during earlier blood meals. 217

Therefore, the detection of pathogens in feeding ticks cannot establish vector competence 218

whereas infected unfed ticks have at least maintained the pathogen transstadially. Although 219

the latter are more likely to serve as potential vectors of live pathogens, in vitro experiments 220

are required to confirm this. The fact that tick species diversity was much higher in feeding 221

ticks may contribute significantly to the low prevalence rate of pathogens observed in 222

questing ticks. It may well be that Rh. evertsi is a less suitable vector of pathogens than other 223

tick species, although vector competence has been reported for Babesia, Theileria and 224

Anaplasma species (38). 225

The only study on the prevalence of C. burnetii in ticks from Africa was conducted in 226

Senegal, where 0.7 to 6.8% of feeding ticks from cattle were found to be infected (17). This 227

rate is considerably lower than the 14% of feeding ticks that we found to be infected. 228

Interestingly, C. burnetii was frequently detected in multiple ticks collected from the same 229

cow. In addition, the infection rate of feeding Rh. evertsi was considerably higher (15.8%; 230

3/19) than in questing Rh. evertsi (0.1%; 1/700) and also the infection rate of feeding nymphal 231

Am. variegatum ticks (33.3%; 4/12) was higher as compared to adults of the same species 232

(14.7%; 5/34). These observations and the difference between infection rates in questing and 233

feeding ticks (0.1% vs. 14%, p < 0.01) may be a reflection of the reservoir status of cattle for 234

C. burnetii. In Nigeria, C. burnetii seems to represent a considerable risk factor for those in 235

contact with cattle. In Senegal, where the prevalence of C. burnetii in cattle is relatively low 236

(3.6%), seroprevalence rates in humans can be as high as 21.4 to 51% (12, 17), suggesting 237

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

11

even higher prevalence rates in Nigeria, where an estimated 27% (17/63) of cattle were 238

infected. Thus, both ticks and cattle must be considered as a considerable source of Q fever 239

and a significant threat to human health in the region. 240

Eight Anaplasma marginale/centrale positive ticks were collected and the estimated 241

prevalence in cattle was 9.5%, which is higher than the prevalence found in cattle blood 242

smears (1.9%) from Nigeria (11). Based on the detection PCR used in the present study, it 243

was not possible to differentiate between the highly pathogenic bovine A. marginale sensu 244

stricto and the naturally attenuated A. marginale subsp. centrale, which is sometimes used as 245

a vaccine (7). As the cattle in this study were not vaccinated, they must have been naturally 246

infected with either one of these subspecies, but the risk of severe disease cannot be 247

estimated. 248

Theileria mutans, the causative agent of benign bovine theileriosis, was detected in four Rh. 249

(Bo.) annulatus and Hy. impeltatum ticks removed from three cows of the same herd in 250

Moniya. This pathogen was not detected in any questing Rh. evertsi ticks from the seven field 251

locations, suggesting that this tick species may not be a competent vector or that T. mutans 252

has a limited distribution in Nigeria. It seems that in Nigeria, the estimated prevalence rate of 253

cattle (4.8%; 3/63) is comparable to that of cattle blood smears from within the country 254

(3.3%) (11). Interestingly, it is much lower than in Ghana, where 97% of cattle blood smears 255

were found to be positive for T. mutans (4). However, all cattle came from an area within a 256

30 km radius, thus also reflecting only a focal prevalence of T. mutans in few cattle herds. 257

Interestingly, Babesia species were not detected in any of the analysed ticks, although reports 258

on the seroprevalence of Babesia bigemina (29.4%) and Babesia bovis (14.1%) in Nigeria 259

exist (3). However, this study was performed in Northern Nigeria in the 1980s, suggesting 260

geographical as well as temporal differences in the distribution of Babesia species. 261

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

12

Different SFG Rickettsia species have been reported in ticks from cattle in Mali (16.2%), 262

Niger (16.3%), Mauretania (0%) and Cameroon (74.7%). We detected R. massiliae and a 263

member of the R. rickettsii group only in questing ticks (p < 0.05). This is compatible with the 264

minor role of vertebrates in the perpetuation and survival of R. massiliae (15). In contrast, 265

