pcr is another in vitro dna synthesis reaction the twist in this case is that the reaction is...

36

Upload: internet

Post on 17-Apr-2015

107 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 2: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between

the primers is amplified

Page 3: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

The first PCR cycle:The sequence between the two primers will be

amplified

Page 4: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Four cycles of PCR

Page 5: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Copy number of the sequence between the primers increases exponentially

Page 6: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

SEQUENCIAMENTO DE DNA

Profa. Dra. Maria Aparecida Fernandez

Depto de Biologia Celular e Genética

Universidade Estadual de Maringá

Page 7: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Structure of dideoxynucleotide triphosphates

Page 8: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist

DNAP requires a template and a primer

The [ddNTP] determines the distribution of chain lengths produced.

The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.

Page 9: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 10: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA

Alto peso molecular

Baixo peso molecular

Filme de raio X

Auto-radiograma

Leitura manual

Page 11: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Automated DNA Sequencing

Page 12: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Reação de seqüênciamentoReação de seqüênciamento

Page 13: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento

Page 14: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Typical output of an automated sequencer

Page 15: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Eletroforese no seqüênciamentoEletroforese no seqüênciamento

Page 16: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 17: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação

Page 18: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 19: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 20: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Seqüenciador automáticoSeqüenciador automático

Page 21: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 22: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 23: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 24: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 25: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 26: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 27: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 28: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 29: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Conjunto

de

16 capilares

Page 30: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 31: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 32: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 33: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers
Page 34: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Panorama no momento da corrida

Page 35: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

Análise preliminar pós corrida

Page 36: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers

ELETROFEROGRAMAS