phage therapy for treatment of multiple drug resistant...
TRANSCRIPT
Phage Therapy for Treatment Of Multiple Drug Resistant Organisms
By
Zhabiz Golkar
Thesis submitted to University Of Karachi, in partial fulfillment of requirement for the degree of Doctor of Philosophy
Department of Microbiology University of Karachi Karachi-75270 Pakisatn
2009
In the name of God, the most Gracious, the Dispenser of Grace.
This dissertation is respectfully Dedicated to my beloved parents.
Aim of Research Antibiotic resistance crisis is the direct result of over-use of antibiotics and disinfectants, which has trigger an increase number of multiple drug resistant (MDR) organisms particularly virulent bacterial pathogens. Bacterial resistance to antibiotics has become a serious medical problem; therefore phage therapy can be used to lyses specific pathogens without disturbing the normal flora. It is inevitable to look for alternative means along with drug designing to combat the infectious agents. Therefore, phage therapy can be a method of choice. Our objective to conduct this study was to find out the alternative to chemotherapeutic agents which can effectively kill MDR infectious agents. Multiple drug resistance is a major problem in Pakistan due to antibiotic abuse. Therefore lytic bacteriophages were isolated from sewage and clinical specimen (Urine of UTI patient), screened and characterized for therapeutic purpose.
Content S.No Title Page I Acknowledgment I II Summary II III Summary( Urdu) III IV List of Figures IV V List of Tables V VI List of Sequences VI Introduction 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
-Bacteriophages 1.1 Definition 1.2 Discovery -Classification of phages -Composition of phages -Structure of phages -Morphology of phages -Infection of host cells: 6.1 Adsorption 6.1.1 Filamentous phages 6.1.2 Tail less (minute)phages 6.1.3 Tail phages 6.2 Nucleic Acid Injection 6.3 Synthesis of proteins and nucleic acid 6.4 Virion assembly 6.5 Release of virions -Phage multiplication cycle
7.1 Lytic or Virulent Phages 7.2 Lysogenic or Temperate Phage
7.3 Lysogenic Conversion -Phage Genetics 8.1 Generalize transduction 8.2 Specialized transduction 8.3 Abortive transduction 8.4 Transposition -Diversity of phages -Diversity of host range of phage -Phage Ecology and Bacterial Pathogenesis -Stalin’s antibiotic alternative -Historical Background and Early studies of phage therapy -Commercial production of phages -Preclinical study of phage therapy in animals (Therapeutic use of phages in animals)
1 1 4 5 6 8 9 9 9 10 10 10 11 11 11 12 12 12 13 15 15 16 17 18 19 21 24 27 27 35 36
16 17 18 19 20 21 22
-Prophylaxis and treatment of bacterial infections in human -Bacteriophages as therapeutic agents:
17.1 - Mode of action 17.2 - Safety profile -Comparison of phages and antibiotics -The Phage Advantage -Food and Agriculture: Testing Grounds -Other application of phages -Possible Problems and Resistance
39 43 44 44 45 48 50 52 53
Materials A B C D E F G H I J K L
Equipments Bacterial strains Media Antibiotics Salts Solutions Buffers Animals Chemicals Miscellaneous Address of Firm List of kits
55 56 57 57 57 58 59 64 64 66 67 72
Methods A Isolation of phages and Characterization 80 A-1 A-2 A-3 A-4 A-5 A-6 A-7 A-8 A-9 A-10 A-11 A-12 A-13
-Purity determination of bacterial culture -Isolation and purification of bacteriophages -Isolation of phage from sewage -Isolation of phage from clinical specimen -Determination of phage activity in clinical sample on bacterial lawn . -Preparation of Lysate -Determination of phage interaction with bacteria A-7.1 Plaque assay by double layer method A-7.2 Spot assay by double agar layer method -Lysate amplification from single plaque -Effect of salt on activity of phage -Comparative study of phage infection in enrich and minimal and selective media -Comparative study of induced lysates activity in aerobic and anaerobic condition -Identification of resistant colonies -Induction 13.1 Induction of Pseudomonas 76 (lysogenic strain) by Bile salt
80 80 80 81 81 81 82 82 82 83 83 83 84 84 84 84
A-14 A-15 A-16 A-17 A-18 A-19 A-20 A-21
13.2 Induction of resistant colonies 13.3 Induction of P7 (lysogenic strain) by Nalidixic acid 13.4 Induction of E.coli-N lysogen by Tetracycline 13.5 Induction of E.coli-N lysogen by Serum 13.6 Induction of E.coli-N lysogen by Urea 13.7 Induction of E.coli-N and Klebsiella-N lysogenic strain by Uric acid. 13.8 Induction of lysogenic E.coli-N and Klebsiella-N by UV 13.9 Induction of P5 and P6 lysogen by Urea 13.10 Induction of P5 and P6 in presence of minimum inducing concentration of Urea -Effect of Salts on temperate phages Induced by Bile salt -Antibiotic sensitivity by MIC method -Phage separation by titration -Screening of antimicrobial substances by wells method -Titration of lysates by liquid serial dilution method (PFL/ml) -Transmission Electron Microscopy -Effect of maltose on phage-host interaction -Lysate amplification from single plaque in presence of maltose
86 85 86 86 86 87 87 87 88 88 88 88 89 89 90 90 90
B Genomic Characterization B-1 B-2 B-3 B-4 B-5 B-6 B-7 B-8 B-9 B-10 B-11 B-12
Gel Electrophoresis B-1.1 Laemmli Discontinues Gel Electrophoresis of Protein. B-1.2 Agarose Gel Electrophoresis of DNA -Action of DNAase I -Action of RNAase A - Phage DNA purification - Phenol-Chloroform DNA extraction - Preparation of ethidium bromide Agarose plate - DNA-extraction directly from lysate - Isolation of DNA fragments from Agarose gel -Southern Blotting B-9.1 DNA probe by Labeling psoralen B-9.2 Hybridization B-9.3 Washing the blots B-9.4 Stripping off of DNA-probe from membrane -Restriction endonucleases -Polymerase Chain Reaction (PCR) amplification -DNA sequencing
91 92 93
94 94
95 95 96 96 97 98 98 99 99 100 100 101 101
C Serological Techniques C-1 C-2 C-3 C-4 C-5 C-6 C-7 C-8
-Preparation of serological test antigen -Dialysis tube preparation -Antigen concentration using dialysis tube -Vaccine C-4.1 Killed Vaccine preparation C-4.2 Adjuvant vaccine preparation C-4.3 DNA vaccine preparation(Pseudomonas ϕ ) C-4.4 DNA vaccine preparation( E.coli ϕ ) -Preparation of antiserum (in Rabbit and Mice) -Antigen-Antibody reaction C-6.1 Wet slide agglutination C-6.2 Ouchterlany gel immunodiffusion C-6.3 Two dimensional immunoelectrophoresis C-6.4 Immnoelecterophoresis C-6.5 Pre-coating glass plates with agarose C-6.6 Staining precipitant lines -Quantative analysis by ELISA: C-7.1 Desalting of lysate by micro dialysis C-7.2 Coating of ELISA 96 wells plate by antigen C-7.3 Coating of ELISA 96 wells plate by lysate C-7.4 Coating of ELISA 96 wells plate by Pseudomonas C-7.5 Estimation of total γ-globulin raised in Rabbit against S.typhi antigen by ELISA . C-7.6 Estimation of IgG raised in mice antiserum against S.typhi antigen by ELISA( by using Fab as secondary antibody) C-7.7 Estimation of IgG raised in mice antiserum against S.typhi antigen by ELISA( by using Fc as secondary antibody)
C-7.8 Antibody detection in HCV positive human serums by ELISA
- Quantative analysis by Western blotting: C-8.1 Western blotting of total amount of rabbit γ-globulin C-8.2 Western blotting of total amount of Mice γ-globulin raised against S.typhi antigen.
C-8.3 Estimation of IgG raised in mice against S.typhi antigen by using Fab –specific as secondary antibody Western Blotting.
C-8.4 Estimation of IgG raised in mice against S.typhi antigen by using Fc –specific as secondary antibody by Western Blotting
102 102 102 103 103 103 104 104 104 105 105 105 106 107 107 107 108 108 108 109 110 110 111 112 113 113 114 115
C-8.5 Western blotting of total amount of Mice γ-globulin against S.typhi antigen (ECL)
116
D Phage Therapy D-1 D-2 D-3
-Phage application as therapeutic agent for treatment of Mice infection due to MDR Pseudomonas -Phage application as therapeutic agent for treatment of Mice infection due to MDR E.coli -Phage therapy on chronic MDR infection.
117 117 118
E Bioinformatics Softwares 118 E-1 E-2 E-3 E-4 E-5 E-6 E-7 E-8 E-9
-ClustalW.2 - BLAST Blastn Blastx tBlastn tpBlast -HCV Quick Align -HCV Gene cutter -HCV Sequence locator -HIV Quick Align -UniProtKB/TrEMBL -Gene annotation -Phylogenic tree
Results 119 Tables
Figures Sequences
Discussion 338 References
List of Tables S.No List of Tables Page 1 ICTV classification of phages 5 2 Some of the major human phage therapy studies performed in
Poland and the former Soviet Union 30
3 Comparison of the prophylactic and/or therapeutic use of phages and antibiotics
47
4 Plaque assay of isolated phage from sewage 256 5 Plaque assay of induced lysates from Urine sample 257 6 Plaque assay and Spot assay of amplified lysates raised in Ps.
aeruginosa, Ps (SIUT) and Ps3 in presence of salts. 259
7 Effect of selective and enriched media on phage-host interaction 260 8 Plaque assay of induced lysates after induction with Bile salts on
the lawn of Ps. aeruginosa , Ps3 and Ps(SIUT) 261
9 Effect of Salts(Bile,MgSO4,CaCl2) on induced lysates 262 10 Determination of bacteriocin activity of lysates by wells method 263 11 Plaque assay of titrated lysates on the lawn of Ps. aeruginosa 264 12 Plaque assay of amplified lysates from Pseudomonas lytic phages 265 13 Wet slide agglutination of antiserum raised in Mice against
Salmonella typhi antigen 266
14 PCR products highlighted with HCV primers 267 15 PCR products highlighted with van primers 268 16 PCR products highlighted with our lab designed primers 269 17 Signature identified on phage genome and ABC-transporter of
Enterococcus V583 genome 270
18 BLASTx analysis of PCR products highlighted by van S, S1, Y, Y1,B,B1 and Tn1546 primers on genome of phage PS5 and its comparison with Staphylococcus aureus MARSA252,Enterococus faecalis V583 ,Streptomycis and Tn1546.
271
19 Functional gene of phage PS5 highlighted by van gene primers and their similarity with other organisms by Blastx and Blastn.
272
20 Large segment of chromosome (Staphylococcus) similar to 13 base stretches of PCR product of phage genome.
274
21 Blastn analysis of PCR product of phage PS5 genome raised by S, S1,R ,R1 in Human genome Database.
275
22 JCVI Gene annotation display of Domains of S/R system of PCR product raised by van S, S1,R and R1
278
23 UniProtKB/TrEMBL analysis of Sensor Box Histidine Kinase Domain highlighted by van S, S1, R, R1 and B primers on phage PS5.
280
24 UniProtKB/TrEMBL analysis of Domains highlighted by van S, S1, R, R1 and B primers on phage PS5 and Enterococcus faecalis V583.
282
25 UniProtKB/TrEMBL analysis of Domains highlighted by van S, S1 and B primers on phage PS5 and Staphylococcus aureus MARSA252.
285
26 UniProtKB/TrEMBL analysis of Domains highlighted by van Y , Y1 and S1 primers on phage PS5 and Streptomyces coelicolor A3(2).
287
27 QuickAlign comparison of PCR product of phage genome homology with HCV sequences in LosAlamose Database.
288
28 QuickAlign analysis of PCR products of phage genome raised by HCV primers.
289
29 QuickAlign analysis of PCR products of phage genome raised by other than HCV primers.
289
List of Sequences S.No List of Sequences Page 1. Sequence PCR products of phage genome raised by Van primers.
290
1.1 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van A) primer
290
1.2 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van B) primer.
291
1.3 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van B1) primer.
292
1.4 Sequence PCR product of phage PS5 genome raised by regulation targeted (van S) primer.
293
1.5 Sequence PCR product of phage PS5 genome raised by regulation targeted (van S1) primer.
294
1.6 Sequence PCR product of phage PS5 genome raised by regulation targeted (van S)primer.
295
1.7 Sequence PCR product of phage PS5 genome raised by Ligase targeted(van A1) primer.
296
1.8 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van B) primer.
297
1.9 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van B1) primer.
298
1.10 Sequence PCR product of phage PS5 genome raised by Ligase targeted (van B1) primer.
299
1.11 Sequence PCR product of phage PS5 genome raised by carboxypeptidase targeted (Y) primer.
300
1.12 Sequence PCR product of phage PS5 genome raised by carboxypeptidase targeted (Y1) primer.
301
1.13 Sequence PCR product of phage PS6 genome raised by regulation targeted (VanS1) primer.
302
1.14 Sequence PCR product of phage PS6 genome raised by dehydrogenase targeted (van H ) primer.
303
1.15 Sequence PCR product of phage PS6 genome raised by resolvase targeted (ORF-2E) primer
304
1.16 Sequence PCR product of phage PS6 genome raised by resolvase targeted (Orf-Rev)primer.
305
1.17 Sequence PCR product of phage PS6 genome raised by regulation targeted (van R1)primer.
306
1.18 Sequence PCR product of phage PS6 genome raised by regulation targeted (van R2) primer.
307
1.19 Sequence PCR product of phage PS5 genome raised by resolvase targeted (ORFID-1)primer.
308
1.20 Sequence PCR product of phage PS5 genome raised by resolvase targeted (ORFID-2) primer.
309
1.21 Sequence PCR product of phage PS5 genome raised by ligase targeted (1546-1 ) primer.
310
1.22 Sequence PCR product of phage PS5 genome raised by ligase targeted( 1546-2) primer.
311
1.23 Sequence PCR product of phage PS5 genome raised by transpoase targeted (S-1216-1) primer.
312
1.24 Sequence PCR product of phage PS5 genome raised by transpoase targeted (S-1216-2) primer.
313
2 Sequence PCR product of phage genome raised by HCV primers 314
2.1 Sequence PCR product of phage PS5 genome raised by 5’-UTR specific targeted (C1) primer
314
2.2 Sequence PCR product of phage PS5 genome raised by 5’-UTR specific targeted (C3) primer
315
2.3 Sequence PCR product of phage PS5 genome raised by 5’-UTR specific targeted (C3) primer
316
2.4 Sequence PCR product of phage PAK genome raised by 5’-UTR specific targeted (C1) primer
317
2.5 Sequence PCR product of phage PS5 genome raised by 5’-UTR specific targeted (C3) primer
318
2.6 Sequence PCR product of phage PL5 genome raised by 5’-UTR specific targeted (C1) primer
319
2.7 Sequence PCR product of phage PL5 genome raised by 5’-UTR specific targeted (C3) primer
320
2.8 Sequence PCR product of phage PL6 genome raised by 5’-UTR specific targeted (C1) primer
321
2.9 Sequence PCR product of phage 3S genome raised by 5’-UTR specific targeted (C3) primer
322
2.10 Sequence PCR product of phage PL6 genome raised by Universal (Ac2) primer
323
2.11 Sequence PCR product of phage PL6 genome raised by Universal (Sc2) primer
323
2.12 Sequence PCR product of phage PL6 genome raised by Universal (Ac2) primer
324
2.13 Sequence PCR product of phage PL6 genome raised by Universal (Sc2) primer
324
2.14 Sequence PCR product of phage PL6 genome raised by Universal (Ac2) primer
325
3 Sequence PCR product of phage genome raised by designed by lab (Reverse/Forward) primers
326
3.1 Sequence PCR product of phage U9 genome raised by design (Forward) primers
326
Sequence PCR product of phage U9 genome raised by design (Reverse) primers
327
3.2 Sequence PCR product of phage U9 genome raised by design (Reverse) primers
328
3.3 Sequence PCR product of phage PS5 genome raised by design (Forward) primers
329
3.4 Sequence PCR product of phage PS5 genome raised by design (Reverse) primers
330
3.5 Sequence PCR product of phage PS6 genome raised by design (Forward) primers
331
3.6 Sequence PCR product of phage PS6 genome raised by design (Reverse) primers
332
3.7 Sequence PCR product of phage PL6 genome raised by design (Reverse) primers
333
3.8 Sequence PCR product of phage 3S genome raised by design (Reverse) primers
334
3.9 Sequence PCR product of phage PAK genome raised by design (Forward) primers
335
3.10 Sequence PCR product of phage PAK genome raised by design (Forward) primers
336
3.11 Sequence PCR product of phage PAK genome raised by design (Reverse) primers
336
3.12 Sequence PCR product of phage PAK genome raised by design (Reverse) primers
337
List of Figures
S.No List of figures Page 1 Spot assay of Isolated Phage Lysate on the Lawn of Multiple Drug
Resistance E.coli3 151
2 Plaque assay of Lytic Phage on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
152
3 Plaque assay of Bile Salt Induced Lysates on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
153
4 Comparative Study of Induced Lysates Activity in Aerobic and Anaerobic Condition on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
154
5 Plaque assay of Urea Induced Strains of Pseudomonas spp. P5, P6 on the Lawn of Respective Hosts
155
6 Effect of Maltose on Interaction of Host-Phage by Plaque assay 156 7 Plaque assay of Human Serum Induced Lysates 157 8 Plaque assay of Urea Induced Lysates 158 9 Plaque assay of UV Induced Lysates 159 10 Spot assay of Isolated Lytic Phage on the Lawn of Multiple Drug
Resistance Pseudomonas aeruginosa and E.coli3 160
11 Poly acrylamide Gel Electrophoresis of Isolated Pseudomonas Phage from Sewage in 10% Gel.
161
12 Poly acrylamide Gel Electrophoresis of Isolated Pseudomonas Phage from Sewage in 10% Gel
162
13 DNA Profile of Lytic Phages 163 14 Electron Micrograph of Urine 164 15 Electron Micrograph of Pseudomonas Lysate U1 and U2 165 16 Electron Micrograph of E.coli-N Lysate U9 167 17 Electron Micrograph of amplified Lysate PS5 and PS6 168 18 Electron Micrograph of amplified Lysate PL5 and PL6 169 19 Electron Micrograph of Induced Lysate P5Urea 170 20 Presence of Empty Head Particles in Lysate U1 171 21 Electron Micrograph of Induced Lysate 3S 172 22 Southern blotting 173 23 Restriction analysis of Amplified Pseudomonas Phage DNAs and
E.coli phages. 175
24 Immunoelectrophoresis 176 25 Antibiotics Resistance profile of Pseudomonas aeruginosa and E.coli
Strains. 177
26 Estimation of Total Gama Globulin Raised in Rabbit against S.typhi Antigens by Use of Mineral Oil and DNA Vaccine by ELISA.
180
27 Estimation of Total Gama Globulin Raised in Mice against S.typhi Antigens by Use of Mineral Oil and DNA Vaccine ( Using IgG-Fc as Secondary Ab) by ELISA.
181
28 Estimation of Total Gama Globulin Raised in Mice against S.typhi
Antigens by Use of Mineral Oil and DNA Vaccine ( Using IgG-Fab as Secondary Ab) by ELISA.
182
29 Estimation of Total Gama Globulin Raised in Mice against S.typhi Antigens by Use of Mineral Oil and DNA Vaccine by ELISA.
183
30 Comparison of Cross Reactivity of PS5, P5(whole cell) with Serum of HCV Positive Patient.
184
31 Comparison of Antisera-IgG Raised in Mice by Use od Mineral Oil and DNA Vaccine by Western blotting.
185
32 Comparison of Antisera-IgG Raised in Rabbit by Use od Mineral Oil and DNA Vaccine by Western blotting.
186
33 Polymerase Chain Reaction (PCR) 187 34 Pseudomonas Phage PS5 Application after 30 minutes on Lesion of
Mice Infected with MDR Pseudomonas aeruginosa. 188
35 E.coli Phage 3S Application after 30 minutes on Lesion of Mice Infected with MDR E.coli .
189
36 Healing of Chronic Infected Lesion of Pseudomonas by Phage P5S Therapy
190
37 Healing of Chronic Infected Lesion of E.coli by Phage Therapy
191
38 E.coli Phage U9 Application after 30 minutes on Lesion of Mice Infected with MDR E.coli
192
39 Healing of Chronic Infected (Deep Skin Lesion and Burn) Lesions of E.coli by Phage U9 Therapy.
193
40 Sequence connection among Phages and Prophages. 194 41 QuickAlign Analysis of PCR Product of phage PS5 Genome
Homologous with HCV Sequence in LosaAlamos. 195
42 QuickAlign Analysis of PCR Product of phage PS5 Genome Homologous with HIV Sequence in LosaAlamos.
208
43 Sequence Locator Analysis of PCR Product of Phage PS5 Genome Homologous with HCV Sequences in NCBI Database
213
44 Similarity of Phage PS5, DNA-binding Response Regulator Protein with Tn1546.
216
45 Similarity of Phage HistidineKinase Protein with Tn1546 217 46 Radical SAM domain Proteins Similarity Highlighted by PCR
Product of PAK phage and PS5 Raised by Reverse and Forward primers in NCBI Database.
218
47 ClustalW Alignment of SAM Domain Protein of As[ergillus clavatus NRRL1 and PCR Product of PAK phage and PS5 Raised by Reverse and Forward primers.
220
48 ClustalW Alignment of SAM Domain Protein and PCR Product of PAK phage and PS5 Raised by Reverse and Forward primers.
229
49 ClustalW Alignment of PCR Product of PAK phage and PS5 Raised 237
by Ac2 Primer and HIV-1. 50 ClustalW Alignment of PCR Product Raised by VanS1 Primer with
HCV Genome. 238
51 ClustalW Sequence Alignment of PCR Product Raised by VanR1 Primer with HCV Genome.
240
52 ClustalW Sequence Alignment of PCR Product Raised by VanR2 Primer with HCV Genome.
242
53 ClustalW Sequence Alignment of PCR Products of phage PS5 Genome Raised by VanR and Ac2 Primers.
245
54 ClustalW Sequence Alignment of PCR Products of phage 3S Genome Raised by Reverse Primer and DPD-N Protein.
247
55 Phylogenic Tree Relation of DNA-binding Response Regulator Protein of Phage PS5 with Different Organisms in NCBI Database.
249
56 Phylogenic Tree Relation of DNA-binding Response Regulator Protein of Phage PS5 with Different Organisms in NCBI Database.
250
57 Phylogenic Tree Relation of Histidine Kinase Protein of Phage PS5 with Different Organisms in NCBI Database.
251
58 Phylogenic Tree Relation of Radical SAM Domain of Phage PS5 (2nd band) with Different Organisms in NCBI Database.
252
59 Phylogenic Tree Relation of Radical SAM Domain of PAK Phage with Different Organisms in NCBI Database.
253
60 Phylogenic Tree Relation of Radical SAM Domain of PAK Phage with Different Organisms in NCBI Database
254
61 Phylogenic Tree Relation of Histidine Kinase Protein of Phage PS5 with Different Organisms in NCBI Database.
255
List of Abbreviations DNA Deoxyribonucleic acid RNA Ribonucleic acid Ф Bacteriophage nt Nucleotide a.a Amino acid Ab Antibody Ag Antigen MARSA Methicilin Resistance Staphylococcus aureus MDR Multiple Drug Resistance Tn Transposon Van Vancomycin ORF Open Reading Frame UTR Untranslated Region SAM Sterile Alpha Motif ATP Adenosine Tri-Phosphate R Resistant to antibiotic S Sensitive to antibiotic L.B Luria-Bertani Lps Lipolysacharide SSC Saline-Sodium Citrate PBS Phosphate Buffer Saline PEG Poly Ethylen Glycol PCR Polymerase Chain Reaction PAGE Poly achryl amide Gel Electerophoresis BHI Brain Heart Infusion LMT Low Melting Temprature UV UltraViolet ELISA Enzyme-linked Immunosorbent Assay EIA Enzyme Immunoassay SDS Sodium Dextran sulfate BLAST Basic Local Alignment Search Tool NCBI National Center for Biotechnology Information HCV Hepatitis C HIV Human Immunodeficiency Virus JCVI J. Craig Venter Institute SIUT Sindh Institute Urology and Transplantation Ps.a Pseudomonas aeruginosa Ps. 3 Pseudomonas aeruginosa Ps. 5 Pseudomonas aeruginosa Ps.6 Pseudomonas aeruginosa S.typhi Salmonella typhimurium Kleb. Klebsiella pneumonia
Abstract
In the hunt of phages for Gram-negative multiple drug resistant organisms,
we have collected lytic phages. These were characterized by identification of
genome nucleic acids and proteins profile of capsid. However present study
was proceed with the phages isolated form urine of athlete lady.
Microbiological examination of urine sample revealed the presence of E. coli
as etiologic agent in urinary tract infection (UTI) patient. Filter sterilized
urine produced enornomous amount of phages as indicated by plaque assay
on the lawn of two local strains of Pseudomonas aeruginosa, P5 and P6.
Electron micrograph of the lysates prepared from urine in Ps5 and Ps6
strains indicated the particles similar to Siphovirideae and Myoviradeae
respectively. Absence of Pseudomonas in urine sample during active disease
and absence of phages in convalescent patient’s urine was significant
features that refer the association of these phages to E. coli. Urea induced E.
coli lysate was used to raise lysates in P5 and P6 strain of Ps. aeruginosa
called U9P5 and U9P6. Small clear and large clear plaques were exhibited
on the lawn of P5 and P6 by these lysates. P5S and PS6 lysates were raised
in P5 and P6 from single small plaque each on the lawn of P5 and P6
respectively. Similarly PL5 and PL6 lysates were produced in respective host
from single large plaque each. Genomes of these Фs were identified as
dsDNA. DNA restriction analysis of all four lysates revealed very similar
restriction pattern. Hybridization with DNA probe of PS6 and PL5 has
indicated the homology in the DNA from these lysates. Methylated and
unmethylated CpG motifs were identified in genome DNA of these phages.
To test the immuno- stimulatory effects mice and rabbits were vaccinated
with killed cell of S. typhi with or without fragmented genome DNA of these
phages. In addition adjuvant efficacy of CpG motifs was compared with
mineral oil. In antisera, types of antibodies were determined by
immunoelectrophoresis and Western blotting. ELISA was done for
Quantative analysis, have shown IgG immunoglobulin was produced in
BALB/c mice and rabbit when fragmented DNA was used as adjuvant. In
antisera raised by Ф DNA vaccine, strong and specific immunogenicity has
been attributed due to the presence of CpG motifs. Difference in immune
response in animals immunized by Ф DNA vaccine was detected that may be
associated with the frequency of CpG island in the DNA. Ps. Ф DNA has
additional CpG sites, compare to E.coli Ф DNA and this may enhance
immunopotentional of its CpG motifs. PS5 phage has shown cross reactivity
with HCV antisera. In order to confirm the cross reactivity of phage and
antisera, the 100 sera samples from the HCV +ve patients were tested by
ELISA on coated plates with HCV antigen, phage and Ps. and have
exhibited significant cross reaction with phage lysates. In order to determine
genomic relation, PCR products raised by HCV specific primers were
sequenced and aligned with HCV genome. BLAST, Gene locater and
QuickAling software have shown homology with the 5’-UTR, 3’-UTR and
NS3 regions of different HCV genotypes. A range of primers pair
corresponding to different antibiotic resistance trait were used to see whether
this phage is a carrier of any antibiotic resistant trait. ClustalW, BLASTn,
BLASTx, ScanProsite and Swiss-Prot analysis of sequenced PCR products
have shown that this phage carries VanA cassette implicated to vancomycin
resistance. Van S & R primers have shown homology with histidine kinase
and DNA-binding response regulators respectively. Interestingly Ps Ф
genome was found to contain a composite transposon which was evolved
from the combination of IS1216 and 1546 transposons. These transposons
were associated with Gram-positive bacteria i.e. Enterococci. VanB gene
primers highlighted seven signature sequence on phage genome correspond
to Walker B motifs of ABC-transporter proteins of Enterococcus faecalis
V583 in addition phage genome has reflected the presence of some
functional domain i.e. SAM which is commonly present in eukaryotic
proteins. Our studies provide the strong evidence that lytic life cycle of this
phage has therapeutic implications, not only for superficial infection, but
effective for systematic infections as well. It is interesting to note that CpG
motifs of phage DNA may have potential to enhance efficacy of
antimicrobial therapies supported by DNA vaccine.
1
1. Bacteriophages.
1.1. Definition:
A bacteriophage (from 'bacteria' and Greek phagein, 'to eat') is any one of
a number of virus-like agents that infect bacteria. The term is commonly
used in its shortened form, phage.
Typically, bacteriophages consist of an outer protein head enclosing
genetic material. The genetic material can be dsRNA, ssDNA, or dsDNA
between 5 and 500 kilo base pairs long with either circular or linear
arrangement. Bacteriophages are much smaller than the bacteria they
destroy - usually between 20 and 200 nm in size. (1, 76)
1.2. Discovery:
The history of bacteriophage discovery has been the subject of lengthy
debates, including a controversy over claims for priority. Ernest Hankin, a
British bacteriologist, reported in 1896 (1) on the presence of marked
antibacterial activity (against Vibrio cholerae) which he observed in the
waters of the Ganges and Jumna rivers in India, and he suggested that an
unidentified substance (which passed through fine porcelain filters and
was heat labile) was responsible for this phenomenon and for limiting the
spread of cholera epidemics. Two years later, the Russian bacteriologist
Gamaleya observed a similar phenomenon while working with Bacillus
2
subtilis (2), and the observations of several other investigators are also
thought to have been related to the bacteriophage phenomenon (3).
However, none of these investigators further explored their findings until
Frederick Twort, a medically trained bacteriologist from England,
reintroduced the subject almost 20 years after Hankin's observation by
reporting a similar phenomenon and advancing the hypothesis that it may
have been due to, among other possibilities, a virus (4). However, for
various reasons including financial difficulties (4,5) Twort did not
pursue this finding, and it was another 2 years before bacteriophages were
"officially" discovered by Felix d'Herelle, a French-Canadian
microbiologist at the Institute Pasteur in Paris.
The discovery or rediscovery of bacteriophages by d'Herelle is frequently
associated with an outbreak of severe hemorrhagic dysentery among
French troops stationed at Maisons-Laffitte (on the outskirts of Paris) in
July-August 1915, although d'Herelle apparently first observed the
bacteriophage phenomenon in 1910 while studying microbiologic means
of controlling an epizootic of locusts in Mexico. Several soldiers were
hospitalized, and d'Herelle was assigned to conduct an investigation of the
outbreak. During these studies, he made bacterium-free filtrates of the
patients' fecal samples and mixed and incubated them with Shigella
strains isolated from the patients. A portion of the mixtures was
3
inoculated into experimental animals (as part of d'Herelle's studies on
developing a vaccine against bacterial dysentery), and a portion was
spread on agar medium in order to observe the growth of the bacteria. It
was on these agar cultures that d'Herelle observed the appearance of
small, clear areas, which he initially called taches, then taches vierges,
and, later, plaques (4). D'Herelle's findings were presented during the
September 1917 meeting of the Academy of Sciences, and they were
subsequently published (6) in the meeting's proceedings. In contrast to
Hankin and Twort, d'Herelle had little doubt about the nature of the
phenomenon, and he proposed that it was caused by a virus capable of
parasitizing bacteria. The name "bacteriophage" was also proposed by
d'Herelle, who, according to his recollections (4), decided on this name
together with his wife Marie on 18 October 1916 the day before their
youngest daughter's birthday (d'Herelle apparently first isolated
bacteriophages in the summer of 1916, approximately 1 year after the
Maisons-Laffitte outbreak). The name was formed from "bacteria" and
"phagein" (to eat or devour, in Greek), and was meant to imply that
phages "eat" or "devour" bacteria.
D'Herelle, who considered himself to be the discoverer of bacteriophages,
was made aware (7, 8) of the prior discovery of Twort but maintained that
the phenomenon described by Twort was distinct from his discovery. In
the meantime, in contrast to Twort, d'Herelle actively pursued studies of
4
bacteriophages and strongly promoted the idea that phages were live
viruses and not "enzymes" as many of his fellow researchers thought.
The priority dispute ceased eventually, and many scientists accepted the
independent discovery of bacteriophages and simply referred to it as the
"Twort-d'Herelle phenomenon" and, later, the "bacteriophage
phenomenon."(9)
2. Classification of phages
The dsDNA tailed phages, or Caudovirales, account for 95% of all the
phages reported in the scientific literature, and possibly make up the
majority of phages on the planet.(77) However, there are other phages
that occur abundantly in the biosphere, phages with different virions,
genomes and lifestyles. Phages are classified by the International
Committee on Taxonomy of Viruses (ICTV) according to morphology
and nucleic acid.
5
Table- 1: ICTV classification of phages
Order Family Morphology Nucleic acid
Caudovirales
Myoviridae Non-enveloped, contractile tail
Linear dsDNA
Siphoviridae Non-enveloped, long non-contractile tail
Linear dsDNA
Podoviridae Non-enveloped, short noncontractile tail
Linear dsDNA
Tectiviridae Non-enveloped, isometric
Linear dsDNA
Corticoviridae Non-enveloped, isometric
Circular dsDNA
Lipothrixviridae Enveloped, rod-shaped Linear dsDNA Plasmaviridae Enveloped, pleomorphic Circular dsDNA
Rudiviridae Non-enveloped, rod-shaped
Linear dsDNA
Fuselloviridae Non-enveloped, lemon-shaped
Circular dsDNA
Inoviridae Non-enveloped, filamentous
Circular ssDNA
Microviridae Non-enveloped, isometric
Circular ssDNA
Leviviridae Non-enveloped, isometric
Linear ssRNA
Cystoviridae Enveloped, spherical Segmented dsRNA
3. Composition of phages
Although different bacteriophages may contain different materials they
all contain nucleic acid and protein.
6
Depending upon the phage, the nucleic acid can be either DNA or RNA
but not both and it can exist in various forms. The nucleic acids of phages
often contain unusual or modified bases. These modified bases protect
phage nucleic acid from nucleases that break down host nucleic acids
during phage infection. The size of the nucleic acid varies depending
upon the phage. The simplest phages only have enough nucleic acid to
code for 3-5 average size gene products while the more complex phages
may code for over 100 gene products.
The number of different kinds of protein and the amount of each kind of
protein in the phage particle will vary depending upon the phage. The
simplest phages have many copies of only one or two different proteins
while more complex phages may have many different kinds. The proteins
function in infection and to protect the nucleic acid from nucleases in the
environment. (75, 77)
4. Structure of phages
Bacteriophages come in many different sizes and shapes. The basic
structural features of bacteriophages are illustrated in figure 1, which
depicts the phage T4.
7
I. Size - T4 is among the largest phages; it is approximately 200 nm
long and 80-100 nm wide. Other phages are smaller. Most phages range
in size from 24-200 nm in length.
II. Head or Capsid - All phages contain a head structure which can
vary in size and shape. Some are icosahedral (20 sides) others are
filamentous. The head or capsid is composed of many copies of one or
more different proteins. Inside the head is found the nucleic acid. The
head acts as the protective covering for the nucleic acid. (77, 75)
III. Tail - Many but not all phages have tails attached to the phage
head. The tail is a hollow tube through which the nucleic acid passes
during infection. The size of the tail can vary and some phages do not
even have a tail structure. In the more complex phages like T4 the tail is
surrounded by a contractile sheath which contracts during infection of the
bacterium. At the end of the tail the more complex phages like T4 have a
base plate and one or more tail fibers attached to it. The base plate and
tail fibers are involved in the binding of the phage to the bacterial cell.
Not all phages have base plates and tail fibers. In these instances other
structures are involved in binding of the phage particle to the bacterium.
(75)
8
5. Morphology of phages
Bacterial viruses are grouped into six morphological types:
- This type is characterized by a hexagonal head and a tail shorter
than the head. The tail has no contractile sheath and may or may
not have tail.
- This type has a hexagonal head however, it lacks a contractile
sheath. Its tail is flexible and it or may not have tail fibers.
- This type has a head made up of small capsomers but has not tail.
- Icosahedra head with no tail which a complex base plate may be
present.
9
- Icosahedra head with a tail. The phage tail may be very short or up
to 4 times the length of head .
- Filamentous bacteriophage which the nucleic acid is in an extended
helical form along the length of the protein coat.(167)
6. Infection of host cells
6.1. Adsorption - The first step in the infection process is the
adsorption of the phage to the bacterial cell. (75)
To enter a host cell, bacteriophages attach to specific receptors on the
surface of bacteria, including lipopolysaccharides, teichoic acids, proteins
or even flagella. This specificity means that a bacteriophage can only
infect certain bacteria bearing receptors that they can bind to, which in
turn determines the phage's host range .(78) This step is mediated by the
tail fibers or by some analogous structure on those phages that lack tail
fibers and it is reversible. The tail fibers attach to specific receptors on the
bacterial cell and the host specificity of the phage (i.e. the bacteria that it
is able to infect) is usually determined by the type of tail fibers that a
phage has. These receptors are on the bacteria for other purposes and
phages have evolved to use these receptors for infection. (75)
6.1.1. Filamentous phages- adsorption of this group e.g.,
ϕM13, Φfd and ϕf1 involve an end to end contact between
10
the viron and the tip of bacterial pilus. (79)
6.1.2 . Tail less (minute)phages- tail less phages have an
attachment organ in the form of a single molecule of “A”
protein present in capsid e.g. ϕU3, ϕQβ and ϕF2. (79)
6.1.3. Tail phages (contractile tail and non-contractile
tail) the irreversible binding of the phage to the bacterium results in
the contraction of the sheath and the hollow tail fiber is pushed
through the bacterial envelop. (75) T-even series Coliphage e.g.; ϕT2,
ϕT4 and ϕT6, whose tails are similar although they may vary in length
and details of collar, and plate and fibers. The contractile tail phages
are an extremely efficient and tend to adsorb rapidly. (74) Non
contractile phages have thin but flexible tails without sheath e.g. T1,
T5 and T6. (78)
6.2. Nucleic Acid Injection -bacteriophages use a syringe-like motion
to inject their genetic material into the cell. After making contact with the
appropriate receptor, the tail fibers bring the base plate closer to the
surface of the cell. Once attached completely, the tail contracts, possibly
with the help of ATP present in the tail, injecting genetic material through
the bacterial membrane.( 78) Usually, the only phage component that
actually enters the cell is the nucleic acid. The remainder of the phage
11
remains on the outside of the bacterium. This is probably due to the
inability of bacteria to engulf materials (75)
6.3. Synthesis of proteins and nucleic acid- Within minutes,
bacterial ribosomes start translating viral mRNA into protein. For RNA-
based phages, RNA replicase is synthesized early in the process. Proteins
modify the bacterial RNA polymerase so that it preferentially transcribes
viral mRNA. The host’s normal synthesis of proteins and nucleic acids is
disrupted, and it is forced to manufacture viral products instead. These
products go on to become part of new virions within the cell, helper
proteins which help assemble the new virions, or proteins involved in cell
lysis. (78)
6.4. Virion assembly- In the case of the T4 phage, the construction of
new virus particles involves the assistance of helper proteins. The base
plates are assembled first, with the tails being built upon them afterwards.
The head capsids, constructed separately, will spontaneously assemble
with the tails. The DNA is packed efficiently within the heads. (78)
6.5. Release of virions- Phages may be released via cell lysis or by
host cell secretion. In the case of the T4 phage, in just over twenty
minutes after injection upwards of three hundred phages will be released
via lysis within a certain timescale. This is achieved by an enzyme called
12
endolysin which attacks and breaks down the peptidoglycan. All released
virions are capable of infecting a new bacterium. (78)
7. Replication cycles of lytic and lysogenic phages
7.1. Lytic phages
After infection, the viral DNA takes over the biosynthetic machinery of
the host cell and uses it to produce the parts needed for production of new
virus particles. Viral DNA replaces the host cell DNA as a template for
both replication (to produce more viral DNA) and transcription (to
produce viral mRNA). Viral mRNAs are then translated, using host cell
ribosomes, tRNAs and amino acids, into viral proteins such as the coat
proteins. The process of DNA replication, synthesis of proteins, and viral
assembly is a carefully coordinated and timed event. (79)
The T-phages, T1 through T7, are referred to as lytic phages because they
always bring about the lysis and death of their host cell, the bacterium E.
coli. (80)
7.2. Lysogenic phages
The indefinite persistence of phage genomes within bacterial cells in the
absence of a productive infection but with the potential to produce
progeny phage under certain circumstances was first recognized in the
1920's.(79) Lysogenic or temperate infection rarely results in lysis of the
13
bacterial host cell. Lysogenic viruses, such as lambda which infects E.
coli, have a different strategy for their replication. After penetration, the
virus DNA integrates into the bacterial Chromosome and it becomes
replicated every time the cell duplicates its chromosomal DNA during
normal cell division. (80)These lysogenized cells are immune to super-
infection by the same phage due to repression of transcription caused by
the resident prophage (79)
7.3. Lysogenic conversion
In a few situations the prophage supplies genetic information such that
the lysogenic bacteria exhibit a new characteristic (new phenotype), not
displayed by the nonlysogenic cell, a phenomenon called lysogenic
conversion. Lysogenic conversion has some interesting manifestations in
pathogenic bacteria that only exert certain determinants of virulence
when they are in a lysogenized state. Hence, Corynebacterium
diphtheriae can only produce the toxin responsible for the disease if it
carries a temperate virus called phage beta (80). Only lysogenic
Streptococci produce the erythrogenic toxin (pyogenic exotoxin) which
causes the skin rash of scarlet fever; and some botulinum toxins are
synthsized only by lysogenic strains of C. botulinum. (80) If the prophage
expresses a toxin gene, then the bacterium will be lysogenically
converted for toxin production. Phage encoded toxins of the
14
Staphylococci include staphylokinase (SAK), staphylococcal entrotoxin,
exfolitive toxin (ETA) and panton-valentine leucocidin (PVL). The gain
in toxin production represents positive lysogenic conversion (252).
Similarly, ϕCJW1 and ϕOmega both have a gene (39 and 61 respectively)
coding for homologues of Lsr2, a major antigen for both cellular and
humoral immunity in M.tuberculosses and M.Leprae (279)
(A) Lytic phages: step 1, attachment; step 2, injection of phage DNA into
the bacterial host; step 3, shutoff of synthesis of host components,
replication of phage DNA, and production of new capsid; step
4, assembly of phages; step 5, release of mature phages (lysis).
(B) Lysogenic phages: steps 1 and 2 are similar to those of lytic phages
(i.e., attachment and injection, respectively); starting with step
3, lysogenic phages can, among other possibilities, initiate a reproductive
cycle similar to that of lytic phages (a) or integrate their DNA into the
15
host bacterium's chromosome (lysogenization) (b). Lysogenized cells can
replicate normally for many generations (1b) or at some point undergo
lysogenic induction (2b) spontaneously or because of inducing agents
such as radiation or carcinogens, during which time the integrated phage
DNA is excised from the bacterial chromosome and may pick up
fragments of bacterial DNA. (79)
8. Phage Genetics
On rare occasions, lysogeny permits the transfer of bacterial genes
between cells by Transduction.
8.1. Generalized Transduction:
When bacterial cells containing phages DNA enter the lytic cycle, phage
enzyme break host cell DNA into many small segments. As the phage
directs synthesis and assembly of new phage particles. It package DNA
by the “headful” (enough DNA of fill the head of a virus). This allows a
bacterial DNA fragment occasionally to be incorporated into a phage
particle. (179) Frequency 105 - 108 per cell. More than one gene may be
cotransduced - limit = packaging size = ~50kbp = ~1% of bacterial
chromosome (143) Once this phage particle, with its newly acquired
bacterial DNA, leaves the infected host, it may infect another susceptible
16
bacteria. Thereby transforming the bacterial genes occurs through the
process of generalized transduction. (179)
General transduction can apparently occur for any marker of the donor
bacterium. only closely linked markers can be transduced by the same
phage particle because the piece of bacterial DNA carried by the phage
correspond to about 1%-2% of the bacterial DNA.`transduction is usually
carried out with a high titer phage preparation obtained from the donor
strain either by lytic infection or by induction of lysogenic cells (180)
8.2. Specialized Transduction:
Results from inaccurate excision of an integrated prophage; some phage
DNA is lost and some bacterial genes are picked up and carried to the
next host - therefore phage are usually defective (non-infectious) and
require replication-competent helper phage to replicate, depending on
which phage genes are lost. (174)
Several lysogenic phages are known to carry out specialized transduction,
but Lambda phage in Escherichia coli has been extensively studied.
Phage usually insert at the specific location when they integrate with a
chromosome. Lambda phage insert into E.coli chromosome between the
gal and bio gene. (177, 178) ϕ105 prophage lies between The B.subtilis
17
leu and phe genes. (293) the best estimate places of ϕ PBS1 in bacillus
subtilis, perhaps between the rodB and hemD genes. (294)
When cells containing prophage are induced to enter the lytic cycle gene
of phages form a loop and are excised from the bacterial chromosome.
In most cases the new phage particles released contain only phage genes.
Occasionally the phage DNA when it was part of the bacterial
chromosome.
Phages, like Coliphage lambda, can carry out specialized transduction in
improper excision of prophage DNA results in inclusion on defective
phage genome of bacterial genes that are linked to bacterial att site.
Specialized transduction of genes linked to the normal att site has been
demonstrated for ϕSpβ, ϕ3T, H2 and IG1, IG3 and IG4 (297).