RAL and R. aeschlimannii were only detected in feeding ticks, indicating a potential role of 266

cattle as hosts. The estimated prevalence rate of RAL in cattle from the same herd was high 267

(15.4 to 50%), either supporting the suspected role of cattle as a reservoir or reflecting a high 268

transovarial transmission rate of RAL in the local tick population. Further studies are 269

warranted to unambiguously identify the involved Rickettsia species and clarify the life cycle 270

of RAL. 271

Different Borrelia species have been described in Africa, most of which are transmitted by 272

soft ticks (36). Ticks of the genus Rhipicephalus are known to transmit Borrelia theileri to 273

cattle, causing bovine borreliosis. The 16S rRNA sequences of the Borrelia species detected 274

in this study differed at least in three nucleotide positions from all known Borrelia sequences. 275

These new sequences form a separate cluster within the Borrelia burgdorferi s.l. group, 276

possibly belonging to a so far unknown Borrelia species. Unfortunately, further 277

characterization based on another gene was unsuccessful. 278

Several sequences from unknown bacteria were obtained in the Anaplasmataceae and 279

Borrelia detection PCRs. As these sequences showed highest similarities to soil bacteria, they 280

were most likely derived from bacteria from the outside rather than the inside of the ticks. 281

We also report here for the first time mixed infections in feeding ticks from Western Africa 282

involving mainly RAL and C. burnetii. Mixed infections involving C. burnetii may originate 283

either from subsequent blood meals, co-feeding events, or feeding on coinfected hosts. In 284

mixed infections involving Rickettsia species also transovarial transmission may play a role 285

(15). Coinfections with multiple pathogens may complicate clinical diagnosis and treatment. 286

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

13

In the Northern hemisphere, symptoms of Lyme Borreliosis have been reported to be more 287

diverse, intense and persistent in patients coinfected with either human anaplasmosis or 288

babesiosis (34). As treatment with an additional antimicrobial is necessary for a 289

Borreliosis/Babesiosis coinfection, misdiagnosis may lead to prolonged illness of patients 290

(34). For other tick-borne human pathogens, including spotted fever group rickettsiae and 291

Coxiella burnetii, the impact of coinfections on the severity of symptoms has not yet been 292

assessed. No such information exists on coinfections in cattle, although coinfections with 293

severe symptoms have been reported in dogs (9, 33). 294

The diversity of tick-borne pathogens in Nigeria was higher in feeding than in questing ticks, 295

suggesting that cattle serve as reservoirs for at least some of the studied pathogens, in 296

particular Coxiella burnetii. Investigations on the implications for human and animal health as 297

well as on the economic impact of these infections are warranted to determine the cost benefit 298

of vaccination of ruminants against A. marginale marginale, C. burnetii or ticks. Other 299

preventive measures like removal of feeding ticks and the concerted use of acaricides also 300

need to be assessed. 301

302

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

14

Acknowledgements 303

The authors want to thank the staff of the Department of Chemical Pathology and 304

Immunology of the University of Ibadan and others for assisting in the tick collection as well 305

as livestock traders and abattoir staff for allowing access to cattle. 306

This work was funded by the Ministry of Cooperation of the Grand-Duchy of Luxembourg 307

and the Centre de Recherche Public-Santé. A.L. Reye was supported by a fellowship from the 308

Bourse Formation Recherche and the Aides à la Formation Recherche of the Fonds National 309

de la Recherche Luxembourg. 310

311

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

15

References 312

1. Adakal, H., L. Gavotte, F. Stachurski, M. Konkobo, H. Henri, S. 313 Zoungrana, K. Huber, N. Vachiery, D. Martinez, S. Morand, and R. 314 Frutos. 2010. Clonal origin of emerging populations of Ehrlichia 315 ruminantium in Burkina Faso. Infect. Genet. Evol. 10:903-912. 316

