pcr and its applications - ordinary words · pdf filepolymerase chain reaction (pcr) and its...
TRANSCRIPT
![Page 1: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/1.jpg)
Polymerase Chain Reaction Polymerase Chain Reaction (PCR) and Its Applications(PCR) and Its Applications
![Page 2: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/2.jpg)
What is PCR?What is PCR?
It was invented in 1983 by Dr. Kary Mullis, for which he received the Nobel Prize in Chemistry in 1993.
PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro.
![Page 3: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/3.jpg)
What is PCR? : What is PCR? : Why Why ““PolymerasePolymerase””??
It is called “polymerase” because the only enzyme used in this reaction is DNA polymerase.
![Page 4: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/4.jpg)
What is PCR? : What is PCR? : Why Why ““ChainChain””??
It is called “chain” because the products of the first reaction become substrates of the following one, and so on.
![Page 5: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/5.jpg)
What is PCR? : What is PCR? : The The ““ReactionReaction”” ComponentsComponents
1) Target DNA - contains the sequence to be amplified.
2) Pair of Primers - oligonucleotides that define the sequence to be amplified.
3) dNTPs - deoxynucleotidetriphosphates: DNA building blocks.
4) Thermostable DNA Polymerase - enzyme that catalyzes the reaction
5) Mg++ ions - cofactor of the enzyme
6) Buffer solution – maintains pH and ionic strength of the reaction solution suitable for the activity of the enzyme
![Page 6: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/6.jpg)
PCR Targets
The number of bases in the targets can vary.
TTAAGGCTCGA . . . . AATTGGTTAA
The . . . . Represents the middle DNA sequence,and does not have to be known to replicate it.
![Page 7: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/7.jpg)
The ReactionThe Reaction
THERMOCYCLERPCR tube
![Page 8: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/8.jpg)
Denature (heat to 95oC)
Lower temperature to 56oC Anneal with primers
Increase temperature to 72oC DNA polymerase + dNTPs
![Page 9: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/9.jpg)
![Page 10: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/10.jpg)
![Page 11: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/11.jpg)
DNA copies vs Cycle number
0
500000
1000000
1500000
2000000
2500000
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Cycle number
DN
A c
opie
s
![Page 12: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/12.jpg)
PCR Denaturing
Denaturing is the first step in PCR, in which
the DNA strands are separated by heating to
95°C.
![Page 13: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/13.jpg)
PCR Primers
Primers range from 15 to 30 nucleotides, aresingle-stranded, and are used for thecomplementary building blocks of the target sequence.
![Page 14: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/14.jpg)
PCR Primers
A primer for each target sequence on the end of your DNA is needed. This allows bothstrands to be copied simultaneously in bothdirections.
![Page 15: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/15.jpg)
PCR Primers
TTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and
<. . . . . . . . . . AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT
![Page 16: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/16.jpg)
PCR Primers
The primers are added in excess so they willbind to the target DNA instead of the two strands binding back to each other.
![Page 17: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/17.jpg)
PCR Annealing
Annealing is the process of allowing two sequences of DNA to form hydrogen bonds.The annealing of the target sequences andprimers is done by cooling the DNA to 55°C.
![Page 18: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/18.jpg)
PCR Taq DNA Polymerase
Taq stands for Thermus aquaticus, which is a microbe found in 176°F hot springs in Yellow Stone National Forest.
![Page 19: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/19.jpg)
PCR Taq DNA Polymerase
Taq produces an enzyme called DNA polymerase, that amplifies the DNA from the primers by the polymerase chain reaction, inthe presence of Mg.
![Page 20: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/20.jpg)
Applications of PCRApplications of PCR• Classification of organisms
• Genotyping• Molecular archaeology
• Mutagenesis• Mutation detection
• Sequencing• Cancer research
• Detection of pathogens
• DNA fingerprinting
• Drug discovery• Genetic matching• Genetic engineering
• Pre-natal diagnosis
![Page 21: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/21.jpg)
Applications of PCR
Basic Research Applied Research• Genetic matching• Detection of pathogens• Pre-natal diagnosis• DNA fingerprinting• Gene therapy
• Mutation screening• Drug discovery• Classification of organisms• Genotyping• Molecular Archaeology• Molecular Epidemiology• Molecular Ecology
• Bioinformatics
• Genomic cloning
• Site-directed mutagenesis
• Gene expression studies
![Page 22: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/22.jpg)
Applications of PCR
Molecular Identification Sequencing Genetic Engineering
• Molecular Archaeology• Molecular Epidemiology• Molecular Ecology• DNA fingerprinting• Classification of organisms• Genotyping• Pre-natal diagnosis• Mutation screening• Drug discovery• Genetic matching• Detection of pathogens
• Bioinformatics
• Genomic cloning
• Human Genome Project
• Site-directed mutagenesis
• Gene expression studies
![Page 23: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/23.jpg)
MMOLECULAROLECULAR IIDENTIFICATION:DENTIFICATION:
![Page 24: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/24.jpg)
![Page 25: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/25.jpg)
Detection of Unknown MutationsDetection of Unknown MutationsMolecular Identification:
![Page 26: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/26.jpg)
SSCP gels:“shifts” representing a mutation in the amplified DNA fragment
![Page 27: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/27.jpg)
Classification of OrganismsClassification of Organisms
1) Relating to each other
2) Similarities
3) Differences
* Fossils
* Trace amounts
* Small organisms
! DNA !
Molecular Identification:
Insufficient data
![Page 28: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/28.jpg)
![Page 29: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/29.jpg)
Rademaker et al. 2001
![Page 30: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/30.jpg)
Detection Of PathogensDetection Of Pathogens
Molecular Identification:
![Page 31: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/31.jpg)
Detection Of PathogensDetection Of Pathogens
Sensitivity of detection of PCR-amplified M. tuberculosis DNA. (Kaul et al.1994)
Molecular Identification:
![Page 32: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/32.jpg)
Sensitivity of detection of PCR-amplified M. tuberculosis DNA. (Kaul et al.1994)
![Page 33: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/33.jpg)
GenotypingGenotyping by STR markersby STR markers
Molecular Identification:
![Page 34: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/34.jpg)
Prenatal DiagnosisPrenatal Diagnosis
644 bp440 bp
204 bp
Molecular analysis of a family with an autosomal recessive disease.
Molecular Identification:
• Chorionic Villus
• Amniotic Fluid
![Page 35: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/35.jpg)
SSEQUENCINGEQUENCING
Nucleotides (dNTP) are modified (dideoxynucleotides = ddNTP)
NO polymerisation after a dideoxynucleotide!
Fragments of DNA differing only by one nucleotide are generated
Nucleotides are either or
![Page 36: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/36.jpg)
Sequencing:
![Page 37: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/37.jpg)
SummarySummary
blood, chorionic villus, amniotic fluid, semen, hair root, saliva
68,719,476,736 copies Gel Analysis, Restriction Digestion, Sequencing
![Page 38: PCR and Its Applications - ordinary words · PDF filePolymerase Chain Reaction (PCR) and Its Applications. What is PCR? It was invented in 1983 by Dr. Kary Mullis, ... primers by the](https://reader034.vdocument.in/reader034/viewer/2022051405/5a8f154b7f8b9afe568d68ea/html5/thumbnails/38.jpg)
ConclusionConclusionThe speedspeed and easeease of use, sensitivitysensitivity, specificityspecificity and
robustnessrobustness of PCR has revolutionised molecular biology
and made PCR the most widely used and powerful
technique with great spectrum of research and
diagnostic applications.