Only one nondefective specialized transduction phage (Spβ carring the
ilvA gene) has been reported. (272)
8.3. Abortive transduction:
In introduced fragment of bacterial DNA (the exogenate) does not always
undergo either partial insertion (by recombination) or destruction .in the
third choice, abortive transduction, the exogenate persists and expresses
the function of its genes; but since it lacks on origin of replication it cant
18
multiply and it is transmitted unlinearly, i.r., from a cell to only one of its
two daughters. Abortive transduction is easily recognized when a gene of
the exogenate codes for enzyme required for growth on the selective
medium, for through the amount is restricted by the unilinear
inheritance,aboretive transductants for a phototrophic gene can make
micro colonies on minimal medium. Which are detectable with
magnification (170)
8.4. Transposition and Insertional Mutagenesis:
Transposition is a central process in the lifestyle of Mu-like
bacteriophages. Soon after infection into host bacteria, phage DNA
integrates into the host genome by conservative transposition and this is a
preliminary step for both lytic lysogenic cycles (168). Bacteriophage Mu
is one of the best-characterized mobile genetic elements and the first for
which an in vitro DNA transposition reaction was established (272). Also
frequent occurrence of transposable phages (TP) of Pseudomonas
aeruginosa e.g.; B39, PH2, PH51, PH93 and PH132 has been
characterized. (276)
The above mechanisms have been very important in bacterial genetics,
also phages are important as cloning vectors (M13, lambda and cosmids)
19
(278). Methods based on DNA transposition offer versatile tools for
genetic analysis of a variety of biological processes (273). The most
efficient strategies are typically based on essentially random insertions of
mobile DNA elements into the genomes of organisms ranging from
viruses and bacteria to higher eukaryotes. Classical examples include
transposon Tn3 and Tn10 insertions into the genomes of bacteriophages
M13 and , respectively (274,275). As well as insertions of the
transposing bacteriophage D3112 genome into the chromosome of
Pseudomonas aeruginosa PAO for gene and genome analysis (276)
currently, advances in DNA transposition technology are rapidly
generating ever more sophisticated systems for the analysis of single
genes, gene networks, and entire genomes (277).
9. Global phage Diversity
Studies of phage model systems revolutionized biology and established
the field of molecular biology (212). Only recently have the enormous
influences of phage on ecosystems been realized (211, 113). Phages are
extremely common in the environment: there are 1010 phage per liter of
surface seawater (191) and 107 to 109 per g of sediment or topsoil (214-
216). In the ocean, phages are major predators of bacteria and significant
sinks of essential nutrients (e.g., nitrogen and phosphorus) (217). Phages
20
are also major conduits of genetic exchange, transducing an estimated
1025 to 1028 bp of DNA per year in the world's oceans (219).
Approximately 1031 tailed bacteriophages are estimated to be on planet
Earth, representing the majority of all biological entities in the biosphere
(206, 207). Phages exert considerable influence on the microbial
community and cohabit with their bacterial hosts in highly dynamic
relationships (208).
Unicellular cyanobacteria of the genus Synechococcus are among the
most abundant picophytoplankton and account for 5 to 30% of the
primary production in the open ocean (159). The concentrations of viruses
or cyanophages which infect specific strains of marine Synechococcus
spp. typically range from 102 to 104 ml 1 in near shore and offshore
waters (160, 161) and sometimes can be more than 105 phage particles
ml 1 (160). It was found previously that 1 to 3% of marine
Synechococcus spp. from a variety of locations contained mature phages
(162), and cyanophages may be responsible for ca. 5 to 14% of
cyanobacterial mortality on a daily basis (160).The significant of 1031
phage virions in biological terms begins to become clear when one
considers what is being learned about the dynamics of this population.
Estimates of the longevity of phages in the environment (217) suggest
that the entire population turns over every few days.
21
Investigations of overall phage diversity will involve more than just
characterized free phages, since these analyses do not include prophages.
in the marine environment, for example, some studies have shown that
~60% of bacterial isolates contain inducible prophages (222) , although
the incidence of lysogeny can be lower (223, 224) , probably due to
seasonal, temperature and nutrient-level-influenced variation (225-227)
A Norwegian group surprised the scientific community with a report on
the high concentration of phage particles in coastal water and the ocean
and even higher concentrations in lakes (217, 229). In eutrophic
estuarine water, bacteria are found at a density of 106 cells/ml and viruses
with a concentration of 107 particles/ml. These concentrations are
estimates that vary with the seasons and the geographical location. In
addition, these figures refer to physical and not viable entities. A popular
model postulates about 10 to 50 different bacterial species and 100 to 300
different phage strains (230) in this environment. In all of the
environmental samples examined, there were roughly 5 to 10 phage
particles for every bacterial cell. This is the basis for the claim above that
phages are a majority of organisms on the earth. (221)
10. Diversity of Host range of phages
Bacteriophages have the potential to control population levels and
microbial diversity in natural bacterial communities (133). The
22
interactions between bacterial and phage populations have been studied in
dairy cultures (134), soil environments (135, 136), aquatic environments
(137-141), and the phytosphere (142). Studies of bacteriophage infection
have revealed that the process is initiated when the virion interacts with
host cell surface receptor molecules (149). Many bacteriophages are
known to be highly specific for their receptors and show little or no
interaction with receptors with an even slightly different structure. This
specificity forms the basis of numerous phage typing methods for the
identification of bacterial species or subspecies (150).
In contrast, it is clear that some bacteriophages do productively infect a
range of bacterial species. Of these broad-host-range phages, P1 and Mu
are the best studied. Bacteriophage P1 is a generalized transducing virus
capable of plaque formation on several enteric species in addition to
Escherichia coli (151), while bacteriophage Mu produces progeny virions
capable of adsorption to and plaque production on different bacterial
species (152) due to the differential orientation of the invertible viral G
segment region (152, 150). Bacteriophages able to interact with a wide
range of host species would be significant in the control of the
composition and genetic diversity of microbial communities as well as the
processes of transductional gene exchange and the transfer of antibiotic
resistance genes through those communities. The prevalence of broad-
23
host-range phages relates to the origin of virus particles which compose
such a large percentage of the dissolved organic carbon in marine
ecosystems (153-155) and which are present in very large numbers in
other ecosystems as well (156-158).
Phages have been found for a wide range of bacteria. A feature of viruses
is their host specifity.hence phages can only infect bacteria .the specifity
is usually marked and phage may be able to attack only a particular strain
of its host species the basis of this specifity is possession by bacteria of
specific receptor substances on their surfaces or appendages, which
adsorb phage particles. But there are some broad host range bacteria
phages as well which can adsorb on to more than one type of bacteria.
either it recognizes the homologous ligand as it is receptor on the
susceptible hosts or it may recognize different ligand as receptor in them
for e.g. phage B278 which does not only infect E.coli but also
citrobacters therefore suggesting that B278 is a broad host range
bacteriophage which can infect several bacteria (181) The host range of
phage may involve specific bacterial spp.; strain or several bacterial
genera (182) bacteriophages of E.coli are considered reliable indicators of
fecal pollution of natural waters (183, 184) although their use as viral
indicators could also be very interesting. The proposal that these
bacteriophages may be useful as indicators of enteric viruses is based on
24
several facts. They are detected in high numbers in sewage and polluted
waters. They have similar resistances to enteric viruses in aquatic
environments and in water treatment process and their detection is carried
out by simple, inexpensive and rapid techniques (185-187).
Broad host range of phages belonging to the Myovirdae compared to the
host range of phages belong to the Siphoviridae and Podoviridae supports
the findings of shuttle and Chan .(192) proved that bacteriophages are
morphologically diverse in marine environments (188).but the great
genetic variation in the infections marine bacteriophages, which leads to
high levels of species and strain diversity (193)and the phenotypic
diversity and genotypic diversity of the phage populations are related to
the interaction between phages and their host organisms, which provides
a tool for understanding the interaction itself(194) Recent observations
concerning large numbers of viruses in both marine and fresh water
systems ranging from 104 to 107 ml-1(193, 195-199) and the fact that up to
34% of all marine bacteria may contain phage particles (197
11. Phage Ecology and Bacterial Pathogenesis
The impact of phages on bacterial pathogenesis may be derived into
major themes, transduction and predation. (251) Phages can move genes,
including genes encoding bacterial virulence factors (VFs), between
25
bacteria. Many aspects of the phage impact on bacterial pathogenesis
have lysogenic conversion at their root, with prophage encoding and
expressing bacterial VF genes. (252) For example, a well-studies
conversion which is important for pathogenesis occur when the
filamentous cholera toxin CTX ϕ cause vibrio cholera to express cholera
toxin. Over time, a number of toxin genes were found to be phage
encoded, and consideration of the role of phages in bacterial pathogenesis
emphasized the dissemination of toxin genes among bacterial strains
(283). However, it has become increasingly clear that toxin genes are only
a subset of the diverse virulence factors encoded by bacteriophages. For
example, some phages encode regulatory factors that increase expression
of virulence genes not encoded by the phage (284), while others encode
enzymes that alter bacterial components related to virulence (286).
Furthermore, phages have unique properties that enable them to
contribute more directly to bacterial virulence than via transduction.
Structural components of virion particles, for example, may be directly
pathogenic (287).
Observations that may bacterial virulence genes are located in the
genomes of prophages have raised the question over the years of whether
phages serve merely as vectors for transfer of virulence genes or
traditionally contribute to the expression of their genes .(253) stx genes in
Shigella dysenteriae are adjacent to lambdoid phage-like sequences
26
interrupted by numerous insertion sequences, suggesting that the toxin
genes lie in a prophage that has been rendered defective by the insertion
sequences (290). Moreover, transduction of a virulence gene is, in and of
itself, insufficient evidence that the gene and chromosomal virulence
genes have been described. For example, the Staphylococcus aureus
pathogenicity island SapI1, which contains the gene for toxic shock
syndrome toxin (tst), is mobilized at high frequency by the generalized
staphylococcal transducing phage 80 (291); a similar mechanism has not
been ruled out for the transmission of the V. cholerae pathogenicity island
(VPI), which was reported to correspond to the genome of a phage (292).
Prophages, Gifsy-1 in Salmonella enterica LT2 and 14028 (258-260)
Gifsy-2 in Salmonella enterica 14028 and SL 1344( 258, 261), Gifsy-3
(263, 264), Fels-1 (265-266), SopEϕ (267-269) in Salmonella typhi, Vp I
in V.colera(270) and Cp4-57 in E.coli K-12( 271) have role in bacterial
pathogenesis of their respective hosts . In some cases, the expression of
these genes may be driven in part by induction of the prophages that
encode them. Since prophage induction contributes to virulence gene
expression and since the human body is replete with prophage-inducing
chemicals, prophage induction in the human body may be an important,
under recognized mechanism of bacterial pathogenesis.
27
12. Stalin’s antibiotic alternative
Georgian doctors turned to a therapy virtually unknown in the West since
1930; they unleashed the bacteria’s natural predators. (109)
Driving phage therapy’s potential rehabilitation although phages offer
hope against drug resistant bacteria and could soon find a role as a
treatment for burns, diabetic ulcers, and other open wounds, experts
concur that these viral breeds are unlikely to knock antibiotics off their
pedestal for most infections. (110)
13. Historical Background and Early studies of phage therapy
Not long after phage discovery, d'Herelle used phages to treat dysentery,
in what was probably the first attempt to use bacteriophages
therapeutically. The studies were conducted at the Hospital des Enfants-
Malades in Paris in 1919 (10) under the clinical supervision of Professor
Victor-Henri Hutinel, the hospital's Chief of Pediatrics. The phage
preparation was ingested by d'Herelle, Hutinel, and several hospital
interns in order to confirm its safety before administering it the next day
to a 12-year-old boy with severe dysentery. The patient's symptoms
ceased after a single administration of d'Herelle's anti-dysentery phage,
and the boy fully recovered within a few days. The efficacy of the phage
preparation was "confirmed" shortly afterwards, when three additional
patients having bacterial dysentery and treated with one dose of the
28
preparation started to recover within 24 h of treatment. However, the
results of these studies were not immediately published and, therefore, the
first reported application of phages to treat infectious diseases of humans
came in 1921 from Richard Bruynoghe and Joseph Maisin (11), who used
bacteriophages to treat staphylococcal skin disease. The bacteriophages
were injected into and around surgically opened lesions, and the authors
reported regression of the infections within 24 to 48 h. Several similarly
promising studies followed (12, 13, 14), and encouraged by these early
results, d'Herelle and others continued studies of the therapeutic use of
phages (e.g., d'Herelle used various phage preparations to treat thousands
of people having cholera and/or bubonic plague in India (10). In addition,
several companies began active commercial production of phages against
various bacterial pathogens.
Phage therapy, as a clinical method, was rejected altogether in the West
upon the discovery, immediate popularization, and wide-scale
dissemination of penicillin in the early 1940s. (15)
However, in the USSR, interest and research in phages persisted. The G.
Eliava Institute of Bacteriophage, Microbiology, and Virology founded in
Tbilisi in 1934-and generously funded and staffed on Stalin's directive-
engaged in the laborious process of sampling, cultivating, matching, and
producing phage preparations against most known pathogens. In the late
1980s, when the institute was at the height of its scientific achievement,
29
1,200 scientists were employed in R&D, maintaining the extensive phage
collections and producing two tons of phage preparations per day.
Unfortunately, the Georgian civil war of the early 1990s instigated the
demise of the institute, the loss of most of its phage collections, the
collapse of its infrastructure, and, subsequently, the relocation of phage
research and production to Russia. (15, 16)
Phage therapy had been spurred by the chronic shortage of adequate and
sufficient antibiotics. The phage industry has been adversely affected by
the general collapse of the post-Soviet economy, and only a handful of
producers remain. Presently, demand for phage therapeutics greatly
exceeds supply.
Unreliable Soviet research and clinical practices, the absence of an
adequate Soviet scientific publication culture, the Cold War,
communication and language barriers, and lack of interest due to the
entrenched, Western antibiotics doctrine have all contributed to keeping
the accumulated phage-therapy experience out of Western sight and
mind.
Meanwhile, breakthroughs in genetic and molecular biology research in
the 1970s stimulated the emergence of an increasingly analytic approach
to phage research in the West. Thanks to their relatively simple structure,
phages have been extensively researched as biologic models, with an eye
to areas of research ranging from genome mapping to cancer to AIDS
30
research. Phage typing and display methods have become standard tools
in bacteriology.
Phage technologies and products are certain to gain a foothold in clinical
applications, if only to compensate for the ever-increasing decline in the
efficacy of antibiotics. In addition, there is still an untapped,
immeasurable market for phage applications in veterinary, agricultural,
industrial, and environmental remediation. (16, 18)
Table :2. Some of the major human phage therapy studies performed in Poland and the former Soviet Union Reference(s) Infection(s) Etiologic agent(s) Comments Babalova et al. (40)
Bacterial dysentery
Shigella
Shigella phages were successfully used for prophylaxis of bacterial dysentery.
Bogovazova et al. (41)
Infections of skin and nasal mucosa
K. ozaenae, K. rhinoscleromatis, and K. pneumoniae
Adapted phages were reported to be effective in treating Klebsiella infections in all of the 109 patients.
Cislo et al. (42)
Suppurative skin infections
Pseudomonas, Staphylococcus, Klebsiella, Proteus, and E. coli
Thirty-one patients having chronically infected skin ulcers were treated orally and locally with phages. The success rate was 74%.
31
Ioseliani et al. (43)
Lung and pleural infections
Staphylococcus, Streptococcus, E. coli, and Proteus
Phages were successfully used together with antibiotics to treat lung and pleural infections in 45 patients.
Kochetkova et al. (44)
Postoperative wound infections in cancer patients
Staphylococcus and Pseudomonas
A total of 131 cancer patients having post surgical wound infections participated in the study. Of these, 65 patients received phages and the rest received antibiotics. Phage treatment was successful in 82% of the cases, and antibiotic treatment was successful in 61% of the cases.
Kochetkova et al. (44)
Postoperative wound infections in cancer Patients
Staphylococcus and Pseudomonas
A total of 131 cancer patients having post surgical wound infections participated in the study. Of these, 65 patients received phages and the rest received antibiotics. Phage treatment was successful in 82% of the cases, and antibiotic treatment was successful in 61% of the cases.
Kucharewicz-Krukowska and Slopek (45)
Various infections
Staphylococcus, Klebsiella, E. coli, Pseudomonas, and Proteus
Immunogenicity of therapeutic phages was analyzed in 57 patients. The authors concluded
32
that the phages' immunogenicity did not impede therapy.
Kwarcinski et al. (46)
Recurrent subphrenic abscess
E. coli
Recurrent subphrenic abscess (after stomach resection) caused by an antibiotic-resistant strain of E. coli was successfully treated with phages.
Litvinova et al. (47)
Intestinal dysbacteriosis
E. coli and Proteus
Phages were successfully used together with bifidobacteria to treat antibiotic-associated dysbacteriosis in 500 low-birth-weight infants.
Meladze et al. (48)
Lung and pleural infections
Staphylococcus
Phages were used to treat 223 patients having lung and pleural infections, and the results were compared to 117 cases where antibiotics were used. Full recovery was observed in 82% of the patients in the phage-treated group, as opposed to 64% of the patients in the antibiotic-treated group.
Miliutina and Vorotyntseva (49)
Bacterial dysentery and salmonellosis
Shigella and Salmonella
The effectiveness of treating salmonellosis using phages and a combination of
33
phages and antibiotics was examined. The combination of phages and antibiotics was reported to be effective in treating cases where antibiotics alone were ineffective.
Perepanova et al. (50)
Inflammatory urologic diseases
Staphylococcus, E. coli, and Proteus
Adapted phages were used to treat acute and chronic urogenital inflammation in 46 patients. The efficacy of phage treatment was 92% (marked clinical improvements) and 84% (bacteriological clearance).
Sakandelidze and Meipariani (51)
Peritonitis, osteomyelitis, lung abscesses, and postsurgical wound infections
Staphylococcus, Streptococcus, and Proteus
Phages administered subcutaneously or through surgical drains in 236 patients having antibiotic-resistant infections eliminated the infections in 92% of the patients.
Sakandelidze (52)
I nfectious allergoses (rhinitis, pharyngitis, dermatitis, and conjunctivitis)
Staphylococcus, Streptococcus, E. coli, Proteus, Enterococcus, and P. aeruginosa
A total of 1,380 patients having infectious allergoses were treated with phages (360 patients), antibiotics (404 patients), or a combination of phages and antibiotics (576 patients). Clinical improvement
34
was observed in 86, 48 and 83% of the cases, respectively.
Slopek et al. (53-59)
Gastrointestinal tract, skin, head, and neck infections
Staphylococcus, Pseudomonas, E. coli, Klebsiella, and Salmonella
A total of 550 patients were treated with phages. The overall success rate of phage treatment was 92%.
Stroj et al. (60)
Cerebrospinal meningitis
K. pneumoniae
Orally administered phages were used successfully to treat meningitis in a newborn (after antibiotic therapy failed).
Tolkacheva et al. (61)
Bacterial dysentery
E. coli and Proteus
Phages were used together with bifidobacteria to treat bacterial dysentery in 59 immunosuppressed leukemia patients. The superiority of treatment with phage-bifidobacteria over antibiotics was reported.
Weber-Dabrowska et al. (62)
Supportive infections
Staphylococcus and various gram-negative bacteria
Orally administered phages were used to successfully treat 56 patients, and the phages were found to reach the patients' blood and urine.
Zhukov-Verezhnikov et al. (63)
Supportive surgical infections
Staphylococcus, Streptococcus, E. coli, and Proteus
The superiority of adapted phages (phages selected against bacterial strains isolated from individual patients)
35
over commercial phage preparations was reported in treating 60 patients having supportive infections.
14. Commercial production of phages
D'Herelle's commercial laboratory in Paris produced at least five phage
preparations against various bacterial infections. The preparations were
called Bacté-coli-phage, Bacté-rhino-phage, Bacté-intesti-phage, Bacté-
pyo-phage, and Bacté-staphy-phage, and they were marketed by what
later became the large French company L'Oréal (10). Therapeutic phages
were also produced in the United States. In the 1940s, the Eli Lilly
Company produced seven phage products for human use, including
preparations targeted against Staphylococci, Streptococci, Escherichia
coli, and other bacterial pathogens. These preparations consisted of
phage-lysed, bacteriologically sterile broth cultures of the targeted
bacteria (e.g. , Staphylo-lysate) or the same preparations in a water-
soluble jelly base (e.g., Staphylo-jel). They were used to treat various
infections, including abscesses, suppurating wounds, vaginitis, acute and
chronic infections of the upper respiratory tract, and mastoid infections.
However, the efficacy of phage preparations was controversial (111,112),
and with the advent of antibiotics, commercial production of therapeutic
36
phages ceased in most of the Western world. Nevertheless, phages
continued to be used therapeutically together with or instead of
antibiotics in Eastern Europe and in the former Soviet Union. . In many
cases, phages were used against multidrug-resistant bacteria that were
refractory to conventional treatment with antibiotics. (9)
Several institutions in these countries were actively involved in
therapeutic phage research and production, with activities centered at the
Eliava Institute of Bacteriophage, Microbiology, and Virology (EIBMV)
of the Georgian Academy of Sciences, Tbilisi, Georgia, and the Hirszfeld
Institute of Immunology and Experimental Therapy (HIIET) of the Polish
Academy of Sciences, Wroclaw, Poland. (9) the most detailed studies
published in English on the use of phages in clinical settings have come
from HIIET institute (53-59).
15. Preclinical study of phage therapy in animals
One of the best-known series of recent studies on the use of phages in
veterinary medicine came from the laboratory of William Smith and his
colleagues in 1982(19-22) at the Institute for Animal Disease Research in
Houghton, Cambridgeshire, Great Britain. In one of their early papers
(19), the authors reported the successful use of phages to treat
experimental E. coli infections in mice. During subsequent studies (20,
37
21, 22), the authors found that a single dose of specific E. coli phage
reduced, by many orders of magnitude, the number of target bacteria in
the alimentary tract of calves, lambs, and piglets infected with a diarrhea-
causing E. coli strain. The treatment also stopped the associated fluid loss,
and all animals treated with phages survived the bacterial infection. These
studies were reviewed by other authors (23, 24, 26) and were evaluated
using mathematical models and statistical analyses (27). Also, the success
of these studies rekindled interest in phage therapy in the West and
prompted other researchers to investigate the effect of phages on
antibiotic-resistant bacteria capable of causing human infections. For
example, Soothill et al. (28, 29, 30) reported the utility of phages in
preventing and treating experimental disease in mice and guinea pigs
infected with Pseudomonas aeruginosa and Acinetobacter, and they
suggested that phages might be efficacious in preventing infections of
skin grafts used to treat burn patients. However, it is unclear whether any
of these "preclinical" studies were used as the basis for subsequent human
clinical trials. In fact, although many human trials probably were
preceded by at least some preliminary testing with laboratory animals,
there are only a very limited number of publications in which such an
approach can be traced. One example is recent studies (31, 32) evaluating
the efficacy of bacteriophages for the treatment of infections caused by
Klebsiella ozaenae, Klebsiella rhinoscleromatis scleromatis and
38
Klebsiella pneumoniae. The phage preparation was reported (31) to be (i)
efficacious in treating experimental infections of mice and (ii) nontoxic in
mice and guinea pigs; i.e., gross and histological changes were not
observed after intravenous (i.v.), intranasal, and intraperitoneal
administration, even after a dose approximately 3,500-fold higher
(estimated by body weight) than the human dose was given to mice
during acute toxicity studies. In addition, the authors delineated the
optimal phage concentration and administration route and reported other
pertinent details which they considered to be important in designing
subsequent human volunteer trials. They subsequently (32) used the
results of their preclinical studies to evaluate the safety and efficacy of the
phages in treating 109 patients having Klebsiella infections. The phage
preparation was reported to be both effective (marked clinical
improvements with associated bacteriological clearance) in treating
Klebsiella infections and nontoxic for the patients. (9)
Other studies (130) demonstrated that a single intramuscular dose of an
anti-K1 phage preparation (3 x 108 PFU) was more effective than multiple
doses of antibiotics in protecting mice from an Escherichia coli
O18:K1:H7 infection. Later studies showed that a single oral dose of E.
coli-specific phage could successfully reduce, by many orders of
magnitude, the number of bacteria in the alimentary tract of calves,
39
piglets, and lambs infected with an enteropathogenic E. coli strain
(131,132) Phages have also been used successfully to prevent bacterial
disease in fish (210) Western scientists are aware of the reported high
success rate despite the positive results obtained with the phage treatment
of E. coli infections in a number of farm animals (calves, piglets, lambs
and chickens) (201-203).
16. Prophylaxis and treatment of bacterial infections in human
The international literature contains several hundred reports on phage
therapy in humans, with the majority of recent publications coming from
researchers in Eastern Europe and the former Soviet Union and only a
few reports (33, 34, 35) published in other countries. In the English
language literature, several reviews of phage therapy have recently been
published (36, 37, 38). Some of the major human phage therapy studies
from Poland and the former Soviet Union are summarized in Table 2.
Phage therapy in humans were reported by Slopek et al., who published a
series of six papers (53-59) on the effectiveness of phages against
infections caused by several bacterial pathogens, including multidrug-
resistant mutants(59). Five hundred fifty patients having bacterial
septicemia and ranging in age from 1 week to 86 years were treated at a
40
total of 10 clinical departments and hospitals located in three different
cities. Antibiotic treatment (no information was given about the specific
antibiotics used) was reported to be ineffective in 518 of the patients,
leading to the decision to use phage therapy. The etiologic agents in the
studies of Slopek et al. (53-59) were Staphylococci, Pseudomonas,
Escherichia, Klebsiella, and Salmonella, and treatment was initiated after
isolating the etiologic agents and selecting specific, highly potent phages
from a collection of more than 250 lytic phages. Phages were
administered as follows: (i) orally, three times a day before eating and
after neutralizing gastric acid by oral administration of baking soda or
bicarbonated mineral water a few minutes prior to phage administration;
(ii) locally, by applying moist, phage-containing dressings directly on
wounds and/or pleural and peritoneal cavities; and (iii) by applying a few
drops of phage suspension to the eye, middle ear, or nasal mucosa. During
the course of phage treatment, the etiologic agents were continuously
monitored for phage susceptibility, and if phage resistance developed,
phages were replaced with different bacteriophages lytic against the
newly emerged, phage-resistant bacterial mutants. The duration of
treatment was 1 to 16 weeks, and in some cases phages were applied for
up to 14 days after negative cultures were obtained. The rates of success
(marked to complete recovery in conjunction with negative cultures)
41
anged from 75 to 100% (92% overall) and were even higher (94%) with
the 518 patients for whom antibiotic therapy was ineffective. (9)
In other study, Staphylococcus aureus phages were used to treat patients
having purulent disease of the lungs and pleura. The patients were
divided into two groups; the patients in group A (223 individuals)
received phages, and the patients in group B (117 individuals) received
antibiotics. Also, this clinical trial is one of the few studies using e.g.
phage administration (48 patients in group A received phages by e.g.
injection). The results were evaluated based on the following criteria:
general condition of the patients, X-ray examination, reduction of
purulence, and microbiological analysis of blood and sputum. No side
effects were observed in any of the patients, including those who received
phages intravenously. Overall, complete recovery was observed in 82%
of the patients in the phage-treated group as opposed to 64% of the
patients in the antibiotic-treated group. Interestingly, the percent recovery
in the group receiving phages intravenously was even higher (95%) than
the 82% recovery rate observed with all 223 phage-treated patients. (121)
In other publications (Table-2), phages were reported to be effective in
treating cerebrospinal meningitis in a newborn (60), skin infections
caused by Pseudomonas, Staphylococcus, Klebsiella, Proteus, and E. coli
(42), recurrent subphrenic and subhepatic abscesses (46), and various
42
chronic bacterial diseases (64). In addition to being effective in the
treatment of long-term supportive infections, phage therapy was found, in
a recent study (62), to normalize tumor necrosis factor alpha (TNF- )
levels in serum and the production of TNF- and interleukin-6 by blood
cell cultures. One of the most, extensive studies evaluating the utility of
therapeutic phages for prophylaxis of infectious diseases was conducted
in Tbilisi, Georgia, during 1963 and 1964 (65) and involved phages
against bacterial dysentery. A total of 30,769 children (6 months to
7 years old) were included in the study. Of these, children on one side of
the streets (17,044 children) were given Shigella phages orally (once
every 7 days), and the children on the other side of the streets (13, 725)
did not receive phages. The children in both groups were visited on a
once-a-week basis to administer phages and monitor their overall health
status. Fecal samples from all children having gastrointestinal disorders
were tested for the presence of Shigella spp. and other, unspecified
diarrhea-causing bacteria. Based on clinical diagnosis, the incidence of
dysentery was 3.8-fold higher in the placebo group than in the phage-
treated group during the 109-day study period; based on the culture-
confirmed cases, the incidence of dysentery was 2.6-fold higher in the
placebo group than in the phage-treated group. An interesting outcome of
the study was that there was an overall reduction (2.3-fold) in diarrhea
diseases of unknown origin among children treated with phages compared
43
to the children in the placebo group. This may have been observed
because some dysentery cases were not diagnosed as such (but were
prevented with the Shigella phage preparation) or because the phage
preparation, although developed specifically against Shigella species, was
also active against some additional gastrointestinal pathogens.
Many similar clinical studies, albeit conducted on a smaller scale, have
yielded similar results (Table-1). To give but a few examples, phages
have been reported to be effective in treating staphylococcal lung
infections (64, 66), P. aeruginosa infections in cystic fibrosis patients
(67), eye infections (68), neonatal sepsis (69), urinary tract infections
(70), and surgical wound infections (71, 72).
17. Bacteriophages as therapeutic agents:
Today’s escalating antibiotics crisis is the direct result of the large scale
and indiscriminant over-use of antibiotics and disinfectants, which has
triggered on increased in quantity ,variety and proliferation of multi-drug
resistance and consequently, particularly virulent bacterial pathogens.
These pathogens have developed resistance to virtually all drugs,
including the 4th generation of antibiotics.
44
Over all, the data substantiate the rising use of newer or broader spectrum
agents and the declining use of older or narrower-spectrum agents. (210)
The emerging antibiotics crisis of the 1990s, however, has triggered a
renewed-though fledgling-interest in phage therapy within the American
and European research communities. Attempts are currently being made
to review the vast body of Eastern European work in the area. (17)
17.1. Mode of action
Only the lytic phages (also known as virulent phages) are a good choice
for developing therapeutic phage preparations. The lytic cycle is a
sequence of events that lytic phages multiply inside the cell, and release a
burst of phages through the membrane, thus lysing the cell. (17) The
basic lytic cycle is shown in Figure 2.
17.2. Safety profile
From a clinical standpoint, phages appear to be innocuous. During the
long history of using phages as therapeutic agents in Eastern Europe and
the former Soviet Union (and, before the antibiotic era, in the United
States), phages have been administered to humans (i) orally, in tablet or
liquid formulations (105 to 1011 PFU/dose), (ii) rectally, (iii) locally (skin,
eye, ear, nasal mucosa, etc.), in tampons, rinses, and creams, (iv) as
45
aerosols or intrapleural injections, and (v) intravenously, albeit to a lesser
extent than the first four methods, and there have been virtually no reports
of serious complications associated with their use (Table-1). In the United
States, because of its apparent safety, phage phi X174 has been used to
monitor humoral immune function in adenosine deaminase-deficient
patients (118) and to determine the importance of cell surface-associated
molecules in modulating the human immune response (119) (in the latter
study, phages were intravenously injected into volunteers). Also, phages
are extremely common in the environment (e.g., nonpolluted water has
been reported [120] to contain ca. 2 × 108 bacteriophage per ml) and are
regularly consumed in foods. However, it would be prudent to ensure
further the safety of therapeutic phages before widely using them as
therapeutic agents. For example, it would be important to ensure that they
(i) do not carry out generalized transduction and (ii) possess gene
sequences having significant homology with known major antibiotic
resistance genes, genes for phage-encoded toxins, and genes for other
bacterial virulence factors. (9)
18. Comparison of phages and antibiotics
Lytic phages are similar to antibiotics in that they have remarkable
antibacterial activity. However, therapeutic phages have some at least
46
theoretical advantages over antibiotics, and phages have been reported to
be more effective than antibiotics in treating certain infections in humans
(92, 93, 94) and experimentally infected animals (95). For example, in
one study (96), Staphylococcus aureus phages were used to treat patients
having purulent disease of the lungs and pleura. The patients were divided
into two groups; the patients in group A (223 individuals) received
phages, and the patients in group B (117 individuals) received antibiotics.
Also, this clinical trial is one of the few studies using i.v. phage
administration (48 patients in group A received phages by i.v. injection).
The results were evaluated based on the following criteria: general
condition of the patients, X-ray examination, reduction of purulence, and
microbiological analysis of blood and sputum. No side effects were
observed in any of the patients, including those who received phages
intravenously. Overall, complete recovery was observed in 82% of the
patients in the phage-treated group as opposed to 64% of the patients in
the antibiotic-treated group. Interestingly, the percent recovery in the
group receiving phages intravenously was even higher (95%) than the
82% recovery rate observed with all 223 phage-treated patients.
47
Table: 3. Comparison of the prophylactic and/or therapeutic use of phages and antibiotics Bacteriophages Antibiotics Comments Very specific (i.e., usually affect only the targeted bacterial species); therefore, dysbiosis and chances of developing secondary infections are avoided (97).
Antibiotics target both pathogenic microorganisms and normal micro flora. This affects the microbial balance in the patient, which may lead to serious secondary infection
High specificity may be considered to be a disadvantage of phages because the disease-causing bacterium must be identified before phage therapy can be successfully initiated. Antibiotics have a higher probability of being effective than phages when the identity of the etiologic agent has not been determined.
Replicate at the site of infection and are thus available where they are most needed (95).
They are metabolized and eliminated from the body and do not necessarily concentrate at the site of infection
The "exponential growth" of phages at the site of infection may require less frequent phage administration in order to achieve the optimal therapeutic effect.
No serious side effects have been described.
Multiple side effects, including intestinal disorders, allergies, and secondary infections (e.g., yeast infections) have been reported (98).
A few minor side effects reported (101,102) for therapeutic phages may have been due to the liberation of endotoxins from bacteria lysed in vivo by the phages. Such effects also may be observed when antibiotics are used (103).
48
Phage-resistant bacteria remain susceptible to other phages having a similar target range.
Resistance to antibiotics is not limited to targeted bacteria.
Because of their more broad-spectrum activity, antibiotics select for many resistant bacterial species, not just for resistant mutants of the targeted bacteria (104).
Selecting new phages (e.g., against phage-resistant bacteria) is a relatively rapid process that can frequently be accomplished in days or weeks.
Developing a new antibiotic (e.g., against antibiotic-resistant bacteria) is a time-consuming process and may take several years (99, 100).
Evolutionary arguments support the idea that active phages can be selected against every antibiotic-resistant or phage-resistant bacterium by the ever-ongoing process of natural selection.
19. The Phage Advantage
Phages thrive in the presence of bacteria, and die out in their
absence.
Because of phages' extreme specificity and chemically large nature,
they have induced neither side nor adverse effects when used as
therapy in clinical practice.
Phages do not cause allergies or affect the body's natural immune
system.
49
Phages generally display a low chemotherapeutic index,
particularly upon primary administration systemically or upon
topical administration, and they are vastly more diverse in their
potential to overcome bacterial resistance than known antibiotics
also displaying comparatively low chemotherapeutic indices.
Phages support and enhance vital micro flora (in contrast with the
indiscriminate action of wide-spectrum antibiotics, which can
decimate the body's protective normal micro flora). (91)
Phages may be used both prophylactically and in the treatment of
ongoing infections.
Phages constantly evolve and can adapt in situ to resistant bacteria
strains.
Phages may also be more effectively targeted to growing bacteria
in local infections.
Phages are administered in a limited number of small doses over a
short period of time. (90)
Phages eliminate pathogens more rapidly and effectively than
standard antibiotics.
Phage medicines have a long shelf life (up to 2 years).
Production costs of phages are low.
Phage therapy is consistent with "green-natural-alternative"
ideology, and its production is environment-friendly.
50
Phages present the only viable alternative and, potentially, the last
resort for the treatment of antibiotic-resistant pathogens.(90, 91)
20. Food and Agriculture: Testing Grounds for Phage Therapy
According Biophage Pharma to curb the spread of antibiotic resistance
from the burgeoning use of agricultural drugs, they have to aired draft
regulations requiring manufacturers to test potential livestock
pharmaceuticals for their ability to help pathogens acquire resistance to
human drugs.
Bacteriophages against Salmonella and pathogenic strains of Escherichia
coli are major concern. (105, 109) Ilenchuk and other advocates are also
eyeing the use of phages in food processing.
Intralytix already has a permit from the U.S. Environmental Protection
Agency to test a phage against the bacterium Listeria monocytogenes in a
food-processing plant; although in this trial the phages cannot be applied
to surfaces that come into contact with food. They also develop phage
preparations to spray on eggs to reduce Salmonella contamination. They
could can target the five or six serogroups most commonly associated
with human illness (106)
In August, 2006 the United States Food and Drug Administration (FDA)
approved using bacteriophages on certain meats to kill the Listeria
51
monocytogenes bacteria, giving them GRAS status (Generally
Recognized As Safe). (122) Government agencies in the West have been
looking to Georgia and the Former Soviet Union for help with exploiting
phages for counteracting bio-weapons and toxins e.g. Anthrax, Botulism.
There are many developments with this amongst research groups in the
west.(123)
Fresh-cut produce might also be candidates for phage treatment. (109) A
team at the U.S. Department of Agriculture (USDA), working with
Intralytix, has found that phages are more effective than chlorine at
ridding cut fruits and vegetables of Salmonella. At least two dozen other
phage firms worldwide are hoping to get a foothold in the food and
livestock market. (109)
Shadowing the corporate push is surging academic interest in using
phages to improve food safety. For example, a team of phage biologist
(107) has isolated phages against Vibrio vulnificus, a bacterium
sometimes found in raw oysters that can trigger severe illness in people.
The researchers have used these phages to cure infected mice and are
trying to harness the phages for depurating oysters for human
consumption. (109)
In a similar vein at Evergreen state Dr.Kutter’s team is working with
USDA to find phages that can clear the deadly E. coli O157:H7 from
52
cattle guts. The strain doesn’t seem to bother cows, but outbreaks traced
to undercooked hamburgers and unpasteurized fruit juices have killed
scores of people. All these potential applications would require regulatory
approval. (108)
21. Other application of phages:
There are different uses of phages, include spray application in
horticulture for protecting plants and vegetable produce from decay and
the spread of bacterial disease. (123)
Bacteriophages are used as a biocide for environmental surfaces e.g.
hospitals - and as a preventative treatment for catheters and medical
devices prior to use in clinical settings. The technology now exists for
phages to be applied to dry surfaces e.g. uniforms, curtains - even sutures
for surgery. (128) Clinical trials reported (123) show success in
veterinary treatment of pet dogs with otitis.
Another use of bacteriophages is by the company Cambrios
Technologies. Its founder (124) pioneered the use of the M13
bacteriophage to create nanowires and electrodes. She started her research
by studying how abalone create their shells from calcium carbonate in sea
water. She took this concept and applied it to bacteriophages. One of her
53
ventures consisted of implanting gold and cobalt oxide in a bacteriophage
to create a paper-thin electrode. The gold was for conductivity. The
cobalt oxide was for the actual use of the battery (125)
22. Possible Problems and Resistance
The introduction of Phage Therapy is expected to encounter the following
obstacles:
Pervasive fixation on chemical antibiotics within the clinical
establishment;
Resistance of the pharmaceutical sector, which is heavily invested
in chemical antibiotics; (244)
Physicians' reluctance to forego wide-spectrum antibiotics in favor
of the highly specific phages;
Structural and functional reorganization required for a coordinated
and responsive diagnosis-production-administration chain;
Pervasive aversion within the biotech research establishment to
revert to "archaic" microbiology;
Need to constantly adapt and refresh phage preparations in
response to pathogen evolution;
Delay between clinical presentation and antibacterial
administration;
General disregard for Russian research and clinical practices;
54
Concerns with bacterial evolution of resistance to phages; and
Lack of a regulatory reference basis. (247, 250)
55
A. Equipments:
1. High Speed Centrifuge machine Model: Multifuge Heraeus-3S
2. Incubator Model : EN-400 (NEL)
3. Vortexer Model: Heioloph-REA × 2000
4. pH meter Model: CG 825 Digital Labor (Schott)
5. Micropipettes Juster Model: Nichipet EX
6. Shaker Incubator Model: S-301 Cul TI.Biotech JMC
7. ELISA Reader Model: TECAN-Magellan
8. Hot plate Model: IKA-Combimag RCH
9. Balance Model: Monobloc-B2002-5
10. Microfuge Machine Model: Heraeus-Spatech
11. Plate Shaker Machine Model: Shelton-Scientific MFG
INC_USA
12. Thermocycle Machine Model: Biometra T1-Whatman
13. Centrifuge Model: Hettich D 2800 Bremen-Germany
14. SDS-Gel Apparatus Model : ABN-7.5 Cm Horizontal
Submarine Unit
15. Protein Gel Apparatus Model: LKB .Bromma 2050 MID
Gel
16. Electrophoresis Unit: ABN-7.5Cm Horizontal Submarine
Unit-USA
56
17. UV Illuminator Model: Kurzwelle .254 NM
18. Immnoelecterophoresis Apparatus Model: Shanodon
19. Water Bath Model : GFL-Germany
20. Microscope Model: Nikon- SE-Type 102
21. Transmission Electron Microscope Model: GOEL-JEM-
1200 EX II
22. Power Supply Model: Desatronic-D-6900
Heidelber.Germany
23. Vaccum pump Model: Rocker -300 oil-less Cat#
167300
24. Ultrasonic homogenizer Model: 4710 series-USA
25. Digital Oven Model: Hot air Sterilizer,No:Yco-010
Gemmy 888
26. Western Blot Apparatus Model: Bio-Rad- mini Trans-
Blot®cell USA
B. Bacterial strains:
Bacterial strains used were different strains of Pseudomonas (Ps.
aeroginosa, P7, P3, P5, P6), Klebsiella, E.coli spp (E.coli 2, 3, 40MD,
Fpl-5014, HM-8305, 13-6aLac) , Salmonella typhyimurium spp ( S.typhi,
para A, para B.) , Staphylococci which were clinical isolated.
57
C. Media:
-Luria Basal (L.B) Agar, Soft Agar, Broth
-Mac Conky Agar (plain)
-Trypton Agar (plain)
-Triple Sugar Iron (TSI)
-Simon citrate
-Eosin Methylen Blue (EMB)
-Pyocinin Base Agar (plain)
-Florescent Base Agar (plain)
-Coliform Agar (plain)
-Minimal media (plain)
D. Antibiotics:
• Nalidixic Acid
• Ampicilin
• Gentamicin
• Tetracycline
E. Salts:
• 0.1 M MgSO4 Solution
58
Salt was dissolved in distilled water and filter sterilized (or autoclaved).
This was the 10× stock solution.
• 0.1 M CaCl2 Solution
Salt was dissolved in distilled water and filter sterilized (or autoclaved).
This was the 10× stock solution.
• Bile salt (0.15% W/V) Solution
Salt was dissolved in distilled water and filter sterilized. This was the 10×
stock solution.
F. Solutions:
• Antibiotic Solution:
Stock solution of antibiotic was prepared in the concentration of 5 mg/ml.
This solution was filter sterilized and was stored at -4°C
• Ethidium Bromide Solution:
Stock solution of EBS was prepared in the concentration of 10mg/ml.
This solution was stored at 4°C.
• SDS Solution:
Stock Solution of SDS was prepared to the concentration of 10% and
filter sterilized.
59
• Dextran Sulphate Solution:
Stock solution of Dextran sulphate was prepared to the concentration of
20%.
The solution stored at 4°C.
• Uranyle acetate Solution:
Stock solution of Uranyle acetate was prepared freshly in the
concentration of 2% and kept at 4°C. (Used within a week)
• Calf Thymus DNA Solution:
Calf thymus DNA was mixed with nuclease free water. It was sheared for
15 min. sheared DNA was denatured at 100°C for 10 min and
immediately chilled on ice. Solution was stored at -20°C.
G. Buffers:
• Electrode Buffer:
Tris-HCl 0.025M
Glycin 0.24 M
SDS 0.1 %
pH 8.4
• TAE Buffer:
Tris-HCl 0.04 M
60
CH3COONa 0.02 M
EDTA 0.002 M
pH 8
• DNase I reaction Buffer:
CH3COONa 10mM
Mg SO4 5 mM
pH 5
• RNase A reaction Buffer:
CH3COONa 10mM
Mg SO4 5mM
ZnSO4 0.5mM
pH 5
• SM Buffer:
Tris-HCl 50mM
NaCl 100mM
Mg SO4 8mM
Gelatin 0.01%
pH 7.5
61
• Phage Buffer:
NaCl 150mM
Tris-HCl 40 mM
Mg SO4 10mM
pH 7.4
• SSC Buffer:
NaCl 3M
NaC6H5O7 0.3M
pH 7
• Denature Buffer:
NaCl 1.5M
NaOH 0.5M
• Neutralized Buffer:
Tris-HCl 1M
NaCl 1.5M
pH 8
• Transfer Buffer:
NaOH 400mM
62
NaCl 1M
• PBK Buffer:
NaHPO4 0.3M
KCl 0.15M
pH 7.5
• Barbitol Buffer:
-5,5-Diethyl barbituric acid Ionic Strength 0.02
-5,5-Diethyl barbituric acid Ionic Strength 0.05
pH 8.6
• Coating Buffer:
Na2CO3 0.15%
NaH CO3 0.29%
pH 9.6
• Blocking Buffer:
BSA 1%
Tween 20 0.02%
In Strile PBS
63
• EIA Buffer:
BSA 0.1%
Tween 20 0.1%
In strile PBS
• Washing Buffer:
Tween 20 0.02%
In Strile PBS
• Phosphate Buffered Saline (ELISA)
NaCl 0.8%
KCl 0.02%
Na2HPO4 0.14%
KH2PO4 0.02%
pH 7.2-7.4
• Transfer Buffer:
Tris-HCl 0.025 M
Glycine 0.192 M
64
• TBS Buffer:
Tris 0.01 M
NaCl 0.15M
Tween-Twenty 0.05%
H. Animals:
• Pathogen free Balb/C mice were maintained in a sterile cage, under
sterile bedding. They were fed enriched heated food and sterile water.