2. Adakal, H., F. Stachurski, M. Konkobo, S. Zoungrana, D. F. Meyer, 317 V. Pinarello, R. Aprelon, I. Marcelino, P. M. Alves, D. Martinez, T. 318 Lefrancois, and N. Vachiery. 2010. Efficiency of inactivated vaccines 319 against heartwater in Burkina Faso: impact of Ehrlichia ruminantium 320 genetic diversity. Vaccine 28:4573-4580. 321

3. Ajayi, S. A., and O. O. Dipeolu. 1986. Prevalence of Anaplasma 322 marginale, Babesia bigemina and B. bovis in Nigerian cattle using 323 serological methods. Vet. Parasitol. 22:147-149. 324

4. Bell-Sakyi, L., E. B. Koney, O. Dogbey, and A. R. Walker. 2004. 325 Incidence and prevalence of tick-borne haemoparasites in domestic 326 ruminants in Ghana. Vet. Parasitol. 124:25-42. 327

5. Casati, S., H. Sager, L. Gern, and J. C. Piffaretti. 2006. Presence of 328 potentially pathogenic Babesia sp. for human in Ixodes ricinus in 329 Switzerland. Ann. Agric. Environ. Med. 13:65-70. 330

6. Clark, K., A. Hendricks, and D. Burge. 2005. Molecular identification 331 and analysis of Borrelia burgdorferi sensu lato in lizards in the 332 southeastern United States. Appl. Environ. Microbiol. 71:2616-2625. 333

7. De Wall, D. T. 2000. Anaplasmosis control and diagnosis in South 334 Africa. Ann N Y Acad Sci 916:474-483. 335

8. Fournier, P. E., B. Xeridat, and D. Raoult. 2003. Isolation of a 336 Rickettsia related to Astrakhan fever Rickettsia from a patient in Chad. 337 Ann. N. Y. Acad. Sci. 990:152-157. 338

9. Gal, A., S. Harrus, I. Arcoh, E. Lavy, I. Aizenberg, Y. Mekuzas-339 Yisaschar, and G. Baneth. 2007. Coinfection with multiple tick-borne 340 and intestinal parasites in a 6-week-old dog. Can. Vet. J. 48:619-622. 341

10. Ishikura, M., S. Ando, Y. Shinagawa, K. Matsuura, S. Hasegawa, T. 342 Nakayama, H. Fujita, and M. Watanabe. 2003. Phylogenetic analysis 343 of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA 344 genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 345 47:823-832. 346

11. Kamani, J., A. Sannusi, O. K. Egwu, G. I. Dogo, T. J. Tanko, S. 347 Kemza, A. E. Tafarki, and D. S. Gbise. 2010. Prevalence and 348 Significance of Haemoparasitic Infections of Cattle in North- Central, 349 Nigeria. Veterinary World Vol.3:445-448. 350

12. Kamga-Waladjo, A. R., O. B. Gbati, P. Kone, R. A. Lapo, G. 351 Chatagnon, S. N. Bakou, L. J. Pangui, H. Diop Pel, J. A. Akakpo, 352 and D. Tainturier. 2010. Seroprevalence of Neospora caninum 353 antibodies and its consequences for reproductive parameters in dairy 354

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

16

cows from Dakar-Senegal, West Africa. Trop. Anim. Health Prod. 355 42:953-959. 356

13. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software 357 for Molecular Evolutionary Genetics Analysis and sequence alignment. 358 Brief. Bioinform. 5:150-163. 359

14. Marconi, R. T., and C. F. Garon. 1992. Development of polymerase 360 chain reaction primer sets for diagnosis of Lyme disease and for 361 species-specific identification of Lyme disease isolates by 16S rRNA 362 signature nucleotide analysis. J. Clin. Microbiol. 30:2830-2834. 363

15. Matsumoto, K., M. Ogawa, P. Brouqui, D. Raoult, and P. Parola. 364 2005. Transmission of Rickettsia massiliae in the tick, Rhipicephalus 365 turanicus. Med. Vet. Entomol. 19:263-270. 366