Mice weighing 27 to 32 gm were used through out.
• Randomly bred rabbits with no detectable serum agglutinins to
Salmonella typhimurium were used.
Rabbits weighing 691 to 1036 gm were used.
I. Media and Chemicals:
Following media and chemicals:
Glucose, Agar-agar, Brain Heart Infusion (BHI) broth , Sodium
Hydroxide (NaOH) , Sodium Carbonate (Na2CO3), Sodium bi-Carbonate
(NaHCO3), Ethanol, Bile Salt, Eosin Methyl Blue(EMB) Media,
Potassium Chloride KCl, Magnesium Sulphate (MgSO4), Calcium
65
Chloride (CaCl2), 5,5-Diethyl barbituric acid , Sucrose, Triple Sugar
Iron(TSI) Media, Sodium Dedeocyle Sulfate (SDS), Simon Citrate Media
and Nutrient Broth Media used were from Merk Company.
Sodium acetate, Peptone, Ethylene Diamine Tetra Acetic Acid(EDTA),
Tris-HCl, Agarose, Low melting Agarose, Tween 20, Tween 80, Phenol,
Isopropanol, Bis, N, N, N’, N’-Tetramethylethylenediamine ( TEMED
)and Acrylamide used were from Sigma Company.
Poly Ethylene Glycol (PEG) 6000, PEG 8000(Cat# V3011) and Nuclease
free water used were from Promega Company.
Bromo Phenol Blue dyes, Comassi Blue Dye used were from Fluka
Company.
Acetic acid, Chloroform and Methanol used were from BioM
Laboratories.
Agarose (Specially purified and tested for used in determination of
Australia Antigen) used were from BDH Chemicals.
Sodium Chloride (NaCl) used was from Fisher Scientific Company.
Ammonium per Sulphate used was from Gibcobel-Life Technologiest
Chemicals.
66
J. Miscellaneous:
Eppendrof, yellow and blue tips, micropipettes of 10 λ, 100 λ and 1000λ
was from eppendrof Co. All Glassware used in this study were Pyrex-
IWAKI
67
Address of Firms
● Promega Corporation
2800 Woods Hollow Road
Madison, WI 53711-5399
USA
PH 800-356-9526
FX 800-356-1970
www.promega.com
● Sigma Chemical Company
P.O. Box 14508
St. Louis, MO 63178
USA
PH 800-325-3010
FX 800-325-5052
www.sigma.com
● Merck Company:
Merk KGOA 64271.
68
Darmstadt-Germany
www.Merk.de
● BDH Company:
BDH Chemical –LtD.
UK.
www.BDH.co.com
● BioM Company:
BioM Laboratories
Carritos
USA
● Fisher Scientific Company
10700 Rocky Road
P.O. Box 1307
Houston, TX 77099
USA
PH 800-441-2368
www.Fisher.co.uk
69
● Ambion
2130 Woodward St.
Suite 200
Austin, TX 78744
USA
PH 512-445-6979
FX 512-445-7139
● Amersham Life Science, Inc.
2636 South Clearbrook Drive
Arlington Heights, IL 60005-4692
USA
PH 800-323-9750
FX 800-228-8735
● Bio-Rad Laboratories
Life Sciences Group
2000 Alfred Nobel Drive
Hercules, CA 94547
USA
70
PH 800-424-6723
FX 800-879-2289
● Difco Laboratories
P.O. Box 331058
Detroit, MI 48232-7058
USA
CONTRACT #V797P-5951J
● Fluka Chemical Corporation
980 South Second Street
Ronkonkoma, NY 11779-7238
USA
PH (800) 358-5287
FX (800) 358-5287
● Medicell International LTD
239 Liverpool Road, London N1 ILX
PH (071) 607 2295
71
FX (071) 700 4156
● Hittich Co.
H.Jurgens & Co.
Germany
P.O.Box : 104449
● AutoBio Diagnostics Co. LTD.
No.87
Jingbei Yi Road.Zhengzhou Economics
Technological Development
PH: 0086 371 66781166
FX: 0086 371 66781199
72
List of Kits ● Wizard® Lambda preps
DNA purification system
Promega Corporation
● Wizard® SV Gel & PCR clean up system
Promega Corporation
● Wizard® PCR Master Mix
Promega Corporation
● Restriction Enzymes
(EcoR I, Bam H I, Hpa I, Hpa II, Cla I, Dra I, Msp I, Hind III)
Promega Corporation
● Southern Blotting kit
Ambion Co.
USA
● ELISA kit
AutoBio Diagnostics Co.LTD
73
APPENDIX I Lysates Key-I Lysates prepared from sewage samples٭ Lysate No.
Description
M76 Sewage (Mahmood abad area) S1 Sewage (NIPA area) S2 Sewage ( KU) C97 Sewage (civil hospital) was prepared in P3 without salts conditions C98 Sewage (civil hospital) was prepared in P7 in no salts conditions B72 Sewage (Boat basin) M77 Lysate prepared in Ps.a by using M76 without salts conditions. M76al Amplified large plaque form M76 (sewage sample) M76am Amplified large plaque form M76 (sewage sample) M76as Amplified large plaque form M76 (sewage sample) B78 Lysate prepared in Ps.a by using B72 without salts conditions M79 Lysate prepared in Ps.a by using M76 in present of MgSO4 and
CaCl2 B80 Lysate prepared in Ps.a by using B72 in present of MgSO4 and
CaCl2 M81 Induced lysate of lysogen Ps in presence of Bile salt. M82 Induced lysate of lysogen P3 in presence of Bile salt M83 Induced lysate of Lysogen P7 in presence of Bile salt M84 Lysate M81 was prepared in P3 in presence of Bile salt M85 Lysate M81 was prepared in P3 in presence of MgSO4 and CaCl2 M86 Lysate M81 was prepared in P7 without salts conditions M87 Lysate M82 was prepared in P3 in presence of Bile salt M88 Lysate M82 was prepared in P3 in presence of MgSO4 and CaCl2 M89 Lysate M82 was prepared in P7 without salts conditions M90 Lysate M83 was prepared in P3 in presence of Bile salt M91 Lysate M83 was prepared in P3 in presence of MgSO4 and CaCl2 M91as Lysate prepared after amplification of single small size plaque of
Lysate M91 M91am Lysate prepared after amplification of single medium size plaque of
Lysate M91 M91al Lysate prepared after amplification of single large size plaque of
Lysate M91 M92 Lysate M83 was prepared in P7 without salts conditions. M93 Lysate prepared after induction of large resistant colony by Bile salt M94 Lysate prepared after induction of small resistant colony by Bile salt C101 Lysate prepared after induction of single colony of P7 by
Tetracycline B72a Amplified lysate of B72 Plaque assay and Spot assay of above lysate (our collection) was performed but٭ were not further characterized.
74
Lysate Key-II
Lysates prepared from Clinical specimen(Urine) Lysate No.
Description
U Urine sample U1 Lysate prepared in P5 by using Urine in presence of MgSO4 and
CaCl2 U2 Lysate prepared in P6 by using Urine in presence of MgSO4 and
CaCl2 U7 Lysate prepared by induction of E.coli-N by Serum U9 Lysate prepared by induction of E.coli-N by Urea U10 Lysate prepared by induction of E.coli-N by Uric acid U12 Lysate prepared in E.coli40MD using Urine as source of phage and
exposed by UV U13 Lysate prepared by induction of E.coli 2 and urine by UV U14 Lysate prepared by induction of E.coli-N by UV P5urea Induced lysate of P5 by urea P6urea Induced lysate of P6 by urea PS5 Amplified small plaque from lawn of P5 PL5 Amplified large plaque from lawn of P5 PS6 Amplified small plaque from lawn of P6 PL6 Amplified large plaque from lawn of P6
75
APPENDIX-II
List of Bacterial Strains
S.No. Bacterial Host Origin 1. Psedomonas aeroginusa
(Ps.a) Laboratory isolate
2. Pseudomonas aeruginosa 3 (Ps. 3)
Laboratory isolate
3. Pseudomonas aeruginosa 5 (Ps. 5)
Laboratory isolate
4. Pseudomonas aeruginosa 6 (Ps. 6)
Laboratory isolate
5. Pseudomonas aeruginosa 7 (Ps.7)
Laboratory isolate
6. Escherichia coli-N Clinical isolate ( UTI female patient)
7. E.coli 40MD Kindly Procured by Dr.Hajra khatoon(ATCC)
8. E.coli FPL-5014 ATCC 9. E.coli HM 8305 ATCC 10. E.coli 13-6aLac ATCC 11. Klebsiella-N Clinical isolate ( UTI female patient) 12. S. typhi Laboratory isolate 13. Salmonella para A Laboratory isolate 14. Salmonella para B Laboratory isolate 15. Shigella Laboratory isolate 16. Staphylococcus Laboratory isolate 17 Streptococcus Laboratory isolate
76
APPENDIX-III Restriction Enzymes used
Enzymes Restriction sites EcoR I
G/AATTC
Bam H I
G/GATCC
Hpa I
GTT/AAC
Hpa II
C/CGG
Cla I
AT/CGAT
Dra I
TTT/AAA
Msp I
C/CGG
Hind III
A/AGCTT
77
APPENDIX –IV Primers used for Polymerase Chain Reaction (PCR) NO.
primers
sequence
MT
1 Forward 5’-CCC GGG ATC CGA T-3’ 50°C 2 Reverse 5’-ATG CCA TCC CGG G-3’ 50°C 3 Van A 5’-ATG AAT AGA ATA AAA GTT GCA ATA C-3’ 52°C 4 Van A1 5’-CCC CTT TAA CGC TAA TAC GAT-3’ 52°C 5 Van B 5’-AAG CTA TGC AAG AAG CCA TG-3’ 60°C 6 Van B1 5’-CCG ACA ATC AAA TCA TCC TC-3’ 60°C 7 Van C 5’-GCT GAA ATA TGA AGT AAT GAC CA-3’ 51.3°C 8 Van C1 5’-CGG CAT GGT GTT GAT TTC GTT-3’ 56.5°C 9 Van H 5’-ATC GGG ATT ACT GTT TAT GGA T-3’ 52°C 10 Van H1 5’-TCC TTT CAA AAT CCA AAC AGT TT-3’ 52°C 11 Van S 5’-AAC GAC TAT TCC AAA CTA GAA C-3’ 50°C 12 Van S1 5’-GCT GGA AGC TCT ACC CTA AA-3’ 50°C 13 Van Y 5’-ACT TAG GTT ATG ACT ACG TTA AT-3’ 50°C 14 Van Y1 5’-CCT CCT TGA ATT AGT ATG TGT T-3’ 50°C 15 C1 5’- AGG CGA CAC TCC ACC ATG GA-3’ 58°C 16 C3 5’-TCA CTC CCC TGT GAG GAA CT-3’ 58°C 17 ORF A 5’-AGG GCG ACG ACA TAT GGT GTA ACA-3’ 58°C 18 ORF A1 5’-GGG GGA CGG TAC AAC ATC TT-3’ 58°C 19 ORF 2E 5’-TTG CGG AAA ATC GGT TAT ATT C-3’ 51.3°C 20 Orf Rev. 5’-AGC CCT AGA TAC ATT AGT AAT T-3’ 52°C 21 Van-R-1 5’-AGC GAT AAA ATA CTT ATT GTGGA-3’ 51°C 22 Van-R-2 5’-CGG ATT ATC AAT GGT GTC GTT-3’ 51°C 23 ORFID-1 5’-CCA TTT CTG TAT TTT CAA TTT ATT A-3’ 47°C 24 ORFID-2 5’-AGC CCT AGA TAC ATT AGT AAT T-3’ 47°C 25 1546-1 5’-GGG AAA ACG ACA ATT GC-3’ 51°C 26 1546-2 5’-GTA CAA TGC GGC CGT TA-3’ 51°C 27 S-1216-1 5’- ACC TTC ACG ATA GCT AAG GTT-3’ 53.3°C 28 S-1216-2 5’- AGG ATT ATA TAA GAA AAC CCG-3’ 53.3°C 29 Ac2 5’-GAGACGGGTATAGTACCCCATGAGAGTCGGC-3’ 64°C 30 Sc2 5’-GGGAGGTCTCGTAGACCGTGGACCATG-3’ 65.6°C 31 S7 5’-AGACCGTGCACCATGAGCAC-3’ 60.3°C 32 A5 5’TACGCCGGGGGTCATGT-3’ 72.3°C
78
APPENDEX-V
L.B Agar (plain)
Agar 2% Yeast extract 0.1% Glucose 1% Peptone 1% NaCl 0.8%
L.B Soft Agar (plain) Agar 0.8% Yeast extract 0.1% Glucose 1% Peptone 1% NaCl 0.8%
L.B Both (plain)
Yeast extract 0.1% Glucose 1% Peptone 1% NaCl 0.8%
Trypton Soft Agar (plain)
Trypton 1.7% Agar 0.8%
Florescent Base Agar
Peptone from casein 1% Peptone from meat 1% MgSO4 0.15% Di-potassium hydrogen 0.15% Agar 1.2% Glycrol 1%
Pyocinin Base Agar
Pepton 2% MgCl 0.14% Potassium sulfate 1% Agar 1.26% Glycerol 1%
79
Minimal Media
KH2PO4 0.3% K2HPO4 0.7% Glucose 0.5% Na-citrate 0.05% (NH4)2SO4 0.1% Agar 2% pH 7 All the above ingredients are separately autoclaved and the sterile solution of Glucose and MgSO4 were added to get a final concentration of 0.2% and 0.01% respectively.
80
A. Isolation of phages and characterization
A-1. Purity determination of bacterial culture:
Bacterial cultures (Appendix II) were streak on L.B agar (plain) plate to
get isolated colonies. Purity of isolated colonies was determined by
Gram-staining, biochemical reactions, colonial and morphological
characters.
A-2. Isolation and purification of bacteriophages:
In present study the bacteriophages were isolated from clinical specimen,
raw sewage water samples collected from different area, Lakes by plaque
assay and spot assay techniques.
A-3. Isolation of phage from sewage:
Coliphage was isolated from sewage sample collected from different area
of Karachi by use of double agar layer technique (Rajala and Hein onen,
1994)BHI 10× was used as developing medium. About 45 ml of sample
was centrifuged at 4000 rpm for 20 min. The pellet was discarded and the
supernatant was further filtered through 0.45 µm pore size Millipore
filters. Into filtered sterile sample, 5 ml of BHI 10× supplemented with
CaCl2 (0.5M final con.), MgSO4 (0.5M final con. ), and 100 λ of young
growth culture of Escherichia coli was added and mixture was incubated
in shaker incubator at 37°C for overnight.
81
A-4. Isolation of phage from clinical specimen:
Urine sample of patient (24 years old athlete female) was centrifuged at
6000 rpm in a Hettich D 2800 Bremen Rotor to remove solid matters and
was then passed through a 0.45 µm pore size nitrocellulose millipore
filter. 50λ of filtrate, 100 λ of culture which growth separately at 37°C
with continuous shaking at 160 rpm for 3-4 hrs, were added in 3 ml of
melted L.B soft agar (plain ) and mixed well then poured on to L.B agar
plate and incubated at 37 °C over night. The following day, plaques were
picked. All phages isolated were purified by successive single –plaque
isolation until homogeneous plaques.
A-5. Determination of phage activity in clinical sample on
bacterial lawn:
In order to determine the phage source from urine, 1ml of young growth
culture of respective host (P5, P6, E.coli, E.coli4MD, E.coli-N, and
Klebsiella-N) was mixed with 100λ of urine this was incubated fro 2hr. at
37°C. Follow centrifuged at 4000rpm for 5 min. pellet was washed with
500 λ of LB broth two times. Finally 500 λ of LB broth was added to
pellet. Cells were resuspended after vortexing and then were exposed to
UV for 1 min and were incubated at 37°C for 2hr.Lysate was filter
sterilized and plaque assay was performed.
82
A-6. Preparation of Lysate:
Isolated colony from over night culture was grown in LB broth for 4 hrs.
Control was run for each reaction. In control tube 100 λ culture, CaCl2
(0.1M final con.), MgSO4 (0.1M final con.) and 800 λ rest LB broth
whereas test tube contained 100 λ of culture, CaCl2 (0.1M final con.),
MgSO4 (0.1M final con.), 100 λ Lysate and 700 λ rest LB broth. Both
tubes incubated at 37°C with shaking at 160 rpm for overnight.
After 24 hrs. Few drop of CH3Cl were added and mixed well through
vortexing. Then filter sterilized. All Lysates were stored at 4°C.
A-7. Determination of phage interaction with bacteria:
Spot assay and plaque assay used to determine the host range of phages
and to check the cross infectivity.
A-7.1. Plaque assay by double layer method:
Respective culture (mentioned in materials) was grown separately at
37°C with shaking at 160 rpm for 3-4 hrs. Then 100λ of young growth
culture, 50λ of respective Lysate and CaCl2 (0.1M final con.) and MgSO4
(0.1M final con.) were added in to 3 ml melted LB soft agar tube. Then
poured on the LB agar plate and incubated at 37°C for over night. Control
was also run in which only Lysate was omitted.
83
A-7.2. Spot assay by double agar layer method:
100 λ of respective young growth culture was mixed in to 3 ml of melted
LB soft agar and plated on the LB agar plate. After solidification 10 λ of
phage Lysate was applied on the bacterial lawn and incubated at 37°C
for over night. By this method phage variability and infectivity was
checked.
A-8. Lysate amplification from single plaque:
Single plaque was picked from the lawn with sterile pasture pipette and
this was added in to sterile ependrof which contained 50 λ of young
growth culture of respective host prepared in LB broth, CaCl2(0.02M
final con.) and MgSO4 (0.02M final con.) and 130 λ rest broth and mixed
well. This was incubated at 37°C with shaking at 160 rpm for overnight.
A-9. Effect of salt on activity of phage:
CaCl2 and MgSO4 were used to determine the effect of salt on activity
and infectivity of phages. As we used 0.1M for preparation of Lysate and
0.1M salt were used for performing plaque assay as well as spot assay.
A-10. Comparative study of phage infection in enrich and
minimal and selective media:
Pyocin and Florescent base agar and soft agar as selective media ,BHI as
enrichment media and LB as minimal media were used for Pseudomonas
84
strains of this study plaque assay and spot assay were performed to
compare the specify of media on phage-host interaction .
A-11. Comparative study of induced Lysates activity in
aerobic and anaerobic condition:
Two set of Plaque assay of Lysate M81 on the lawn of P7 was performed
and were incubated in anaerobic condition and aerobic condition
separately. The plates were incubated at 37°C for 24hr.
A-12. Identification of resistant colonies:
Gram stain and biochemical reactions were performed to identify the
resistant macro colonies and micro colonies.
A-13. Induction:
A-13.1. Preparation of Lysate by induction of
Pseudomonas 76 (lysogenic strain) by Bile salt:
Single colony of over night culture of Ps (76) picked and inoculated in
LB broth, Bile salt were added final concentration of 0.075 (w/v) and
incubated at 37 °C with shaking at 160 rpm for overnight. After 24hr. few
drop of CH3Cl were added and mixed well through vortexing then filter
sterilized. This effect was determined by turbidity of control and test
reaction.
85
A-13.2. Induction of resistant colonies:
Single resistant macro colony and micro colony from lawn of P7 and
lysate M86 were grown in BHI broth containing 0.075 (w/v) Bile salt
separately and incubated at 37 °C over night. Similarly, a resistant colony
(homogenous size) from lawn of P7 and lysate M84 was induced by
0.075(w/v) Bile salt. After 24hr. few drop of CH3Cl were added and
filter sterilized.
A-13.3. Preparation of Lysate by induction of P7
(lysogenic strain) by Nalidixic acid:
Single colony of over night culture of P7 from antibiotic agar contain 50
mg/ml Nalidixic acid were added and incubated at 37°C with shaking at
160 rpm for overnight . After 24 hrs. Few drops CH3Cl were added and
mixed well through vortexing. Then filter sterilized. This effect was
determined by turbidity of control and test reaction.
A-13.4. Induction of E.coli-N and Klebsiella-N lysogen by
Tetracycline:
Single colony of overnight culture of lysogenic strain of E.coli-N,
Klebsiella-N which were isolated from urine were grown in Luria Broth
separately at 37 for 4hr. tetracycline (final concentration 100µg/ml ) was
86
added in to each young growth culture and incubated at 37°C with
shaking at 160 rpm for over night. After 24hr. few drops of CH3Cl were
added and mixed well through vortexing then filter sterilized. This effect
was determined by turbidity of control and test reaction.
A-13.5. Induction of E.coli-N lysogen by Serum:
Single colony of overnight culture of lysogenic E.coli-N were grown in
LB at 37°C for 4 hr. 4% of human serum was added and incubated at
37°C with shaking at 160 rpm for overnight . After 24hr few drops of
CH3Cl were added and mixed well and filter sterilized. This effect was
determined by turbidity of control and test reaction.
A-13.6. Induction of E.coli-N lysogen by Urea:
In young growth culture of E.coli-N 0.5% urea (Merck Co.) and 100λ of
urine was added and incubated at 37°C with shaking at 160 rpm for
overnight. After 24hr few drops of CH3Cl was added and mixed well
through vortexing and filter sterilized. This effect was determined by
turbidity of control and test reaction.
A-13.7. Induction of E.coli-N lysogenic strain by Uric acid:
Single colony of overnight culture of lysogenic E.coli-N were grown in
LB separately at 37°C for 4 hr.0.2% uric acid was added and incubated at
87
37°C with shaking at 160 rpm for overnight . After 24hr few drops of
CH3Cl were added and mixed well and filter sterilized. This effect was
determined by turbidity of control and test reaction.
A-13.8. Induction of lysogenic E.coli-N and Klebsiella-N by
UV:
Urine was propagated in E.coli2 (U13), E.coli-N (U14) and E.coli40MD
as source of phages and then were exposed to UV for 2 min. After
induction by UV plaque assay and spot assay was performed.
A-13.9. Induction of P5 and P6 lysogenic by Urea:
Single colony of overnight culture of lysogenic P5 and P6 were grown
separately in Brain Heart Infusion (BHI) broth, which contain 0.5% urea
and incubated at 37°C with shaking at 160 rpm for overnight. After 24hr.
few drops of CH3Cl were added and mixed well through vortexing then
filter sterilized.
A-13.10. Induction of P5 &P6 in presence of minimum
inducing con. of Urea:
2 ml of BHI and LB broth were supplemented separately with 0.085 µg/λ
(Final con.) of urea (bacterial culture was omitted). This was used as
lysate on the lawn of P5 and P6. In order to determine the quantity of
88
urea which could effectively induced the Ps. temperate phages while we
were using urea inducing E.coli lysate for propagating phage in Ps(5 µg/λ
final con.)
A-14. Effect of Salt on temperate phages Induced by Bile salt:
CaCl2, MgSO4 and Bile salt were used to determine the effect of salt on
infectivity of induced phages. As we used 0.1M for preparation of Lysate
and 0.1M salt were used for performing plaque assay as well as spot
assay.
A-15. Antibiotic sensitivity by MIC method:
Antibiotic plates were prepared by adding stock solution of antibiotic in
sterilized LB agar to have final concentration from 5µg/ml to 200 µg/ml.
A-16. Phage separation by Titration:
In 100 λ of urine sample, 100 λ of young growth culture of Ps was added
then it was incubated at 37°C for 15 min, mixture was centrifuged at 10 k
for 10 min. to the supernatant, 100 λ of young growth culture of E.coli
was added the it was incubated at 37°C for 15 min, mixture was
centrifuged at 10 k for 10 min. supernatant was collected and into that
100 λ of young growth culture of Streptococci was added and incubated
at 37°C for 15 min . Each pellet was washed 2 times with PBS and 100 λ
89
of each pellet added into 3 ml melted BHI soft agar separately and poured
onto BHI hard agar . Finally, collected supernatant was filter sterilized
and 10 λ of that was apply as a spot on the lawn of respective culture.
17: Screening of antimicrobial substances by wells method:
Isolated colony from over night plate was grown in LB broth. After 4hr.
young culture was prepared. Bacterial lawn was made on the LB agar
plate by means of cotton swab. Wells made by borer. 10 λ of sterile lysate
were applied in the wells by help of micropipette. The plates were
incubated at 37°C for 24hr. following day looked for the zone of
inhibition.
A-18. Titration of lysates by liquid serial dilution method
(PFL/ml):
50 λ portions of each lysates were added to appendrofs separately which
were contain 200 λ plain broth and mixed well. Then 10 λ of diluted
lysate were transferred to 90 λ of broth and continued till 10-9
(concentration).
In each step the concentration was checked by plaque assay. The plates
were incubated at 37°C and were monitored daily for 3-4 days.
The controls were containing no plaques.
90
A-19. Transmission Electron Microscopy:
To study of particles morphology, lysate were precipitated by using PEG
6000 (Promega Co.) and NaCl with 8% and 4% final concentration
respectively and were incubated at 4°C for overnight. These were
centrifuged at 14000 rpm for 20 min. the pellet was resuspended in 100λ
of double deionized distill water. 400 mesh carbon coated grids were
submerged in phage suspension for 1 minute. Specimen was negatively
stain with 2 % uranyl acetate for 30 seconds and examined in a GOEL-
JEM-1200 EX II transmission electron microscope.
A-20. Effect of maltose on phage-host interaction:
Single colony of P6 was grown in LB broth at 37°C for 4hr.100 λ of
young growth culture, 50 λ of lysates U9 and 30 λ of maltose solution,
final concentration 2% were added in to 3ml of LB soft agar.
For comparison plaque assay were performed which only maltose was
omitted. The poured on LB agar plate and incubated at 37°C for
overnight.
A-21. Lysate amplification from single plaque in the presence
of maltose:
Single plaque was picked from the lawn of agar plate with sterile pasture
pipette. It was expelled into an eppendrof which contain 100 λ phage
91
buffer (150mM NaCl, 40mM Tris-HCl, 10mM MgSO4, pH 7.4) and it
was placed at 4°C overnight. Following day young growth culture of
respective host was prepared in 1 ml of LB, supplemented with 10 λ of
20% maltose, MgSO4 (0.01M final conc.) and was incubated at 37°C in
shaker incubator. Into 500 λ of this culture, 100 λ phage buffer contain
plaque was added and were incubated at 37°C for 20 min. then this
infected culture was transferred into 250ml flask containing 100ml pre-
warmed( 37° C ) LB broth supplemented with 1M of MgSO4 and was
incubated in shaker incubator at 37°C for overnight. After 24hr. 500 λ
CH3Cl was added and incubated further in shaker incubator for 15 min.
Then it was centrifuged at 6000 rpm for 10min and filter sterilized.
B. Genomics Characterization
B-1. Gel Electrophoresis:
B-1.1. Laemmli Discontinues Gel Electrophoresis of
Protein:
The resolving gel, poured to a depth of 10cm was made from following
mixture:
0.125M Tris-HCl , 0.1% SDS, 10 % Bis acryl amid, 0.05% TEMED,15.5
ml water, 0.5% ammonium per sulfate, 15.5 ml water. The gel was
overlaid with water until it was polymerized. Then water was poured off.
92
The stacking gel was poured on the top of the resolving gel. This was
allowed to set completely.
Viral proteins was denatured by heating viral suspension in sodium
dodecyle sulfate(0.05% SDS final conc.) and 2-mercapto ethanol (0.5%
final conc. ) at 100°C for 5 min. to this sample a few crystals of sucrose
and 5 λ of bromo phenol blue was added and mixed well. It was then
loaded on to gel and electrophoresis at constant voltage of 50v for 3hr. in
an electrode buffer of 0.25M Tris-Hcl, 0.24M glycin, 0.1%SDS , pH 8.4.
The gel was then placed in staining solution that contains 0.1gm of
Comassie blue, 10% acetic acid and 50% methanol for about 45min.
Then it was destained in solution containing 10% acetic acid and 5%
methanol for overnight. This 10% gel was used for molecular weight
determination of protein samples.
B-1.2. Agarose Gel Electrophoresis of DNA:
The gel was made from following mixture: 1% Agarose was dissolved in
TAE buffer
i: Preparation of sample:
1.5 ml of each lysate transferred in to an eppendrof and NaCl, final
concentration 4% and PEG 6000 final concentration 8% (promega co.)
were added and then was incubated at 4°C for overnight. Following day
the phages were pelleted by centrifuging at 14000 rpm for 15 min and
supernatant was discarded. The phage pellet was resuspended in 50 λ
93
sterile distil water and treated by sodium dodecyle sulfate(0.05%SDS)
and 2-mercapto ethanol (0.5% ) and shocked by heating at 100 °C for 5
min .5 λ of bromo phenol blue and few crystal of sucrose were added and
mixed well. It was then loaded on to gel and electrophoresed for 3hr. at
constant voltage 50v in TEA buffer of 0.04M Tris base, 0.02M sodium
acetate, 0.002M EDTA pH 8.
ii: Staining gel:
The gel was carefully placed in staining tray and soaked in 100 ml of
distil water and 3 λ ethidium bromide was added and gel was stained for
15 min. Gel was observed on UV illuminator and photographed.
B-2. Action of DNAase I:
The pellet of each lysate were prepared by adding 8% polyethylene
glycol 6000 and 4%NaCl and after incubation at 4°C for overnight.
Centrifuged at 14000 rpm to precipitate the phage particles.
The precipitate was dissolved in sterile deionized distil water .aliquot of
phage suspension (30 λ) was digested with 2 λ DNAase I (1mg/ml) in 10
λ of reaction DNAase buffer (10 mM sodium acetate, 5mM magnesium
sulfate, pH 5) and then was incubated for 1 hr. at 37 °C. The reaction was
terminated by adding of 5 λ of 2-mercapto ethanol and SDS and heated at
94
100°C for 5 min. To this sample few crystal of sucrose and 5 λ of bromo
phenol blue was added and mixed well. The samples were then
electrophoresed on the 1% agarose gel.
B-3. Action of RNAase A:
The aliquot of phage suspension (30 λ) was digested with 2 λ RNAase A
(1mg/ml) and 10 λ of reaction RNAase buffer (10mM sodium acetate,
5mM magnesium sulfate,0.5mM zinc sulfate pH 5.0) and then was
incubated at 37°C for 1 hr. The reaction was terminated by adding of 5 λ
of 2-mercapto ethanol and SDS and heated at 100°C for 5 min. To this
sample few crystal of sucrose and 5 λ of bromo phenol blue was added
and mixed well. The samples were then electrophoresed on the 1%
agarose gel.
B-4. Phage DNA purification:
To 10 ml of lysate, 40λ nuclease was added and mixture was incubated at
37°C for 15 min, then 4ml of phage precipitate were added and after
mixing gently incubated on ice for 30 min. then it was resuspended in
500λ of phage buffer, then was centrifuged at 10,000 rpm for 30 seconds.
The supernatant was draw up. 1ml of purification resin (Promega Co.)
was added to supernatant, it was mixed thoroughly by inverting the tube.
The syringe barrel was attached to mini column and it was inserted into
vacuum system. The column was washed by 2ml of 80% isopropanol and
95
resin was dry by apply to vacuum system for 30 seconds. the column was
transferred into 1.5ml eppendrof and was centrifuged at 10,000rpm for 2
min. the column was transferred to new eppendrof and 100λ of pre
heated( 80°C) nuclease free water ( Promega co.) were applied. Then it
was centrifuged at 10,000 rpm for 30 seconds to elute the DNA.
B-5. Phenol-Chloroform DNA extraction:
DNA sample was mixed with equal volume of phenol containing 0.1%
hydroxylquionoline (Sigma Co.) in an eppendrof and mixing was
continued until an emulsion forms. This was centrifuged at 12000 rpm for
5 min. the separated aqueous phase was transferred to new eppendrof and
lower organic phase was discarded. Washing with phenol was repeated
for 3 times. To this an equal volume of sewage CH3Cl and iso-amyl
alcohol (24:1) was added, after mixing well it was centrifuged at
12000rpm for 5 min. Aqueous phase was transferred to new eppendrof
and DNA was recovered by precipitation with diethyl ether . Finally 0.6
vol. of isopropanol was added and incubated at 4°C for overnight.
Following day sample was centrifuged at 14000 rpm for 20 min.
B-6. Preparation of ethidium bromide Agarose plate:
0.1gr of Agarose was added into 10ml of distil water. The slurry was
heated until Agarose dissolved. The dissolved Agarose was cooled to 50
96
°C and then ethidium bromide was added (final conc. 10 mg/ml) .the
solution was poured into a disposable petri dish. Each extracted fraction
was checked for presence of DNA by spotting on an ethidium bromide
agarose plate and 1% Agarose gel electrophoresis. The fractions were
stored frozen at -4°C.
B-7. DNA-extraction directly from lysate:
In to 1ml of lysate, 5λ of nuclease (Promega Co.) was added and
incubated at 37°C for 15 min. equal vol. of phenol containing 0.1%
hydroxylquionoline (Sigma Co.) was added in to lysate in an eppendrof
and mixing was continued until an emulsion forms. This was centrifuged
at 12000 rpm for 5 min. the separated aqueous phase was transferred to
new eppendrof. Washing with phenol was repeated for 3 times. Aqueous
phase was transferred to new eppendrof and equal vol. of isopropanol
was added and incubated at -4°C for overnight. After which the DNA was
collected by centrifugation at 12000 rpm for 20 min at 4°C.
The supernatant were drained carefully and pellet was washed with 70%
chilled ethanol and was dried at room temperature for 30 min and finally
resuspended in 50λ of sterile distilled water. The fractions were stored at
-20°C.
97
B-8. Isolation of DNA fragments from Agarose gel:
Gel was cast by using low melting temperature (LMT) agarose and
electrophoresis in usual way and follow manufacture’s protocols
(Promega Co. Kit). The DNA was stained by soaking the gel in ethidium
bromide solution for 15 min. Long wave UV illuminator was used to
locate the DNA bands and bands were cut out by sharp razor blade. Then
gel slices was chopped into fine pieces and transferred into 3ml
eppendrof. 10λ membrane binding solution (Promega Co.) was added per
10mg of gel slices and vortexed well. Then incubated at 65°C till gel got
completely dissolved. Gel mixture was transferred into SV mini column
and incubated at room temperature for 1 min. Vacuum was applied and
mixture was pass through it. Then 700 λ membrane wash (ETOH) was
added and pulled out by applying vacuum. This was repeated for two
times. The column transferred to collection tube and was centrifuged at
10,000 rpm for 15 min.
Finally, column was transferred to clean eppendrof and 50λ nuclease free
water was added into column. After incubation at room temperature for 1
min it was centrifuged at 10,000 rpm for 5 min. DNA was stored at -20
°C.
98
B-9. Southern Blotting:
Bacteriophages DNA fragment were separated on a 1% (wt/vol) Agarose
gel. Electrophoresis gels were transferred on to nylon membrane
(Ambion Co.) in transfer buffer; NaOH 400mM, NaCl 1M (0.5 ml/cm2).
B-9.1. DNA probe by labeling psoralen:
Respective samples were denatured by heating at 100°C for 10min and
then rapidly were cooled in dry ice. vial containing the lyophilized bright
star psoralen Biotin was centrifuged at 2000 rpm for 15 sec. and
reconstituted in 33λ-DMF pipette up and down for few times to get the
psoralen into solution . Frozen sample was thawed by rolling in between
gloved hands and immediately 1 λ of psoralen was added into 10λ of
nucleic acid solution in a microfuge tube. Sample was transferred to a
well of 96 wells micro plate on ice bath and exposed to 365 nm UV light
source directly while whole set up was covered. the samples was
irradiated for 45 min. samples was diluted to 100λ by adding 89λ of TE
buffer , 200λ of water saturated N-butanol. After vortexing well it was
centrifuged at 7000 rpm for 1 min. this as repeated for two times.
Labeled nucleic acid was stored at -20°C.
99
B-9.2. Hybridization:
Blot was wet with 5× SSC buffer (NaCl 3M, NaC6H5O7 0.3M pH 7). It
was placed in polythene bag. After adding 10ml of preheated
hybridization buffer (5× SSC buffer, 2 %( w/v) SDS, 5 %( w/v) dextran
sulfate) and 100µg/ml sheared denatured calf thymus DNA bag was
sealed. It was rocked at 60°C for 30 min. Denatured probe was chilled in
ice and was added into hybridization buffer. After adding the probe bag
was sealed again and incubated in a shaker incubator at 60°C for over
night.
B-9.3. DNA probe:
20λ of 100m M EDTA, 105 λ H2O and 75 λ probe was mixed and heated
at 90°C or 10 min and chilled on ice.
Bacteriophages DNA probe was generated by using labeling kit
(Amersham Life Science, Arlington heights III).
B-9.4. Washing the blots:
After 24hr. the blots were washed 2 times with washing buffer for 50 min
at room temperature and then were washed 2 times with blocking buffer
for 7 min. membrane was incubated in blocking buffer for 30 min. Then
was incubated in 10ml blocking and 1 λ strep-AP for 30 min. Membrane
100
was incubated in blocking buffer for 15 min . then blots were washed 3
times wash with 1× washing buffer for 5 min and then incubated 2 times
in 1× assay buffer for 2 times . Membrane was incubated in CDP star for
5 min. excess of CDP-star was removed without letting the membrane to
dry. Then it was wrapped in saran wrap and exposed to X-ray film in
different exposure time.
B-9.5. Stripping off the DNA-probe from membrane:
Probe was stripped off from membrane by autoclaving the membrane in a
bottle contain 0.1% SDS solution for 30 min.
B-10. Restriction endonucleases:
Purified phage DNA of PS5Φ, PS6 Φ, PL5Φ, PL6Φ , U9Φ and 3S Φ
were digested with EcoR I, Bam H I, Cla I, Dra I, Hpa I, Hpa II, Msp I
and Hind III.( Appendix III ) according to manufacture’s protocols
(Promega Co.). 15λ of purified DNA, 2λ respective Buffer, 0.2λ BSA, 1λ
respective enzyme and 1λ nuclease free water was mixed and digestion
was carried out for 3 hr. at 37°C and products of reaction were analyzed
by 2% agarose gel electrophoresis.
101
B-11. Polymerase Chain Reaction (PCR) amplification:
Phage DNA was isolated from lysates PS5 Φ, PL5Φ, PS6Φ and PL6Φ,
PAKΦ and 3SΦ as described before and these DNAs were used as PCR
templates. PCR products were generated by using Taq DNA polymerase
(Promega Co.) by following the manufacture’s protocols.
Range of primer sets were used (Appendix-IV).
The PCR conditions used were denaturation at 94°C for 4 min, following
by 35 cycles of denaturation at 94°C for 30 seconds, annealing
temperature was recommended by manufacture for 30 Seconds and
extension at 72°C for 2 min.
Amplified produced were sized by 2% Agarose gel electrophoresis and
photographed.
B-12. DNA sequencing:
Amplified PCR products were sized by 2% Agarose gel electrophoresis
and fragments were selected for sequencing.
The selected PCR mixtures were prepared in 50λ for each reaction and
amplified products were sequenced using the original amplification
primers.
102
C. Serological Techniques
C-1. Preparation of serological test antigen:
Lawn of Salmonella typhi was grown on the large Petri plate BHI agar.
Bacteria were suspended in 10ml of distilled water. Cells were heated at
60°C for 1 hr. and then disintegrated in homogenizer for 15 min.
To ensure that all of bacteria were killed, sodium deoxycholate was added
to a final concentration of 1 %( wt/vol) and was concentrated by pressure
dialysis.
C-2. Dialysis tube preparation:
Dialysis tubing-visking size 3-20 132” was boiled for 10 min in 10mM
disodium EDTA adjusted to pH 7.4 with NaOH. It was then rinsed
several times in sterile dionized distill water and stored at 4°C and
handled carefully to prevent contamination.
C-3. Antigen concentration using dialysis tube:
10ml of antigen suspension was poured in dialysis tube and then was
placed in to 250 gm sucrose (Merck Co.). Pressure dialysis was carried
out for 2hr.
103
This required a volume reduction of 2.0 fold to get final concentration of
5mg/ml. To obtain a clear suspension, the antigen was then centrifuged
for 30 min at 12000 rpm. The supernatant was distributed in aliquots and
stored frozen at -20°C.
C-4. Vaccine preparation:
C-4.1. Killed Vaccine preparation:
Lawn of Salmonella typhi was grown on the BHI agar. Bacteria were
scoped off and suspended in 10ml of BHI broth. Cells were heated at
60°C for 1 hr. No growth after plating of heated bacteria on BHI agar
indicated that all cells were killed. Cells were centrifuged at 10,000 rpm
for 20 min and pellet washed 3 times with PBS buffer. And pellet was
resuspended in sterile distilled water at a concentration of 520 µg/ml.
Suspension was stored at freezer.
C-4.2. Adjuvant vaccine preparation:
Adjuvant vaccine was prepared by homogenizing a suspension of 520
µg/ml of heat-killed S.typhi with 250λ of mineral oil. To form a thick
stable emulsion which was injected inter- muscularly in rabbit and inter
peritonealy in mice.
104
C-4.3. Pseudomonas ϕ DNA vaccine preparation:
DNA vaccine was prepared by homogenizing a suspension of 520 µg/ml
of heat killed S.typhi with 250λ of mineral oil and 16λ of PS5Φ DNA to
form a thick emulsion which was injected inter muscularly in rabbit and
inter peritonealy in mice.
C-4.4. E.coli ϕ DNA vaccine preparation:
DNA vaccine was prepared by homogenizing a suspension of 520 µg/ml
of heat killed S.typhi with 250λ of mineral oil and 16λ of U9Φ DNA to
form a thick emulsion which was injected inter muscularly in rabbit and
inter peritonealy in mice.
C-5. Preparation of antiserum
C-5.1. Preparation of antiserum in Rabbit:
Before immunization, blood from marginal ear vein of each rabbit was
collected. Rabbits were immunized with 3 dose (each dose after 7 days)
intramuscularly injection of killed vaccine (520µg/ml heat killed S.typhi
cells, 250µl PBS) , adjuvant vaccine (520µg/ml heat killed S.typhi cells,
250 µl mineral oil), DNA vaccine (520µg/ml heat killed S.typhi cells, 250
µl mineral oil and 16 λ ϕ DNA).Each rabbit was bled by cardic puncture
1 week after the last injection. All blood samples were incubated at 37°C
105
for 1 hr. and then overnight at 4°C.The serum was separated and stored at
-20°C.
C-5.2. Preparation of antiserum in Mice:
Pathogen free Balb/C mice were immunized with 3 dose (each dose after
7 days) intraperitonaly injection of killed vaccine (4 µl heat killed S.typhi
cell, 130µl PBS) , adjuvant vaccine (4 µl heat killed S.typhi cells,150 µl
mineral oil), DNA vaccine (4 µl heat killed S.typhi cells, 150 µl mineral
oil and 8 λ ϕ DNA). Each mice was decapitated 1 week after the last
injection. All blood samples were incubated at 37°C for 1 hr. and then
overnight at 4°C. The serum was separated and stored at -20°C.
C-6: Antigen-Antibody reactions
C-6.1. Wet slide agglutination:
200λ of each serum was mixed with 200λ of antigen in eppendrof
separately and then were incubated at 37°C, wet slide was prepared using
50λ of each reaction placed in cavity slide and was observed after 15, 30,
60 and 120 minutes of incubation .
C-6.2. Ouchterlony gel immunodiffusion:
Serological relationships between antiserums were examined by gel
immunodiffusion on microscopic slide. The gels were prepared by boiling
solution of 1% purified agar (electrophoresis grade, Sigma) in PBK
106
buffer, cooling to 60°C. 3ml of molten Agarose was poured onto clean
microscopic slide .after gel solidification 5 wells were cut out (central
well was surrounded by 4 wells) by borer. Slides were placed in petri
plates. The central well was filled with 10 λ of heat-killed cell suspension
of S.typhi while the 4 peripheral wells were filled with 10λ of un-diluted
antiserum. Serological reaction was allowed to occur at 37°C in humid
atmosphere for 1-2 days.
C-6.3. Two dimensional immunoelectrophoresis:
Two dimensional immunoelectrophoresis was performed on agarose-pre
coated mounting slides (2.5 by 7.5cm) and larger slides (5 by 7.5) were
used. The support was a 2mm film of 0.8% (wt/vol) agarose gel (Sigma
Co.) in barbital buffer (Ionic strength, 0.02; pH 8.6), 0.5% Triton X-100
and 0.1% sodium deoxycholate were added to the gel for the first-
dimension electrophoresis. 10λ antigen was placed in a 4mm well and
electrophoresis was carried out at 50 Vol for 60 min. Second –dimension
gel was contained 0.5% Triton X-100, 1% antiserum and 2λ bromo
phenol blue was used as a tracer. Barbital buffer at a pH of 8.6 and Ionic
strength of 0.05 with 0.1% sodium deoxycholate was used in
electrophoresis bath for first dimension and for second phase, sodium
deoxycholate was omitted.
107
C-6.4. Immnoelecterophoresis:
Immunoelectrophoresis was performed on agarose-precoated slides
(25×75 mm). The supported was a 2 mm film of 0.8 %( wt/vol) agarose
gel and 0.1% sodium deoxcholated ,0.5% TritonX-100 and 0.01% sodium
azide were added to the gel and electrophoresed in barbital buffer
(pH;8.6;Ionic strength,0.02). 10λ of antigen was added to each trough and
diffusion was carried out at room temperature for 48hr. The slides were
washed in distilled water and were stained with coomassie brilliant blue
for 2hr and destained for overnight.
C-6.5. Pre-coating glass plates with agarose:
0.5% agarose was melted in distilled water. 2 ml of molten agarose was
spread on glass slide to make a thin layer film and then left overnight at
room temperature to get completely dry. Dry pre-coated slides were used
for immunoelectrophoresis and two-dimension immunoelectrophoresis of
each antiserum.
C-6.6. Staining of precipitate lines:
Gels were stained in 0.025% w/v of coomassie brilliant blue in methanol:
water: acetic acid (50:45:5) for 1 hr. and then destained in water: acetic
acid: methanol (87:8:5) for over night. Destained Sol. was changed until
to get the clear background in gels.
108
C-7. Quantitive analysis by ELISA
C-7.1. Desalting of lysate by micro dialysis:
In order to remove the media and salt from phage suspension, dialysis
tube was used. Desalting was carried out in eppendrof tube with a cap
replaced by cut of 2cm of dialysis membrane fixed with rubber band.
Subsequently the tube was allowed to float in on upside-down position
supported in cool sterile distilled water. Water was changed after one
hour and incubated at 4°C overnight. After dialysis the eppendrof was
centrifuged in an upright position to assure complete recovering of
dialysis.
C-7.2. Coating the ELISA 96 wells plate by antigen:
100 λ of S.typhi antigen was added in to each well of 96 wells ELISA
plate (IWAKI) at a concentration of 1/5 in coating buffer contain 0.15%
NaCO3, 0.29% NaHCO3, pH 9.6. Plates were incubated at 4°C for
overnight. Solution was discarded and 200 λ of blocking buffer contain
1% bovine serum albumin (Promega Co.), 0.02% tween 20 in PBS
(contain 0.8% NaCl, 0.02% KCl, 0.144 % Na2HPO4 and in deionized
water) was added into each well. Plates were incubated at room
temperature for 1 hr. blocking reagent was discarded and plates were dry
at 4°C. Then each well was washed 5 times with 200λ of washed buffer
contain 0.02% tween 20 in PBS.
Plates were pad dry on paper towel and were stored at 4°C.
109
C-7.3. Coating ELISA 96 wells plate by lysate:
In to 10ml of lysate PL5Φ 0.95% PEG 8000 and ).8% NaCl was added
and it was incubated overnight at 4°C .lysate was centrifuged at 14000
rpm for 45 min and pellet was resuspended into 300λ of sterile distilled
water. In order to remove the media and salt from phage suspension,
dialysis tube-visking (size 3-20, 132”) was used.
Phage suspension was diluted 1/5 in coating buffer and 100λ of dilution
was added in each wells and plate was incubated at 4°C overnight.
Solution was discarded and micro plate was incubated with 200λ of
blocking buffer for 1 hr. at room temperature. Then blocking buffer was
discarded and wells were air dried. Plate was washed with 200λ washed
buffer per well 5 times and then it was pad dry on paper towel. 100λ
HCV positive serum was added into coated wells and incubated for 1 hr.
at 37°C after being washed with wash with wash buffer wells were
incubated for 30 min with 100λ of goat anti-human-IgG HRP conjugate
(AutoBio Diagnostics Co.). Plates were washed again and color was
developed by using choromogen substrate A containing urea hydrogen
peroxide and choromogen substrate B containing stabilized 3, 3’-5, 5’
tetramethylbenzidine. Color reaction was stopped after 10 min by
addition of 50λ stop reagent 1M sulfuric acid to each well.The intensity
of the reaction was photometricaly measured at 490nm.
Positive and negative control sera were included in every reaction.
110
C-7.4. Coating ELISA 96 wells plate by Pseudomonas:
Lawn of organisms was grown on the BHI agar. Bacteria were washed
times with PBS buffer. 100 λ of cell suspension (1:10 in coating buffer)
was added into each well of ELISA plate. Plates were incubated at 4°C
overnight. Solution was discarded and 200 λ of blocking buffer was
added and after 1 hour incubation of at room temperature reagent was
discarded and plate was pad dried at 4°C. The wells were washed with
200 λ of washed buffer per well five times and stored at 4°C.
C-7.5. Estimation of total γ-globulin raised in Rabbit
against S.typhi antigen by ELISA:
Serum sample was diluted 10/100 in EIA buffer containing 0.1% bovine
serum albumin (Promega Co.) and 0.1% tween 20 (Sigma Co.) in PBS
buffer. 100µl of each dilution was incubated in each coated well for one
hour after being washed 5 times with wash buffer containing 0.02%
tween 20 in PBS. Wells were incubated for 1 hr. with 100µl of peroxidase
labbled anti-rabbit antibody (Amersham life-science) diluted 1/500 in
nuclease free water.
Plates were then washed again 5 times and color was developed by using
choromogen substrate A solution containing Urea Hydrogen Peroxide and
choromogen substrate B solution containing stabilized 3,3’-5,5’
Tetramethylbenzidine (TMB) ( Autobio diagnostics Co.).
111
Color reaction was stopped after 10 min by addition of 50µl of stop
solution containg 1M sulfuric acid to each well.
Optical density at 490nm was measured with ELISA reader.
Positive and negative control sera were included in every reaction.
C-7.6. Estimation of IgG raised in mice antiserum against
S.typhi antigen by ELISA (Fab specific as secondary antibody):
10 µl of mice antiserum was diluted into 700µl of EIA buffer and 100µl
of this was incubated in a coated well for 1 hr. after being washed 5 times
with wash buffer. Wells were incubated for 1 hr. with 100µl of anti-
mouse IgG (Fab specific) (Sigma Co.) diluted 1:2000 in nuclease free
water. Plate was then washed again 5 times and color was developed by
using choromogen substrate A sol. and chromogen substrate B sol.
Color reaction was stopped after 30 min by addition of 50µl stop solution
contain 1 M sulfuric acid to each well. Optical density at 490nm was
measured with ELISA reader.
C-7.7. Estimation of IgG raised in mice antiserum against
S.typhi antigen by ELISA (Fc specific as secondary antibody):
10 µl of mice antiserum was diluted into 700µl of EIA buffer and 100µl
of this was incubated in a coated well for 1 hr. after being washed 5 times
with wash buffer. Wells were incubated for 1 hr. with 100µl of anti-
112
mouse IgG (Fc specific) (Sigma Co.) diluted 1:2000 in nuclease free
water. Plate was then washed again 5 times and color was developed by
using choromogen substrate A sol. and chromogen substrate B sol.
Color reaction was stopped after 30 min by addition of 50µl stop solution
contain 1 M sulfuric acid to each well. Optical density at 490nm was
measured with ELISA reader.
C-7.8. Antibody detection in HCV positive human serums by
ELISA:
96 wells plate of HCV antigen coated was used from commercial kit of
AutoBio Diagnosis Co. 100λ HCV positive serum was added into wells
and incubated for 1 hr. at 37°C after being washed with wash buffer.
Wells were incubated for 30 min with 100λ of goat anti-human-IgG HRP
conjugate. Plates were washed again and color was developed by using
choromogen substrate A containing urea hydrogen peroxide and
choromogen substrate B containing stabilized 3, 3’-5, 5’
tetramethylbenzidine. Color reaction was stopped after 10 min by
addition of 50λ stop reagent 1M sulfuric acid to each well.
The intensity of the reaction was photometricaly measured at 490nm.
Positive and negative control sera were included in every reaction.
113
C-8. Quantative analysis by Western blotting
C-8.1. Western blotting of total amount of rabbit γ-globulin:
PAGE gel was run by laemmli’s method, 25 mA and 100 volt and was
placed in transfer buffer for 20 min at 4°C. Blotting sandwich was
assembled in blotting cassette. Filter pad, whatman paper, nitrocellulose
membrane, polyacrylamide gel, and whatman paper and then filter pad
soaked in transfer buffer. Current was flowed from anode to cathode and
was left at 35 volt and 90mA for overnight. Membrane was first blocked
with 0.5% dry milk in TBS buffer for 2 hours at room temperature on
rocker. Blot was washed 2 times with TBS at room temperature on rocker
for 10 min. Gel was stained with commasi blue to insure that protein was
transferred to membrane. Membrane was treated in primary antibody (1:
500) for 1 hour at room temperature and then was washed with TBS
buffer 2 times. Membrane was incubated in secondary Ab (1:5000) for 1
hour at room temperature. Blot was washed with TBS buffer for 15 min,
7ml detection (BCIP/NBT) liquid substrate reagent (Sigma Co.) was
added on blot. The color was developed after 15 min.
C-8.2. Western blotting of total amount of Mice γ-
globulin raised against S.typhi antigen:
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C.
114
Blotting sandwich was assembled in blotting cassette. Filter pad,
whatman paper, nitrocellulose membrane, polyacrylamide gel, and
whatman paper and then filter pad soaked in transfer buffer. Current was
flowed from anode to cathode and was left at 35 volt and 90mA for
overnight. Membrane was first blocked with 0.5% dry milk in TBS buffer
for 2 hours at room temperature on rocker. Blot was washed with TBS
buffer for 20 min twice at room temperature. Gel was stained with
commasi blue to insure that protein was transferred to membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
was incubated in Anti-mouse antibody (1:5000) for 3 hour at room
temperature. Blot was washed with TBS buffer for 10 min, 7ml detection
(BCIP/NBT) liquid substrate reagent (Sigma Co.) was added on blot.
The color was developed after 15 min.
C-8.3. Estimation of IgG raised in mice against S.typhi
antigen by Western Blotting ( Fab –specific as secondary antibody )
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C. Blotting sandwich was assembled in
blotting cassette. Filter pad, whatman paper, nitrocellulose membrane,
polyacrylamide gel, and whatman paper and then filter pad soaked in
transfer buffer. Current was flowed from anode to cathode and was left at
115
35 volt and 90mA for overnight. Membrane was first blocked with 0.5%
dry milk in TBS buffer for 2 hours at room temperature on rocker. Blot
was washed with TBS buffer for 20 min twice at room temperature. Gel
was stained with commasi blue to insure that protein was transferred to
membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
was incubated in secondary Ab IgG-Fab specific (1:5000) for 3 hour at
room temperature. Blot was washed with TBS buffer for 10 min, 7ml
detection (BCIP/NBT) liquid substrate reagent (Sigma Co.) was added on
blot. The color was developed after 15 min.
C-8.4. Estimation of IgG raised in mice against S.typhi
antigen by Western Blotting (Fc –specific as secondary antibody)
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C. Blotting sandwich was assembled in
blotting cassette. Filter pad, whatman paper, nitrocellulose membrane,
polyacrylamide gel, whatman paper and then filter pad soaked in transfer
buffer. Current was flowed from anode to cathode and was left at 35 volt
and 90mA for overnight. Membrane was first blocked with 0.5% dry milk
in TBS buffer for 2 hours at room temperature on rocker. Blot was
washed with TBS buffer for 20 min twice at room temperature.
116
Gel was stained with commasi blue to insure that protein was transferred
to membrane. Membrane was treated in primary antibody (1: 7000) at
room temperature for overnight and then was washed with TBS buffer 2
times. Membrane was incubated in secondary Ab IgG-Fc specific
(1:5000) for 3 hour at room temperature. Blot was washed with TBS
buffer for 10 min, 7ml detection (BCIP/NBT) liquid substrate reagent
(Sigma Co.) was added on blot. The color was developed after 15 min.
C-8.5. Western blotting of total amount of Mice γ-globulin
raised against S.typhi antigen (ECL):
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C.
Blotting sandwich was assembled in blotting cassette. Filter pad,
whatman paper, nitrocellulose membrane, polyacrylamide gel, and
whatman paper and then filter pad soaked in transfer buffer. Current was
flowed from anode to cathode and was left at 35 volt and 90mA for
overnight. Membrane was first blocked with 0.5% dry milk in TBS buffer
for 2 hours at room temperature on rocker. Blot was washed with TBS
buffer for 20 min twice at room temperature. Gel was stained with
commasi blue to insure that protein was transferred to membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
117
was incubated in Anti-mouse antibody (1:5000) for 3 hour at room
temperature. Blot was washed with TBS buffer for 10 min, and then it
was wrapped in saran wrap and exposed to X-ray film in different
exposure time.
D. Phage Therapy
D-1. Phage application as therapeutic agent for treatment of
Mice infection due to MDR Pseudomonas:
Pathogen free 7 weeks old male BALB/c mices were used for this
experiment. 5λ of young grow culture of MDR Pseudomonas aeruginosa
was used as an infectious agent on deep legioned Mices and 20 λ lytic ϕ
PS6 was applied after 30 min of infection. Mices were administered by
two dose of phage application on legion and orally. While positive
control Mice was not received phage for treatment. Infected mices and
controls were observed under sterile condition for one week and were
photographed.
D-2. Phage application as therapeutic agent for treatment of
Mice infection due to MDR E.coli
7 weeks old male BALB/c mice was infected by 5λ of young grow
culture of MDR E.coli as an infectious agent on deep legioned Mices and
20 λ lytic Φ3S and ΦU9 were applied separately after 30 min of infection.
118
Mices were administered by two dose of phage application on legion and
orally. Positive control Mice was not received phage.Infected mices and
controls were observed under sterile condition for one week and were
photographed.
D-3. Phage therapy on chronic MDR infection:
One week infected Mices by MDR Ps and MDR E.coli separately
(controls) were used as chronic infected test for treatment. Mices were
maintained in sterile condition and received 3 doses of respective Lytic
phages. Infected mices were observed for one week and photographed.
E. Bioinformatics analysis
DNA sequencing and computer analysis:
Sequencing reaction was performed at MACROGEN-advancing through
genomics. For alignment and comparison of similar of new sequences
ClustalW.2 was used. HCV and HIV similarities searches and analysis
were done using BLAST, QuickAlign, Gene locator and Sequence locator
programs. The similarity between our data sequence and sequence
database assessed by use of BLAST-NCBI. Including algorithms Blastn
and Blastx via the National center for Biotechnology internet service and
LosAlamose Databank.
119
1. Purity determination of bacterial culture:
Bacterial strains of Pseudomonas (Ps.aeroginosa, P7, P3, P4, P5),
Klebsiella, E.coli spp (E.coli 2, 3,40MD). Salmonella typhyimurium,
S.typhi para A, S.typhi para B were observed as Gram negative short
rods. Size variation has been notice in colonial characteristic of P5 and
P6 resistant colonies to phage but in staining both were gram negative
rods.
2. Isolation of phage from sewage:
Sewage sample S1 on the lawn of E.coli3 produced two types of plaques,
few large, clear, round and uncountable small, turbid and confluent
plaques. Sewage sample S2 on the lawn of E.coli3 was produced large,
clear center and turbid zone an uncountable small, turbid, irregular
margin. (Table-4) Lysate S1 and S2 on the lawn of E.coli2 were produced
uncountable, confluent, homogenous plaques. Amplified plaques from
lawn of E.coli3 and S1 (3Sam) on the lawn of E.coli3 produced small,
clear, confluent, homogenous plaques. Resistant colonies were also
observed. Spot assay of 3Sam on the lawn of E.coli 40MD, E.coli2 and
E.coli3 was very clear and no resistant colonies were present.
Amplified large plaque form the lawn of E.coli3 and S1 (3Sal ) produced
clear, large and plaques. Resistant macro colonies and micro colonies
120
were present. Amplified small plaques from lawn of E.coli3 and S1 (3Sas
) on the lawn of E.coli3 was produced homogenous small, turbid plaques
with clear center. Variable size resistant colonies were observed.
3. Isolation of phage from clinical specimen (Urine):
Urine sample of Urinary Tract Infection (UTI) patient was used as lysate
and plaque assay and spot assay was performed on the lawn of different
hosts. On the lawn of Ps. aeruginosa, P3, P5, P6 and P7 urine produced
variable size plaques, which was mixture of clear and turbid plaques.
large number of resistant colonies was present of the lawn of respective
hosts. (Table-5) Spot assay of urine on the lawn of Ps. aeruginosa, P3,
P5, P6 and P7 produced strong spots, which contain resistant colonies.
Numbers of resistant colonies were less on the lawn of P5 and P6.
Urine was propagated in P5 and P6 as source of phages. U1 (dilution of
10-8) on the lawn of P5 was produced two types of plaques, medium,
clear round, homogenouges, few small, turbid plaques. No resistant
colonies were observed. (Fig-2A) U2 (dilution of 10-6) on the lawn of P6,
produced two types of plaques, small and medium size, round and clear.
No resistant colony or turbid zones were present. (Fig-2B)
121
4. Determination of phage interaction with bacteria:
Plaque assay and spot assay was performed as basic assays to
determination of phage-host interaction. Lysate M77 on the lawn of P7
produced pinpointed plaques. Lysate B78 and M79 on the lawn of Ps.a
produced pinpointed turbid plaques but on the lawn of P7, M79 produced
very small, pinpointed plaques (Fig-2C) Lysate B78 on the lawn of P3
produced large, clear plaques. After 72 hrs dimension of plaques were
increased. Lysate M79 on the lawn of P3 produced uncountable
pinpointed, clear plaques (Fig-2D) Lysate M79am on the P7 produced
homogenous medium size, turbid plaques. Variable size resistant colonies
in each plaque were observed. Lysate M79al on the P7 produced
homogenous large clear plaques. (Table-4) Spot assay of M77, B78, M79
and B80 produced very strong clear spot. Few variable size resistant
colonies in clear area were observed. (Table-4)
5. Amplification of single plaque:
For All lysates several amplification was done in order to get the
homogenous plaques on the lawn of respective host. Lysate M76 on the
lawn of Ps.aeroginusa was produced 3 size plaques, small, medium and
large. All three sizes were amplified M76al, M76am and M76as.
122
Lysate B72 on the lawn of Ps. aeruginosa was produced 2 small turbid
plaques. Single plaque was amplified B72a on the lawn of Ps.a was
produced homogenous, clear and confluent plaques.
6. Effect of salt on Phage and Host interaction:
Plaque assay and spot assay on the lawn of Staphylococci aureus was
performed to compare the effect of MgSO4, CaCl2 and NaCl on phage-
host interaction. Plaque assay of Lysates 38, 39, 43, 46, 52, 53, 55, 59,
60 and 61 in presence of MgSO4 was strongly positive and plaques were
clear with halo zone. Lysates 39 and 52 produced turbid plaques. But in
presence of CaCl2 lysates 48, 52, 53, 55 and 60 produced no plaque on
the lawn of Staphylococci. Spot assay of these lysates in presence of
MgSO4 on the lawn of Staphylococci were positive and lysates 38, 43,
46, 53 and 60 were produced plaques around the clear spots and lysates
39 and 52 produced turbid plaque and on spot produced by Lysate 61
resistant colonies were present. Plaque assays of these Lysate in presence
of 7% NaCl and MgSO4 was strongly positive. Lysates 48, 52 and 55
were produced small size, clear plaques. In presence of 7% NaCl and
CaCl2 Lysates 39, 43, 46, 53, 59 and 60 were negative and Lysate 48 was
producing turbid plaques.
Spot assays of lysates 43, 46, 48, 52, 53, 55, 59, 60 and 61 in presence of
7%NaCl and MgSO4 were positive and no resistant colonies were
observed.
123
7. Comparative study of phage infection in enrich and minimal
media.
Plaque assay was performed to compare the effect of minimal media
(L.B) and enrichment media (BHI) on phage –host interaction. Plaque
assay of lysates M38, M39, M43, M46, M48, M52, M53, M55, M55,
M59, M60 and M61 in presence of MgSO4 and in LB media were
positive. Plaque assay of Lysates M38, M39, M43, M46, M59 and M61
in presence of CaCl2 and in LB media were positive but lysates M48,
M52, M53, M55 andM59 produced no result. Plaque assay of lysates
M38, M39, M43, M46, M48, M52, M53, M55, M55, M59, M60 and M61
in presence of MgSO4 and in BHI media were strong positive and clear,
round plaques were observed . Plaque assay of lysates M39, M55 and
M60 in presence of CaCl2 and in BHI media were negative.
8. Comparative study of selective and enriched media on phage
and host interaction:
Pyocin and Florescent base agar and soft agar were used as selective
media for Pseudomonas strains of this study and BHI was used as
enrichment media and plaque assay and spot assay were performed to
compare the specify of media on phage-host interaction. Lysate M85 on
the lawn of P7 was produced pinpointed, small, few large confluent
plaques. On the lawn of P3 and Ps.a produced confluent plaques, most of
124
the host lawn was eaten up by phages. Variable size resistant colonies
were present. Lysate M88 on the lawn of P7 was produced large clear
and pinpointed plaques. On the lawn of P3 few large clear plaques were
present, but on the lawn of Ps.a variable size resistant colonies were
present. Lysate M89 on the lawn of P7 was produced homogenous,
confluent plaques. Resistant colonies were observed. On the lawn of P3
pinpointed, clear and few turbid small plaques were present. Lysate M89
on the lawn of Ps.a produced confluent, large plaques .resistant colonies
also were observed.
Lysate M90 on the lawn of P7 was produced small, pinpointed and large
turbid with clear center plaques. On the lawn of P3 pinpointed, small
clear center and turbid hollow zone were present. Lysate M90 on the
lawn of Ps.a produced confluent large plaques contained variable size
resistant colonies. Lysate M92 on the lawn of P7 was produced
homogenous, confluent plaques. In some of plaques resistant colonies
were observed. On the lawn of P3 few variable size turbid plaques and
on the lawn of Ps.a large, confluent plaques, uncountable pinpointed
plaques were present. (Table-7)
9. Lysate activity after induction By Bile salt:
Plaque assay was performed as basic assay to determination of activity of
lysates after induction by Bile salt.
125
Lysate M81 on the lawn of Ps. aeruginosa and P3 produced variable size
plaques, clear small, some had hollow zone, large size and irregular
margin clear plaques were observed .( Fig-3D) Lysate M81 on the lawn
of P7 produced 3 sizes of plaques, small, medium and large size with
irregular margin. All plaques were clear (Fig-3E).
Lysate M82 on the lawn of Ps. aeruginosa and P3 produced clear plaques
and center of plate was eaten up by plaques. Most of the plaques were
clear, confluent and few had hollow zone. No resistant colony was
observed. (Fig-3B)
Lysate M82 on the lawn of P7 was produced confluent, clear, small size
plaques. Some of plaques were containing very small resistant colony.
(Fig-3A) Lysate M83 on the lawn of P3 was produced very clear and
large plaques and some had tiny zone. (Fig-3C)(Table-8)
10. Effect of Salt (Bile, MgSO4, CaCl2) on Induced Lysates:
Plaque assay was performed for comparative study of effect of Bile,
MgSO4, CaCl2 salts on infectivity of lysates. Lysates M84, M85, M86,
M87, M88, M89, M90, M92, C97 and C98 on the lawn of Ps.
aeruginosa, P3 and P7 were producing uncountable, confluent plaques
and few resistant colonies were observed on the lawn of respective host.
Lysates were further diluted to estimation of titration and accuracy.
(Table-11)
126
11. Identification of resistant colonies:
Gram staining of large resistant colony has shown gram negative, short
rods, Oxidase and citrate positive. Gram staining of small colony has
shown gram negative, short rods, these cells were change their
morphology , and were similar to gram negative coco bacillus, oxidase
and citrate positive. Both large and small resistant colonies on the F base
agar were produced green florescent pigments.
12. Induction of resistant colony by Bile salt.
After induction of resistant colonies selected from plaque assay plate of
P7 and Lysate M86 by Bile salt, plaque assay and spot assay were
performed. Lysate M93 on the lawn of Ps.a produced homogenous, clear
plaques, on the lawn of P7 variable size; most medium and few small
clear plaques were observed. On the lawn of P3, Lysate M93 produced
homogenous, confluent plaques, resistant colonies also were present.
Lysate M94 on the lawn Ps.a produced clear plaques, some of plaques
had turbid zone. On the lawn of P7, clear plaques and few pinpointed
clear plaques were present. Lysate M94 on the lawn of P3 produced
variable size, clear plaques.
Lysate M95 on the lawn of Ps.a produced homogenous, clear plaques. On
the lawn of P7 turbid plaques, confluent and pinpointed plaques were
observed.
127
Lysate M95 on the lawn of P3 produced confluent plaques, almost same
size. Variable size resistant colonies were present. (Table-6)
Lysate PAK on the lawn of P3 produced homogenous turbid plaques.
Large resistant colonies were observed. Lysate PAK on the lawn of P5
produced medium size homogenous clear plaques, some of plaques had
irregular margin. Lysate PAK on the lawn of P6 produced medium size
homogenous plaques. Variable size resistant colonies were present.
Lysate PAK on the lawn Ps.a produced large, clear and few confluent
plaques. Lysate PAK on the lawn of P3 produced uncountable,
confluent, clear plaques. Most of the lawn was eaten up by phages. Few
resistant colonies in clear area were observed.
Lysate PAK on the lawn of P7 after 72hr. produced very small clear
pinpointed plaques. Spot assay of induced lysates had shown strong
positive spot on the lawn of the respective hosts.
13. Comparative study of induced lysates activity in aerobic and
anaerobic condition:
Lysate M81 on the lawn of P7 in anaerobic condition was produced large
and medium size, very clear plaques and no resistant colony or turbid
zone were observed (Fig-4) Lysate M81 on the lawn of P3 produced
medium size, clear plaques and on the lawn of Ps. aeruginosa produced
small confluent clear plaques.
128
14. Induction of lysogenic strain of P7 by Naledixic acid:
Single colony of P7 was grown in LB broth supplement with Nalidixic
acid, final concentration of 150µg/ml. After 24hr lysate was filter striled
and plaque and spot assay was performed. Plaque assay of induced lysate
C101 on the lawn of P3 produced variable size clear plaques. On the
lawn of P7, homogenous, clear plaques were observed. Lysate C101 on
the lawn of Ps.a produced confluent, variable size plaque, resistant
colonies also were present. (Table-6)
15. Antibiotic Resistance Profile of Bacterial Strains:
The antibiotic susceptibility pattern of our isolates are presented that
strains Ps.aeruoginosa, P3, P7, P5, P6 and E.coli-N are resistant to
Ciproflaxin when Minimal Inhibitory Concentration (MIC) ≥ 5µg/ml. P3,
P7, P5, P6 and E.coli-N are resistant to Nalidixic Acid when MIC
≥150µg/ml to Ampicylin when MIC ≥200µg/ml, to Gentamycin when
MIC ≥50µg/ml to Methacylin when MIC is ≥ 5µg/ml to vancomycin
when MIC is ≥30µg/ml and to minomycin when MIC is ≥30µg/ml.(Fig-
25)
16. Phage separation by titration:
After inoculation of urine on BHI agar, plate was incubated for 24 hr at
37°C. The biochemical test performed and colonies were identified as
Streptococci, Pseudomonas, and E.coli.
129
Urine sample plaque assay and spot assay was strong clear spot on the
lawn of Ps. aeruginosa and E.coli3 and produced no spot on the lawn of
Streptococci. Pseudomonas was grown in BHI broth and was grown for
4 hr .and was centrifuged at 3000 rpm for 5 min. pellet was washed 2
times with PO4 buffer and 100λ of cell suspension was mixed in LB soft
agar and plated. After 24 hr. small, turbid, irregular margin plaques were
observed. E.coli3 pellet was washed 2 times with PO4 buffer and 100 λ
of cell suspension was mixed in LB soft agar and plated .after 24hr. few
small, pinpointed, clear plaques were observed.
Streptococci pellet was washed 2 times with PO4 buffer and 100 λ of cell
suspension was mixed in LB soft agar and plated. After 24hr. no plaque
was present. Finally, supernatant was filter sterilized and spot assay was
performed on the lawn Pseudomonas, E.coli3 and Streptococci. After 24
hr. clear spot were observed on the lawn of E.coli3 and Pseudomonas.
17. Determination of bacteriocin activity of Lysates by wells
method:
10µl of each lysate was added in to separate wells. And after 24hr.
incubation at 37°C, Lysates M84, M87, M88 and M92 were produced
very narrow turbid zone around the wells. Presence of zone may be is
due to bacteriocin activity of these lysate. (Table-10)
130
18. Titration of lysates by liquid serial dilution method (PFL/ml):
Plaque assay in different dilution was performed to estimate the titration
of lysates. Lysate M84 was diluted 10-6 times and plaque assay was
performed. On the lawn of P3 different size, large clear and small turbid
plaques were produced. Accuracy of M84 was determined ± 47%.
Lysate M85 was diluted 10-7 times and plaque assay was performed. On
the lawn of P3, variable size, confluent, turbid and few clear plaques
were observed. Accuracy of M85 was determined ±31%. Lysates M86
was diluted 10-5 times and plaque assay was performed. On the lawn of
P3, variable size plaques, large plaques were clear and small size plaques
were turbid with clear center and confluent were observed .accuracy of
M86 was determined ±44%. Lysate M87 was diluted 10-9 times and
plaque assay was performed. On the lawn of P3, homogenous medium
sizes turbid with clear center were present. Accuracy of M87 was
determined±18%. Lysate M88 was diluted 10-10 times and plaque assay
was performed. On the lawn of P3 Variable size plaques, clear with no
resistant colony were observed. Accuracy of M88 was determined ±32%
Lysate M89 was diluted 10-4 times and plaque assay was performed. On
the lawn of P3 Clear, small plaques and several turbid plaques in
different size and in one side of lawn were observed and after 72 hrs.
Increase in size and very tiny plaques in other side of lawn also observed
.accuracy of M89 was determined ±32%. Lysates M90 was diluted 10-10
131
times and plaque assay was performed. On the lawn of P3 variable size,
district, clear and few turbid plaques were present. Accuracy was
determined ±30%. Lysate M91 was diluted 10-16 times and plaque assay
was performed. On the lawn of P3 Small, turbid plaques, some confluent
plaques also observed. Accuracy was determined ±26%.
Lysate M92 was diluted 10-4 times and plaque assay was performed. On
the lawn of P3, homogenous medium size clear and few small confluent
turbid plaques were observed. Accuracy of M92 was determined ±37%
Lysate C97 was diluted 10-9 times and plaque assay was performed. On
the lawn of P3 Clear variable size, few confluent small turbid plaques
were observed. Accuracy of C97 was determined ±42%. Lysate C98 was
diluted 10-3 times and plaque assay was performed. On the lawn of P3
clear tiny irregular margin plaques and few clear large plaques were
observed. Accuracy of C98 was determined ±70%. Lysate C99 was
diluted 10-13 times and plaque assay was performed. On the lawn of P3
Produced homogenous plaque with large turbid zone. Accuracy of C99
was determined ±10.5%. Lysate C101 was diluted 10-2 times and plaque
assay was performed. On the lawn of P3 Variable size plaques, few clear
medium size and background of plate was full of pin pointed turbid
plaque. Accuracy of C101 was determined ±60%. (Table-11)
132
19. Laemmli Discontinues Gel Electrophoresis of Protein:
Protein profile was similar in all lysates; phage in lysate U1 and U2
have the identical bands profiles. However in U1 one additional
strong band was present. In U7 one additional band, which was very
strong, was present. That indicated high quantity of protein in sample.
This strong band referred to serum that was used for induction.U9 is
similar to U2 but in U9 the bands are wear that is due to low quantity
of protein. (Fig-12) Amplified lysate of PS5, PL5, PS6 and PL6 have
the identical bands profiles.
20. Nuclease assay and DNA profile:
All phages which were prepared from single plaques have shown band of
DNA genomes on the basis of their migration following SDS Agarose
electrophoresis. U1 and U2 have got the very strong band in the same
position. All the lysates in addition to induced ones have shown a single
discrete band of ds DNA (Fig-13) Phage E.coli.N, exhibited two DNA
band. These DNA bands were in same intensity even following 3 rounds
of plaque purification. (Fig-13)
21. Induction of E.coli-N lysogen by antibiotics:
Induced lysate of E.coli-N by tetracycline produced 2 types of small and
medium size clear plaques on the lawn of E.coli-N. After induction of
133
E.coli-N by ampiciline no plaque were observed on the lawn of respective
hosts.
22. Induction of lysogenic E.coli-N by human serum:
After induction of E.coli-N by 4% human serum plaque assay and spot
assay was performed. Induced Lysate of E.coli-N by serum (U7) on the
lawn of P5 and P6 produced three types of plaques. Medium and small
plaques were clear and large plaques had irregular margin. (Table-4)
Lysate U7 on the lawn of E.coli-N produced no plaques. (Table-4)
23. Induction of lysogenic E.coli-N by Urea:
After induction of E.coli-N by urea plaque assay and spot assay was
performed. Induced Lysate of E.coli-N by urea (U9) on the lawn of P5
and P6 produced homogenous, clear plaques, no resistant colonies were
present. Lysate U9 and U6 on the lawn of E.coli1 produced pinpointed
and small clear plaques. Lysate U9 on the lawn of Ps. aeruginosa
produced uncountable, variable size clear plaques and resistant micro
colonies and macro colonies were present. Lysate U9 on the lawn of P5
produced three types of plaques which were picked separately and were
amplified. Plaque assay of amplified lysates (PS5, PM5, and PL5) on the
lawn of P5 produced homogenous, clear, round plaques. No turbid
zone or resistant colonies were observed.
134
U9 on the lawn of P6 produced three types of plaques. Each plaque was
picked separately and was amplified. Plaque assay of amplified lysate
PS6 on the lawn of P6 has shown homogenous small, clear, round
plaques. On the lawn of P6, amplified lysate PM6 produced homogenous,
medium size, turbid, irregular margin plaques. Amplified PL6 on the
lawn of P6 was produced large, clear, round, confluent plaques. (Table-
11)
24. Induction of E.coli-N lysogenic strain by Uric acid:
After induction of E.coli-N by uric acid plaque assay and spot assay was
performed. Induced Lysate of E.coli-N by uric acid (U10) on the lawn of
P6 produced few small turbid plaques. And on the lawn of E.coli-N
small clear plaques were produced.
25. Induction of lysogenic E.coli-N by UV.
Urine was propagated in E.coli (U12), E.coli2 (U13), E.coli-N (U14)
and E.coli40MD (U16) as source of phages and then were exposed to UV
for 2 min. After induction by UV plaque assay and spot assay was
performed.
Induced lysate U12 on the lawn of P5 produced variable size plaques
which contain resistant colonies. Induced lysate U12 on the lawn of P6
135
produced uncountable variable size plaques. Resistant colonies also were
present.
Induced lysate U12 on the lawn of Ps.a produced variable size plaques,
large plaques were clear. Resistant colonies were observed. (Table-4)
Induced lysate U12 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. Induced lysate U13 on the
lawn of P5 produced few variable sizes, turbid plaques. Resistant
colonies were observed. Induced lysate U13 on the lawn of P6 produced
few small, turbid plaques. Induced lysate U13 on the lawn of Ps.a
produced uncountable, variable size plaques. Resistant colonies were
present. (Table-4) Induced lysate U13 on the lawn of E.coli40MD, E.coli,
E.coli2, E.coli-N, Staphylococci produced no plaque or spot.
Induced lysate U14 on the lawn of P5 produced variable size, clear
plaques. Induced lysate U14 on the lawn of P6 produced uncountable,
small size, clear and few pinpointed plaques. Induced lysate U14 on the
lawn of Ps.a produced variable size clear plaques.
Induced lysate U14 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. (Table-4)
Induced lysate U16 on the lawn of P5 produced small and few large
plaques .resistant colonies were present. Induced lysate U16 on the lawn
of P6 produced variable size clear, round plaques. Induced lysate U16 on
136
the lawn of Ps.a produced variable size turbid, irregular margin, few
confluent plaques. Resistant colonies were observed.
Induced lysate U16 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. (Table-4)
26. Transmission Electron Microscopy of phage particles:
Each phage isolated was examined under the electron microscope and
was placed in phage families based on its morphology or morphotype as
describe by Ackerman and colleagues. (Fig-14-21) In U1 we observed
variation in isometric head sized from 92 × 108 nm to 108 × 100 nm and
contractile tail of 133 × 25 nm. Tiny small empty head particles were also
observed (Fig-15A). Electron micrograph of U2 have shown similar
particles consisting of an isometric head of 130 × 95 nm and contractile
tail of 140 × 20 nm observed (Fig-15B). Induced lysate U9 phage
particles with the isometric head 116× 122nm and complex contractile
tail 122 × 128 nm were observed (Fig-16)
27. Induction of P5 and P6 lysogenic by Urea:
After induction of Lysogenic strains P5 and P6 by 0.5% urea plaque
assay and spot assay was performed. Induced lysate of P5urea on the
lawn of P5 was produced uncountable confluent plaques which had clear
137
center and large turbid zone. At the background, small, turbid plaques
with turbid zone were observed. After 72 hr. turbid zone was more clear
(Fig-5).
Lysate P5 urea on the lawn of P6 was produced clear, round,
homogenous large and few small plaques. (Fig-5) Lysate P6urea on the
lawn of P5 was produced few small, clear plaques. Lysate P6urea on the
lawn of P6 was produced uncountable, homogenous, confluent, clear
plaques. Resistant colonies were also present and few mucoidal micro
colonies were observed.
28. Effect of maltose on interaction of host and phage:
Plaque assay of lysate U9 on the lawn of P6 in present of maltose was
performed. Central portion of lawn was clear which was due to strong
phage-host interaction. Uncountable large plaque and few pinpointed
clear plaques were observed. Plaques were almost homogenous and large
number of resistant micro colonies and macro colonies were present.
Lysate U9 on the lawn of P6 in present of no sugar produced,
uncountable pinpointed and few small and large clear plaques. Less
number of resistant micro colonies and macro colonies were observed.
(Fig-6) Small and large size plaques were amplified in presence of
maltose and plaque assay was performed.
138
Amplified lysate PS6 on the lawn of P6 was produced homogenous small
plaques. Three types of resistant colonies were present:
- Large number of mucoidal, transparent, white color macro
colonies.
- Transparent, yellow color mucoidal macro colonies.
- Pinpointed, turbid micro colonies.
Amplified lysate PL6 on the lawn of P6 was produced homogenous large
plaques with turbid zone. Two types of resistant colonies were observed.
- Few mucoidal macro colonies
- Large number of turbid micro colonies.
Some resistant colonies had turbid zone. (Fig-6)
29. Phage DNA purification:
Isolated DNA fragments obtain by Phenol-Chloroform extraction,
Promega kit or directly from lysate were run in 2% Agarose gel and
further purified. Ethidium bromide Agarose plate was used in each step to
highlight the concentration and presence of purified phage DNA.
30. Southern Blotting:
Result of Southern blotting have shown that lysate U1 (Fig-22, lane-3)
and U2 (Fig-22, lane-4) are positive, 2 bands which were close together at
139
top and one strong band of low molecular weight was highlighted by
PS5Φ DNA as probe. PL6 Φ and PL5 Φ have shown identical patterns.
Comparing U1 (Fig-22, lane-3) and U2 (Fig-22, lane-4) with 4 amplified
lysates (PL6, PS6, PL5 and PS5), in U1 (Fig-22, lane-3) and U2 (Fig-22,
lane-4), 2 additional bands at top were present which were missing in
amplified ones. Smearing in PS5 (Fig-22, lane-1) was more than U1 (Fig-
22, lane-3) and U2 (Fig-22, lane-4) that could be due to replicated form
of phage genome or chromosomal DNA. All amplified lysate DNA (Fig-
22, lane-1, 6, 7, 8), U1 (Fig-22, lane-3) and U2 (Fig-22, lane-4) are
closely related and identical. Lysate H2, H3 and K3 were strongly
positive and related when PL5Φ was used as probe. In H2 two heavy
molecular weigh bands close to each other and smearing through out was
highlighted.
Highlighted band in M97 have shown slight shift and was concentrated.
Lysate M87, induced lysates P5urea and P6urea have not shown any
positive results with treated probes.
31. Restriction endonucleases:
The restriction endonuclease digestion pattern with EcoR I for DNA
purified from each four amplified phage are shown (Fig-23, lane;1-5) and
gave similar electrophoretic mobility pattern, PS6 has got 19 bands ,PS5:
140
10 bands with low intensity .PL6 and PL5 Shown; 18 bands. Bands were
almost in similar position.
Digestion pattern with Bam H I (Fig-23, lane; 1-5) for above DNAs
showed 7-13 fragments. PS5 has shown high density in bands.
Cla I (Fig-23, lane; 1-5) showed similar position bands.PS5 has got 29
bands, PS6: 30 bands, one additional band in 6th position, PL5:18 bands,
band of 7th position was missing. PL6: 19 bands, additional band with
low mobility was present. Dra I (Fig-23, lane; 1-5) showed PS5 has 26
bands, PS6: 26 bands, which lower bands shows weak intensity. PL5:17
bands. Band at 11th position was missing and bands have got strong
intensity. PL6: 19 have got bands.
Digestion with Hpa I (Fig-23, lane; 1-5) PS5: 20 bands, band from
position 9th was missing. PS6:20 bands. PL5: 21 bands and bands with
high mobility at the bottom of gel show weak intensity. PL6: 22 bands.
Bands have got strong intensity.
DNAs also digested by Msp I (Fig-23, lane; 1-5) has shown, PS5:18
bands, PS6:20 bands, PL5:20 bands and PL6:17 bands.
Digestion with Hind III (Fig-23, lane; 1-5) showed PS5 has got 16 bands
PS6:31 bands. There is an additional band at 2nd position. PL5:31 bands,
the bands have shown high density and band from 2nd position was
missing. PL6 has got 17 bands and lower bands were missing.
141
Digestion pattern with Hpa II (Fig-23, lane; 1-5) has shown that, PS5 has
got 15 bands, PS6:13 bands, PL5:10 bands and PL6 has shown 15 bands.
DNA of U9 Φ after digestion with EcoR I shows 15 bands, Bam H I:17
bands, Cla I :22 bands ,Dra I:28 bands, Hpa I:20 bands, Hpa II:16 bands
and Msp I:16 bands. DNA of U9 has no restriction site for Hind III
endonuclease, since it gave the same electrophoric pattern as compare to
undigested DNA(Fig-23, Lane;1-5)
The DNAs gave similar mobility pattern but DNA of U9 Φ has no
restriction site for Hind III endonuclease, since it gave the same
electrophoric pattern as compare with undigested DNA.
Hpa II (Fig-23, lane; 1-5) showed several digested fragments, similar
position which shows they are identical.
32. Wet slide agglutination:
After 15 minutes of incubation at 37°C aggregation was start in all the
tubes contained immunized Rabbit antiserum .after 60 minutes, in tube
contained antiserum raised by vaccine motile clumps and alive cells in
the filed were observed, in tube contained antiserum raised by vaccine
and oil motile small clumps, most cells were alive. In tube contained
antisera raised with vaccine, oil and Ps (P5). ϕ DNA, large clumps with
no movement were observed. Similarly in tube contain antisera raised by
vaccine, oil and E.coli ϕ (U9) DNA large clumps were present.
142
Tube agglutination after 15 min of incubation at 37°C of Mice antisera
raised by vaccine and oil, vaccine and Ps. ϕ DNA, vaccine, oil and P5. ϕ
DNA, vaccine, oil and E.coli ϕ DNA were similar and clumps were
present. While tube contains control antisera shows very small
aggregation, motility of the cells were observed.
The results obtained with wet slide agglutination are shown in (Table-13)
33. Ouchterlany gel immunodiffusion:
The raised antiserums were interacted with S.typhi antigen and a clear
line of identity among the wells was observed. (Fig-24)
34. Immnoelecterophoresis:
Comparison of raised antiserums against S.typhi by
immunoelectrophoresis showed that each antiserum contained positive
charged antibodies and had anodic movement. That was common in all
raised antiserums of this study. Antisera raised against vaccine, adjuvant
vaccine and phage DNA (U9 Φ) vaccine had relatively stronger positive
charges. Antisera raised by phage DNA (U9 Φ) vaccine had two
apparently positively charged zone. Antiserum raised against Adjuvant
vaccine had a broad migration zone as compare to other antiserums
No zone was observed in control serum against S.typhi antigen.
143
35. Estimation of total γ-globulin raised in Rabbit and Mice
against S.typhi antigen by ELISA:
ELISA result, has indicated high yield of gamma globulin in Rabbit
antisera raised by adjuvant DNA vaccines (Fig-26). Similarly in Mice
antiserums (Fab/Fc- specific) maximum reading was due to adjuvant
DNA vaccines ( Fig-29) cut off value was 0.105
36. Coating ELISA 96 wells plate by lysate:
ELISA results, has indicated that 83% of HCV positive serums were
bind to Lysate coated plate ( Fig-30) .Maximum reading was 0.283 while
blank was 0.059.
37. Coating ELISA 96 wells plate by Pseudomonas cells:
ELISA results, has indicated that 77% of HCV positive serums were react
to Pseudomonas coated plate (Fig-30). Maximum reading was 0.494
while blank was 0.053.
38. Western blotting of total amount of γ-globulin raised in Rabbit
and Mice against S.typhi antigen:
Western blot profile of immunized mice antisera indicated that IgG- Fab
highlighted the high molecular weight (220-97-46.kD) (Fig-31). Whereas
144
low molecular weight bands (14 KD) of Ag were highlighted by IgG-Fc
fragment. (Fig-31)
Similarly western blot profile of immunized rabbit has shown enhance Ab
production against all four types of S.typhi Ags. (Fig-32)
39. Phage application as therapeutic agent for treatment of Mice
infection due to MDR (Multiple drug resistance) Pseudomonas.:
The results of the recovery of animals form infection is illustrated in (Fig-
34) two dose of phage application significantly reduced the bacterial load
on the legion.
40. Phage application as therapeutic agent for treatment of Mice
infection due to MDR (Multiple drug resistance) E.coli:
The parameter used to evaluate the efficacy of phage therapy were the
same for the MDR Ps. infected mice. Two dose of phage application
simultaneously local and oral administration were used and after 5 days
infected mice was healthy and no infection or diarrhea were observed.
(Fig-35)
145
41. Phage therapy on chronic MDR infection.
The data reported in (Fig-34-39) proved untreated control animals carried
chronic infection (5days) after 6 days of phage administration, were free
of the bacterial infection.
146
Bioinformatics analysis
Sequencing:
HCV PCR products analysis
Blast matching of PCR product amplified from phage genome with C1
and C2 primers ( Fig- ) have been shown similarity (63%- 92 % ) among
different HIV subtype (B, D, O, SMM, 10_CD, MAC, 01_AE, BF1, A,
A1, U, 33, 01B, 02C, 02_AG and BF ) in HIV data base. Interestingly,
data has shown that phage genome of our collection have 80% similarity
with HIV-1 envelope glycoprotein (env) gene, rev protein (rev) and tat
protein (tat) genes , 63% similarity with vpu genes , 73% pol genes and
76% similarity with gag genes (Fig-42 ). Ac2 and Sc2 primers have
highlighted the segments on phage genome which has shown 82-86%
similarity with partial Ns3 and poly protein genes, respectively. PCR
product raised by Ac2 primer has shown 64% similarity with env gene.