16. Mediannikov, O., G. Diatta, F. Fenollar, C. Sokhna, J. F. Trape, and 367 D. Raoult. Tick-borne rickettsioses, neglected emerging diseases in 368 rural Senegal. PLoS Negl. Trop. Dis. 4: e821. 369

17. Mediannikov, O., F. Fenollar, C. Socolovschi, G. Diatta, H. Bassene, 370 J. F. Molez, C. Sokhna, J. F. Trape, and D. Raoult. 2010. Coxiella 371 burnetii in humans and ticks in rural Senegal. PLoS Negl. Trop. Dis. 372 4:e654. 373

18. Mtshali, M. S., J. de la Fuente, P. Ruybal, K. M. Kocan, J. Vicente, P. 374 A. Mbati, V. Shkap, E. F. Blouin, N. E. Mohale, T. P. Moloi, A. M. 375 Spickett, and A. A. Latif. 2007. Prevalence and genetic diversity of 376 Anaplasma marginale strains in cattle in South Africa. Zoonoses Public 377 Health 54:23-30. 378

19. Mura, A., C. Socolovschi, J. Ginesta, B. Lafrance, S. Magnan, J. M. 379 Rolain, B. Davoust, D. Raoult, and P. Parola. 2008. Molecular 380 detection of spotted fever group rickettsiae in ticks from Ethiopia and 381 Chad. Trans. R. Soc. Trop. Med. Hyg. 102:945-949. 382

20. Ndi, C., P. H. Bayemi, F. N. Ekue, and B. Tarounga. 1991. Preliminary 383 observations on ticks and tick-borne diseases in the north west province 384 of Cameroon. I. Babesiosis and anaplasmosis. Rev. Elev. Med. Vet. 385 Pays. Trop. 44:263-265. 386

21. Ndip, L. M., E. B. Fokam, D. H. Bouyer, R. N. Ndip, V. P. Titanji, D. H. 387 Walker, and J. W. McBride. 2004. Detection of Rickettsia africae in 388 patients and ticks along the coastal region of Cameroon. Am. J. Trop. 389 Med. Hyg. 71:363-366. 390

22. Ndip, L. M., M. Labruna, R. N. Ndip, D. H. Walker, and J. W. McBride. 391 2009. Molecular and clinical evidence of Ehrlichia chaffeensis infection 392 in Cameroonian patients with undifferentiated febrile illness. Ann. Trop. 393 Med. Parasitol. 103:719-725. 394

23. Ndip, L. M., R. N. Ndip, S. N. Esemu, V. L. Dickmu, E. B. Fokam, D. 395 H. Walker, and J. W. McBride. 2005. Ehrlichial infection in 396 Cameroonian canines by Ehrlichia canis and Ehrlichia ewingii. Vet. 397 Microbiol. 111:59-66. 398

24. Ndip, L. M., R. N. Ndip, S. N. Esemu, D. H. Walker, and J. W. 399 McBride. 2010. Predominance of Ehrlichia chaffeensis in Rhipicephalus 400

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

17

sanguineus ticks from kennel-confined dogs in Limbe, Cameroon. Exp. 401 Appl. Acarol. 50:163-168. 402

25. Ndip, L. M., R. N. Ndip, V. E. Ndive, J. A. Awuh, D. H. Walker, and J. 403 W. McBride. 2007. Ehrlichia species in Rhipicephalus sanguineus ticks 404 in Cameroon. Vector Borne Zoonotic Dis. 7:221-227. 405

26. Okuthe, O. S., and G. E. Buyu. 2006. Prevalence and incidence of tick-406 borne diseases in smallholder farming systems in the western-Kenya 407 highlands. Vet. Parasitol. 141:307-312. 408

27. Parola, P., H. Inokuma, J. L. Camicas, P. Brouqui, and D. Raoult. 409 2001. Detection and identification of spotted fever group Rickettsiae and 410 Ehrlichiae in African ticks. Emerg. Infect. Dis. 7:1014-1027. 411

28. Rajput, Z. I., S. H. Hu, W. J. Chen, A. G. Arijo, and C. W. Xiao. 2006. 412 Importance of ticks and their chemical and immunological control in 413 livestock. J Zhejiang Univ. Sci. B. 7:912-921. 414

29. Rar, V. A., N. V. Fomenko, A. K. Dobrotvorsky, N. N. Livanova, S. A. 415 Rudakova, E. G. Fedorov, V. B. Astanin, and O. V. Morozova. 2005. 416 Tickborne pathogen detection, Western Siberia, Russia. Emerg. Infect. 417 Dis. 11:1708-1715. 418

30. Reye, A. L., J. M. Hubschen, A. Sausy, and C. P. Muller. 2010. 419 Prevalence and seasonality of tick-borne pathogens in questing Ixodes 420 ricinus ticks from Luxembourg. Appl. Environ. Microbiol. 76:2923-2931. 421

31. Simuunza, M., W. Weir, E. Courcier, A. Tait, and B. Shiels. 2011. 422 Epidemiological analysis of tick-borne diseases in Zambia. Vet. 423 Parasitol. 175:331-342. 424

32. Stachurski, F. 2000. Invasion of West African cattle by the tick 425 Amblyomma variegatum. Med. Vet. Entomol. 14:391-399. 426

33. Suksawat, J., Y. Xuejie, S. I. Hancock, B. C. Hegarty, P. 427 Nilkumhang, and E. B. Breitschwerdt. 2001. Serologic and molecular 428 evidence of coinfection with multiple vector-borne pathogens in dogs 429 from Thailand. J. Vet. Intern. Med. 15:453-462. 430

34. Swanson, S. J., D. Neitzel, K. D. Reed, and E. A. Belongia. 2006. 431 Coinfections acquired from Ixodes ticks. Clin. Microbiol. Rev. 19:708-432 727. 433

35. To, H., N. Kako, G. Q. Zhang, H. Otsuka, M. Ogawa, O. Ochiai, S. V. 434 Nguyen, T. Yamaguchi, H. Fukushi, N. Nagaoka, M. Akiyama, K. 435 Amano, and K. Hirai. 1996. Q fever pneumonia in children in Japan. J. 436 Clin. Microbiol. 34:647-651. 437

36. van Dam, A. P., T. van Gool, J. C. Wetsteyn, and J. Dankert. 1999. 438 Tick-borne relapsing fever imported from West Africa: diagnosis by 439 quantitative buffy coat analysis and in vitro culture of Borrelia 440 crocidurae. J. Clin. Microbiol. 37:2027-2030. 441

37. Vesco, U., N. Knap, M. B. Labruna, T. Avsic-Zupanc, A. Estrada-442 Pena, A. A. Guglielmone, G. H. Bechara, A. Gueye, A. Lakos, A. 443 Grindatto, V. Conte, and D. De Meneghi. 2011. An integrated 444 database on ticks and tick-borne zoonoses in the tropics and subtropics 445

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

18

with special reference to developing and emerging countries. Exp. Appl. 446 Acarol. 54:65-83. 447

38. Walker, A. R., A. Bouattour, J. L. Camicas, A. Estrada Pena, I. G. 448 Horak, A. A. Latif, P. R.G., and P. M. Preston. 2003. Ticks of domestic 449 animals ticks in Africa: a guide to identification of species. Bioscience 450 reports:1-221. 451

452

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19

Figure legend 453

454

Figure 1 455

Neighbour-Joining phylogenetic trees based on (A) a 263 nucleotide (nt) fragment of the 16S 456

rRNA gene of Anaplasmataceae (nt 246466 - 246728 of CP001079.1), (B) a 339 nt fragment 457

of the 17-kDa gene of Rickettsiaceae (nt 1194686 - 1195024 of CP000766.2), (C) a 226 nt 458

fragment of the 18S rRNA gene of Piroplasmidae (nt 656 - 881 of HQ184411.1), (D) a 317 nt 459

fragment of the htpB gene of Coxiella (nt 273435 - 273751 of CP000733.1), (E) a 323 nt 460

fragment of the 16S rRNA gene of Borrelia species (nt 444099 - 443777 of CP002228.1) and 461