BLAST matching of PCR product amplified from the template of
Pseudomonas phage genome with primers of HCV (Table-27) have
exhibited the similarity among different HCV genotype in HCV database
(66%-74% with 1a,2a,1b and 2b) (Fig-41 ) . HIV-1 QuickAlign analysis
of PCR product raised by phage PS5 has shown, primer C1 has
highlighted the segment 224nt, which has homology with 5’-LTR of
147
HIV-1. The LTR region of HIV-1 genome is known to be highlight
polymorphic among different genetic variants of the virus. Similarly
primers Sc2 has shown a stretch of 227nt match with Pol gene of HIV-1
and primers Ac2 has highlighted the segment of 131nt related to env gene
of HIV-1 (Table-27).
Vancomycine PCR product analysis:
Van Y:
On PCR product raised by Y primer, the stretch of 14nt
(AAGACAATTACAGA) has 100% homology with 14 bp stretches
present on different location of Staphylococcus aureus MRSA252. All
these location were corresponding to genes for rRNA-23S ribosomal
RNA. This motif in phage genome may play regulatory role at the level
of translation during its stay in host. (Table-20) Similarly stretch of 13 nt
motif of PCR product by Y1 has shown 100% identity with putative cell
division protein, peptidyle-tRNA hydrolase and rRNA-23 ribosomal
RNA on Staphylococcus aureus MRSA25 chromosome (Table-20). Y1
primer was highlighted 2 motifs of (GATGCTGCCCGGGGTTGCGG)
and (TGCTGCACGGGGTGCCGGC) on PCR product of phage genome
, these motifs impilicated the GC rich functional region in the phage
genome, which have 90% and 94% identity with hypothetical protein and
148
integral membrane efflux protein respectively. These motifs were share
100% similarity on 10 nt of their sequence on Streptomycis genome .Y1
primer has shown 2 motifs of 19-22 nt which were present on different
location on phage genome and chromosome but were related to genes for
integral membrane protein in Streptomycis. (Table- 26)
BLAST result of PCR product of van Y has shown significant existence
of motifs of 13-25 bp of phage genome to 13-793bp related to membrane
protein of Staphylococcus aureus MRSA252 and Enterococcus faecalis
V583. Short motifs of 15-33 bp have shown 94 % identity to 15-981 bp
Streptomycis chromosome. (Table-19)
Van B:
BLASTn result of PCR product raised by van B primer , 2 stretches of
16-15 nt (CACGCATGATGTTCAA), (TGTTCAATATAATTT) and 3
stretches of 15-18nt with van B1 primer (TGTTCAATATAATTT),(
ATTAATACAACCCGATCA ) and ( GCAAGCAATAAATTTTCT ),
100% identity were highlighted at different location of Enterococcus
faecalis V583 chromosome corresponding to ABC- transporter ATP-
binding/permease protein (Table-17). Interestingly ABC-transporter
protein genes were highlighted with primers van S, van S1, van B and
van B1 (Table-17) at different position on phage genome and have shown
100% homology on Enterococcus faecalis V583 chromosome.
149
Van B,B1 primer highlighted 2 motifs of 22-23 nt (
AGGACATACGTTTGTTGAAACAA) ,
(GGACATACGTTTGTTGAAACAA) correspond to peptidyl-tRNA
hydrolase protein and 15 nt stretches of (CGTTTGTTGAAACAA)
related to genes for Triphosphoribosyl-dephospho-CoA synthase has
show 100% identity repeated twice on phage genome but same location
on Enterococcus faecalis V583. Several 15-30 nt AT rich signatures were
highlighted correspond to hypothetical protein on Enterococcus faecalis
V583 chromosome which have shown 83-100% identity with PCR
product raised by van B primer.
BLASTn comparison of PCR product of phage raised by van B primer
and Staphylococcus aureus MRSA25 chromosome were highlighted
single stretch of 12 nt ( TGACGACCAACA ) represented genes for
putative cell division. Similarly primers van B and B1 highlighted
13,14nt motifs of (CCAACATGGACAA) and (CCAACATGGACAAC),
100% identity which were at same location of Staphylococcus aureus
MRSA25 genome and different location on phage genome correspond to
Sodium:alanin symporter family protein.
Van B primer highlighted 15nt signature of (TGAATCATTACACAC)
with 100% identity corresponding to cobalamin synthesis protein/P47K
family protein genes on different location on phage genome and
Staphylococcus aureus MRSA25 chromosome. Similarly gene for
150
mannitol-1-phosphate 5-dehyrogenase has got 100% identity with 13,14
nt ( CATACATTTCTCCTT),(ATAAACCCAAAGAC) located at 2
different position of PCR product of phage genome and Staphylococcus
aureus MRSA25 chromosome.
Van S:
Van S primer highlighted 19 nt ( AAGCAACTTTTGCAAAAAA) , 94%
identity correspond with ABC-transporter in Enterococcus faecalis V583
chromosome . van S,S1 primers has shown 2 stretches of 14nt
(CATATGCTGGTGCA),(TGCTGGTGCAGATG) 100% identity
present on same location on Staphylococcus aureus MRSA25
chromosome and different position (11 nt different) on phage genome.
Van R:
BLASTx and BLASTn analysis of PCR products highlighted by van R
and R1 primers was indicated that, 2 stretches of 29nt , 83% identity, 2
stretches of 64nt , 78% identity, 2 stretches of 120 nt , 67% identity , 2
stretches of 65nt , 71% identity and 2 stretches of 33 nt , 79% identity
represented of genes for DNA-binding response regulator on
chromosome of Enterococcus faecalis V583. Comparison of BLAST
matching of our data has proved a stretch of 19 bp on PCR product
highlighted with van S, van B and Y1 primers at the 826-844 nt(
151
AAGCAACTTTTGCAAAAAA) position on phage PS5 genome has
similarity with the motifs of different gene on the chromosome of
Staphylococcus aureus MRSA252, Enterococcus faecalis V583 and
Streptomycis i.e. Glycine betaine transporter 2 in Staphylococcus aureus
MRSA252, ABC-transporter, permease protein in Enterococcus faecalis
V583 and integral membrane protein in Streptomycis respectively .(
Table-19).
152
Figure 1: Spot Assay of Isolated Lytic Phage Lysate on the Lawn of Multiple Drug Resistance E.coli3
A B Key: A: lawn of bacterial culture E.coli 2 B: lawn of bacterial culture E.coli 3
153
Figure 2: Plaque Assay of Lytic Phage on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
A B
C D Key: A: Plaque assay of lysate U1 on the lawn of P5 B: Plaque assay of lysate U2 on the lawn of P6 C: Plaque assay of lysate M79 on the lawn of Ps.a D: Plaque assay of lysate M79 on the lawn of P3
154
Figure 3: Plaque Assay of Bile Salt Induced Lysates on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
A B
C D
E Key: A: Plaque assay of lysate M82 on the lawn of P7 B: Plaque assay of lysate M82 on the lawn of P3 C: Plaque assay of lysate M83 on the lawn of P3 D: Plaque assay of Lysate M81 on the lawn of Ps.a E: Plaque assay of lysate M81 on the lawn of P7
155
Figure 4: Comparative Study of Induced Lysates Activity in Aerobic and Anaerobic Condition on the Lawn of Different Strains of Multiple Drug Resistance Pseudomonas spp.
A B
C D Key: A: anaerobic conduction, Lysate M81, lawn of P3. B: aerobic conduction, Lysate M81, lawn of P3. C: anaerobic conduction, Lysate M81, lawn of P7. D: aerobic conduction, Lysate M81, lawn of P7.
156
Figure 5: Plaque Assay of Urea Induced Strains of Pseudomonas spp. P5, P6 on the Lawn of Respective Hosts.
A B
C D Key: A: Plaque assay of lysate P6urea on the lawn of P6 B: Plaque assay of lysate P5urea on the lawn of P5 C: Plaque assay of lysate P5urea on the lawn of P6. D: Plaque assay of lysate P6urea on the lawn of P5.
157
Figure 6: Effect of Maltose on Interaction of Host-Phage by Plaque Assay.
A B
C D
E Key: A: Plaque assay of lysate PL5 on the lawn of P5 B: Plaque assay of lysate PS6 on the lawn of P6 C: Plaque assay of lysate PL5 on the lawn of P6 D: Plaque assay of lysate PS5 on the lawn of P5 E: Plaque assay of lysate U9 on the lawn of P6
158
Figure 7: Plaque Assay of Human Serum Induced Lysates.
A B
C D Key: A: Plaque assay of lysate U7 on the lawn of P5 B: Plaque assay of lysate U7 on the lawn of P6 C: Plaque assay of lysate U8 on the lawn of P6 D: Plaque assay of lysate U8 on the lawn of P5
159
Figure 8: Plaque Assay of Urea Induced Lysates
A B
C D Key: A: Plaque assay of lysate U9 on the lawn of E.coli B: Plaque assay of lysate U6 on the lawn of P6 C: Plaque assay of lysate U9 on the lawn of P6 D: Plaque assay of lysate U9 on the lawn of P5
160
Figure 9: Plaque Assay of UV Induced Lysates.
A B
C D Key: A: Plaque assay of lysate U14 on the lawn of P6 B: Plaque assay of lysate U15 on the lawn of P6 C: Plaque assay of lysate U12 on the lawn of P5 D: Plaque assay of lysate U15 on the lawn of P6
161
Figure 10: Spot Assay of Isolated Lytic Phage on the Lawn of Multiple Drug Resistance Pseudomonas aeruginosa and E.coli3
A B Key: A: lawn of bacterial culture Ps.a B: lawn of bacterial culture E.coli3
162
Figure 11: Polyacrylamide Gel Electrophoresis of Isolated Pseudomonas Phages from Sewage in 10% Gel
1 2 3 4 5 6 7 8 9 10 11 12 13 Key: Lane 1: Lysate M101 Lane 2: Lysate M97 Lane 3: Lysate M92 Lane 4: Lysate M91 Lane 5: Lysate M90 Lane 6: Lysate M89 Lane 7: Lysate M88 Lane 8: Lysate M87 Lane 9: Lysate M86 Lane 10: Lysate M84 Lane 11: Lysate K2 Lane 12: Lysate K3 Lane 13: Lysate K1
163
Figure 12: Polyacrylamide Gel Electrophoresis of Isolated Pseudomonas Phages from Urine in 10% Gel.
1 2 3 4 Key: Lane 1: Lysate U1 Lane 2: Lysate U2 Lane 3: Lysate U9 Lane 4: Bovine serum albumin
164
Figure 13:
DNA Profile of Isolated Lytic Phages.
1 2 3 4 5 6 7 8 9 Key: Lane 1: Purified DNA from amplified phage PS5 Lane 2: Purified DNA from amplified phage PL5 Lane 3: Purified DNA from amplified phage PS6 Lane 4: Purified DNA from amplified phage PL6 Lane 5: Nuclease assay from lysate K3 Lane 6: Nuclease assay from lysate H1 Lane 7: Nuclease assay from lysate H2 Lane 8: Purified DNA from lysate 3S Lane 9: Purified DNA from U9
165
Figure 14:
Electron Micrograph of Urine.
A:
B:
C: Key: A: Phage particle in urine B: Phage particle in urine C: Phage particle in urine
166
Figure 15: Electron Micrograph of Pseudomonas Lysates U1 and U2 A:
B:
Key: A: lysate U1 B: lysate U2
167
Figure 16: Electron Micrograph of E.coli-N Lysate U9 A:
B:
Key: A: Phage particle (large in number) B: Phage particle (few in number)
168
Figure 17: Electron Micrograph of Amplified Lysates PS5 and PS6. A B
Key: A: lysate PS5 B: lysate PS6
169
Figure 18: Electron Micrograph of Amplified Lysates PL5 and PL6. A B
Key: A: Lysate PL5 B: Lysate PL6
170
Figure 19: Electron Micrograph of Induced Lysate P5Urea
171
Figure 20: Presence of Empty Head Bacteriocin Particle in Lysate U1
172
Figure 21:
Electron Micrograph of Induced Lysate 3S
.
173
Figure 22: Southern Blot Analysis A B
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 Amplified lysates, using the PL5 Striped off blot and highlighted as probe (after 30 min exposure). with 2nd probe( PS6)( after 30 min exposure). Key: Lane 1: Ф PL5 DNA Lane 2: λ DNA Lane 3: lysate U1 Lane 4: lysate U2 Lane 5: lysate U9 Lane 6: lysate PS6 Lane 7: lysate PL6 Lane 8: lysate PL5
174
Continue- Determination of Sequence Homology Between the Genome of Different Phages and P6S Probe. C
1 2 3 4 5 6 7 8 Lysates, using the PS6 as probe (after 30 min exposure). Key: Lane 1: Lysate M84 Lane 2 Lysate M97 Lane 3: Lysate M90 Lane 4: Lysate U9 Lane 5: Lysate U9P5 Lane 6: Lysate U9P6 Lane 7: Lysate P5urea Lane 8: Lysate P6urea
175
Continue- D
1 2 3 4 5 Lysates, using the PS6 as probe (after 30 min exposure). key: Lane 1: Lysate H2 Lane 2 Lysate M87 Lane 3: Lysate K3 Lane 4: Lysate H3 Lane 5: Lysate 97
176
Figure 23: Restriction Analysis of Amplified Pseudomonas Phage DNAs and E.coli phages Dra I Hpa II Hind III EcoR I
1 2 3 4 5 6 1 2 3 4 5 1 2 3 4 5 6 1 2 3 4 6 Bam H I Cla I Msp I Hpa I
1 2 3 4 6 1 2 3 4 5 6 1 2 3 4 5 6 1 2 3 4 5 6 Key: Lane 1: PS5 Ф Lane 2: PL6 Ф Lane 3: PS6 Ф Lane 4: PL5 Ф Lane 5: U9 Ф Lane 6: 3S
177
Figure 24:
Immunoelectrophoresis Antigen-Antibody Reaction of Rabbit Antiserum Raised Against S.typhi Antigens by Use of Mineral Oil, DNA and Adjuvant Vaccine by Immunoelectrophoresis. A B
C D
E
Key: A: antiserum raised against vaccine + mineral oil + DNA of E.coli phage B: antiserum raised against vaccine C: antiserum raised against vaccine + mineral oil D: antiserum raised against vaccine + minimal oil + DNA of Ps phage E: Control
178
Figure 25: Antibiotic Resistance Profile of Pseudomonas aeruginosa and E.coli Strains.
0
20
40
60
80
100
120
140
160
µg/ml
Ps.aeruginosa
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
0
20
40
60
80
100
120
140
160
180
200
µg/ml
Ps3
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
179
Continue-
0
20
40
60
80
100
120
140
160
180
200
µg/ml
Ps(SIUT)
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
0
20
40
60
80
100
120
140
160
180
200
µg/ml
Ps5
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
180
Continue-
0
20
40
60
80
100
120
140
160
180
200
µg/ml
Ps6
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
0
50
100
150
200
250
µg/ml
E.coli-N
Ciproflaxin
Nalidixic acid
Ampicylin
Gentamycin
Methacylin
vancomycin
Minomycin
181
Figure 26: Estimation of Total Gamma Globulin Raised in Rabbit Against S.typhi Antigens by Use of Mineral Oil and DNA Vaccine by ELISA.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
1 2 3 4 5 6
Samples
Co
nc
en
tra
tio
n
Series2
Key: Sample No. 1: Vaccine Sample No. 2: Vaccine + Mineral Oil Sample No. 3: Vaccine +Mineral Oil +DNA Ps ϕ Sample No. 4: Vaccine +Mineral Oil +DNA E.coli ϕ Sample No. 5: Control No. 6: Blank
182
Figure 27: Estimation of IgG Raised in Mice against S.typhi Antigens by Use of Mineral Oil and DNA Vaccines (Using IgG-Fc as Secondary Ab) by ELISA
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
0.5
1 2 3 4 5 6
Samples
Co
nc
en
tra
tio
n
Series2
Key: Sample No. 1: Vaccine +Mineral Oil Sample No. 2: Vaccine + DNA of Ps. ϕ Sample No. 3: Vaccine +Mineral Oil + DNA of Ps. ϕ Sample No.4: Vaccine + Mineral Oil+ DNA of E.coli ϕ Sample No.5: Control No.6: Blank
183
Figure 28: Estimation of IgG Raised in Mice Against S.typhi Antigens by Use of Mineral Oil and DNA Vaccines (Using IgG-Fab as Secondary Ab) by ELISA
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1 2 3 4 5 6
Samples
Co
nc
en
tra
tio
n
Series2
Key: Sample No. 1: Vaccine +Mineral Oil Sample No. 2: Vaccine + DNA of Ps. ϕ Sample No. 3: Vaccine +Mineral Oil + DNA of Ps. ϕ Sample No.4: Vaccine + Mineral Oil+ DNA of E.coli ϕ Sample No.5: Control No.6: Blank
184
Figure 29: Estimation of Total Gamma Globulin Raised in Mice Against S.typhi Antigens by Use of Mineral Oil and DNA Vaccines by ELISA
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1 2 3 4 5 6
Samples
Co
nc
en
tra
tio
n
Series2
Key: Sample No. 1: Vaccine +Mineral Oil Sample No. 2: Vaccine + DNA of Ps. ϕ Sample No. 3: Vaccine +Mineral Oil + DNA of Ps. ϕ Sample No.4: Vaccine + Mineral Oil+ DNA of E.coli ϕ Sample No.5: Control No.6: Blank
185
IX-a: Equipments:
1. High Speed Centrifuge machine Model: Multifuge Heraeus-3S
2. Incubator Model : EN-400 (NEL)
3. Vortexer Model: Heioloph-REA × 2000
4. pH meter Model: CG 825 Digital Labor (Schott)
5. Micropipettes Juster Model: Nichipet EX
6. Shaker Incubator Model: S-301 Cul TI.Biotech JMC
7. ELISA Reader Model: TECAN-Magellan
8. Hot plate Model: IKA-Combimag RCH
9. Balance Model: Monobloc-B2002-5
10. Microfuge Machine Model: Heraeus-Spatech
11. Plate Shaker Machine Model: Shelton-Scientific MFG
INC_USA
12. Termocycle Machine Model: Biometra T1-Whatman
13. Centrifuge Model: Hettich D 2800 Bremen-Germany
14. SDS-Gel Apparatus Model : ABN-7.5 Cm Horizontal
Submarine Unit
15. Protein Gel Apparatus Model: LKB .Bromma 2050 MID
Gel
16. Electrophoresis Unit: ABN-7.5Cm Horizontal Submarine
Unit-USA
17. UV Illuminator Model: Kurzwelle .254 NM
18. Immnoelecterophoresis Apparatus Model: Shanodon
19. Water Bath Model : GFL-Germany
20. Microscope Model: Nikon- SE-Type 102
21. Transmission Electron Microscope Model: GOEL-JEM-
1200 EX II
22. Power Supply Model: Desatronic-D-6900
Heidelber.Germany
23. Vaccum pump Model: Rocker -300 oil-less Cat#
167300
24. Ultrasonic homogenizer Model: 4710 series-USA
25. Digital Oven Model: Hot air Sterilizer,No:Yco-010
Gemmy 888
26. Western Blot Apparatuse Model: Bio-Rad- mini Trans-
Blot®cell USA
IX-b: Bacterial strains:
Bacterial strains used were different strains of Pseudomonas (Ps.
aeroginosa, P7, P3, P5, P6), Klebsiella, E.coli spp (E.coli 2, 3, 40MD,
Fpl-5014, HM-8305, 13-6aLac) , Salmonella typhyimurium spp ( S.typhi,
para A, para B.) , Staphylococci which were clinical isolated.
IX-c: Media:
-Luria Basal (L.B) Agar, Soft Agar, Broth
-Mac Conky Agar (plain)
-Trypton Agar (plain)
-Triple Suger Iron (TSI)
-Simon citrate
-Eosin Methylen Blue (EMB)
-Pyocinin Base Agar (plain)
-Florescent Base Agar (plain)
-Coliform Agar (plain)
-Minimal media (plain)
IX-d: Antibiotics
• Nalidixic Acid
• Ampicilin
• Gentamicin
• Tetracycline
IX-e: Salts:
• 0.1 M MgSO4 Solution
Salt was dissolved in distilled water and filter sterilized (or autoclaved).
This was the 10× stock solution.
• 0.1 M CaCl2 Solution
Salt was dissolved in distilled water and filter sterilized (or autoclaved).
This was the 10× stock solution.
• Bile salt (0.15% W/V) Solution
Salt was dissolved in distilled water and filter sterilized. This was the 10×
stock solution.
IX-f: Solutions:
• Antibiotic Solution:
Stock solution of antibiotic was prepared in the concentration of 5 mg/ml.
This solution was filter sterilized and was stored at -4°C
• Ethidium Bromide Solution:
Stock solution of EBS was prepared in the concentration of 10mg/ml.
This solution was stored at 4°C.
• SDS Solution:
Stock Solution of SDS was prepared to the concentration of 10% and
filter sterilized.
• Dextran Sulphate Solution:
Stock solution of Dextran sulphate was prepared to the concentration of
20%.
The solution stored at 4°C.
• Uranyle acetate Solution:
Stock solution of Uranyle acetate was prepared freshly in the
concentration of 2% and kept at 4°C. (Used within a week)
• Calf Thymus DNA Solution:
Calf thymus DNA was mixed with nuclease free water. It was sheared for
15 min. sheared DNA was denatured at 100°C for 10 min and
immediately chilled on ice. Solution was stored at -20°C.
IX-g: Buffers:
• Electrod Buffer:
Tris-HCl 0.025M
Glycin 0.24 M
SDS 0.1 %
pH 8.4
• TAE Buffer:
Tris-HCl 0.04 M
CH3COONa 0.02 M
EDTA 0.002 M
pH 8
• DNase I reaction Buffer:
CH3COONa 10mM
Mg SO4 5 mM
pH 5
• RNase A reaction Buffer:
CH3COONa 10mM
Mg SO4 5mM
ZnSO4 0.5mM
pH 5
• SM Buffer:
Tris-HCl 50mM
NaCl 100mM
Mg SO4 8mM
Gelatin 0.01%
pH 7.5
• Phage Buffer:
NaCl 150mM
Tris-HCl 40 mM
Mg SO4 10mM
pH 7.4
• SSC Buffer:
NaCl 3M
NaC6H5O7 0.3M
pH 7
• Denature Buffer:
NaCl 1.5M
NaOH 0.5M
• Neutralized Buffer:
Tris-HCl 1M
NaCl 1.5M
pH 8
• Transfer Buffer:
NaOH 400mM
NaCl 1M
• PBK Buffer:
NaHPO4 0.3M
KCl 0.15M
pH 7.5
• Barbitol Buffer:
-5,5-Diethyl barbituric acid Ionic Sterngth 0.02
-5,5-Diethyl barbituric acid Ionic Sterngth 0.05
pH 8.6
• Coating Buffer:
Na2CO3 0.15%
NaH CO3 0.29%
pH 9.6
• Blocking Buffer:
BSA 1%
Tween 20 0.02%
In Strile PBS
• EIA Buffer:
BSA 0.1%
Tween 20 0.1%
In strile PBS
• Washing Buffer:
Tween 20 0.02%
In Strile PBS
• Phosphate Buffered Saline (ELISA)
NaCl 0.8%
KCl 0.02%
Na2HPO4 0.14%
KH2PO4 0.02%
pH 7.2-7.4
• Transfer Buffer:
Tris-HCl 0.025 M
Glycine 0.192 M
• TBS Buffer:
Tris 0.01 M
NaCl 0.15M
Tween-Twenty 0.05%
IX-h: Animals:
• Pathogen free Balb/C mice were maintained in a sterile cage, under
sterile bedding. They were fed enriched heated food and sterile water.
Mice weighing 27 to 32 gm were used through out.
• Randomly bred rabbits with no detectable serum agglutinins to
Salmonella typhimurium were used.
Rabbits weighing 691 to 1036 gm were used.
IX-i: Media and Chemicals :
Following media and chemicals:
Glucose, Agar-agar, Brain Heart Infusion (BHI) broth , Sodium
Hydroxide (NaOH) , Sodium Carbonate (Na2CO3), Sodium bi-Carbonate
(NaHCO3), Ethanol, Bile Salt, Eosin Methyl Blue(EMB) Media,
Potassium Chloride KCl, Magnesium Sulphate (MgSO4), Calcium
Chloride (CaCl2), 5,5-Diethyl barbituric acid , Sucrose, Triple Sugar
Iron(TSI) Media, Sodium Dedeocyle Sulfate (SDS), Simon Citrate Media
and Nutrient Broth Media used were from Merk Company.
Sodium acetate, Peptone, Ethylene Diamine Tetra Acetic Acid(EDTA),
Tris-HCl, Agarose, Low melting Agarose, Tween 20, Tween 80, Phenol,
Isopropanol, Bis, N, N, N’, N’-Tetramethylethylenediamine ( TEMED
)and Acrylamide used were from Sigma Company.
Poly Ethylene Glycol (PEG) 6000, PEG 8000(Cat# V3011) and Nuclease
free water used were from Promega Company.
Bromo Phenol Blue dyes, Comassi Blue Dye used were from Fluka
Company.
Acetic acid, Chloroform and Methanol used were from BioM
Laboratories.
Agarose (Specially purified and tested for used in determination of
Australia Antigen) used were from BDH Chemicals.
Sodium Chloride (NaCl) used was from Fisher Scientific Company.
Ammonium per Sulphate used was from Gibcobel-Life Technologiest
Chemicals.
IX-j: Miscellaneous:
Eppendrof, yellow and blue tips, micropipettes of 10 λ, 100 λ and 1000λ
was from eppendrof Co. All Glassware used in this study were Pyrex-
IWAKI
Address of Firms
● Promega Corporation
2800 Woods Hollow Road
Madison, WI 53711-5399
USA
PH 800-356-9526
FX 800-356-1970
www.promega.com
● Sigma Chemical Company
P.O. Box 14508
St. Louis, MO 63178
USA
PH 800-325-3010
FX 800-325-5052
www.sigma.com
● Merk Company:
Merk KGOA 64271.
Darmstadt-Germany
www.Merk.de
● BDH Company:
BDH Chemical –LtD.
UK.
www.BDH.co.com
● BioM Company:
BioM Laboratories
Carritos
USA
● Fisher Scientific Company
10700 Rocky Road
P.O. Box 1307
Houston, TX 77099
USA
PH 800-441-2368
www.Fisher.co.uk
● Ambion
2130 Woodward St.
Suite 200
Austin, TX 78744
USA
PH 512-445-6979
FX 512-445-7139
● Amersham Life Science, Inc.
2636 South Clearbrook Drive
Arlington Heights, IL 60005-4692
USA
PH 800-323-9750
FX 800-228-8735
● Bio-Rad Laboratories
Life Sciences Group
2000 Alfred Nobel Drive
Hercules, CA 94547
USA
PH 800-424-6723
FX 800-879-2289
● Difco Laboratories
P.O. Box 331058
Detroit, MI 48232-7058
USA
CONTRACT #V797P-5951J
● Fluka Chemical Corporation
980 South Second Street
Ronkonkoma, NY 11779-7238
USA
PH (800) 358-5287
FX (800) 358-5287
● Medicell International LTD
239 Liverpool Road, London N1 ILX
PH (071) 607 2295
FX (071) 700 4156
● Hittich Co.
H.Jurgens & Co.
Germany
P.O.Box : 104449
● AutoBio Diagnostics Co. LTD.
No.87
Jingbei Yi Road.Zhengzhou Economics
Technological Development
PH: 0086 371 66781166
FX: 0086 371 66781199
List of Kits ● Wizard® Lambda preps
DNA purification system
Promega Corporation
● Wizard® SV Gel & PCR clean up system
Promega Corporation
● Wizard® PCR Master Mix
Promega Corporation
● Restriction Enzymes
(EcoR I, Bam H I, Hpa I, Hpa II, Cla I, Dra I, Msp I, Hind III)
Promega Corporation
● Southern Blotting kit
Ambion Co.
USA
● ELISA kit
AutoBio Diagnostics Co.LTD
X - Methods
X-A Isolation of phages and characterization
1: Purity determination of bacterial culture:
Bacterial cultures (Appendix II) were streak on L.B agar (plain) plate to
get isolated colonies. Purity of isolated colonies was determined by
Gram-staining, biochemical reactions, colonial and morphological
characters.
2: Isolation and purification of bacteriophages:
In present study the bacteriophages were isolated from clinical specimen,
raw sewage water samples collected from different area, Lakes by plaque
assay and spot assay techniques.
3: Isolation of phage from sewage:
Coliphage was isolated from sewage sample collected from different area
of Karachi by use of double agar layer technique (Rajala and Hein onen,
1994)BHI 10× was used as developing medium. About 45 ml of sample
was centrifuged at 4000 rpm for 20 min. The pellet was discarded and the
supernatant was further filtered through 0.45 µm pore size Millipore
filters.In to filtered sterile sample, 5 ml of BHI 10× supplemented with
CaCl2 (0.5M final con.), MgSO4 (0.5M final con. ), and 100 λ of young
growth culture of Escherichia coli was added and mixture was incubated
in shaker incubator at 37°C for overnight.
4: Isolation of phage from clinical specimen:
Urine sample of patient (24 years old athlete female) was centrifuged at
6000 rpm in a Hettich D 2800 Bremen Rotor to remove solid matters and
was then passed through a 0.45 µm pore size nitrocellulose millipore
filter. 50λ of filtrate, 100 λ of culture which growth separately at 37°C
with continuous shaking at 160 rpm for 3-4 hrs, were added in 3 ml of
melted L.B soft agar (plain ) and mixed well then lated on to L.B agar
plate and incubated at 37 °C over night. The following day, plaques were
picked. All phages isolated were purified by successive single –plaque
isolation until homogeneous plaques.
5: Determination of phage activity in clinical sample on bacterial
lawn:
In order to determine the phage source from urine, 1ml of young growth
culture of respective host (P5, P6, E.coli, E.coli4MD, E.coli-N, and
Klebsiella-N) was mixed with 100λ of urine this was incubated fro 2hr. at
37°C. Follow centrifuged at 4000rpm for 5 min. pellet was washed with
500 λ of LB broth two times. Finally 500 λ of LB broth was added to
pellet. Cells were resuspended after vortexing and then were exposed to
UV for 1 min and were incubated at 37°C for 2hr.Lysate was filter
sterilized and plaque assay was performed.
6: Preparation of Lysate:
Isolated colony from over night culture was grown in LB broth for 4 hrs.
Control was run for each reaction. In control tube 100 λ culture, CaCl2
(0.1M final con.), MgSO4 (0.1M final con.) and 800 λ rest LB broth
whereas test tube contained 100 λ of culture, CaCl2 (0.1M final con.),
MgSO4 (0.1M final con.), 100 λ Lysate and 700 λ rest LB broth. Both
tubes incubated at 37°C with shaking at 160 rpm for overnight.
After 24 hrs. Few drop of CH3Cl were added and mixed well through
vortexing. Then filter sterilized. All Lysates were stored at 4°C.
7: Determination of phage interaction with bacteria:
Spot assay and plaque assay used to determine the host range of phages
and to check the cross infectivity.
7.1: Plaque assay by double layer method:
Respective culture (mentioned in materials) was grown separately at 37°C
with shaking at 160 rpm for 3-4 hrs. Then 100λ of young growth culture,
50λ of respective Lysate and CaCl2 (0.1M final con.) and MgSO4 (0.1M
final con.) were added in to 3 ml melted LB soft agar tube. Then poured
on the LB agar plate and incubated at 37°C for over night. Control was
also run in which only Lysate was omitted.
7.2: Spot assay by double agar layer method:
100 λ of respective young growth culture was mixed in to 3 ml of melted
LB soft agar and plated on the LB agar plate. After solidification 10 λ of
phage Lysate was applied on the bacterial lawn and incubated at 37°C
for over night. By this method phage variability and infectivity was
checked.
8: Lysate amplification from single plaque:
Single plaque was picked from the lawn with sterile pasture pipette and
this was added in to sterile ependrof which contained 50 λ of young
growth culture of respective host prepared in LB broth, CaCl2(0.02M final
con.) and MgSO4 (0.02M final con.) and 130 λ rest broth and mixed well.
This was incubated at 37°C with shaking at 160 rpm for overnight.
9: Effect of salt on activity of phage:
CaCl2 and MgSO4 were used to determine the effect of salt on activity
and infectivity of phages. As we used 0.1M for preparation of Lysate and
0.1M salt were used for performing plaque assay as well as spot assay.
10: Comparative study of phage infection in enrich and minimal
and selective media:
Pyocin and Florescent base agar and soft agar as selective media ,BHI as
enrichment media and LB as minimal media were used for Pseudomonas
strains of this study plaque assay and spot assay were performed to
compare the specify of media on phage-host interaction .
11: Comparative study of induced lysates activity in aerobic and
anaerobic condition:
Two set of Plaque assay of Lysate M81 on the lawn of P7 was performed
and were incubated in anaerobic condition and aerobic condition
separately. The plates were incubated at 37°C for 24hr.
12: Identification of resistant colonies
Gram stain and biochemical reactions were performed to identify the
resistant macro colonies and micro colonies.
13: Induction:
13.1: Preparation of Lysate by induction of Pseudomonas 76
(lysogenic strain) by Bile salt:
Single colony of over night culture of Ps (76) picked and inoculated in
LB broth, Bile salt were added final concentration of 0.075 (w/v) and
incubated at 37 °C with shaking at 160 rmp for overnight. After 24hr. few
drop of CH3Cl were added and mixed well through vortexing then filter
sterilized. This effect was determined by turbidity of control and test
reaction.
13.2: Induction of resistant colonies:
Single resistant macro colony and micro colony from lawn of P7 and
lysate M86 were grown in BHI broth containing 0.075 (w/v) bile salt
separately and incubated at 37 °C over night. Similarly, a resistant colony
(homogenous size) from lawn of P7 and lysate M84 was induced by
0.075(w/v) Bile salt. After 24hr. few drop of CH3Cl were added and filter
sterilized.
13.3: Preparation of Lysate by induction of P7 (lysogenic
strain) by Nalidixic acid:
Single colony of over night culture of P7 from antibiotic agar contain 50
mg/ml Nalidixic acid were added and incubated at 37°C with shaking at
160 rpm for overnight . After 24 hrs. Few drops CH3Cl were added and
mixed well through vortexing. Then filter sterilized. This effect was
determined by turbidity of control and test reaction.
13.4: Induction of E.coli-N and Klebsiella-N lysogen by
Tetracycline:
Single colony of overnight culture of lysogenic strain of E.coli-N,
Klebsiella-N which were isolated from urine were grown in Luria Broth
separately at 37 for 4hr. tetracycline (final concentration 100µg/ml ) was
added in to each young growth culture and incubated at 37°C with
shaking at 160 rpm for over night. After 24hr. few drops of CH3Cl were
added and mixed well through vortexing then filter sterilized. This effect
was determined by turbidity of control and test reaction.
13.5: Induction of E.coli-N lysogen by Serum:
Single colony of overnight culture of lysogenic E.coli-N were grown in
LB at 37°C for 4 hr. 4% of human serum was added and incubated at
37°C with shaking at 160 rpm for overnight . After 24hr few drops of
CH3Cl were added and mixed well and filter sterilized. This effect was
determined by turbidity of control and test reaction.
13.6: Induction of E.coli-N lysogen by Urea:
In young growth culture of E.coli-N 0.5% urea (Merk Co.) and 100λ of
urine was added and incubated at 37°C with shaking at 160 rpm for
overnight. After 24hr few drops of CH3Cl was added and mixed well
through vortexing and filter sterilized. This effect was determined by
turbidity of control and test reaction.
13.7: Induction of E.coli-N lysogenic strain by Uric acid:
Single colony of overnight culture of lysogenic E.coli-N were grown in
LB separately at 37°C for 4 hr.0.2% uric acid was added and incubated at
37°C with shaking at 160 rpm for overnight . After 24hr few drops of
CH3Cl were added and mixed well and filter sterilized. This effect was
determined by turbidity of control and test reaction.
13.8: Induction of lysogenic E.coli-N and Klebsiella-N by UV:
Urine was propagated in E.coli2 (U13), E.coli-N (U14) and E.coli40MD
as source of phages and then were exposed to UV for 2 min. After
induction by UV plaque assay and spot assay was performed.
13.9: Induction of P5 and P6 lysogenic by Urea:
Single colony of overnight culture of lysogenic P5 and P6 were grown
separately in Brain Heart Infusion (BHI) broth, which contain 0.5% urea
and incubated at 37°C with shaking at 160 rpm for overnight. After 24hr.
few drops of CH3Cl were added and mixed well through vortexing then
filter sterilized.
13.10: Induction of P5 &P6 in presence of minimum inducing
con. of Urea:
2 ml of BHI and LB broth were supplemented separately with 0.085 µg/λ
(Final con.) of urea (bacterial culture was omitted). This was used as
lysate on the lawn of P5 and P6. In order to determine the quantity of
urea which could effectively induced the Ps. temperate phages while we
were using urea inducing E.coli lysate for propagating phage in Ps(5 µg/λ
final con.)
14: Effect of Salt on temperate phages Induced by Bile salt:
CaCl2, MgSO4 and Bile salt were used to determine the effect of salt on
infectivity of induced phages. As we used 0.1M for preparation of Lysate
and 0.1M salt were used for performing plaque assay as well as spot
assay.
15: Antibiotic sensitivity by MIC method:
Antibiotic plates were prepared by adding stock solution of antibiotic in
sterilized LB agar to have final concentration from 5µg/ml to 200 µg/ml.
16: Phage separation by Titration:
In 100 λ of urine sample, 100 λ of young growth culture of Ps was added
then it was incubated at 37°C for 15 min, mixture was centrifuged at 10 k
for 10 min. to the supernatant, 100 λ of young growth culture of E.coli
was added the it was incubated at 37°C for 15 min, mixture was
centrifuged at 10 k for 10 min. supernatant was collected and into that
100 λ of young growth culture of Streptococci was added and incubated
at 37°C for 15 min . Each pellet was washed 2 times with PBS and 100 λ
of each pellet added into 3 ml melted BHI soft agar separately and poured
onto BHI hard agar . Finally, collected supernatant was filter sterilized
and 10 λ of that was apply as a spot on the lawn of respective culture.
17: Screening of antimicrobial substances by wells method:
Isolated colony from over night plate was grown in LB broth. After 4hr.
young culture was prepared. Bacterial lawn was made on the LB agar
plate by means of cotton swab. Wells made by borer. 10 λ of sterile lysate
were applied in the wells by help of micropipette. The plates were
incubated at 37°C for 24hr. following day looked for the zone of
inhibition.
18: Titration of lysates by liquid serial dilution method (PFL/ml):
50 λ portions of each lysates were added to appendrofs separately which
were contain 200 λ plain broth and mixed well. Then 10 λ of diluted
lysate were transferred to 90 λ of broth and continued till 10-9
(concentration).
In each step the concentration was checked by plaque assay. The plates
were incubated at 37°C and were monitored daily for 3-4 days.
The controls were containing no plaques.
19 : Transmission Electron Microscopy:
To study of particles morphology, lysate were precipitated by using PEG
6000 (promega Co.) and NaCl with 8% and 4% final concentration
respectively and were incubated at 4°C for overnight. These were
centrifuged at 14000 rpm for 20 min. the pellet was resuspended in 100λ
of double deionized distill water. 400 mesh carbon coated grids were
submerged in phage suspension for 1 minute. Specimen was negatively
stain with 2 % uranyl acetate for 30 seconds and examined in a GOEL-
JEM-1200 EX II transmission electron microscope.
20: Effect of maltose on phage-host interaction:
Single colony of P6 was grown in LB broth at 37°C for 4hr.100 λ of
young growth culture, 50 λ of lysates U9 and 30 λ of maltose solution,
final concentration 2% were added in to 3ml of LB soft agar.
For comparison plaque assay were performed which only maltose was
omitted. The poured on LB agar plate and incubated at 37°C for
overnight.
21: Lysate amplification from single plaque in the presence of
maltose:
Single plaque was picked from the lawn of agar plate with sterile pasture
pipette. It was expelled into an eppendrof which contain 100 λ phage
buffer (150mM NaCl, 40mM Tris-HCl, 10mM MgSO4, pH 7.4) and it
was placed at 4°C overnight. Following day young growth culture of
respective host was prepared in 1 ml of LB, supplemented with 10 λ of
20% maltose, MgSO4 (0.01M final conc.) and was incubated at 37°C in
shaker incubator. Into 500 λ of this culture, 100 λ phage buffer contain
plaque was added and were incubated at 37°C for 20 min. then this
infected culture was transferred into 250ml flask containing 100ml pre-
warmed( 37° C ) LB broth supplemented with 1M of MgSO4 and was
incubated in shaker incubator at 37°C for overnight. After 24hr. 500 λ
CH3Cl was added and incubated further in shaker incubator for 15 min.
Then it was centrifuged at 6000 rpm for 10min and filter sterilized.
X-B Genomics Characterization
22: Gel Electrophoresis:
22.1: Laemmli Discontinues Gel Electrophoresis of Protein:
The resolving gel, poured to a depth of 10cm was made from following
mixture:
0.125M Tris-HCl , 0.1% SDS, 10 % Bis acryl amid, 0.05% TEMED,15.5
ml water, 0.5% ammonium per sulfate, 15.5 ml water. The gel was
overlaid with water until it was polymerized. Then water was poured off.
The stacking gel was poured on the top of the resolving gel. This was
allowed to set completely.
Viral proteins was denatured by heating viral suspension in sodium
dodecyle sulfate(0.05% SDS final conc.) and 2-mercapto ethanol (0.5%
final conc. ) at 100°C for 5 min. to this sample a few crystals of sucrose
and 5 λ of bromo phenol blue was added and mixed well. It was then
loaded on to gel and electrophoresis at constant voltage of 50v for 3hr. in
an electrode buffer of 0.25M Tris-Hcl, 0.24M glycin, 0.1%SDS , pH 8.4.
The gel was then placed in staining solution that contains 0.1gm of
Comassie blue, 10% acetic acid and 50% methanol for about 45min.
Then it was destained in solution containing 10% acetic acid and 5%
methanol for overnight. This 10% gel was used for molecular weight
determination of protein samples.
22.2: Agarose Gel Electrophoresis of DNA:
The gel was made from following mixture: 1% Agarose was dissolved in
TAE buffer
i: Preparation of sample:
1.5 ml of each lysate transferred in to an eppendrof and NaCl, final
concentration 4% and PEG 6000 final concentration 8% (promega co.)
were added and then was incubated at 4°C for overnight. Following day
the phages were pelleted by centrifuging at 14000 rpm for 15 min and
supernatant was discarded. The phage pellet was resuspended in 50 λ
sterile distil water and treated by sodium dodecyle sulfate(0.05%SDS)
and 2-mercapto ethanol (0.5% ) and shocked by heating at 100 °C for 5
min .5 λ of bromo phenol blue and few crystal of sucrose were added and
mixed well. It was then loaded on to gel and electrophoresed for 3hr. at
constant voltage 50v in TEA buffer of 0.04M Tris base, 0.02M sodium
acetate, 0.002M EDTA pH 8.
ii: Staining gel:
The gel was carefully placed in staining tray and soaked in 100 ml of
distil water and 3 λ ethidium bromide was added and gel was stained for
15 min. Gel was observed on UV illuminator and photographed.(-)
23: Action of DNAase I:
The pellet of each lysate were prepared by adding 8% polyethylene glycol
6000 and 4%NaCl and after incubation at 4°C for overnight. Centrifuged
at 14000 rpm to precipitate the phage particles.
The precipitate was dissolved in sterile deionized distil water .aliquot of
phage suspension (30 λ) was digested with 2 λ DNAase I (1mg/ml) in 10
λ of reaction DNAase buffer (10 mM sodium acetate, 5mM magnesium
sulfate, pH 5) and then was incubated for 1 hr. at 37 °C. The reaction was
terminated by adding of 5 λ of 2-mercapto ethanol and SDS and heated at
100°C for 5 min. To this sample few crystal of sucrose and 5 λ of bomo
phenol blue was added and mixed well. The samples were then
electrophoresed on the 1% agarose gel.
24: Action of RNAase A:
The aliquot of phage suspension (30 λ) was digested with 2 λ RNAase A
(1mg/ml) and 10 λ of reaction RNAase buffer (10mM sodium acetate,
5mM magnesium sulfate,0.5mM zinc sulfate pH 5.0) and then was
incubated at 37°C for 1 hr. The reaction was terminated by adding of 5 λ
of 2-mercapto ethanol and SDS and heated at 100°C for 5 min. To this
sample few crystal of sucrose and 5 λ of bomo phenol blue was added and
mixed well. The samples were then electrophoresed on the 1% agarose
gel.
25: Phage DNA purification:
To 10 ml of lysate, 40λ nuclease was added and mixture was incubated at
37°C for 15 min, then 4ml of phage precipitate were added and after
mixing gently incubated on ice for 30 min. then it was resuspended in
500λ of phage buffer, then was centrifuged at 10,000 rpm for 30 seconds.
The supernatant was draw up. 1ml of purification resin (Promega Co.)
was added to supernatant, it was mixed thoroughly by inverting the tube.
The syringe barrel was attached to mini column and it was inserted into
vacuum system. The column was washed by 2ml of 80% isopropanol and
resin was dry by apply to vacuum system for 30 seconds. the column was
transferred into 1.5ml eppendrof and was centrifuged at 10,000rpm for 2
min. the column was transferred to new eppendrof and 100λ of pre
heated( 80°C) nuclease free water ( Promega co.) were applied. Then it
was centrifuged at 10,000 rpm for 30 seconds to elute the DNA.