(F) a 321 nt fragment of the 16S rRNA gene of Conexibacter woesei (nt 834 - 1151 of 462

NR_028979.1). Nigerian sequences are named with their unique identifier, tick species, 463

geographic location and biological source. Compressed clusters containing sequences from 464

Nigeria are marked with an asterisk. Only bootstrap values above 70 are shown 465

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

20

TABLE 1. Primers and PCR conditions used for the detection of the five different pathogen groups. PCR protocol: 94°C for 3min; 40 cycles of 466

94°C for 30s, specific annealing conditions for 30s and 72°C for specific elongation time; subsequent incubation at 72°C for 10min. 467

Pathogen Primer

name

Primer

orientation

Target

gene 5’-3’ Sequence Reference

[Primer]

(µM)

[MgCl2]]

(mM)

Annealing

temperature (°C)

Elongation

time (s)

Anaplasmataceae EHR1 forward 16S rRNA GAACGAACGCTGGCGGCAAGC 0.4 2 63 45

newEHR2* reverse 16S rRNA CACGCTTTCGCACCTCAGTGTC

EHR3 forward 16S rRNA TGCRTAGGAATCTRCCTAGTAG 0.8 2 59 45

newEHR2* reverse 16S rRNA CACGCTTTCGCACCTCAGTGTC (29)

Rickettsiaceae Rr17k.1p forward 17-kDa TTTACAAAATTCTAAAAACCAT 0.8 2 55 45

Rr17k.539n reverse 17-kDa TCAATTCACAACTTGCCATT

Rr17k.90p forward 17-kDa GCTCTTGCAACTTCTATGTT 0.8 2 54 45

Rr17k.539n reverse 17-kDa TCAATTCACAACTTGCCATT (10)

Piroplasmidae BJ1 forward 18S rRNA GTCTTGTAATTGGAATGATGG 0.8

3

61

60

BN2 reverse 18S rRNA TAGTTTATGGTTAGGACTACG (5)

Coxiella Q5 forward htpB GCGGGTGATGGTACCACAACA

0.4

1.5

58

30 Q3 reverse htpB GGCAATCACCAATAAGGGCCG

Q6 forward htpB TTGCTGGAATGAACCCCA

0.8

2

56

30 Q4 reverse htpB TCAAGCTCCGCACTCATG (35)

Borrelia species newLDf* forward 16S rRNA GTAAACGATGCACACTTGGTG

0.4

2

61

30 newLDr* reverse 16S rRNA TCCGRCTTATCACCGGCAGTCT (14)

Outer1 forward flaB gene AARGAATTGGCAGTTCAATC

Outer2 reverse flaB gene GCATTTTCWATTTTAGCAAGTGATG 0.8 2 59 30

Inner1 forward flaB gene ACATATTCAGATGCAGACAGAGGTTCTA

Inner2 reverse flaB gene GAAGGTGCTGTAGCAGGTGCTGGCTGT (6) 0.8 2 59 30

* primer sequence modified 468

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

21

TABLE 2. Origin and number of herds, numbers of cattle and feeding ticks analysed and prevalence of detected pathogens. Asterisks mark total prevalence rates 69

in ticks which differ significantly from those observed in ticks from vegetation (p < 0.05). 70

A. marginale/centrale E. chaffeensis E. ewingii Ehrlichia sp. R. aeschlimannii RAL T. mutans C. burnetii

Herd Ticks (T/C)

Cattle Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

Pot. Inf. cattle

(%)

Inf. ticks (%)

PoInf. c

(%

Alakia 9

(1-2) 8

1 (11.1)

1 (12.5)

- - 1

(11.1) 1

(12.5) 1

(11.1) 1

(12.5) - -

3 (33.3)

3 (37.5)

- - 2

(22.2) 2

(25

Aleshinloye 1

(1) 1 - - - - - - - -

1 (100)

1 (100)

- - - - - -

Bodija 1 9

(1-2) 7 - - - - - -

1 (11.1)

1 (14.3)

- - - - - - - -

Bodija 2 20

(3-6) 4 - - - - - - - - - -

1 (5)

1 (25)

- - 1

(5) 1

(25

Bodija 3 2

(1) 2 - - - - - - - -

1 (50)

1 (50)

1 (50)

1 (50)

- - 1

(50) 1

(50

Moniya 1 20

(1-3) 13

1 (5)

1 (7.7)

- - - - 1

(5) 1

(7.7) 1

(5) 1

(7.7) 2

(10) 2

(15.4) - -

1 (5)

1(7.

Moniya 2 20

(1-3) 13

1 (5)

1 (7.7)

- - - - - - - - 4

(20) 3

(23.1) - -

3 (15)

2(15

Moniya 3 45

(1-7) 11

4 (8.9)

2 (18.2)

1 (2.2)

1 (9.1)

- - 1

(2.2) 1

(9.1) - -

2 (4.4)

2 (18.2)

4 (8.9)

3 (27.3)

8 (17.8)

8(72

Moniya 4 2

(2) 1 - - - - - - - - - - - - - - - -

Moniya 5 2

(2) 1 - - - - - - - - - - - - - - - -

Moniya 6 6

(3) 2

1 (16.7)

1 (50)

- - - - 1

(16.7) 1

(50) - -

1 (16.7)

1 (50)

- - 3

(50) 2

(10

Total 136

(1-7) 63

8 (5.9)*

6 (9.5)

1 (0.7)

1 (1.6)

1 (0.7)

1 (1.6)

5 (3.7)*

5 (7.9)

3 (2.2)*

3 (4.8)

14 (10.3)*

13 (20.6)

4 (2.9)*

3 (4.8)

19 (14)*

17(27

T/C, Range of numbers of ticks per cow; A., Anaplasma; E., Ehrlichia; R., Rickettsia; RAL, Rickettsia africae-like species; T, Theileria; C, Coxiella; Inf., 71

Infected; Pot., Potentially; -, not detected (0%).72

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

22

TABLE 3. Names of locations, numbers of questing ticks analysed and prevalence of detected pathogens. Asterisks mark total prevalence rates in ticks which 73

differ significantly from those observed in ticks from cattle (p < 0.05). 74

Location Ticks alpha proteobacterium

(%) R. massiliae

(%) RRG (%)

Borrelia sp. (%)

unknown bacterium (%)

C. burnetii (%)

Alowo-nle 100 -

4 (4)

- - - -

Igbo Ora 100 -

2 (2)

- - - -

Fuleni 100 -

1 (1)

- - - -

Maya 100 - 2

(2) -

3 (3)

2 (2)

-

Lanlate 100 2

(2) 8

(8) - -

4 (4)

-

Elepo 100 - 2

(2) 1

(1) - - -

Orisunbare 100 - 2

(2) - -

3 (3)

1 (1)

Total 700 2

(0.3) 21

(3)* 1

(0.1) 3

(0.4) 9

(1.3) 1

(0.1)*

R., Rickettsia; RRG, Rickettsia rickettsii group; C, Coxiella; -, not detected (0%). 75

76

TABLE 4. Mixed infections in ticks feeding on cattle and pathogen species involved. Ticks from the vegetation were not found to harbour multiple pathogens. 77

Pathogen species involved in mixed infections Ticks feeding on cattle

(%) Potentially infected cattle

(%) RAL C. burnetii 4 (2.9) 4 (6.3)

A. marginale/centrale T. mutans 2 (1.5) 2 (3.2) A. marginale/centrale T. mutans C. burnetii 1 (0.7) 1 (1.6)

E. chaffeensis C. burnetii 1 (0.7) 1 (1.6) Ehrlichia sp. C. burnetii 1 (0.7) 1 (1.6) Ehrlichia sp. RAL 1 (0.7) 1 (1.6) Ehrlichia sp. RAL C. burnetii 1 (0.7) 1 (1.6)

A., Anaplasma; E., Ehrlichia; RAL, Rickettsia africae-like species; T, Theileria; C, Coxiella. 78

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from

on April 21, 2020 by guest

http://aem.asm

.org/D

ownloaded from