26: Phenol-Chloroform DNA extraction:
DNA sample was mixed with equal volume of phenol containing 0.1%
hydroxylquionoline (Sigma Co.) in an eppendrof and mixing was
continued until an emulsion forms. This was centrifuged at 12000 rpm for
5 min. the separated aqueous phase was transferred to new eppendrof and
lower organic phase was discarded. Washing with phenol was repeated
for 3 times. To this an equal volume of sevage CH3Cl and iso amyl
alcohol (24:1) was added, after mixing well it was centrifuged at
12000rpm for 5 min. Aqueous phase was transferred to new eppendrof
and DNA was recovered by precipitation with diethyl ether . Finally 0.6
vol. of isopropanol was added and incubated at 4°C for overnight.
Following day sample was centrifuged at 14000 rpm for 20 min.
27: Preparation of ethidium bromide Agarose plate:
0.1gr of Agarose was added into 10ml of distil water. The slurry was
heated until Agarose dissolved. The dissolved Agarose was cooled to 50
°C and then ethidium bromide was added (final conc. 10 mg/ml) .the
solution was poured into a disposable petri dish. Each extracted fraction
was checked for presence of DNA by spotting on an ethidium bromide
agarose plate and 1% Agarose gel electrophoresis. The fractions were
stored frozen at -4°C.
28: DNA-extraction directly from lysate:
In to 1ml of lysate, 5λ of nuclease (Promega Co.) was added and
incubated at 37°C for 15 min. equal vol. of phenol containing 0.1%
hydroxylquionoline (Sigma Co.) was added in to lysate in an eppendrof
and mixing was continued until an emulsion forms. This was centrifuged
at 12000 rpm for 5 min. the separated aqueous phase was transferred to
new eppendrof. Washing with phenol was repeated for 3 times. Aqueous
phase was transferred to new eppendrof and equal vol. of isopropanol
was added and incubated at -4°C for overnight. After which the DNA was
collected by centrifugation at 12000 rpm for 20 min at 4°C.
The supernatant were drained carefully and pellet was washed with 70%
chilled ethanol and was dried at room temperature for 30 min and finally
resuspended in 50λ of sterile distilled water. The fractions were stored at -
20°C.
29: Isolation of DNA fragments from Agarose gel:
Gel was cast by using low melting temperature (LMT) agarose and
electrophoresis in usual way and follow manufacture’s protocols
(Promega Co. Kit). The DNA was stained by soaking the gel in ethidium
bromide solution for 15 min. Long wave UV illuminator was used to
locate the DNA bands and bands were cut out by sharp razor blade. Then
gel slices was chopped into fine pieces and transferred into 3ml
eppendrof. 10λ membrane binding solution (Promega Co.) was added per
10mg of gel slices and vortexed well. Then incubated at 65°C till gel got
completely dissolved. Gel mixture was transferred into SV mini column
and incubated at room temperature for 1 min. Vacuum was applied and
mixture was pass through it. Then 700 λ membrane wash (ETOH) was
added and pulled out by applying vacuum. This was repeated for two
times. The column transferred to collection tube and was centrifuged at
10,000 rpm for 15 min.
Finally, column was transferred to clean eppendrof and 50λ nuclease free
water was added into column. After incubation at room temperature for 1
min it was centrifuged at 10,000 rpm for 5 min. DNA was stored at -20
°C.
30: Southern Blotting:
Bacteriophages DNA fragment were separated on a 1% (wt/vol) Agarose
gel. Electrophoresis gels were transferred on to nylon membrane (Ambion
Co.) in transfer buffer; NaOH 400mM, NaCl 1M (0.5 ml/cm2).
30.1: DNA probe by labeling psoralen:
Respective samples were denatured by heating at 100°C for 10min and
then rapidly were cooled in dry ice. vial containing the lyophilized bright
star psoralen Biotin was centrifuged at 2000 rpm for 15 sec. and
reconstituted in 33λ-DMF pipette up and down for few times to get the
psoralen into solution . Frozen sample was thawed by rolling in between
gloved hands and immediately 1 λ of psoralen was added into 10λ of
nucleic acid solution in a microfuge tube. Sample was transferred to a
well of 96 wells micro plate on ice bath and exposed to 365 nm UV light
source directly while whole set up was covered. the samples was
irradiated for 45 min. samples was diluted to 100λ by adding 89λ of TE
buffer , 200λ of water saturated N-butanol. After vortexing well it was
centrifuged at 7000 rpm for 1 min. this as repeated for two times.
Labeled nucleic acid was stored at -20°C.
30.2: hybridization:
Blot was wet with 5× SSC buffer (NaCl 3M, NaC6H5O7 0.3M pH 7). It
was placed in polythene bag. After adding 10ml of preheated
hybridization buffer (5× SSC buffer, 2 %( w/v) SDS, 5 %( w/v) dextran
sulfate) and 100µg/ml sheared denatured calf thymus DNA bag was
sealed. It was rocked at 60°C for 30 min. Denatured probe was chilled in
ice and was added into hybridization buffer. After adding the probe bag
was sealed again and incubated in a shaker incubator at 60°C for over
night.
30.3: DNA probe:
20λ of 100m M EDTA, 105 λ H2O and 75 λ probe was mixed and heated
at 90°C or 10 min and chilled on ice.
Bacteriophages DNA probe was generated by using labeling kit
(Amersham Life Science, Arlington heights III).
30.4: Washing the blots:
After 24hr. the blots were washed 2 times with washing buffer for 50 min
at room temperature and then were washed 2 times with blocking buffer
for 7 min. membrane was incubated in blocking buffer for 30 min. Then
was incubated in 10ml blocking and 1 λ strep-AP for 30 min. Membrane
was incubated in blocking buffer for 15 min . then blots were washed 3
times wash with 1× washing buffer for 5 min and then incubated 2 times
in 1× assay buffer for 2 times . Membrane was incubated in CDP star for
5 min. excess of CDP-star was removed without letting the membrane to
dry. Then it was wrapped in saran wrap and exposed to X-ray film in
different exposure time.
30.5: Stripping off the DNA-probe from membrane:
Probe was stripped off from membrane by autoclaving the membrane in a
bottle contain 0.1% SDS solution for 30 min.
31: Restriction endonucleases:
Purified phage DNA of PS5Φ, PS6 Φ, PL5Φ, PL6Φ , U9Φ and 3S Φ were
digested with EcoR I, Bam H I, Cla I, Dra I, Hpa I, Hpa II, Msp I and
Hind III.( Appendix III ) according to manufacture’s protocols (Promega
Co.). 15λ of purified DNA, 2λ respective Buffer, 0.2λ BSA, 1λ respective
enzyme and 1λ nuclease free water was mixed and digestion was carried
out for 3 hr. at 37°C and products of reaction were analyzed by 2%
agarose gel electrophoresis.
32: Polymerase Chain Reaction (PCR) amplification:
Phage DNA was isolated from lysates PS5 Φ, PL5Φ, PS6Φ and PL6Φ,
PAKΦ and 3SΦ as described before and these DNAs were used as PCR
templates. PCR products were generated by using Taq DNA polymerase
(Promega Co.) by following the manufacture’s protocols.
Range of primer sets were used (Appendix-IV).
The PCR conditions used were denaturation at 94°C for 4 min, following
by 35 cycles of denaturation at 94°C for 30 seconds, annealing
temperature was recommended by manufacture for 30 Seconds and
extension at 72°C for 2 min.
Amplified produced were sized by 2% Agarose gel electrophoresis and
photographed.
33: DNA sequencing:
Amplified PCR products were sized by 2% Agarose gel electrophoresis
and fragments were selected for sequencing.
The selected PCR mixtures were prepared in 50λ for each reaction and
amplified products were sequenced using the original amplification
primers.
X-C Serological Techniques
34: Preparation of serological test antigen:
Lawn of Salmonella typhi was grown on the large Petri plate BHI agar.
Bacteria were suspended in 10ml of distilled water. Cells were heated at
60°C for 1 hr. and then disintegrated in homogenizer for 15 min.
To ensure that all of bacteria were killed, sodium deoxycholate was added
to a final concentration of 1 %( wt/vol) and was concentrated by pressure
dialysis.
35: Dialysis tube preparation:
Dialysis tubing-visking size 3-20 132” was boiled for 10 min in 10mM
disodium EDTA adjusted to pH 7.4 with NaOH. It was then rinsed
several times in sterile dionized distill water and stored at 4°C and
handled carefully to prevent contamination.
36: Antigen concentration using dialysis tube:
10ml of antigen suspension was poured in dialysis tube and then was
placed in to 250 gm sucrose (Merk Co.). Pressure dialysis was carried out
for 2hr.
This required a volume reduction of 2.0 fold to get final concentration of
5mg/ml. To obtain a clear suspension, the antigen was then centrifuged
for 30 min at 12000 rpm. The supernatant was distributed in aliquots and
stored frozen at -20°C.
37: Vaccine preparation:
37.1: Killed Vaccine preparation:
Lawn of Salmonella typhi was grown on the BHI agar. Bacteria were
scoped off and suspended in 10ml of BHI broth. Cells were heated at
60°C for 1 hr. No growth after plating of heated bacteria on BHI agar
indicated that all cells were killed. Cells were centrifuged at 10,000 rpm
for 20 min and pellet washed 3 times with PBS buffer. And pellet was
resuspended in sterile distilled water at a concentration of 520 µg/ml.
Suspension was stored at freezer.
37.2: Adjuvant vaccine preparation:
Adjuvant vaccine was prepared by homogenizing a suspension of 520
µg/ml of heat-killed S.typhi with 250λ of mineral oil. To form a thick
stable emulsion which was injected inter- muscularly in rabbit and inter
peritonealy in mice.
37.3. A: Pseudomonas ϕ DNA vaccine preparation:
DNA vaccine was prepared by homogenizing a suspension of 520 µg/ml
of heat killed S.typhi with 250λ of mineral oil and 16λ of PL5Φ DNA to
form a thick emulsion which was injected inter muscularly in rabbit and
inter peritonealy in mice.
37.3. B: E.coli ϕ DNA vaccine preparation:
DNA vaccine was prepared by homogenizing a suspension of 520 µg/ml
of heat killed S.typhi with 250λ of mineral oil and 16λ of U9Φ DNA to
form a thick emulsion which was injected inter muscularly in rabbit and
inter peritonealy in mice.
38 .a: Preparation of antiserum in Rabbit:
Before immunization, blood from marginal ear vein of each rabbit was
collected. Rabbits were immunized with 3 dose (each dose after 7 days)
intramuscularly injection of killed vaccine (520µg/ml heat killed S.typhi
cells, 250µl PBS) , adjuvant vaccine (520µg/ml heat killed S.typhi cells,
250 µl mineral oil), DNA vaccine (520µg/ml heat killed S.typhi cells, 250
µl mineral oil and 16 λ ϕ DNA).Each rabbit was bled by cardic puncture 1
week after the last injection. All blood samples were incubated at 37°C
for 1 hr. and then overnight at 4°C.The serum was separated and stored at
-20°C.
38.b Preparation of antiserum in Mice:
Pathogen free Balb/C mice were immunized with 3 dose (each dose after
7 days) intraperitonaly injection of killed vaccine (4 µl heat killed S.typhi
cell, 130µl PBS) , adjuvant vaccine (4 µl heat killed S.typhi cells,150 µl
mineral oil), DNA vaccine (4 µl heat killed S.typhi cells, 150 µl mineral
oil and 8 λ ϕ DNA). Each mice was decapitated 1 week after the last
injection. All blood samples were incubated at 37°C for 1 hr. and then
overnight at 4°C. The serum was separated and stored at -20°C.
39 : Antigen-Antibody reactions
39.1: Wet slide agglutination:
200λ of each serum was mixed with 200λ of antigen in eppendrof
separately and then were incubated at 37°C, wet slide was prepared using
50λ of each reaction placed in cavity slide and was observed after 15, 30,
60 and 120 minutes of incubation .(-)
39.2: Ouchterlony gel immunodeffiusion:
Serological relationships between antiserums were examined by gel
immunodeffiusion on microscopic slide. The gels were prepared by
boiling solution of 1% purified agar (electrophoresis grade, Sigma) in
PBK buffer, cooling to 60°C. 3ml of molten Agarose was poured onto
clean microscopic slide .after gel solidification 5 wells were cut out
(central well was surrounded by 4 wells) by borer. Slides were placed in
petri plates. The central well was filled with 10 λ of heat-killed cell
suspension of S.typhi while the 4 peripheral wells were filled with 10λ of
un-diluted antiserum. Serological reaction was allowed to occur at 37°C
in humid atmosphere for 1-2 days.
39.3: Two dimensional immunoelectrophoresis:
Two dimensional immunoelectrophoresis was performed on agarose-pre
coated mounting slides (2.5 by 7.5cm) and larger slides (5 by 7.5) were
used. The support was a 2mm film of 0.8% (wt/vol) agarose gel (Sigma
Co.) in barbital buffer (Ionic strength, 0.02; pH 8.6), 0.5% Triton X-100
and 0.1% sodium deoxycholate were added to the gel for the first-
dimension electrophoresis. 10λ antigen was placed in a 4mm well and
electrophoresis was carried out at 50 Vol for 60 min. Second –dimension
gel was contained 0.5% Triton X-100, 1% antiserum and 2λ bromo
phenol blue was used as a tracer. Barbital buffer at a pH of 8.6 and Ionic
strength of 0.05 with 0.1% sodium deoxycholate was used in
electrophoresis bath for first dimension and for second phase, sodium
deoxycholate was omitted.
39.4: Immnoelecterophoresis:
Immunoelectrophoresis was performed on agarose-precoated slides
(25×75 mm). The supported was a 2 mm film of 0.8 %( wt/vol) agarose
gel and 0.1% sodium deoxcholated ,0.5% TritonX-100 and 0.01% sodium
azide were added to the gel and electrophoresed in barbital buffer
(pH;8.6;Ionic strength,0.02). 10λ of antigen was added to each trough and
diffusion was carried out at room temperature for 48hr. The slides were
washed in distilled water and were stained with coomassie brilliant blue
for 2hr and destained for overnight.
39.5: Pre-coating glass plates with agarose:
0.5% agarose was melted in distilled water. 2 ml of molten agarose was
spread on glass slide to make a thin layer film and then left overnight at
room temperature to get completely dry. Dry pre-coated slides were used
for immunoelectrophoresis and two-dimension immunoelectrophoresis of
each antiserum.
39.6: Staining precipitant lines:
Gels were stained in 0.025% w/v of coomassie brilliant blue in methanol:
water: acetic acid (50:45:5) for 1 hr. and then destained in water: acetic
acid: methanol (87:8:5) for over night. Destained Sol. was changed until
to get the clear background in gels.
40: Quantitive analysis by ELISA
40.1: Desalting of lysate by micro dialysis:
In order to remove the media and salt from phage suspension, dialysis
tube was used. Desalting was carried out in eppendrof tube with a cap
replaced by cut of 2cm of dialysis membrane fixed with rubber band.
Subsequently the tube was allowed to float in on upside-down position
supported in cool sterile distilled water. Water was changed after one
hour and incubated at 4°C overnight. After dialysis the eppendrof was
centrifuged in an upright position to assure complete recovering of
dialysis.
40.2: Coating the ELISA 96 wells plate by antigen:
100 λ of S.typhi antigen was added in to each well of 96 wells ELISA
plate (IWAKI) at a concentration of 1/5 in coating buffer contain 0.15%
NaCO3, 0.29% NaHCO3, pH 9.6. Plates were incubated at 4°C for
overnight. Solution was discarded and 200 λ of blocking buffer contain
1% bovine serum albumin (Promega Co.), 0.02% tween 20 in PBS
(contain 0.8% NaCl, 0.02% KCl, 0.144 % Na2HPO4 and in deionized
water) was added into each well. Plates were incubated at room
temperature for 1 hr. blocking reagent was discarded and plates were dry
at 4°C. Then each well was washed 5 times with 200λ of washed buffer
contain 0.02% tween 20 in PBS.
Plates were pad dry on paper towel and were stored at 4°C.
40.3: Coating ELISA 96 wells plate by lysate:
In to 10ml of lysate PL5Φ 0.95% PEG 8000 and ).8% NaCl was added
and it was incubated overnight at 4°C .lysate was centrifuged at 14000
rpm for 45 min and pellet was resuspended into 300λ of sterile distilled
water. In order to remove the media and salt from phage suspension,
dialysis tube-visking (size 3-20, 132”) was used.
Phage suspension was diluted 1/5 in coating buffer and 100λ of dilution
was added in each wells and plate was incubated at 4°C overnight.
Solution was discarded and micro plate was incubated with 200λ of
blocking buffer for 1 hr. at room temperature. Then blocking buffer was
discarded and wells were air dried. Plate was washed with 200λ washed
buffer per well 5 times and then it was pad dry on paper towel. 100λ HCV
positive serum was added into coated wells and incubated for 1 hr. at
37°C after being washed with wash with wash buffer wells were
incubated for 30 min with 100λ of goat anti-human-IgG HRP conjugate
(AutoBio Diagnostics Co.). Plates were washed again and color was
developed by using choromogen substrate A containing urea hydrogen
peroxide and choromogen substrate B containing stabilized 3, 3’-5, 5’
tetramethylbenzidine. Color reaction was stopped after 10 min by
addition of 50λ stop reagent 1M sulfuric acid to each well.The intensity of
the reaction was photometricaly measured at 490nm.
Positive and negative control sera were included in every reaction.
40.4: Coating ELISA 96 wells plate by Pseudomonas:
Lawn of organisms was grown on the BHI agar. Bacteria were washed
times with PBS buffer. 100 λ of cell suspension (1:10 in coating buffer)
was added into each well of ELISA plate. Plates were incubated at 4°C
overnight. Solution was discarded and 200 λ of blocking buffer was added
and after 1 hour incubation of at room temperature reagent was discarded
and plate was pad dried at 4°C. The wells were washed with 200 λ of
washed buffer per well five times and stored at 4°C.
40.4: Estimation of total γ-globulin raised in Rabbit against
S.typhi antigen by ELISA:
Serum sample was diluted 10/100 in EIA buffer containing 0.1% bovine
serum albumin (Promega Co.) and 0.1% tween 20 (Sigma Co.) in PBS
buffer. 100µl of each dilution was incubated in each coated well for one
hour after being washed 5 times with wash buffer containing 0.02%
tween 20 in PBS. Wells were incubated for 1 hr. with 100µl of peroxidase
labbled anti-rabbit antibody (Amersham life-science) diluted 1/500 in
nuclease free water.
Plates were then washed again 5 times and color was developed by using
choromogen substrate A solution containing Urea Hydrogen Peroxide and
choromogen substrate B solution containing stabilized 3,3’-5,5’
Tetramethylbenzidine (TMB) ( Autobio diagnostics Co.).
Color reaction was stopped after 10 min by addition of 50µl of stop
solution containg 1M sulfuric acid to each well.
Optical density at 490nm was measured with ELISA reader.
Positive and negative control sera were included in every reaction.
40.5. a : Estimation of IgG raised in mice antiserum against
S.typhi antigen by ELISA (Fab specific as secondary antibody):
10 µl of mice antiserum was diluted into 700µl of EIA buffer and 100µl
of this was incubated in a coated well for 1 hr. after being washed 5 times
with wash buffer. Wells were incubated for 1 hr. with 100µl of anti-
mouse IgG (Fab specific) (Sigma Co.) diluted 1:2000 in nuclease free
water. Plate was then washed again 5 times and color was developed by
using choromogen substrate A sol. and chromogen substrate B sol.
Color reaction was stopped after 30 min by addition of 50µl stop solution
contain 1 M sulfuric acid to each well. Optical density at 490nm was
measured with ELISA reader.
40.5. b : Estimation of IgG raised in mice antiserum against
S.typhi antigen by ELISA (Fc specific as secondary antibody):
10 µl of mice antiserum was diluted into 700µl of EIA buffer and 100µl
of this was incubated in a coated well for 1 hr. after being washed 5 times
with wash buffer. Wells were incubated for 1 hr. with 100µl of anti-
mouse IgG (Fc specific) (Sigma Co.) diluted 1:2000 in nuclease free
water. Plate was then washed again 5 times and color was developed by
using choromogen substrate A sol. and chromogen substrate B sol.
Color reaction was stopped after 30 min by addition of 50µl stop solution
contain 1 M sulfuric acid to each well. Optical density at 490nm was
measured with ELISA reader.
40.6 : Antibody detection in HCV positive human serums by
ELISA:
96 wells plate of HCV antigen coated was used from commercial kit of
AutoBio Diagnosis Co. 100λ HCV positive serum was added into wells
and incubated for 1 hr. at 37°C after being washed with wash buffer.
Wells were incubated for 30 min with 100λ of goat anti-human-IgG HRP
conjugate. Plates were washed again and color was developed by using
choromogen substrate A containing urea hydrogen peroxide and
choromogen substrate B containing stabilized 3, 3’-5, 5’
tetramethylbenzidine. Color reaction was stopped after 10 min by
addition of 50λ stop reagent 1M sulfuric acid to each well.
The intensity of the reaction was photometricaly measured at 490nm.
Positive and negative control sera were included in every reaction.
41: Quantative analysis by Western blotting
41.1: Western blotting of total amount of rabbit γ-globulin:
PAGE gel was run by laemmli’s method, 25 mA and 100 volt and was
placed in transfer buffer for 20 min at 4°C. Blotting sandwich was
assembled in blotting cassette. Filter pad, whatman paper, nitrocellulose
membrane, polyacrylamide gel, and whatman paper and then filter pad
soaked in transfer buffer. Current was flowed from anode to cathode and
was left at 35 volt and 90mA for overnight. Membrane was first blocked
with 0.5% dry milk in TBS buffer for 2 hours at room temperature on
rocker. Blot was washed 2 times with TBS at room temperature on rocker
for 10 min. Gel was stained with commasi blue to insure that protein was
transferred to membrane. Membrane was treated in primary antibody (1:
500) for 1 hour at room temperature and then was washed with TBS
buffer 2 times. Membrane was incubated in secondary Ab (1:5000) for 1
hour at room temperature. Blot was washed with TBS buffer for 15 min,
7ml detection (BCIP/NBT) liquid substrate reagent (Sigma Co.) was
added on blot. The color was developed after 15 min.
41.2: Western blotting of total amount of Mice γ-globulin
raised against S.typhi antigen:
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C.
Blotting sandwich was assembled in blotting cassette. Filter pad,
whatman paper, nitrocellulose membrane, polyacrylamide gel, and
whatman paper and then filter pad soaked in transfer buffer. Current was
flowed from anode to cathode and was left at 35 volt and 90mA for
overnight. Membrane was first blocked with 0.5% dry milk in TBS buffer
for 2 hours at room temperature on rocker. Blot was washed with TBS
buffer for 20 min twice at room temperature. Gel was stained with
commasi blue to insure that protein was transferred to membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
was incubated in Anti-mouse antibody (1:5000) for 3 hour at room
temperature. Blot was washed with TBS buffer for 10 min, 7ml detection
(BCIP/NBT) liquid substrate reagent (Sigma Co.) was added on blot.
The color was developed after 15 min.
42.3: Estimation of IgG raised in mice against S.typhi antigen by
Western Blotting ( Fab –specific as secondary antibody )
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C. Blotting sandwich was assembled in
blotting cassette. Filter pad, whatman paper, nitrocellulose membrane,
polyacrylamide gel, and whatman paper and then filter pad soaked in
transfer buffer. Current was flowed from anode to cathode and was left at
35 volt and 90mA for overnight. Membrane was first blocked with 0.5%
dry milk in TBS buffer for 2 hours at room temperature on rocker. Blot
was washed with TBS buffer for 20 min twice at room temperature. Gel
was stained with commasi blue to insure that protein was transferred to
membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
was incubated in secondary Ab IgG-Fab specific (1:5000) for 3 hour at
room temperature. Blot was washed with TBS buffer for 10 min, 7ml
detection (BCIP/NBT) liquid substrate reagent (Sigma Co.) was added on
blot. The color was developed after 15 min.
42.4: Estimation of IgG raised in mice against S.typhi antigen by
Western Blotting (Fc –specific as secondary antibody)
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C. Blotting sandwich was assembled in
blotting cassette. Filter pad, whatman paper, nitrocellulose membrane,
polyacrylamide gel, whatman paper and then filter pad soaked in transfer
buffer. Current was flowed from anode to cathode and was left at 35 volt
and 90mA for overnight. Membrane was first blocked with 0.5% dry milk
in TBS buffer for 2 hours at room temperature on rocker. Blot was
washed with TBS buffer for 20 min twice at room temperature.
Gel was stained with commasi blue to insure that protein was transferred
to membrane. Membrane was treated in primary antibody (1: 7000) at
room temperature for overnight and then was washed with TBS buffer 2
times. Membrane was incubated in secondary Ab IgG-Fc specific
(1:5000) for 3 hour at room temperature. Blot was washed with TBS
buffer for 10 min, 7ml detection (BCIP/NBT) liquid substrate reagent
(Sigma Co.) was added on blot. The color was developed after 15 min.
42.5: Western blotting of total amount of Mice γ-globulin raised
against S.typhi antigen (ECL):
Gel was run by SDS laemmli’s method 25mM and 35volt placed in
transfer buffer for 20 min at 4°C.
Blotting sandwich was assembled in blotting cassette. Filter pad,
whatman paper, nitrocellulose membrane, polyacrylamide gel, and
whatman paper and then filter pad soaked in transfer buffer. Current was
flowed from anode to cathode and was left at 35 volt and 90mA for
overnight. Membrane was first blocked with 0.5% dry milk in TBS buffer
for 2 hours at room temperature on rocker. Blot was washed with TBS
buffer for 20 min twice at room temperature. Gel was stained with
commasi blue to insure that protein was transferred to membrane.
Membrane was treated in primary antibody (1:7000) at room temperature
for overnight and then was washed with TBS buffer 2 times. Membrane
was incubated in Anti-mouse antibody (1:5000) for 3 hour at room
temperature. Blot was washed with TBS buffer for 10 min, and then it
was wrapped in saran wrap and exposed to X-ray film in different
exposure time.
X-D: Phage Therapy
42: Phage application as therapeutic agent for treatment of Mice
infection due to MDR Pseudomonas:
Pathogen free 7 weeks old male BALB/c mices were used for this
experiment. 5λ of young grow culture of MDR Pseudomonas aeruginosa
was used as an infectious agent on deep legioned Mices and 20 λ lytic ϕ
PS6 was applied after 30 min of infection. Mices were administered by
two dose of phage application on legion and orally. While positive control
Mice was not received phage for treatment. Infected mices and controls
were observed under sterile condition for one week and were
photographed.
43: Phage application as therapeutic agent for treatment of Mice
infection due to MDR E.coli
7 weeks old male BALB/c mice was infected by 5λ of young grow culture
of MDR E.coli as an infectious agent on deep legioned Mices and 20 λ
lytic Φ3S and ΦU9 were applied separately after 30 min of infection.
Mices were administered by two dose of phage application on legion and
orally. Positive control Mice was not received phage.Infected mices and
controls were observed under sterile condition for one week and were
photographed.
44: Phage therapy on chronic MDR infection:
One week infected Mices by MDR Ps and MDR E.coli separately
(controls) were used as chronic infected test for treatment. Mices were
maintained in sterile condition and received 3 doses of respective Lytic
phages. Infected mices were observed for one week and photographed.
X-E: Bioinformatics analysis
DNA sequencing and computer analysis:
Sequencing reaction was performed at MACROGEN-advancing through
genomics. For alignment and comparison of similar of new sequences
ClustalW.2 was used. HCV and HIV similarities searches and analysis
were done using BLAST, QuickAlign, Gene locator and Sequence locator
programs. The similarity between our data sequence and sequence
database assessed by use of BLAST-NCBI. Including algorithms Blastn
and Blastx via the National center for Biotechnology internet service and
LosAlamose Databank.
XI Results:
1. Purity determination of bacterial culture:
Bacterial strains of Pseudomonas (Ps.aeroginosa, P7, P3, P4, P5),
Klebsiella, E.coli spp (E.coli 2, 3,40MD). Salmonella typhyimurium,
S.typhi para A, S.typhi para B were observed as Gram negative short
rods. Size variation has been notice in colonial characteristic of P5 and P6
resistant colonies to phage but in staining both were gram negative rods.
2. Isolation of phage from sewage:
Sewage sample S1 on the lawn of E.coli3 produced two types of plaques,
few large, clear, round and uncountable small, turbid and confluent
plaques. Sewage sample S2 on the lawn of E.coli3 was produced large,
clear center and turbid zone an uncountable small, turbid, irregular
margin. (Table-4) Lysate S1 and S2 on the lawn of E.coli2 were produced
uncountable, confluent, homogenous plaques. Amplified plaques from
lawn of E.coli3 and S1 (3Sam) on the lawn of E.coli3 produced small,
clear, confluent, homogenous plaques. Resistant colonies were also
observed. Spot assay of 3Sam on the lawn of E.coli 40MD, E.coli2 and
E.coli3 was very clear and no resistant colonies were present.
Amplified large plaque form the lawn of E.coli3 and S1 (3Sal ) produced
clear, large and plaques. Resistant macro colonies and micro colonies
were present. Amplified small plaques from lawn of E.coli3 and S1 (3Sas
) on the lawn of E.coli3 was produced homogenous small, turbid plaques
with clear center. Variable size resistant colonies were observed.
3. Isolation of phage from clinical specimen (Urine):
Urine sample of Urinary Tract Infection (UTI) patient was used as lysate
and plaque assay and spot assay was performed on the lawn of different
hosts. On the lawn of Ps. aeruginosa, P3, P5, P6 and P7 urine produced
variable size plaques, which was mixture of clear and turbid plaques.
large number of resistant colonies was present of the lawn of respective
hosts. (Table-5) Spot assay of urine on the lawn of Ps. aeruginosa, P3,
P5, P6 and P7 produced strong spots, which contain resistant colonies.
Numbers of resistant colonies were less on the lawn of P5 and P6.
Urine was propagated in P5 and P6 as source of phages. U1 (dilution of
10-8) on the lawn of P5 was produced two types of plaques, medium, clear
round, homogenouges, few small, turbid plaques. No resistant colonies
were observed. (Fig-2A) U2 (dilution of 10-6) on the lawn of P6,
produced two types of plaques, small and medium size, round and clear.
No resistant colony or turbid zones were present. (Fig-2B)
4. Determination of phage interaction with bacteria:
Plaque assay and spot assay was performed as basic assays to
determination of phage-host interaction. Lysate M77 on the lawn of P7
produced pinpointed plaques. Lysate B78 and M79 on the lawn of Ps.a
produced pinpointed turbid plaques but on the lawn of P7, M79 produced
very small, pinpointed plaques (Fig-2C) Lysate B78 on the lawn of P3
produced large, clear plaques. After 72 hrs dimension of plaques were
increased. Lysate M79 on the lawn of P3 produced uncountable
pinpointed, clear plaques (Fig-2D) Lysate M79am on the P7 produced
homogenous medium size, turbid plaques. Variable size resistant colonies
in each plaque were observed. Lysate M79al on the P7 produced
homogenous large clear plaques. (Table-4) Spot assay of M77, B78, M79
and B80 produced very strong clear spot. Few variable size resistant
colonies in clear area were observed. (Table-4)
5. Amplification of single plaque:
For All lysates several amplification was done in order to get the
homogenous plaques on the lawn of respective host. Lysate M76 on the
lawn of Ps.aeroginusa was produced 3 size plaques, small, medium and
large. All three sizes were amplified M76al, M76am and M76as.
Lysate B72 on the lawn of Ps. aeruginosa was produced 2 small turbid
plaques. Single plaque was amplified B72a on the lawn of Ps.a was
produced homogenous, clear and confluent plaques.
6. Effect of salt on Phage and Host interaction:
Plaque assay and spot assay on the lawn of Staphylococci aureus was
performed to compare the effect of MgSO4, CaCl2 and NaCl on phage-
host interaction. Plaque assay of Lysates 38, 39, 43, 46, 52, 53, 55, 59, 60
and 61 in presence of MgSO4 was strongly positive and plaques were
clear with halo zone. Lysates 39 and 52 produced turbid plaques. But in
presence of CaCl2 lysates 48, 52, 53, 55 and 60 produced no plaque on
the lawn of Staphylococci. Spot assay of these lysates in presence of
MgSO4 on the lawn of Staphylococci were positive and lysates 38, 43,
46, 53 and 60 were produced plaques around the clear spots and lysates
39 and 52 produced turbid plaque and on spot produced by Lysate 61
resistant colonies were present. Plaque assays of these Lysate in presence
of 7% NaCl and MgSO4 was strongly positive. Lysates 48, 52 and 55
were produced small size, clear plaques. In presence of 7% NaCl and
CaCl2 Lysates 39, 43, 46, 53, 59 and 60 were negative and Lysate 48 was
producing turbid plaques.
Spot assays of lysates 43, 46, 48, 52, 53, 55, 59, 60 and 61 in presence of
7%NaCl and MgSO4 were positive and no resistant colonies were
observed.
7. Comparative study of phage infection in enrich and minimal
media.
Plaque assay was performed to compare the effect of minimal media
(L.B) and enrichment media (BHI) on phage –host interaction. Plaque
assay of lysates M38, M39, M43, M46, M48, M52, M53, M55, M55,
M59, M60 and M61 in presence of MgSO4 and in LB media were
positive. Plaque assay of Lysates M38, M39, M43, M46, M59 and M61
in presence of CaCl2 and in LB media were positive but lysates M48,
M52, M53, M55 andM59 produced no result. Plaque assay of lysates
M38, M39, M43, M46, M48, M52, M53, M55, M55, M59, M60 and M61
in presence of MgSO4 and in BHI media were strong positive and clear,
round plaques were observed . Plaque assay of lysates M39, M55 and
M60 in presence of CaCl2 and in BHI media were negative.
8. Comparative study of selective and enriched media on phage
and host interaction:
Pyocin and Florescent base agar and soft agar were used as selective
media for Pseudomonas strains of this study and BHI was used as
enrichment media and plaque assay and spot assay were performed to
compare the specify of media on phage-host interaction. Lysate M85 on
the lawn of P7 was produced pinpointed, small, few large confluent
plaques. On the lawn of P3 and Ps.a produced confluent plaques, most of
the host lawn was eaten up by phages. Variable size resistant colonies
were present. Lysate M88 on the lawn of P7 was produced large clear
and pinpointed plaques. On the lawn of P3 few large clear plaques were
present, but on the lawn of Ps.a variable size resistant colonies were
present. Lysate M89 on the lawn of P7 was produced homogenous,
confluent plaques. Resistant colonies were observed. On the lawn of P3
pinpointed, clear and few turbid small plaques were present. Lysate M89
on the lawn of Ps.a produced confluent, large plaques .resistant colonies
also were observed.
Lysate M90 on the lawn of P7 was produced small, pinpointed and large
turbid with clear center plaques. On the lawn of P3 pinpointed, small
clear center and turbid hollow zone were present. Lysate M90 on the
lawn of Ps.a produced confluent large plaques contained variable size
resistant colonies. Lysate M92 on the lawn of P7 was produced
homogenous, confluent plaques. In some of plaques resistant colonies
were observed. On the lawn of P3 few variable size turbid plaques and
on the lawn of Ps.a large, confluent plaques, uncountable pinpointed
plaques were present. (Table-7)
9. Lysate activity after induction By Bile salt:
Plaque assay was performed as basic assay to determination of activity of
lysates after induction by Bile salt.
Lysate M81 on the lawn of Ps. aeruginosa and P3 produced variable size
plaques, clear small, some had hollow zone, large size and irregular
margin clear plaques were observed .( Fig-3D) Lysate M81 on the lawn of
P7 produced 3 sizes of plaques, small, medium and large size with
irregular margin. All plaques were clear (Fig-3E).
Lysate M82 on the lawn of Ps. aeruginosa and P3 produced clear plaques
and center of plate was eaten up by plaques. Most of the plaques were
clear, confluent and few had hollow zone. No resistant colony was
observed. (Fig-3B)
Lysate M82 on the lawn of P7 was produced confluent, clear, small size
plaques. Some of plaques were containing very small resistant colony.
(Fig-3A) Lysate M83 on the lawn of P3 was produced very clear and
large plaques and some had tiny zone. (Fig-3C)(Table-8)
10. Effect of Salt (Bile, MgSO4, CaCl2) on Induced Lysates:
Plaque assay was performed for comparative study of effect of Bile,
MgSO4, CaCl2 salts on infectivity of lysates. Lysates M84, M85, M86,
M87, M88, M89, M90, M92, C97 and C98 on the lawn of Ps.
aeruginosa, P3 and P7 were producing uncountable, confluent plaques
and few resistant colonies were observed on the lawn of respective host.
Lysates were further diluted to estimation of titration and accuracy.
(Table-11)
11. Identification of resistant colonies:
Gram staining of large resistant colony has shown gram negative, short
rods, Oxidase and citrate positive. Gram staining of small colony has
shown gram negative, short rods, these cells were change their
morphology , and were similar to gram negative coco bacillus, oxidase
and citrate positive. Both large and small resistant colonies on the F base
agar were produced green florescent pigments.
12. Induction of resistant colony by Bile salt.
After induction of resistant colonies selected from plaque assay plate of
P7 and Lysate M86 by Bile salt, plaque assay and spot assay were
performed. Lysate M93 on the lawn of Ps.a produced homogenous, clear
plaques, on the lawn of P7 variable size; most medium and few small
clear plaques were observed. On the lawn of P3, Lysate M93 produced
homogenous, confluent plaques, resistant colonies also were present.
Lysate M94 on the lawn Ps.a produced clear plaques, some of plaques
had turbid zone. On the lawn of P7, clear plaques and few pinpointed
clear plaques were present. Lysate M94 on the lawn of P3 produced
variable size, clear plaques.
Lysate M95 on the lawn of Ps.a produced homogenous, clear plaques. On
the lawn of P7 turbid plaques, confluent and pinpointed plaques were
observed.
Lysate M95 on the lawn of P3 produced confluent plaques, almost same
size. Variable size resistant colonies were present. (Table-6)
Lysate PAK on the lawn of P3 produced homogenous turbid plaques.
Large resistant colonies were observed. Lysate PAK on the lawn of P5
produced medium size homogenous clear plaques, some of plaques had
irregular margin. Lysate PAK on the lawn of P6 produced medium size
homogenous plaques. Variable size resistant colonies were present.
Lysate PAK on the lawn Ps.a produced large, clear and few confluent
plaques. Lysate PAK on the lawn of P3 produced uncountable, confluent,
clear plaques. Most of the lawn was eaten up by phages. Few resistant
colonies in clear area were observed.
Lysate PAK on the lawn of P7 after 72hr. produced very small clear
pinpointed plaques. Spot assay of induced lysates had shown strong
positive spot on the lawn of the respective hosts.
13. Comparative study of induced lysates activity in aerobic and
anaerobic condition:
Lysate M81 on the lawn of P7 in anaerobic condition was produced large
and medium size, very clear plaques and no resistant colony or turbid
zone were observed (Fig-4) Lysate M81 on the lawn of P3 produced
medium size, clear plaques and on the lawn of Ps. aeruginosa produced
small confluent clear plaques.
14. Induction of lysogenic strain of P7 by Naledixic acid:
Single colony of P7 was grown in LB broth supplement with Nalidixic
acid, final concentration of 150µg/ml. After 24hr lysate was filter striled
and plaque and spot assay was performed. Plaque assay of induced lysate
C101 on the lawn of P3 produced variable size clear plaques. On the
lawn of P7, homogenous, clear plaques were observed. Lysate C101 on
the lawn of Ps.a produced confluent, variable size plaque, resistant
colonies also were present. (Table-6)
15. Antibiotic Resistance Profile of Bacterial Strains:
The antibiotic susceptibility pattern of our isolates are presented that
strains Ps.aeruoginosa, P3, P7, P5, P6 and E.coli-N are resistant to
Ciproflaxin when Minimal Inhibitory Concentration (MIC) ≥ 5µg/ml. P3,
P7, P5, P6 and E.coli-N are resistant to Nalidixic Acid when MIC
≥150µg/ml to Ampicylin when MIC ≥200µg/ml, to Gentamycin when
MIC ≥50µg/ml to Methacylin when MIC is ≥ 5µg/ml to vancomycin
when MIC is ≥30µg/ml and to minomycin when MIC is ≥30µg/ml.(Fig-
25)
16. Phage separation by titration:
After inoculation of urine on BHI agar, plate was incubated for 24 hr at
37°C. The biochemical test performed and colonies were identified as
Streptococci, Pseudomonas, and E.coli.
Urine sample plaque assay and spot assay was strong clear spot on the
lawn of Ps. aeruginosa and E.coli3 and produced no spot on the lawn of
Streptococci. Pseudomonas was grown in BHI broth and was grown for 4
hr .and was centrifuged at 3000 rpm for 5 min. pellet was washed 2 times
with PO4 buffer and 100λ of cell suspension was mixed in LB soft agar
and plated. After 24 hr. small, turbid, irregular margin plaques were
observed. E.coli3 pellet was washed 2 times with PO4 buffer and 100 λ of
cell suspension was mixed in LB soft agar and plated .after 24hr. few
small, pinpointed, clear plaques were observed.
Streptococci pellet was washed 2 times with PO4 buffer and 100 λ of cell
suspension was mixed in LB soft agar and plated. After 24hr. no plaque
was present. Finally, supernatant was filter sterilized and spot assay was
performed on the lawn Pseudomonas, E.coli3 and Streptococci. After 24
hr. clear spot were observed on the lawn of E.coli3 and Pseudomonas.
17. Determination of bacteriocin activity of Lysates by wells
method:
10µl of each lysate was added in to separate wells. And after 24hr.
incubation at 37°C, Lysates M84, M87, M88 and M92 were produced
very narrow turbid zone around the wells. Presence of zone may be is
due to bacteriocin activity of these lysate. (Table-10)
18. Titration of lysates by liquid serial dilution method (PFL/ml):
Plaque assay in different dilution was performed to estimate the titration
of lysates. Lysate M84 was diluted 10-6 times and plaque assay was
performed. On the lawn of P3 different size, large clear and small turbid
plaques were produced. Accuracy of M84 was determined ± 47%.
Lysate M85 was diluted 10-7 times and plaque assay was performed. On
the lawn of P3, variable size, confluent, turbid and few clear plaques
were observed. Accuracy of M85 was determined ±31%. Lysates M86
was diluted 10-5 times and plaque assay was performed. On the lawn of
P3, variable size plaques, large plaques were clear and small size plaques
were turbid with clear center and confluent were observed .accuracy of
M86 was determined ±44%. Lysate M87 was diluted 10-9 times and
plaque assay was performed. On the lawn of P3, homogenous medium
sizes turbid with clear center were present. Accuracy of M87 was
determined±18%. Lysate M88 was diluted 10-10 times and plaque assay
was performed. On the lawn of P3 Variable size plaques, clear with no
resistant colony were observed. Accuracy of M88 was determined ±32%
Lysate M89 was diluted 10-4 times and plaque assay was performed. On
the lawn of P3 Clear, small plaques and several turbid plaques in
different size and in one side of lawn were observed and after 72 hrs.
Increase in size and very tiny plaques in other side of lawn also observed
.accuracy of M89 was determined ±32%. Lysates M90 was diluted 10-10
times and plaque assay was performed. On the lawn of P3 variable size,
district, clear and few turbid plaques were present. Accuracy was
determined ±30%. Lysate M91 was diluted 10-16 times and plaque assay
was performed. On the lawn of P3 Small, turbid plaques, some confluent
plaques also observed. Accuracy was determined ±26%.
Lysate M92 was diluted 10-4 times and plaque assay was performed. On
the lawn of P3, homogenous medium size clear and few small confluent
turbid plaques were observed. Accuracy of M92 was determined ±37%
Lysate C97 was diluted 10-9 times and plaque assay was performed. On
the lawn of P3 Clear variable size, few confluent small turbid plaques
were observed. Accuracy of C97 was determined ±42%. Lysate C98 was
diluted 10-3 times and plaque assay was performed. On the lawn of P3
clear tiny irregular margin plaques and few clear large plaques were
observed. Accuracy of C98 was determined ±70%. Lysate C99 was
diluted 10-13 times and plaque assay was performed. On the lawn of P3
Produced homogenous plaque with large turbid zone. Accuracy of C99
was determined ±10.5%. Lysate C101 was diluted 10-2 times and plaque
assay was performed. On the lawn of P3 Variable size plaques, few clear
medium size and background of plate was full of pin pointed turbid
plaque. Accuracy of C101 was determined ±60%. (Table-11)
19. Laemmli Discontinues Gel Electrophoresis of Protein:
Protein profile was similar in all lysates; phage in lysate U1 and U2
have the identical bands profiles. However in U1 one additional
strong band was present. In U7 one additional band, which was very
strong, was present. That indicated high quantity of protein in sample.
This strong band referred to serum that was used for induction.U9 is
similar to U2 but in U9 the bands are wear that is due to low quantity
of protein. (Fig-12) Amplified lysate of PS5, PL5, PS6 and PL6 have
the identical bands profiles.
20. Nuclease assay and DNA profile:
All phages which were prepared from single plaques have shown band of
DNA genomes on the basis of their migration following SDS Agarose
electrophoresis. U1 and U2 have got the very strong band in the same
position. All the lysates in addition to induced ones have shown a single
discrete band of ds DNA (Fig-13) Phage E.coli.N, exhibited two DNA
band. These DNA bands were in same intensity even following 3 rounds
of plaque purification. (Fig-13)
21. Induction of E.coli-N lysogen by antibiotics:
Induced lysate of E.coli-N by tetracycline produced 2 types of small and
medium size clear plaques on the lawn of E.coli-N. After induction of
E.coli-N by ampiciline no plaque were observed on the lawn of respective
hosts.
22. Induction of lysogenic E.coli-N by human serum:
After induction of E.coli-N by 4% human serum plaque assay and spot
assay was performed. Induced Lysate of E.coli-N by serum (U7) on the
lawn of P5 and P6 produced three types of plaques. Medium and small
plaques were clear and large plaques had irregular margin. (Table-4)
Lysate U7 on the lawn of E.coli-N produced no plaques. (Table-4)
23. Induction of lysogenic E.coli-N by Urea:
After induction of E.coli-N by urea plaque assay and spot assay was
performed. Induced Lysate of E.coli-N by urea (U9) on the lawn of P5
and P6 produced homogenous, clear plaques, no resistant colonies were
present. Lysate U9 and U6 on the lawn of E.coli1 produced pinpointed
and small clear plaques. Lysate U9 on the lawn of Ps. aeruginosa
produced uncountable, variable size clear plaques and resistant micro
colonies and macro colonies were present. Lysate U9 on the lawn of P5
produced three types of plaques which were picked separately and were
amplified. Plaque assay of amplified lysates (PS5, PM5, and PL5) on the
lawn of P5 produced homogenous, clear, round plaques. No turbid
zone or resistant colonies were observed.
U9 on the lawn of P6 produced three types of plaques. Each plaque was
picked separately and was amplified. Plaque assay of amplified lysate
PS6 on the lawn of P6 has shown homogenous small, clear, round
plaques. On the lawn of P6, amplified lysate PM6 produced homogenous,
medium size, turbid, irregular margin plaques. Amplified PL6 on the lawn
of P6 was produced large, clear, round, confluent plaques. (Table-11)
24. Induction of E.coli-N lysogenic strain by Uric acid:
After induction of E.coli-N by uric acid plaque assay and spot assay was
performed. Induced Lysate of E.coli-N by uric acid (U10) on the lawn of
P6 produced few small turbid plaques. And on the lawn of E.coli-N small
clear plaques were produced.
25. Induction of lysogenic E.coli-N by UV.
Urine was propagated in E.coli (U12), E.coli2 (U13), E.coli-N (U14) and
E.coli40MD (U16) as source of phages and then were exposed to UV for
2 min. After induction by UV plaque assay and spot assay was performed.
Induced lysate U12 on the lawn of P5 produced variable size plaques
which contain resistant colonies. Induced lysate U12 on the lawn of P6
produced uncountable variable size plaques. Resistant colonies also were
present.
Induced lysate U12 on the lawn of Ps.a produced variable size plaques,
large plaques were clear. Resistant colonies were observed. (Table-4)
Induced lysate U12 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. Induced lysate U13 on the
lawn of P5 produced few variable sizes, turbid plaques. Resistant
colonies were observed. Induced lysate U13 on the lawn of P6 produced
few small, turbid plaques. Induced lysate U13 on the lawn of Ps.a
produced uncountable, variable size plaques. Resistant colonies were
present. (Table-4) Induced lysate U13 on the lawn of E.coli40MD, E.coli,
E.coli2, E.coli-N, Staphylococci produced no plaque or spot.
Induced lysate U14 on the lawn of P5 produced variable size, clear
plaques. Induced lysate U14 on the lawn of P6 produced uncountable,
small size, clear and few pinpointed plaques. Induced lysate U14 on the
lawn of Ps.a produced variable size clear plaques.
Induced lysate U14 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. (Table-4)
Induced lysate U16 on the lawn of P5 produced small and few large
plaques .resistant colonies were present. Induced lysate U16 on the lawn
of P6 produced variable size clear, round plaques. Induced lysate U16 on
the lawn of Ps.a produced variable size turbid, irregular margin, few
confluent plaques. Resistant colonies were observed.
Induced lysate U16 on the lawn of E.coli40MD, E.coli, E.coli2, E.coli-N,
Staphylococci produced no plaque or spot. (Table-4)
26. Transmission Electron Microscopy of phage particles:
Each phage isolated was examined under the electron microscope and
was placed in phage families based on its morphology or morphotype as
describe by Ackerman and colleagues. (Fig-14-21) In U1 we observed
variation in isometric head sized from 92 × 108 nm to 108 × 100 nm and
contractile tail of 133 × 25 nm. Tiny small empty head particles were also
observed (Fig-15A). Electron micrograph of U2 have shown similar
particles consisting of an isometric head of 130 × 95 nm and contractile
tail of 140 × 20 nm observed (Fig-15B). Induced lysate U9 phage
particles with the isometric head 116× 122nm and complex contractile tail
122 × 128 nm were observed (Fig-16)
27. Induction of P5 and P6 lysogenic by Urea:
After induction of Lysogenic strains P5 and P6 by 0.5% urea plaque
assay and spot assay was performed. Induced lysate of P5urea on the lawn
of P5 was produced uncountable confluent plaques which had clear center
and large turbid zone. At the background, small, turbid plaques with
turbid zone were observed. After 72 hr. turbid zone was more clear (Fig-
5).
Lysate P5 urea on the lawn of P6 was produced clear, round, homogenous
large and few small plaques. (Fig-5) Lysate P6urea on the lawn of P5 was
produced few small, clear plaques. Lysate P6urea on the lawn of P6 was
produced uncountable, homogenous, confluent, clear plaques. Resistant
colonies were also present and few mucoidal micro colonies were
observed.
28. Effect of maltose on interaction of host and phage:
Plaque assay of lysate U9 on the lawn of P6 in present of maltose was
performed. Central portion of lawn was clear which was due to strong
phage-host interaction. Uncountable large plaque and few pinpointed
clear plaques were observed. Plaques were almost homogenous and large
number of resistant micro colonies and macro colonies were present.
Lysate U9 on the lawn of P6 in present of no sugar produced,
uncountable pinpointed and few small and large clear plaques. Less
number of resistant micro colonies and macro colonies were observed.
(Fig-6) Small and large size plaques were amplified in presence of
maltose and plaque assay was performed.
Amplified lysate PS6 on the lawn of P6 was produced homogenous small
plaques. Three types of resistant colonies were present:
- Large number of mucoidal, transparent, white color macro
colonies.
- Transparent, yellow color mucoidal macro colonies.
- Pinpointed, turbid micro colonies.
Amplified lysate PL6 on the lawn of P6 was produced homogenous large
plaques with turbid zone. Two types of resistant colonies were observed.
- Few mucoidal macro colonies
- Large number of turbid micro colonies.
Some resistant colonies had turbid zone. (Fig-6)
29. Phage DNA purification:
Isolated DNA fragments obtain by Phenol-Chloroform extraction,
Promega kit or directly from lysate were run in 2% Agarose gel and
further purified. Ethidium bromide Agarose plate was used in each step to
highlight the concentration and presence of purified phage DNA.
30. Southern Blotting:
Result of Southern blotting have shown that lysate U1 (Fig-22, lane-3)
and U2 (Fig-22, lane-4) are positive, 2 bands which were close together at
top and one strong band of low molecular weight was highlighted by
PS5Φ DNA as probe. PL6 Φ and PL5 Φ have shown identical patterns.
Comparing U1 (Fig-22, lane-3) and U2 (Fig-22, lane-4) with 4 amplified
lysates (PL6, PS6, PL5 and PS5), in U1 (Fig-22, lane-3) and U2 (Fig-22,
lane-4), 2 additional bands at top were present which were missing in
amplified ones. Smearing in PS5 (Fig-22, lane-1) was more than U1 (Fig-
22, lane-3) and U2 (Fig-22, lane-4) that could be due to replicated form of
phage genome or chromosomal DNA. All amplified lysate DNA (Fig-22,
lane-1, 6, 7, 8), U1 (Fig-22, lane-3) and U2 (Fig-22, lane-4) are closely
related and identical. Lysate H2, H3 and K3 were strongly positive and
related when PL5Φ was used as probe. In H2 two heavy molecular weigh
bands close to each other and smearing through out was highlighted.
Highlighted band in M97 have shown slight shift and was concentrated.
Lysate M87, induced lysates P5urea and P6urea have not shown any
positive results with treated probes.
31. Restriction endonucleases:
The restriction endonuclease digestion pattern with EcoR I for DNA
purified from each four amplified phage are shown (Fig-23, lane;1-5) and
gave similar electrophoretic mobility pattern, PS6 has got 19 bands ,PS5:
10 bands with low intensity .PL6 and PL5 Shown; 18 bands. Bands were
almost in similar position.
Digestion pattern with Bam H I (Fig-23, lane; 1-5) for above DNAs
showed 7-13 fragments. PS5 has shown high density in bands.
Cla I (Fig-23, lane; 1-5) showed similar position bands.PS5 has got 29
bands, PS6: 30 bands, one additional band in 6th position, PL5:18 bands,
band of 7th position was missing. PL6: 19 bands, additional band with
low mobility was present. Dra I (Fig-23, lane; 1-5) showed PS5 has 26
bands, PS6: 26 bands, which lower bands shows weak intensity. PL5:17
bands. Band at 11th position was missing and bands have got strong
intensity. PL6: 19 have got bands.
Digestion with Hpa I (Fig-23, lane; 1-5) PS5: 20 bands, band from
position 9th was missing. PS6:20 bands. PL5: 21 bands and bands with
high mobility at the bottom of gel show weak intensity. PL6: 22 bands.
Bands have got strong intensity.
DNAs also digested by Msp I (Fig-23, lane; 1-5) has shown, PS5:18
bands, PS6:20 bands, PL5:20 bands and PL6:17 bands.
Digestion with Hind III (Fig-23, lane; 1-5) showed PS5 has got 16 bands
PS6:31 bands. There is an additional band at 2nd position. PL5:31 bands,
the bands have shown high density and band from 2nd position was
missing. PL6 has got 17 bands and lower bands were missing.
Digestion pattern with Hpa II (Fig-23, lane; 1-5) has shown that, PS5 has
got 15 bands, PS6:13 bands, PL5:10 bands and PL6 has shown 15 bands.
DNA of U9 Φ after digestion with EcoR I shows 15 bands, Bam H I:17
bands, Cla I :22 bands ,Dra I:28 bands, Hpa I:20 bands, Hpa II:16 bands
and Msp I:16 bands. DNA of U9 has no restriction site for Hind III
endonuclease, since it gave the same electrophoric pattern as compare to
undigested DNA(Fig-23, Lane;1-5)
The DNAs gave similar mobility pattern but DNA of U9 Φ has no
restriction site for Hind III endonuclease, since it gave the same
electrophoric pattern as compare with undigested DNA.
Hpa II (Fig-23, lane; 1-5) showed several digested fragments, similar
position which shows they are identical.
32. Wet slide agglutination:
After 15 minutes of incubation at 37°C aggregation was start in all the
tubes contained immunized Rabbit antiserum .after 60 minutes, in tube
contained antiserum raised by vaccine motile clumps and alive cells in the
filed were observed, in tube contained antiserum raised by vaccine and oil
motile small clumps, most cells were alive. In tube contained antisera
raised with vaccine, oil and Ps (P5). ϕ DNA, large clumps with no
movement were observed. Similarly in tube contain antisera raised by
vaccine, oil and E.coli ϕ (U9) DNA large clumps were present.
Tube agglutination after 15 min of incubation at 37°C of Mice antisera
raised by vaccine and oil, vaccine and Ps. ϕ DNA, vaccine, oil and P5. ϕ
DNA, vaccine, oil and E.coli ϕ DNA were similar and clumps were
present. While tube contains control antisera shows very small
aggregation, motility of the cells were observed.
The results obtained with wet slide agglutination are shown in (Table-13)
33. Ouchterlany gel immunodeffiusion:
The raised antiserums were interacted with S.typhi antigen and a clear line
of identity among the wells was observed. (Fig-24)
34. Immnoelecterophoresis:
Comparison of raised antiserums against S.typhi by
immunoelectrophoresis showed that each antiserum contained positive
charged antibodies and had anodic movement. That was common in all
raised antiserums of this study. Antisera raised against vaccine, adjuvant
vaccine and phage DNA (U9 Φ) vaccine had relatively stronger positive
charges. Antisera raised by phage DNA (U9 Φ) vaccine had two
apparently positively charged zone. Antiserum raised against Adjuvant
vaccine had a broad migration zone as compare to other antiserums
No zone was observed in control serum against S.typhi antigen.
35. Estimation of total γ-globulin raised in Rabbit and Mice against
S.typhi antigen by ELISA:
ELISA result, has indicated high yield of gamma globulin in Rabbit
antisera raised by adjuvant DNA vaccines (Fig-26). Similarly in Mice
antiserums (Fab/Fc- specific) maximum reading was due to adjuvant
DNA vaccines ( Fig-29) cut off value was 0.105
36. Coating ELISA 96 wells plate by lysate:
ELISA results, has indicated that 83% of HCV positive serums were bind
to Lysate coated plate ( Fig-30) .Maximum reading was 0.283 while blank
was 0.059.
37. Coating ELISA 96 wells plate by Pseudomonas cells:
ELISA results, has indicated that 77% of HCV positive serums were react
to Pseudomonas coated plate (Fig-30). Maximum reading was 0.494
while blank was 0.053.
38. Western blotting of total amount of γ-globulin raised in Rabbit
and Mice against S.typhi antigen:
Western blot profile of immunized mice antisera indicated that IgG- Fab
highlighted the high molecular weight (220-97-46.kD) (Fig-31). Whereas
low molecular weight bands (14 KD) of Ag were highlighted by IgG-Fc
fragment. (Fig-31)
Similarly western blot profile of immunized rabbit has shown enhance Ab
production against all four types of S.typhi Ags. (Fig-32)
39. Phage application as therapeutic agent for treatment of Mice
infection due to MDR (Multiple drug resistance) Pseudomonas.:
The results of the recovery of animals form infection is illustrated in (Fig-
34) two dose of phage application significantly reduced the bacterial load
on the legion.
40. Phage application as therapeutic agent for treatment of Mice
infection due to MDR (Multiple drug resistance) E.coli:
The parameter used to evaluate the efficacy of phage therapy were the
same for the MDR Ps. infected mice. Two dose of phage application
simultaneously local and oral administration were used and after 5 days
infected mice was healthy and no infection or diarrhea were observed.
(Fig-35)
41. Phage therapy on chronic MDR infection.
The data reported in (Fig-34-39) proved untreated control animals carried
chronic infection (5days) after 6 days of phage administration, were free
of the bacterial infection.
Bioinformatics analysis
Sequencing:
HCV PCR products analysis
Blast matching of PCR product amplified from phage genome with C1
and C2 primers ( Fig- ) have been shown similarity (63%- 92 % ) among
different HIV subtype (B, D, O, SMM, 10_CD, MAC, 01_AE, BF1, A,
A1, U, 33, 01B, 02C, 02_AG and BF ) in HIV data base. Interestingly,
data has shown that phage genome of our collection have 80% similarity
with HIV-1 envelope glycoprotein (env) gene, rev protein (rev) and tat
protein (tat) genes , 63% similarity with vpu genes , 73% pol genes and
76% similarity with gag genes (Fig-42 ). Ac2 and Sc2 primers have
highlighted the segments on phage genome which has shown 82-86%
similarity with partial Ns3 and poly protein genes, respectively. PCR
product raised by Ac2 primer has shown 64% similarity with env gene.
BLAST matching of PCR product amplified from the template of
Pseudomonas phage genome with primers of HCV (Table-27) have
exhibited the similarity among different HCV genotype in HCV database
(66%-74% with 1a,2a,1b and 2b) (Fig-41 ) . HIV-1 QuickAlign analysis
of PCR product raised by phage PS5 has shown, primer C1 has
highlighted the segment 224nt, which has homology with 5’-LTR of HIV-
1. The LTR region of HIV-1 genome is known to be highlight
polymorphic among different genetic variants of the virus. Similarly
primers Sc2 has shown a stretch of 227nt match with Pol gene of HIV-1
and primers Ac2 has highlighted the segment of 131nt related to env gene
of HIV-1 (Table-27).
Vancomycine PCR product analysis:
Van Y:
On PCR product raised by Y primer, the stretch of 14nt
(AAGACAATTACAGA) has 100% homology with 14 bp stretches
present on different location of Staphylococcus aureus MRSA252. All
these location were corresponding to genes for rRNA-23S ribosomal
RNA. This motif in phage genome may play regulatory role at the level of
translation during its stay in host. (Table-20) Similarly stretch of 13 nt
motif of PCR product by Y1 has shown 100% identity with putative cell
division protein, peptidyle-tRNA hydrolase and rRNA-23 ribosomal RNA
on Staphylococcus aureus MRSA25 chromosome (Table-20). Y1 primer
was highlighted 2 motifs of (GATGCTGCCCGGGGTTGCGG) and
(TGCTGCACGGGGTGCCGGC) on PCR product of phage genome ,
these motifs impilicated the GC rich functional region in the phage
genome, which have 90% and 94% identity with hypothetical protein and
integral membrane efflux protein respectively. These motifs were share
100% similarity on 10 nt of their sequence on Streptomycis genome .Y1
primer has shown 2 motifs of 19-22 nt which were present on different
location on phage genome and chromosome but were related to genes for
integral membrane protein in Streptomycis. (Table- 26)
BLAST result of PCR product of van Y has shown significant existence
of motifs of 13-25 bp of phage genome to 13-793bp related to membrane
protein of Staphylococcus aureus MRSA252 and Enterococcus faecalis
V583. Short motifs of 15-33 bp have shown 94 % identity to 15-981 bp
Streptomycis chromosome. (Table-19)
Van B:
BLASTn result of PCR product raised by van B primer , 2 stretches of 16-
15 nt (CACGCATGATGTTCAA), (TGTTCAATATAATTT) and 3
stretches of 15-18nt with van B1 primer (TGTTCAATATAATTT),(
ATTAATACAACCCGATCA ) and ( GCAAGCAATAAATTTTCT ),
100% identity were highlighted at different location of Enterococcus
faecalis V583 chromosome corresponding to ABC- transporter ATP-
binding/permease protein (Table-17). Interestingly ABC-transporter
protein genes were highlighted with primers van S, van S1, van B and van
B1 (Table-17) at different position on phage genome and have shown
100% homology on Enterococcus faecalis V583 chromosome.
Van B,B1 primer highlighted 2 motifs of 22-23 nt (
AGGACATACGTTTGTTGAAACAA) ,
(GGACATACGTTTGTTGAAACAA) correspond to peptidyl-tRNA
hydrolase protein and 15 nt stretches of (CGTTTGTTGAAACAA)
related to genes for Triphosphoribosyl-dephospho-CoA synthase has
show 100% identity repeated twice on phage genome but same location
on Enterococcus faecalis V583. Several 15-30 nt AT rich signatures were
highlighted correspond to hypothetical protein on Enterococcus faecalis
V583 chromosome which have shown 83-100% identity with PCR
product raised by van B primer.
BLASTn comparison of PCR product of phage raised by van B primer
and Staphylococcus aureus MRSA25 chromosome were highlighted
single stretch of 12 nt ( TGACGACCAACA ) represented genes for
putative cell division. Similarly primers van B and B1 highlighted 13,14nt
motifs of (CCAACATGGACAA) and (CCAACATGGACAAC), 100%
identity which were at same location of Staphylococcus aureus MRSA25
genome and different location on phage genome correspond to
Sodium:alanin symporter family protein.
Van B primer highlighted 15nt signature of (TGAATCATTACACAC)
with 100% identity corresponding to cobalamin synthesis protein/P47K
family protein genes on different location on phage genome and
Staphylococcus aureus MRSA25 chromosome. Similarly gene for
mannitol-1-phosphate 5-dehyrogenase has got 100% identity with 13,14
nt ( CATACATTTCTCCTT),(ATAAACCCAAAGAC) located at 2
different position of PCR product of phage genome and Staphylococcus
aureus MRSA25 chromosome.
Van S:
Van S primer highlighted 19 nt ( AAGCAACTTTTGCAAAAAA) , 94%
identity correspond with ABC-transporter in Enterococcus faecalis V583
chromosome . van S,S1 primers has shown 2 stretches of 14nt
(CATATGCTGGTGCA),(TGCTGGTGCAGATG) 100% identity
present on same location on Staphylococcus aureus MRSA25
chromosome and different position (11 nt different) on phage genome.
Van R:
BLASTx and BLASTn analysis of PCR products highlighted by van R
and R1 primers was indicated that, 2 stretches of 29nt , 83% identity, 2
stretches of 64nt , 78% identity, 2 stretches of 120 nt , 67% identity , 2
stretches of 65nt , 71% identity and 2 stretches of 33 nt , 79% identity
represented of genes for DNA-binding response regulator on chromosome
of Enterococcus faecalis V583. Comparison of BLAST matching of our
data has proved a stretch of 19 bp on PCR product highlighted with van S,
van B and Y1 primers at the 826-844 nt(
AAGCAACTTTTGCAAAAAA) position on phage PS5 genome has
similarity with the motifs of different gene on the chromosome of
Staphylococcus aureus MRSA252, Enterococcus faecalis V583 and
Streptomycis i.e. Glycine betaine transporter 2 in Staphylococcus aureus
MRSA252, ABC-transporter, permease protein in Enterococcus faecalis
V583 and integral membrane protein in Streptomycis respectively .(
Table-19).
1
Discussion The isolation of lytic bacteriophages infected Multiple Drug Resistant (MDR) E.coli and Pseudomonas strains provide an opportunity to characterize the newly isolated bacteriophages and to determine their host range, life cycle and genetic characteristics. The phages isolated in this study fell into two categories with respect to source of isolation (sewage or clinical specimen) and hosts, all phages originally isolated from E.coli or Pseudomonas species. Initially all isolated phages in this study were detected by plaque assay on lawn of the respective bacterial hosts. The plaques were then screened for the ability to lyse both original and isolated (sewage and clinical specimen) strains of MDR bacteria (App. II) as additional bacterial host. (Table- 4-12)(Fig-1-10) Phages observed to cause the lysis of MDR Pseudomonas or E.coli hosts were used in onward experiments i.e. characterization and identification of genome nucleic acid and protein profile of capsid. In this study phage lysates, M84, M85, M86, M87, M88, M89, M90, M91 and M92 (App-I) were virulent on Ps.a, P7 and P3 grown on enrichment media and seems specific for the MDR hosts (Table-7). The volume of this thesis, based mainly on the work with phages isolated from clinical specimen (Urine sample) of 24 years old athlete lady patient of urinary tract infection. E.coli was detected as etiological agent of UTI infection. No Pseudomonas was detected. Our curiosity warrants us to further proceed by using the Pseudomonas spp. as bacterial lawn for detecting the Host-phage interaction. Plaque assay of filter sterilized urine sample on the lawn of Ps5 and Ps6 exhibited enormous clear plaques due to lytic activity. These phages were prorogated as virulent phages in MDR Pseudomonas aeruginosa. (Table- 6) To classify the phages into morphotype group, particles in different lysates prepared in Pseudomonas were examined by transmission electron microscope. Electron micrograph of U1 and U2 lysates prepared in Ps from active disease urine indicated the presence of mixed phages. (Fig-14A) Base on morphological characteristic, phages appear to be a typical member of the Myoviridea and Siphoviridea family. Literature has documented that ,member of Myoviridea family represent some of most common characteristized phages of Pseudomonas species (298)has been characterized as double-stranded DNA phages, like P2 (299). Electron micrograph of lysate U1 has indicated the presence of high titer of empty headed small particles as well (Fig-15A). Presumably these particles seem to be killer particles refer to bacteriocin (Fig-20). Presence of 3 different type of particles in the lysates U1 and U2 were grown in Pseudomonas has indicated the correlation and compatibility in Siphophage, Myophage and bacteriocin mean , all these are belong to same compatibility group and inter-dependents as far as their morphogenesis is concerned . Absence of Pseudomonas in Urine sample was a significant feature to think of two possibilities:
2
i- The relation of theses phages with E.coli as initial host and possible inducing agent that may induce these temperate phages which then infected the secondary host i.e. Pseudomonas.
ii- Absence of Pseudomonas in urine, refer to virulent activity of these Фs which cause complete disintegration of Pseudomonas.
Clear plaques on the lawn of Ps. were detected in the presence of urea induced E.coli-N lysate (Table-5)(Fig-8). This warrant us to investigate about some more possible inducing agents present in vivo. Since urea and uric acid are components of urine and may cause the induction of indigenous infectious agents present in urinary tract and vagina, in this pretext chemical and physical agents such as UV, tetracycline , uric acid, urea and human serum as inducing agents were consider for experimentation, that induction could be due to either one of this agents. We used tetracycline because patient had been using this therapeutics antibiotic. It is documented in literature that, temperate bacteriophages possess a dual mode of existence, able either to lyse sensitive cells or to form stable lysogen in which the phage genome is propagated as prophage by bacterium, with phage lytic function repressed by one or several phage repressors (313). The induction mechanism for lysogeny known as SOS response which designed to cope with the inducing treatment in order to repair the damaged DNA and restore the replication. Other stress responses of the bacterial cell, abandon a host in physiological difficulty. (-) Activation of temperate phage with diversified inducing agents may occur through different pathways. UV can elicit the SOS system of bacteria, in response to DNA damage and tetracycline can inhibit the protein synthesis of bacteria and may cause the induction. Similarly presence of antibiotics in serum can affect the metabolic functions of Gram-negative bacteria while uric acid was considered as non significant inducing agent. It is interesting to note that urea induced lysates of E.coli-N (App-I) were produced turbid plaques on the lawn of respective hosts but were strongly positive on Ps.a, P5, P6 and P7 (Table-5). Based on inducing agents and plaque morphology collectively, we can presume that more than one type of phage were identified that they were temperate for E.coli-N but either one of them seems to be virulent for Pseudomonas .spp( App-II). The implication of these observations is, E.coli-N seems to be high frequency lysogen whereas Pseudomonas aeruginosa strains are indicator host for the temperate phages of E.coli. To confirm the presence of active phage of E.coli-N in urine, lysate was propagated by using the urine as phage source in E.coli40MD (ATCC strain, F- ∆Pro lac, trp-, rpsl, Smr, thi) which was consider virgin as not to be harbored with any Ф. When lysate of E.coli40MD (untreated with urine ) was used no plaque formation was seen on Pseudomonas spp. this control experiment was compared with the lysate of E.coli40MD prepared by using induced lysate of E.coli-N by serum (U7) and clear plaques were observed on the lawn of P6. It is notable that, urine of patient did not contain any Pseudomonas. We used Pseudomonas spp. from our lab collection (App-II). All Pseudomonas spp. used for
3
examination, were explored for existence of indigenous temperate phages and presence of bacteriocin. We found that urea can induced strains P5 and P6 (P5urea, P6urea) and clear plaques were produced on the lawn of P5 and P6 (Table-12) (Fig-5). Several studies (-) has proved that, lysogenic phage induction is usually consequences of DNA damage. However, in all cases, it results from the destruction or inactivation of phage repressor. Our data demonstrated that, the indigenous temperate phages from pathogenic E.coli are able to infect and grow virulently in Pseudomonas aeruginosa. Furthermore phages belong to Myoviridea and Siphoviridea both can grow concurrently in the same host like Ps. It seems that both of them belong to same compatibility group of phages. However, to enter a host cell, phages attach to specific receptors on the surface of bacteria, lytic growth phase of E.coli phages in Ps reflected its potential that Ps. and E.coli-N may share common receptors for Myophage and Siphophage, and E.coli-N phage can absorb and cable to evade nuclease of Ps. and propagate in it virulently. Another possibility is that this Ф may have ability to interact with more than one receptor in the respective host. Although it has been documented that, many bacteriophages are known to be highly specific for host receptors and show little or no interaction with receptors with an even slightly different structure (301). In E.coli, the outer membrane proteins OmpA, LamB, PhoE and also the flagella and fimbrial proteins flagellin, FimH and PapA have been used to display peptides or proteins on the cell surface, the best-documented example of phage attachment is lambda receptor which is restricted for the surface proteins and only fused to LamB(302). In contrast, it is clear that some bacteriophages do productively infect a range of bacterial species.(303) Most bacteriophages attach to the cell wall, but there are other cell receptors on the pili, flagella or capsule of the host. It has been documented (303) that most of tailed bacteriophages attach to the cell wall and do so by tip of their tails. And some such as phage χ and PBSI attached to flagella. Phage receptors on Gram-positive bacteria are usually associated with non proteinaceous components of the cell wall (304-309). Pip is an exception to the norm for Gram-positive phage receptors. Other than S-layer or flagellar proteins, it is known plasma membrane-associated protein that acts as a phage receptor on Gram-positive bacteria (301). Even c2-species lactococcal phage apparently adsorb to carbohydrate receptors before or concurrently with Pip. (311) It appear that multiple receptors for a single phage are common among Gram-positive bacteria (310) the cell wall receptors for two 936-species lactococcal phage,sk1 and kh, is rhamnose and other sugars commonly found in the cell was of L.lactic. Recently, genes involved in the synthesis of cell wall carbohydrate have been identified and found to be required for adsorption of 936-species phages bIL 170 and Ф645(312). Identification of receptor and its chemistry elucidation was not the objective of this research project. Nevertheless, presumably one of the above mentioned subcellular ligand could be the choice for E.coli phage to enter into its host bacteria. Another persistently observed feature was the emergence of the micro colonies distinctively present on the lawn of Ps.a, P5 and P6 during plaque and spot assays with almost all lysates (Fig-1-10). The appearance of phage-resistant micro colonies on the lawn of strains Ps.a, P5 and P6, suggested that some cells of host bacteria have
4
developed strategies to cop with the attack of certain phages. It was speculated that occurrence of phage-insensitive cells may be due to the possible formation of lysogen. However, all attempts to produce any detectable phage particle from phage resistance colonies were failed. In contrast when normal colonies of P5 and P6 were treated with urea in the context of induction these lysate produced clear plaques on the lawn of respective strains (Fig-5) P5urea phage morphology was different (Fig-19) P5urea was not used further in this study. Urea induced E.coli-N (U9) lysate was used to raise lysate P5 and P6 strains of Ps. aeruginosa called U9P5 and U9P6. Small clear and large clear plaques were exhibited on the lawn of P5 and P6 by these lysates (Fig-6). U9 lysate was produced small turbid plaques on the lawn of E.coli-N. Data generated in this project was by the use of these lysates. Result of proteins profile from lysates U1, U2 and U9 phages active on Pseudomonas are presented in (Fig-12) these results allow us to conclude that lysate U1, U2 have similar profile, however in U1 one additional band was present. The band intensity is variable for U9 though same for lysate U1 and U2. (Fig-12) It is noteworthy that, southern blot results have confirmed that DNA from lysate U9 has no homology with DNA probe of PL5 Ф and PS6 Ф. Hybridization with DNA probe of PL5 Ф and PS6 Ф has indicated the homology in the DNA of U1 and U2, U9P5 and U9P6 and PL6 Фs. No homology have found with lambda genome (Fig-22). Indigenous phage of P5 (P5urea) and P6 (P6urea) has shown no relation with DNA probe of PL5 Ф and PS6 Ф (Fig-22C). Interestingly the DNA of M84, M87, M90, 97, H2, H3 and K3 have shown homology with DNA probe of PL6 Ф (Fig-22C,22D). These results reflected the relation among these phages. Since we have isolated these phages from sewage of different locations of city, and E.coli as a common enteric bacteria essentially present in sewage, therefore existence of these phages in sewage has further strengthen the notion that PL5 Ф and PS6 Ф phages are the lytic phages of Ps. has relation with E.coli as well. P5urea and P6urea have shown no homology with PS6 Ф, this indicated that P5urea and P6urea are temperate phages of P5 and P6 (Fig-5). This has implicated that indigenous temperate phages of Pseudomonas (P5urea, P6urea) and U9 lysate are different from PS5 Ф and PS6 Ф phages, P5urea and P6urea also were not induced by E.coli Ф(U9). Epidemiological surveys demonstrated that the majority of the clinical isolates contain prophages (314, 315) many bacterial genomes deposited in the public database contain phage DNA integrated into bacterial chromosome. It is not rare for bacteria to contain multiple prophages in their chromosomes, which then constitute a sizable part of the total bacterial DNA. The most extreme case is currently represented by the food pathogen E.coli 0157:H7 strain Sakai, it contains 18 prophages genome elements, which amount to 16% of its total genome content. Less extreme but still impressive case are represented by Staphylococcus pyogenes with four to six prophages, amounting to 12% of bacterial DNA content (316). However, phages that are less well documented with respect to genome sequence can also integrate their DNA into the bacterial chromosome. One would expect competition and exclusion between prophage during the establishment of a poly lysogenic cell (317)
5
Since Southern blot has indicate the absence of relation between U9 and amplified Фs of Pseudomonas i.e. PS5, PS6, PL5 and PL6. However U9 lysate produce strong clear plaque on the lawn of P5 and P6 bacterial strains in multiple attempts of plaque assays (Fig-8) and these plaques are reproducible. This experimental data implicated that E.coli-N urea induced lysate U9 contains more than one phage (Fig-16). Similarly Pseudomonas aeruginosa strains P5 and P6 are harbored with more that one phages as well. (Fig-17, 18) It is interesting to note that single plaque (small and large each) amplified lyate electron micrograph has indicated the presence of mixture of particles. Lysate PS6 has exhibited Myoviridea like phage i.e P-SSM4 in addition to phage with double capsid. (Fig-17B) similarly PS5 contained Myoviridea like with small empty head particles (Fig-17A). Electron microscopic observation has confirmed the presence of Myophage in both strains. The relative proportion of Myophage is high in P5 strain whereas the ratio of double layer capsid phage is relatively high in P6 (Fig-17). The single plaque of variable size on the lawn of P5 and P6 in reality contains the combination of phages. Initially based on plaque size we considered 4 lysate PS5 (small plaque), PL5 (large plaque), PS6 and PL6 respectively. But DNA restriction profile of these 4 lysates represents 2 phages. Because PS5 and PL6 have exhibited identical restriction profile (Fig-33) similarly PL5 and PS6 profile is identical (Fig-33). Therefore these profiles were referring to the genomic DNA of the phages which are in high number in the respective lysates i.e. P5 and P6. PS5 refers to Myophage and PS6 refer to double layer capsid. (Fig-17B) In nutshell our experimental data has proposed that, E.coli-N urea induced lysate (U9) and urine contain a temperate phage of E.coli which not only infected the Pseudomonas but also cause induction of its phage in both strains P5 and P6. This is supported by electron micrograph of U9 which has indicated the presence of phage particles belong to Podoviridea (Fig-16B) and the relative proportion of Siphoviridea is high. Therefore U9 lysate DNA correspond to this phage which has no relation with PS5 and PS6 DNA. It is justified to hypothesis that Podoviridea phage may cause the induction of Pseudomonas phage. Hence PS5 Ф and PL6 Ф are same, whereas PL5 Ф and PS6 Ф are identical. These were identified on the base of restriction enzymes profile (Fig-33) and southern blots (Fig-22). In southern blot probe was prepared by DNA eluted out from the gel for PL5 Ф and PS6 Ф. This single band highlighted the two bands in the lysates of U1 and U2 (Fig-22, lane-3, 4). The electron microscope has indicated the presence of Siphoviridea and Myoviridea like morphology in the lysates. Interestingly U1 and U2 were raised directly from urine whereas PS5 and PS6 lysate were raised from U9 (E.coli-N lysate). PS6 Ф has shown Myophage like particles (Fig-17B). Electeromicrograph of urine has indicated 3 type of particles ( Fig-14). Similarly electron microscopy of U9 lysate has indicated the presence of two type of particles (Fig-16). Finally all lysates electron microscope analysis has confirmed the existence of polylysogenic status of these bacterial strains .i.e. E.coli-N, P5 and P6. Phages in P5 and P6 have exhibited different restriction profile (Fig-33), therefore are two different phages. Rest of the experiments of this project was done with PS5 Ф and PS6 Ф. All above experimental data lead to the hypothesis that E.coli-N lysate U9
6
contain same phages which may be present in urine as well as cause the induction of Pseudomonas virulent phages P5 and P6. In order to understand correlation of their genetic materials, DNA was isolated from lysate phage and digested with EcoRI, Bam H I, Msp I, Hpa I, Hpa II , Hind III and Cla I, Dra I (Fig-33). Interestingly, restriction mapping of PS5 Ф and PL6 Ф have shown that these two phages have identical sites for Dra I, Hpa I, Hpa II, Msp I, EcoR I, Bam H I, Hind III and Cla I(Fig-33). PS6 Ф and PL5 Ф have shown identical restriction profile for Dra I, Hpa I, Hpa II, Msp I, EcoR I, Bam H I, Hind III and Cla I (Fig-33). Restriction analysis indicating that PL5 Ф and PS6 Ф, PL6 Ф and PS5 Ф and U9 have no similarity (Fig-33) but restriction profile of PL5 Ф and PS6 Ф are identical. Similarly PL6 Ф and PS5 Ф have shown identical profile. Hpa II was the only enzyme that all four amplified Фs have shown similar pattern (Fig-33). Our experiments provide clear evidences for two important implications. First hexagonal headed and T4 like phage particles are different in capsid, tail size and shape are residing in Ps. and repressed as temperate phages and induced by E.coli phage. Secondly these phages adopt lytic mode of life in Pseudomonas host. Restriction analysis elucidated the nature of these phages and provided an enhanced understanding of the archetype of them and to broaden our molecular understanding of their genetic structure and to facilitate the future molecular detection of isolated phages of our collection. It has been studied that bacterial DNA contains immunostimulatory motifs if it is consisting of unmethylated CpG motifs. (332). These motifs rapidly triggered an innate immune response, by the production of IL-6, IL-12 and IFN-gamma. Since DNA vaccines are usually prepared from plasmids of bacterial DNA. Therefore we examined the presence of CpG motifs in genome of PL5 Ф, PS6 Ф, PL6 Ф and PS5 Ф and U9 in order to confirm that CpG motifs present in these phages genome may contribute in immunogenicity of DNA vaccines. However restriction profiles of Msp I and Hpa II has indicated that E.coli Ф(U9) DNA , Ps Ф(PS5) and 3S E.coli phage isolated from sewage DNA have got several unmethylated CpG motifs sites(Fig-33). In order to assess the immune response to phage DNA vaccine, immunization of a group of rabbits and Balb/c mice were carried out using intramuscular and intrapertonal rout respectively. Each group was containing five animals. Immunoelectrophoresis of antiserums raised by U9 and PS5 Ф DNA vaccines have shown strong line of precipitation near cathode which proved that high quantity of IgG was produced in both groups of animals which immunized with Ф DNA vaccine (Fig-24). Existence of increased level of IgG antibody against antigens of S.typhi has presumably concluded due to the activation of B cells in Mice and Rabbits.(Fig-24) Our finding is consistent with documented literature (333) that CpG motifs in DNA sequence has direct immune stimulatory effects on B cells. These sequences may cause up-regulation of MHC II, B7 and B7.2 collectively. We can conclude that CpG motifs contain Ф DNA can activate B cels in mice and rabbits. A large body of
7
evidence on isolated B cells demonstrated that the effect of CpG motifs on B cells are direct in nature (333). In this study whole S.typhi antigens were used as vaccine for immunization of the animals. Comparison of ELISA results of sera from immunized rabbit (Fig-26) and Mice (Fig-29) has indicated that CpG motifs in phage DNA vaccine appeared to stimulated the enhanced immune response as compare to animals immunized by exclusive killed S.typhi cells and these along with adjuvant. ELISA of immunized mice sera have confirmed high immunogenesity of phage DNA vaccine by increasing the high quality of IgG-Fab specific (Fig-28) as compare to Ig-G-Fc specific (Fig-27) the reason for strong bond in Fab specific reaction was due to multiple interaction sites for antigen and antibody. Comparison of Western blotting results of immunized mices has shown significantly enhance yield of γ-globulin-Fab against Vi and Lps antigens and low yield of H antigen were observed in animals immunized by Ф DNA vaccine. After addition of mineral oil in DNA vaccine, significant amount of Ab against H antigen were being produced. Ps. Ф DNA vaccine elicited the immune response against all S.typhi antigens whereas E.coli Ф DNA vaccine exhibited strong immune response against Lps antigens (Fig-31). We presumed that low molecular weight of S.typhi antigen may refer to Lps, which may enhance the production of all 3 type of antibodies in immunized rabbit and mice. B cell activation by CpG DNA shows strong synergy with signaling through the B cell receptor, such as stimulatory effect of CpG DNA would tend to promote the development of antigen-specific immune response against associated antigens, which would be of obvious teleological benefit (333). In the present study IgG-Fab/Fc were used as secondary antibodies for immunized mice and sera, in order to determine the specifity of IgG fragments, Fc fragment has shown less specifity to Vi and Lps, compare to Fab since antibodies were strongly has further confirmed the specific humeral response in mices. Subsequent assays for determination of specific antibody response in immunized mices with Fab and Fc fragments of IgG as secondary antibodies by ELISA and Western blotting have shown perfect correlation. It has been shown(334) that Fc fragment does not bind to Ags but act as initiation of the complement cascade, a process that lead to lysis of the target cells or mediates phagocytosis(334). Comparative study has indicated that, stimulatory effect of E.coli Ф(U9) DNA and Ps Ф(PS5) DNA contains CpG motifs in rabbit and mice has shown a shift toward the B cell activation response. Based on these results, it can be hypothesized that CpG motifs has implicated enhanced B cell activation. These result demonstrated that comparable B cells less than Ps. Ф DNA. This difference in immune response may be due to associated with Hind II restriction profile of Ps. Ф DNA indicated the existence of additional CpG motifs (Fig-333) consequently pronounced IgG yield. Based on out results, responses both quantitively and qualitively were observed in animals immunized by DNA vaccine. This means protection level and also adaptive immunity might enhance by CpG contained Ф DNA administration. Our finding are consistent with similar studies, has proved activation of innate immunity by exposing mice to the single does of CpG DNA provide long-term protection (for 2 weeks ) against multiple pathogens, including Listeria monocytogenes, Francisells tubarsis,
8
Anthrax, ebola, malaria, Leshmania and Schisoma (335). In current study we were unable to check the prolong protection effect of immunized animals due to scarification of them for antisera. However this study demonstrates, for the first time, that CpG motifs in phage genomes are efficacious as imunostimulants in mice and rabbit, number of studies indicated Cpg-motifs have been effective in controlling intracellular protozoa, bacteria and viruses. This is the first report showing CpG-motifs-contain phage genome to be effective against bacterial disease in animal models. Comparative band intensity in western blot has shown, Ф DNA adjuvant vaccines have quentitive relevance to relatively high yield of IgG against all Ags of S.typhi (Fig-31, 32). Presumably it is related to antigen retention activity of mineral oil which could be one of the reasons for prolonged immune response. It has been documented (335) the protection offered by CpG DNA against pathogen challenge can be sustained past five weeks if the CpG DNA is administered in a formation providing some sustained released, such as alum. Thus exposure to CpG DNA engenders a relatively long-lasting state of broad –spectrum immune resistance against lethal from selected bacteria, virus and parasite. (335) Our study provides clear evidence that, not only on the superficial infection, lytic phages can be locally applied but also can be used orally in systematic infections. It is interesting to note that CpG motifs of ϕ DNA may have potential to enhance efficacy of antimicrobial therapies and DNA vaccine development. C1, C3 primers present in the lab collection were used contingently to highlight the PCR product from amplified phage genome. Presence of discrete bands of 640-1169 bp (Fig-33) (Table- 14) warrants us to evaluate any possible genetic or serological relation between phage and HCV. In order to confirm these possible serological cross-reactivity/relation between phage and HCV +ve antisera, ELISA and PCR was performed. Among the various immunological tests for detection of antibody that have been developed for diagnosis of hepatitis C the most widely used is the ELISA test, which is an inexpensive and simple method. Therefore, we considered the establishment of an ELISA for detection of binding of HCV antibody protein with purified phage particles as an antigen which has not been reported by other investigators. Interestingly HCV positive control available in the kit has shown strong reaction on phage coated plate (Fig-30). This encouraged us to look for the substantial evidence for cross reactivity. Therefore 100 HCV positive sera were used in this study and it was found that 83% of HCV positive sera tested were reacted to the phage coated
9
plate. This value is comparable to validity of HCV antigen coated plate. It has been shown that presence of antibodies in HCV positive sera is highly correlated with respective antigens Core/NS as indicated with ELISA (Fig-30) Similarly the range for Pseudomonas aeruginosa cross reaction with HCV positive sera (Fig-30) was found to be in 30% sera. A plausible reason for high Pseudomonas cutoff value for a HCV +ve serums (OD=0.13) could be attributed to invasive Pseudomonas aeruginosa secondary infection in that patients. However correlation between the HCV antibodies titer and high cutoff value due to phage lysate had been exhibited (Fig-30). This feature has further strengthened the antigenic relation between phage and HCV in addition to secondary infections of Pseudomonas in the HCV patients respectively. Antigen antibody reaction is highly specific in some cases, but antibodies elicited by one antigen can cross react with unrelated antigen. Based on ELISA, our finding suggested that, serological relation between cascade (NS3, NS5, and Core) was exhibited cross-reaction with Ps. phage(PS5 Ф). The enhance ELISA cutoff value of phage lysate compared with Pseudomonas has been exhibited significant cross-reactivity of HCV antibodies and phage antigens. High cut off value for cross reaction between phage antigen and 83% of HCV samples seropositive has reflected the possible sequence similarities between antigen determinant region in HCV genome and phage genome. The HCV 5’-UTR specific primers and universal primers (Ac2, Sc2, A5 and S7) were used to highlight the genome segment of Pseudomonas phage (PS5ϕ) (Fig-33).These PCR products warrants us to see the possible genomic relation between HCV and phage. PCR products raised by HCV specific primers were sequenced (Seq.-2) and was confirmed by QuickAligment data have exhibited the similarity among different HCV genotypes in HCV database (1a, 2a, 1b, 2b, … )(Fig-41). Genelocator software has highlighted reverse complement of nucleotide position (Similarity 90%) on 3’-UTR, 5’-UTR and NS3 region of H77 (shown as red bar in Fig-43). According to preliminary data HCV 3’-UTR binds various cellular proteins such as the 52kDa La autoantigen, the 57kDa polypyrimidine tract-binding protein, and other proteins (335). This region is involved in RNA replication of HCV genome. Result of a cross-reactivity triggered by antigenic region at residue on NS3 and Core of HCV genome and 104-640bp of Pseudomonas phage genome. We conclude that, strong reactivity of HCV antibodies and Pseudomonas phage antigens have conformational epitopes located on NS3 region and also because of the conservation of residues essential for antibody binding. Many investigators have demonstrated that following the injection of an antigen, antibodies specific for the antigen and immunoglobulins without apparent specificity are synthesized during the course of the ensuing immune response. (236) The cross reactivity is exhibited due to sharing of antigenic determinants by two unrelated microbes, for example, most studies, have detected the presence of antibody reactive to a recent cloned host derived antigen GOR is highly correlated with the presence of antibody to HCV positive patients. Not merely due to sequence homology but also due to cross reactivity at the molecular level.
10
Antibodies against GOR1-125, which translated in humans, have been detected in some individuals but without an association with HCV infection. (336) Similarly the sequence of the GOR (GOR47-1) epitope has partial homology with the HCV encoded core protein sequence. (337) . In this study, we are for the first time reporting specific sequence recognition of phage genome has identified similar epitopes on HCV antigen and on the Pseudomonas phage PS5 Ф surface antigens. Epidemiological data show that many HCV-infected patients are coinfected by HIV. Despite their remarkable differences, HIV and HCV share common characteristics (genetic, replicative, and pathological) that make real their interaction and facilitate the exacerbation of their related diseases.(338) Parallels of HCV with HIV include positive-sense single-stranded RNA genomes of >9500 nucleotides in both cases, persistence of the virus, genetic diversity during replication in the host, and the utility of combination treatment that is just now being appreciated with HCV infection. It has been reported that hypervariable region of the NS1 protein of HCV may share similarities with the hypervariable region of the envelope protein of human immunodeficiency virus (HIV).(338) In present study, results of C1 and C3 pair primer and individuals primer has highlighted non structural 3’-UTR and 5’-UTR related to regulatory region of HCV genome respectively. And also nonstructural region of NS3 has been highlighted by Ac2 primer.(Fig-41-5) Serological tests and sequencing have shown that Pseudomonas phage (PS5 Ф) share similar antigenic epitops with HCV genome. This similarity warrants us to see sequence similarity of phage and HIV genome, since co-infection of HCV/HIV has been noticed worldwide. In has been documented that, in HIV patient antibodies made against the env gene protein that appear to be the most important, these antibodies neutralized the envelope glycoprotein that seem to be an essential part of HIV’s infecting process. However, it is the env gene that is subject to fragment mutations, producing HIV with different envelope glycoprotein within a given individual. (338) HIV-1 QuickAlign analysis of our PCR product raised by PS5 Ф has shown, primer C1 has highlighted the segment which has homology with 5’-LTR of HIV-1. (Fig-42) The LTR region of HIV-1 genome is known to be highlight polymorphic among different genetic variants of the virus. Similarly primers Sc2 has shown match with Pol gene of HIV-1 and primers Ac2 has highlighted the segment related to env gene of HIV-1 (Table- 27)(Fig-42-4) We can hypothesis that ELISA positive results were due to presence of NS3 cascade of epitops which was provided in the kit of ELISA. Serological cross-reaction of Ag-Ab was found to be related to presence of NS3 and this was further substantiate with HCV-QuickAlign analysis of PCR products (Fig-33) .ClustalW alignment of PCR product raised by Ac2 and retrieved NS3 sequence has confirmed that this homology is present close to N-terminal of NS3 region we can predict that genome of phage PS5 may code a protein may have similar N domain of NS3 that may have catalytic activity as protease.
11
Interestingly PCR product raised by Ac2 primer has highlighted the product from PS5 Ф which produce 2 band (Fig-33, lane-3); data analysis of 1st band has shown similarity with 3’-UTR of HCV genome. We predict that this similarity is related to highly conserved X-region of 3’-UTR which contribute to efficient translation stimulation. Second band of this PCR product (Fig-33, lane-3) raised by Ac2 have shown a stretch of 128 nt similarity with NS3 region of HCV genome. Nonstructural protein NS3 is an essential component of HCV replication complex. NS3 protein is a protease that mediates NS2/3 cleavage. Based on our result we can predict that isolated PS5 Ф may have got regulatory machinery similar to HCV type translation-regulation. This similarity of phage translation-regulation regions and regulatory 5’-UTR and 3’-UTR of HCV was substantiate by QuickAlign and Genelocator analysis of our lab designed non-HCV primers(Reverse and Forward)(Table-27) which has shown variable matched size of PS5 Ф and 5’-UTR and 3’-UTR regulatory region of HCV genome (Fig-33) Based on computational analysis, i.e.3’-UTR and 5’-UTR homology with HCV, we can predict that Pseudomonas aeruginosa genome share similar regulatory stem and loop structure or common functional domain with HIV/HCV genome which can facilated protein-protein interaction between prokaryotes and eukaryotes. Furthermore, serological cross reaction and PCR (just rely on PCR product without sequencing) may lead to wrongly diagnosed as HCV/HIV infection. A normal individual having this phage may have received interferon or antiviral drug. Diagnosis should be strictly based on HCV antigen detection and sequence analysis of PCR product. It should be noted that presence of phage in an individual could be one of the reason for false positive serodiagnosis of HCV/HIV. This phage genome segment could be used in vaccine against HCV or HIV for prophylaxis as well as therapeutic purpose to control the HCV or HIV prevalence. It worth to note that, 5’-UTR and the extreme end of the 3’-UTR have the lowest sequence diversity among various genotype and subtype. The relatively conserved nature of these regions significant in their functional importance in the viral life cycle. (339) QuickAling and Genelocator analysis of PCR products of Ф genome raised by HCV 5’-UTR specific primers have highlighted region of phage that has similarity with domain I and II of 5’-UTR of HCV genome (Fig-43, 44). This Untranslated conserved region is involved in viral RNA replication which plays an important role in translation as well. It has been documented that, 3’-UTR of HCV varies between 200 nt and 235 nt long, which typically consist of three distinct regions, in the 5’to 3’ direction , a variable region a poly (U/UC) stretch and a highly conserved 98nt X-region(340). Similarly QuickAlign and Genelocator have shown the similarity of PCR products of phage genome and 3’-UTR of HCV genome. (Fig- 44) Data analyses of our results have shown that, this similarity is related to conserve X-region of 3’-UTR and through it.
12
It has been known that 3’-UTR sequence particularly the X-region , is involved in the regulation of translation, much in the same way as the poly (A) sequence in the mRNAs of other RNA viruses(341). Based on BLAST, QuickAlign and Genelocator results, we can assume that existence of similar stretches of phage genome and 3’-UTR and 5’-UTR of HCV may have implication for the initiation of RNA replication and regulation of translation. Presumably PS5 Ф has similar mode of translation which required IRES for ribosomal and mRNA interaction. Primers Ac2 was highlighted the segment of 128nt from PCR product of phage genome (Fig-33) which has similarity with N-terminus of NS3 region on HCV genome. The one third of serine protease of NS3 contains the protease activity which could be excellent targeted for a structure-base drug design approach. Another interesting feature was, most of the primers used in this study have highlighted the segments of phage genome which have similarity with 3’-UTR of HCV genome (Fig-43, 44) this comparative analysis confirmed that PS5 Ф have got the flexible region on genome which is similar with 3’-UTR IRES of HCV RNA which is involve in the cap-independent translation. Another exciting feature of Pseudomonas lytic phage of our study was to have similar stretch in its genome with HIV a eukaryotes virus. HIV-1 QuickAlign analysis of PCR product raised by phage PS5 has shown, primer C1 has highlighted the segment 224nt, which has homology with 5’-LTR of HIV-1. The LTR region of HIV-1 genome is known to be highlight polymorphic among different genetic variants of the virus. Similarly primers Sc2 has shown a stretch of 227nt match with Pol gene of HIV-1 and primers Ac2 has highlighted the segment of 131nt related to env gene of HIV-1. (Table-27) Interestingly, QuickAlign alignment analysis of PCR products raised by R and S primers of van target genes has shown significant similarity with 3’ UTR of HCV 1a H77. PCR products raised by C1 and C3 HCV Primer have shown similarity with 3’ and 5’UTR of H77. Whereas Ac2 primer has highlighted a similar segment on NS3 region of H77 and has shown extensive alignment with HIV-1 genome (Table-27) Quickalign analysis has indicated that C1, C3 primers were highlighted the region on Pseudomonas phage genome which has shown similarity with 5’-UTR of HCV genome (Fig-41) PCR product of phage PS5-C1 has shown a stretch of 197 nt homology with 5’-UTR related to conserved structural domains I, II and partial domain III while PCR product of phage PS5- C3 has shown a stretch of 43nt homology from 5’-UTR of HCV genome represented the conserved domain I of 5’-UTR. (Fig-41) Domain I is involved in RNA replication but not essential for translation; therefore, the function of this region is distinct from the rest of the 5’-UTR (domain II-IV) which mediated the translation of HCV ORF. Horizontal transfer of genetic material between distantly related prokaryotes has been shown to play a major role in the evolution of bacterial genomes, but exchange of genes between prokaryotes and eukaryotes is not as well understood (342) and it can not be ignored.
13
In this pretext, studies of retroviruses could be the best example which led to the first demonstrated synthesis of DNA from RNA templates, a fundamental mode for transferring genetic material that occurs in both eukaryotes and prokaryotes. It has been noted that, retrovirus infection, introducing additional viral oncogenes into the cells, transforming proteins which convert normal cells to tumor cells (343) Retroviruses are unusual amongst animal viruses in their capacity to integrate into host genome and be transmitted vertically to host progeny. Vertebrate genomes contain numerous and diverse retrovirus-derived sequence reflecting a long co-evolutionary history during which genome invasion has occurred repeatedly, with wide-ranging evolutionary consequences (344). The idea that viruses played a crucial role in the evolution of placental mammals is pretty nifty, but this is just the best-investigated case and there is circumstantional evidence suggesting that retroviruses have been involved in other major evolutionary innovations too. For instance, it turns out that eukaryotic DNA polymerase bear a closer structural resemblance to viral DNA polymerase that they do to those of eubacteria, suggesting that perhaps the genes of DNA viruses were recruited in the evolution of eukaryotic cellular machinery. (345) Reverse transcriptase activity outside of retroviruses has been found in almost all eukaryotes, enabling the generation and insertion of new copies of retroviruses into host genome. Recent advances is understanding the molecular relation of host-pathogen and their interactions which are highlighted the role in microbial evolution and could play a significant role in the emergence of bacterial pathogens. The vast majority of host-pathogen interactions involve protein-protein interaction therefore role of domains are critical for protein functions. Based on computational analysis, i.e, 3’-UTR and 5’-UTR homology with HCV. We predict that Pseudomonas phage genome share similar antigenic epitope or common functional domains with HIV/HCV genome which can facilate protein-protein interaction between prokaryotes and eukaryotes. The exchange of gene between phage and virus can be visualized by this scenario. HIV/HCV patients are prone to any infections. Pseudomonas is a very common etiologic agent of UTI, respiratory and other infections. Therefore a human body of HIV/HCV patient could be the reunion site for these prokaryotes i.e. phage and virus for the exchange of genetic material. Generalized transduction by phage can enhance the chances of viral fragmented genome to be captured in phage genome. Another plausible mechanism is illegitimate recombination provide the mean of genetic mixing between .phage and virus in human /animal cell background. Illegitimate recombination is the characteristic feature of Retro and transposable phages. These flexible nucleic acids defiantly have their own modification to evade the nucleases of the host. We proposed that fluxes of genetic material between prokaryotes and eukaryotes can not be rule out. Recombination and Transposition are the main process to catalyses this exchange survival of naked eukaryotic DNA can be replicated in prokaryotic background and vice versa. Bacteriophages provide one of the most efficient vehicles for moving DNA sequences between bacterial cells. One consequence of transduction is disseminating sequences
14
that allow bacteria to become more pathogenic and antimicrobial drug resistant (346, 350). Phages can transduce resistance to imipenem, aztreonam, and ceftazidime in Pseudomonas aeruginosa (349), methicillin in Staphylococcus epidermidis (350), tetracycline in S. aureus (348) and Actinobacillus actinomycetemcomitans (347). They can also transduce resistance genes from Salmonella enterica serovar Typhimurium DT104.(346) Actinobacillus actinomycetemcomitans (Aa) strain ST1 carries the tetracycline (Tc) resistance transposon Tn916 and the Aa phi ST1 prophage, which is closely related to temperate bacteriophage Aa phi 23.(351) Two wild-type bacteriophages AP-2 and AP-12, have been isolated and propagated from two multiple drug resistant strains of P. aeruginosa. Both phages were found to transduce Imipenem- (IMI), Aztreonam- (AZA) and Ceftazidime- (CTZ) resistance as well as resistance determinants to other drugs.(352) P1 phage infects and lysogenized drug- resistant E.coli and several other enteric bacteria. Ronsor made use of the P1 CM a strain that harbors the unstable Tn9 transposon encoding chloromphenicol acetyltransferase acquired from R factor (353) additionally, sequences of T4 genome about Tn5 a well-studied transposable element show that this phage consist of three drug resistant genes.(334) Analysis of the genome sequences of bacterial pathogens can expeditiously reveal whether virulence factors are associated with phage-like DNA sequences regardless of whether they are transmissible. For example non transmissible (221) stx genes in Shigella dysenteriae are adjacent to lambdoid phage-like sequences interrupted by numerous insertion sequences, suggesting that the toxin genes lie in prophage that has been rendered defective by the insertion sequences(221). Moreover, transduction of a virulence gene is , in and of itself, insufficient evidence that the gene resides in a phage genome. Generalized transducing phages can package and transmit any chromosomal locus, and specific interaction between generalized transuding phages and chromosomal virulence genes have been described. For example , the Staphylococcus aureus pathogenecity island Sap II, which contains the gene for toxic shock syndrome toxin(tst) , is mobilized at high frequency by the generalized staphylococcal transducing phage 80α (221); a similar mechanism has been ruled out for the transmission of the V.cholerae pathogenecity island(VPI) which was reported to correspond to the genome of a phage .(221) In order to explore any cassette related to antibiotic resistance we used range of primers which were available in our lab. Vancomycin is a potent glycopeptide antibiotic that has been used exclusively for the treatment of Gram-positive bacterial infections for over 30 years (-).Whereas this glycopeptide antibiotic is ineffective for Gram-negative bacteria. Therefore in order to elucidate the reason for ineffectiveness, Van specific primers were used to determine the relevance. In this study, phage DNA was purified and to identify the genes responsible for antibiotic resistance a PCR- based experiment was used for detection of van resistant genes family by using set of primers (Van A, Van B, Van C, Van H, Van S, Van Y, Van R, ORF A, ORF 2E, ORFID , 1546, S-1216). Interestingly, some primers based on van sequences e.g. van A, van B, van S, van Y, ORFID, 1546 & S1216 , amplified the DNA of Pseudomonas phage PS5 yielding fragments of different size (Table-15). We used ClustalW, a global sequence alignment algorithm, which assumed that PCR products of phage PS5 by Van family of primers are sharing some similar nucleotide stretches over their entire length.
15
Similarity between PCR amplified product of PS5 phage genome and sequence database was assessed by use of BLAST programs. In order to determine nucleotide and amino acid sequence similarity BLASTn and BLASTx were used respectively. This analysis demonstrated that, results of BLASTn have identified similar stretches with PS5 phage located on genome of Staphylococcus aureus MRSA252, Enterococcus faecalis V583 plasmid pTEF2 and Streptomyces coelicolor A3 (2) present in NCBI database. Van A gene cassatte is present on transposon Tn1546, a mobile genetic element containing genes responsible for high-level glycopeptide resistance among enterococci and several other gram-positive organism (356) Tn 1546 is composed of nine genes: van A, van R, van S, van H and van X are required for expression of resistance. Interestingly, vanA gene, corresponding to D-alanine-D-lactate ligase was not highlighted by primer specified for Enterococcus faecalis ligase gene, but when primer 1546 was used, PCR product of 707bp was amplified. BLASTn result of this PCR product has indicated, 3 stretches of 22-224nt with the range of 72-86% identity were highlighted at different location of Enterococcus faecalis V583 chromosome corresponding to D-alanin-D lactate ligase protein (Table-19). It has been documented, presence of D-Ala-D-Lac ligase leads to the production of modified peptidoglycan that precursors with reduced affinity for glycopeptides and hence, resistance (357). PCR product highlighted by van B primer demonstrated the 100% identity of four 113 bp stretches of phage genome with 13 bp motif of Staphylococcus aureus MRSA252 genome represented 1-phosphatidylinositol phosphoecliesterase a phosppholipase C specific for phosphoinositides, accruing in all tissues. Similarly 114 bp stretches of phage genome has shown 100% identity with 12 bp of Staphylococcus aureus MRSA252 genome related to LysR family regulatory protein, and super antigen-like protein 7 of Staphylococcus aureus MRSA252 genome. BLASTn analysis of this PCR product has shown the sequence similarity with various proteins on the Enterococcus faecalisV583 chromosome as well. (Table-21) ABC transporters are widespread among living organisms and comprise one of the largest protein families. It has been documented that ABC-transporters are found in all species and are evolutionary related. ABC transporters are responsible for target export and import of variety of allocrites across the cytoplasmic membrane or capsular polysaccharide in gram-negative bacteria. (358) Our result have shown that phage PS5 has share similarity with membrane protein (transport protein) like ABC-transporter protein in Enterococcus faecalis V583 (Table-17 ). ATP-binding cassette (ABC) transporters are widespread among living organisms and comprise one of the largest protein families. For example, components of ABC transporters are encoded by approximately 5% of Escherichia coli and Bacillus subtilis genome (358) these transporters are found in all species and are evolutionarily related. However, they are functionally diverse and have roles in a wide range of important cellular functions. ATP-binding cassette (ABC) proteins of both eukaryotic and prokaryotic origins are implicated in the transport of lipids.(358)
16
ABC transporters are remarkably conserved in terms of the primary sequence and the organization of the domains or subunits. Characteristically, ABC transporters have a highly conserved ATPase domain (the ABC, also known as nucleotide-binding domain) which binds and hydrolyzed ATP to provide energy for the import and export of a wide variety of substrates (or allocrites).(359) The ABC contains two highly conserved motifs, the walker A and walker B motifs, which together form a structure for binding ATP.(360) The ABC protein super family functions range from the acquisition of nutrients and the excretion of waste products to the regulation of various cellular processes. Generally, ABC proteins are low capacity, but high affinity transporters, able to transport substrates against a concentration gradient of up to 10 000 fold. Hydrolysis of ATP is required for substrate transport. (361) In bacteria, ABC transporters have a diverse range of functions that may be required in response to the environments in which different bacteria find themselves. They import a variety of allocries, including sugars and other carbohydrates (362), amino acids (363), peptides (364), polyamines (365), metal ions (366), sulfate(367), iron (368) and molybdate(369). ABC transporters are also responsible for the targeted export of other allocrites across the cytoplasmic membrane (for example, capsular polysaccharide (370) in gram negative bacteria). Other exporters are responsible for the secretion of antibiotics in some extracellular toxins. Members of another class of ABC systems have roles in cellular process, such as translational regulation (371) and DNA repair. (372) Seven signature sequence of FVENVF, -PLFGQFI, TSYIK, PSIVW- , VRTTS, -LCWAS and RSLFKP were identified on ABC-transporter protein of Enterococcus faecalis V583 (Table-17). All these amino acid are found to be hydrophobic in nature except E and N. these signatures are different from Walker A and human ABC signatures. Presumably these signatures reflected the relation with Walker B sequence. As there pattern seems to be closed to “hhhhD” motifs where “h” stands for hydrophobic. Our data suggested that Pseudomonas lytic phage has some protein which has partially similar structure to ABC_ transporter with Walker B motifs. Existence of these unique signature sequences once in different ABC-transporter in Enterococcus faecalis V583 and phage genome has reflected the presence of some functional domain on these proteins which has not yet been identified and their function need to be elucidated. It can be presumed that phage can modulate the uptake system of host by coding membrane transport protein. In order to enhance nutritional requirement and biochemical potentional of host and up taking the variety of allocrities during the lysogen stage of phage which are important for phage survival and morphogenesis. Similarly UniProtKB/TrEMBL and JCVI Gene annotation analysis has highlighted the motifs related to alcohol dehydrogenase by vanB primer (Table-22) Oxidation-reduction is an important regulator of various metabolic function of cell. Comparative data analysis of our phage indicated that presence of motifs (Table-24) related to alcohol dehydrogenase domain on phage genome can encode for energy production by phage genome and can be tool of phage for additional energy providing oxidation-reduction systems. Presence of this domain may play a functional role in the phage that can benefit phages by temporarily optimization of functionality before lysis.
17
In this study, comparative analysis of PCR products Pseudomonas phage genome and database gives us a new window into phage-host interactions and their evolutionary implication. Presence of alcohol dehydrogenase domains in phage genome has indicated the independency of phage in evolutionary tree and indicated that phage is fully equipped with genetic tools that it can not only dictated its host biochemical machinery for its own morphogenesis but also make it capable for molecular interaction with eukaryotic cells BLASTx analysis of PCR products highlighted by van S, S1, Y,Y1, B, B1 and Tn1546 primers on genome of phage PS5 has shown significant similarity with different gene on chromosome of Staphylococcus aureus MRSA252, Enterococcus faecalis V583 and Streptomycis (Table-19). Highest degree of similarity has indicated the relation S, S1 PCR product with sensor histidine kinase, the gene located on PCR product by van S and S1 has exhibited 85% similarity with Tn1546 sensor protein. (Table-19) In Tn1546 ,Van S and Van R comprise a two-component regulatory system for transcriptional activation of the genes van H, van A and van X (374, 375) two-component regulatory systems are signal transduction pathways commonly used by prokaryotes to sense and adapt to stimuli in the environment (376). As many as 50 different system may exist in a simple bacterium such as E.coli, as well as other bacteria (377, 378) in addition, analogous signal transduction pathways have recently been identified in eukaryotic organisms including Yeasts (379, 380), Plants (381) and Neurospora(382). These systems are characterized by a sensor kinase (often a trans membrane signaling kinase such as van S ),which under atuophosphorylation on the histidine residue , and this phosphoryl group is then transferred to an aspartate residue on a response regulator protein ( in this case van R ), which usually acts as a transcriptional activator.(376) VanS has an N-terminal domain with two transmembrane-spanning segments believed to act as a signal sensing domain and a C-terminal cytoplasmic “transmitter “ domain with autophosphorylation and phosphotransfer activities (377). Sensor kinase and response regulators of two-component regulatory systems share extensive sequence similarities to other family members, even of phylogenically distant species (377). These sequence similarities probably lead to structural similarities that are responsible for cross- reactivates between sensor kinase and response regulators of different systems (376). This phenomenon, called “cross-talk” has been observed in vitro and it has been implicated in complex phenotypes in vivo. (383, 384) Results of this study have shown that, genome of phage PS5 has signal transduction system. In order to determine the origin of this system, Pseudomonas aeruginosa phage genome was explored by applying softwares . BLASTn comparison has indicated the absence of such signal transduction system on genome of Pseudomonas aeruginosa, therefore it can be concluded that this system may be acquired by phage from some transposons, which can be shuttle between Gram-positive and Gram-negative host background. Presumably phage PS5 is capable to manipulate the genetics regularor of host by this signal transduction system provided; compatible genes are located on the host. Based on our data we can predict that R/S complex of Pseudomonas lytic phage may derived or aquired from transposon Tn1546 In this study another significant feature was the presence of long stretches of 113 bp on PCR
18
product of phage genome raised by van S and van B primer and short stretches of 13bp motifs on Staphylococcus aureus MRSA252 chromosome have shown 100% similarity on gene related to different proteins (Table -20). In order to determine the possible location of functional protein on PCR products raised by primers vanS, S1, B, B1, R1 and R2, sequenced PCR product were analyzed by UniProtKB/TrEMBL and JCVI Gene annotation. The PCR products raised by S, S1 and R1, R2 further contain coding information for Histidine kinase i.e sensor and response proteins (cross talk) system. Phage coded histidine kinase is mainly related to Tn1546 coded gene (Fig-44). However it is more similar to Staphylococcus aureus MRSA252 gene and it is less similar to Enterococcus faecalis V583 and Streptomycis (Table-19). Comparative bioinformatics data analysis has indicated the existence of functional domains (Table-23) similar to HATPase_c, NtrB, PAS and HisKA of Enterococcus faecalis V583. Similarly in addition to these USP_OKCHK and KdpD domains were shared from Staphylococcus aureus MRSA252 histidine kinase. PCR product raised by R1 and R2 contain coding information for signal receiver, Effector response regulator and OmpR; response regulators domains of Enterococcus faecalis V583 (Fig-23) Prokaryotes S/R comprise a two-component signaling systems considering of Histidine protein kinase that sense a signal input and a response regulator that mediates the output , are ancient and evolutionarily conserved signaling mechanisms in prokaryotes and eukaryotes(385). Presence of Histidine kinase and response regulator domains on phage genome can provide facility for phosphorylation process which required to trigger cross-talk between sensor kinase and DNA-binding response regulator of host cell. We can predict that presence of Histidine kinase and response regulator in Pseudomonas phage indicated that phage can assist Pseudomonas to interact with human or animal cells. Pseudomonas phage genome contains cross-talk system and this system activates signal transduction of host cell as well. Due to presence of S/R domains and similarity to human domain i.e F-Box protein, NcK-associated protein and CCR4-NOT transcription complex, which are the domains corresponding to growth, chemotaxis and transcription in Homo sapiens (Table- ). Our data suggest that, existence of these domains in addition to other functional domains in phage coded cross-talk system is capable to transduce the signals in eukaryotic cells. This interaction of phage and eukaryotes very likely possible, if infectious agents i.e Pseudomonas is harboring with this phage during the course of infection in animal or human body and play a role in pathogenesis and mutualism benefits for Pseudomonas to acknowledge enrich nutritional assistance from eukaryotic cells in human or animal background. It can also be implicated hypothetically that phage can interact by itself with the help of these domain to eukaryotic cells or facilitation of signal transduction in the cell. Presence of such functional domain in phage coded protein implicate self reliance ability of phage .although a group of contemporary scientist are doubtful about the status of phage to be as an organisms, these domains existence on phage coded proteins has provide the evidence of evolutional and functional independency to
19
provide the confirmation for phage to be an organism. Presence of these domains related to its host interaction with eukaryotic cells highlighted the fact that this phage is fully equipped with molecular tools which can optimize these metabolic pathways of its host which are required for vegetative growth/lytic cycle of the phage. Phages can activate the signal transduction of host required for DNA syntheses hence its replication will be facilated. Furthermore, Van S, S1, B and B1 primers were highlighted stretches of 13-14 nt contains A, T tracts (Table-20 ). It has been documented that, presence of intrinsic curvature in DNA because of the presence of specific base sequences has functional importance. Sequence-induced curved DNA is present in the replication origin of bacteriophages lambda and an autonomously replication sequencing of Yeast (386). We can presume that, PS5 phage genome has super helicity due to presence of poly A-T tracts. UniProtKB/TrEMBL and JVCI gene annotation analysis of Y primer has highlighted the significant match, although the primer Y was targeted for carboxylase gene of Enterococcus faecalis but sequenced PCR product of phage genome by Y primer contain coding information of RNA polymerase (60% ), 40% similarity in polC_OBF, POLIIIAc, DEDDh exonuclease and DNA_pol3_alpha of Enterococcus faecalis 583 (Table-24) and 47% similarity with NarY domain of Staphylococcus aureus MRSA252 genome located at 1-519nt of PCR product of phage genome. Small stretches close to 5’ end on 5-67nt of PCR product raised by vanY primer have shown 43% similarity in EntF,AMP-binding, NRPS, PP-binding and LuxE domains of Streptomycis genome(Table-24) Interestingly, although we have used range of primers (App -IV) and PCR product which were highlighted by van S, S1, B, B1, Y, Y1(Fig -33 ) among these, the product which completely matched was S primer product , which has shown similarity with Histidine kinase enzyme and this enzyme coded by our phage genome. Whereas the Van B gene primer highlighted the PCR product of phage genome which has no similarity with ligase enzyme. Several motifs of this PCR product have exhibited structural resemblance with ABC-transporter protein of Enterococcus faecalis V583. (Table-17) BLASTx comparison of PCR products of phage genome raised by ORF-2E,ORF-2E-1 primers and Enterococcus faecalis V583 chromosome were highlighted , 6 stretches with 21%-36% identity corresponding to resolvase family site-specific recombinase (Table- 19). Similarly ORFID-1 and ORFID-2 primers highlighted 7 stretches with 25-35% identity represented to resolvase family site-specific recombinase. (Table-19) PCR product of phage genome raised by S1216 specific primer was highlighted 7 stretches, 93% identity on Enterococcus faecalis V583 chromosome representation of genes of IS1216 traspoase. (Table-19) It has been known that, presence of IS elements accounts for much of the heterogeneity. Until recently IS1216V, IS1542, IS1251 and IS1476 were reported in VanA VRE. IS1216V is known to be ubiquitous in VanA elements. Whereas the other three IS elements appear to be geographically restricted. (387) It has been documented (388) that IS1216V insertion has been characterized in vanX-vanY intergenic region of VRE. We didn’t check the presence of vanX gene on phage genome and vanY primer was not highlighted the carboxypeptidase gene but PCR product of VanY has shown significant existence of motifs of 13-25bp related to
20
membrane protein of Staphylococcus aureus MRSA252 and Enterococcus faecalis V583. If we sum up all the fundings related to PCR product and respective genetic traits, this study provide the evidence, that lytic phage of Pseudomonas aeruginosa (phage PS5) genome contains a composite transposon which was evolved from combination of IS1216 and 1546 transposons since phage genome contain a vanA cassette for vancomycin-resistance derived from IS1216 represented by genes of IS1216 transpoase and regulatory complex van S/R of histidine kinase which was derived from Tn1546. While VanB primer product has shown relation with ABC-transporter protein. It is interesting to note that, conserved and consensus sequence similarity has been found in phage genome and ABC-transporter protein. (Table-17) Our findings suggest that evolving site for new strains of phages is human body especially gut provide an ecosystem for genetic mixing of phage and different bacteria(Gram-positive and Gram-negative) are the numerically predominant in human colon and may act as very important reservoirs for resistant genes. Our analysis of phage genome has implications not only for phage fitness but also evolution of hosts, there are evidence that phages may have mediated horizontal gene transfer between host and phages could have implications for evolutionary of both hosts and phages and it may represent a more general phenomenon of metabolic facilitation of host functions. We can predict that phage can not only dictate its host biochemical machinery for its own morphogenesis but also make it capable for molecular interaction with eukaryotic cells. PCR product analysis of the genome of our lytic phage provide the evidence that, this phages depend for a number of energy dependent functions and other uptake activities of their host bacteria during their vegetative growth or morphogenesis. ClustalW, BLASTn, BLASTx analysis of sequenced PCR products raised by van primers (Table-15) have shown that this phage carries composite cassette for vancomycin resistance trait. Our study has suggested that cross-talk system and partial vanA cassette were being acquired by the phage directly from Tn1546 originated form Enterococcus faecalis . Since BLAST analysis has shown 99% similarity of highlighted PCR product (Table-15) with Tn1546 present in NCBI database. PCR product of phage genome raised by IS1216 primers highlighted gene segment representation of IS1216 transpoase. S and R primers highlighted genes related to Histidine kinase, DNA-binding response regulators related to cross-talk system and also resolvase family site-specific recombinase on Enterococcus faecalis V583. Enterococcus specific vanA primers amplified a PCR product of 700bp that has shown no similarity with ligase. Interestingly Y and B primers represented Carboxypeptidase and ligase respectively, highlighted significant products of 807 and 1248 bp related to RNA polymerase and ABC-transport membrane protein of Enterococcus faecalis genome respectively. Evidence supported the fact that phage code RNA polymerase of its own. Transposae and Resolvase genes are essential for transposition. Presence of transposes and resolvase (Table -19) genes in phage genome indicated the status of Pseudomonas lytic phage as transposone-like phage. In contrast, transposable phages
21
have been isolated from Pseudomonas and D3112-like and B3 represented two major groups of Pseudomonas transposable phages. Genomic comparison of isolated Pseudomonas phage has shown no relation with previously isolated transposable-like phages, D3112 and B3. Transposons are flexible molecules which can move around to different positions within the genome, the evolution of transposon and their effect on genome evolution is currently a dynamic field of study. (389) It is known that, Tn1546 has been associate with VRE as Gram-positive host but interestingly our study has proved the Tn1546 associated genes in the genome of lytic phage of Gram-negative (Pseudomonas) host. These results lead one to wonder the correlation of presence of Tn1546 and IS1216-assosiated genes initially belong to gram-positive bacteria (VRE) and its presence in gram-negative bacterial (Pseudomonas) phage. The most significant question is about their origin and how these transfer events would have occurred? In this study, Pseudomonas phage was initially isolated from 24 year old female urine and our data have shown that the genome of this phage has significant homology with Tn1546. Early reports of very broad host range gene transfer events, e.g., between Gram-negative and Gram-positive bacteria, were viewed by many people as laboratory curiosities that could not possibly occur in nature (390). Our experimental data lead us to hypothesis that, horizontal transfer of genes between bacteria of different of species occurs easily and frequently in nature, even between bacteria that normally present in different sites. Previous findings are consistent with the hypothesis as it is documented that, alleles of ermF have been found both in oral Spirochetes and in human colonic Bacteroides species and alleles of ermG have been found both in colonic Bacteroides species and in a Bacillus species from soil (391). Alleles of tetM have been found in a variety of Gram-positive and Gram-negative bacteria (392, 393). Extensive literatures scanned has documented the status of Bacterioides sp. (e.g., B. acidifaciens, B. distasonis , B. gracilis, B. fragilis, B. oris, B. ovatus, B. putredinis, B. pyogenes, B. stercoris, B. suis, B. tectus, B. thetaiotaomicron, B. vulgatus, etc.) as a shuttle for exchange of genetic material between gram negative and gram-positive host in enteric environment. In contrast to this, our data indicated the status of Enterococcus faecalis V853 to be another shuttle organism for the fluxes of genes between gram-positive and gram-negative hosts.
Comparison of Tn1546 and Bacterioides (accession numbers - ATCC 43185) has shown no relation with phage genome. It has been documented that Enterococcus have been described as extremely hardy organisms capable of living in many mediums that would certainly kill other bacteria. They normally inhabit the bowls of mammals, they are found in soil, vegetation, and surface water, probably due to contamination by animal excrement (394) . Enterococci is a commmenasl bacterium present in gastrointestinal tracts of humans and are the numerically predominant in human colon. We can predict that Tn1546 directly derived from Enterococcus, the most substantial portion of human gastrointestinal flora, may act as very important reservoirs for gene transfer between Gram-positive and Gram-negative hosts in human ecosystem. It is worth to note that, sometimes transposons behave as discrete
22
unites of life and can invade RM system of bacteria. It has been documented that they are often linked with mobile genetic elements such as plasmids, viruses, transposons and integrons. The comparison of closely related bacterial genomes also suggested that, at times, RM genes themselves behave as mobile elements and cause genome rearrangements. (395)
In this study, bioinformatics analysis have shown that, percentage of identity of Histidine kinase, Tn 1546 and resolvase genes highlighted by PCR primers (Table-19) and different bacterial genome present in NCBI database was found between 75-100% . Our results provide convincing evidence for evolution and must have occurred via horizontal gene transfer. It is reasonable to assume the possible pathway of evolution of these phages from a common ancestor provided that their genomes were formed in genetically distant bacteria. Evolution requires genetic variation and in order for continuing evolution there must be mechanisms to increase or decrease this process. Horizontal gene transfer can be act as the mode for evolution. Horizontal gene transfer is intraspecies and interspecies exchange of genetic information and plays an important role in the evolution of bacteria. (395) three major mechanisms, transformation, transduction and conjugation provide bacterial populations with access to a “horizontal gene pool”, enabling them to rapidly respond to environmental challenges. (396) Furthermore, there is ample evidence for continued exchange of genetic elements between phages, bacterial genomes, and various other mobile genetics elements. (397) The analysis of protein domains and sequence motifs provides valuable information about the details of protein functions and interaction as well as insights into evolutionary biology. In order to highlight the GC rich segments and/or CpG island in phage genome, restriction site based primer pair was design in our lab and used to amplify the segments in the genome of Pseudomonas phages and E.coli phages. Highlighted PCR product by Reverse and Forward primers were sequenced and have shown homology (Fig-56-61) with diversified group of organisms. Existence of similar stretched of nucleotide sequences in the genome of E.coli phage and Pseudomonas phage has reflected not only phylogenetic relation but also confirmed the genome evolution. BLAST comparison of U9 Ф(in our collection) PCR product raised by designed primers of Reverse and Forward has highlighted similarity of U9 Ф genome and several membrane protein (i.e. major facilator transporter, glycosyl transferase, lipopolysaccharide biosynthesis, outer membrane usher, phosphatidylethanolamine binding protein, transferase/phosphorylase , intimim type gamma and drug efflux) (Table- ). Similarly PCR product of 3S phage (in our collection) genome has shown similarity with variety of E.coli cell wall protein (UDP, N-muramate alanine ligase , DNA repair Rec N and recombination and repair protein) (Table- ) of E.coli strains of NCBI databank (Table- ). BLAST analysis of E.coli phages provide the evidence that U9 and 3S phage genomes belong to Myophage family may have share some domain with E.coli host related to membrane and cell wall proteins respectively. PCR products highlighted by Reverse and Forward primers of another phage (PAK phage) of our lab collection, previously isolated in our lab (By shamila-data unpublished) has shown more than one band (Fig-33) and interestingly BLAST analysis of forth band has shown homology with SAM domain (Fig-47) . Sterile alpha
23
motif (SAM) domains are known to exhibit diverse protein-protein interaction modes. SAM domain is a putative protein interaction module present in a wide variety of proteins involved in many biological processes. The SAM domain that spreads over around 70-amino acid protein sequence that participates in protein-protein, protein-lipid, and protein-RNA interactions and is conserved from lower to higher eukaryotes. They can form multiple self-association architectures and also bind to various non-SAM domain-containing proteins (398). The SAM domain can potentially function as a protein interaction module through the ability to homo- and hetero-oligomerize with other SAM domains.(398) This extended data suggests that, presence of SAM is indicated that, SAM can have role in evolutionary conserved protein binding domains that is involved in the regulation of numerous processes among prokaryotes and diverse eukaryotes. Another interesting feature in this pretext was presence of radical SAM domain proteins highlighted by PCR product of PAK Ф and PS5 Ф raised by reverse and forward primers .We explored the similarity view of SAM domain of Pseudomonas aeruginosa LESB58 (GeneID:XM_001276480) and PAK Ф and PS5 Ф PCR product by BLAST and ClustalW(Fig-47 ). This comparative analysis has indicated 99% and 84% similarity with Ps. aeruginosa LESB58 respectively. Based on the catalytic mechanisms revealed from studies on a few radical SAM enzymes , they all share one common feature, an unconventional [4Fe-4S] cluster coordinated by three rather than four closely spaced cysteine residues in a CxxxCxxC
motif .(399)
In addition to demonstrating that the radical SAM domain contains essential motifs to coordinate the [4Fe-4S] cluster and cofactor SAM, is essential for the antiviral activity of viperin. (399)Viperin is identified as an antiviral protein induced by interferon
(IFN), viral infections, and pathogen-associated molecules (399) Viperin was initially identified as a human cytomegalovirus- and IFN- -inducible protein in fibroblasts (399). Since then, it has been shown that the protein can be induced by the infection of many other viruses, such as VSV, dengue virus, yellow fever virus, human polyomavirus JC, and HCV, in cultured cells and in vivo (399). The rapid and robust induction of viperin gene expression by a range of different viruses and its evolutionary conservation in vertebrates suggest that viperin is an important component of innate immunity against virus infections.
Moreover, our work, for the first time, provides strong evidence suggesting that PAK Ф and PS5 Ф are sharing identical domain similar to radical SAM domains in different organism in NCBI databank. (Fig-46) Previous studies (399) have reported that viperin is a putative radical S-adenosyl-L-methionine (SAM) enzyme and may indirectly inhibit HCV replication by inducing antiviral cytokines. In addition to demonstrating that the antiviral activity of viperin depends on its radical SAM domain, which contains conserved motifs to coordinate [4Fe-4S] cluster and cofactor SAM and is essential for its enzymatic activity.(399) Our findings suggest that presence of SAM domain in isolated phage genomes of our study, may have therapeutic potential to trigger the enhance activation of viperin as a novel antiviral pathway that works with other antiviral proteins, such as ISG20 and PKR, to mediate the IFN response against HCV infection.
24
ClustalW comparison of PCR product of PAK Ф and PS5 Ф raised by Reverse and Forward primers, which highlighted the SAM domain, has shown identical similarity in 3’ end of Pseudomonas SAM domain (GeneID: CAW30068) as prokaryotes (Fig-46) and 5’end and central region of Aspergillus clavatus NRRL 1 (GeneID:XM_001276480 ) SAM domain as eukaryotes (Fig-47). Presence of SAM domain in isolated phages can enable them to have role in diversified functions of host cell. Similarly Forward primer highlighted the segment of phage PS5 genome related to ATP-dependent DNA helicase Rep of different strains of Pseudomonas spp. presence of this protein in phage genome, may have role in gene expression of phage host genome as well. Another interesting feature of BLASTn analysis of this study was, similarity of segment of PS5 Ф genome highlighted by Forward primer and sulfotrasferase family of Homo sapiens. (Table-21) it has been known that sulfotransferase enzymes, catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and exenobiotic compounds. These cytosolic enzymes are different in their tissue disturbiutions and substrate specifities. Our results provide the evidence that presence of region on lytic phage of Pseudomonas (PS5 Ф) may have role to encode the gene related to phenol sulfotransferase with thermolabile enzyme activity. Bioinformatics facilitate the advancement of molecular biology by getting access to databanks. Therefore it becomes easy to predict and anticipate the genetics and biochemical potential of on organisms. The present study has described analysis genetic and biochemical function of isolated phages by our lab with the help of application of different software. Data analysis has provided evidence that PS5 Ф as lytic phage of Pseudomonas and E.coli phages of collection of our lab are potential candidate for phage therapy. PS5 Ф genome contain functional domains coded by this phage for interaction eukaryotes, involve in immune response, antimicrobial activity and healing process. In addition to have CpG motifs which is strongly stimulatory for innate/adaptive immunity responses. Interestingly PS5 Ф has shared conserved and consensus sequence similarity with ABC- transporter proteins which are commonly present in wide range of prokaryotes and eukaryotes. Based on bioinformatics analysis we can predict that not only PS5 Ф but E.coli Ф can also code some membrane proteins and influence the fluxes of nutrient and metabolites required for cellular function during phage lytic cycle in the host i.e. import and export of variety of substrates from host membrane. Another feature highlighted by PCR was LysR protein on phage genome. Presence of LysR may have role on autoregulatory transcriptional of host cell and may enhance activation of transcription of operons and regulons involved in fixation, oxidation or stress response of host cell Phage therapy is actually a revived idea and widely employed to treat various bacterial diseases both in human and animals; it is only recently that more rigorous assays have been performed. In summary, there are good reasons to believe that the use of phages for treatment of bacterial infections can be successful tools in acute and chronic infections. Our study provides the evidence that presence of CpG motifs of PS5 Ф and 3S Ф genomes can activate the immune response to antigen specially in systematic
25
infections ,in order to minimizing the chance of survival of pathogens by eliciting the production of protective antibodies ,in addition to lytic ability of phage and also enhance their usefulness as DNA vaccine. Existence of MHC-1 domains on PS5 Ф genome was another interesting added value feature of this phage for therapeutic purpose. Presence of MHC-1 may enhance the encoding of antigens expressed on T cell surface and may be used as a tool for enhancement of antibody response and facilate the adaptive immune response by maturation and activation of cytotoxic T cells in eukaryotes. Wound healing is a well-orchestrated dynamic process involving an intricate interaction between variety of growth factors and cytokines. Immune response genes among the late wound healing genes included several MHC molecules and complement component 1q.(400) Eukaryotes cells MHC-I proteins display antigens made by a cell, and are used to mount an immune response (400). Cytokines, produced by T-helper cells during healing process, act as messengers and send signals to cells to produce more MHC-I. Existence of MHC in phage genome may have far reaching implication in wound healing process in addition to activating a adaptive immune response. These values of a phage can strongly recommend this phage as a candidate for phage therapy. Also presence of MHC in phage genome may enhance the activation/co-stimulation of host cell MHC-1 and thus potentionaly enhancement of immunity. This process provide the biochemical cues necessary to activate cellular responses, including growth factor secretion, that is required for wound repair. Presence of R/S system domains on PS5 Ф can provide facility for phosphorylation process which required triggering cross-talk between sensor kinase and DNA-binding response regulator of host cell. Presumably PS5 Ф may have ability to manipulate the genetics machinery of eukaryotic host cell by signal transduction system provided, compatible genes on the host. Future investigation needed to be done because full knowledge of phage genome sequences would be more helpful to evaluate the possible complications or presence of harmful genes during phage therapy. Since phages may carry virulence factors or toxin genes as well. In our computational analysis of this study we observed that the number of PCR product raised by primers has a strong similarity with functionally unknown genes or proteins of different organisms. In this pretext, presence of studied functional domains in phage encoded protein implicate self reliance ability of PS5 Ф. In addition, combination of CpG motifs, ABC-transporter proteins, Lytic life cycle. We can introduce this phage as candidate of therapeutic tools for preventing of MDR Pseudomonas and E.coli infections. Pseudomonas aeruginosa is an etiological agent of serious infections in patients with burn wounds. Acute burn wounds cause a breach in the protective skin barrier and suppress the immune system, rendering the patients highly susceptible to bacterial infections. P. aeruginosa colonization of severe burn wounds and its rapid proliferation within the damaged tissues often lead to disseminated infections, resulting in bacteremia and septic shock (401, 402) and high rates of mortality and morbidity. Treatment of such infections is confounded by the innate and acquired resistance of P. aeruginosa to many antimicrobials (401). Multiple studies have
26
demonstrated the benefits of phage therapy for a variety of bacterial infections in animal model systems (403). In our investigation the efficacy of phage treatment in mice, after superficial infection with MDR P. aeruginosa, we found that simultaneous administration of phage PS5 on the animal was protect them against infection. Concerning the timing of phage treatment, our results showed that administration of phage 30-45 minutes after the bacterial challenge was effective. The scientific literature shows, simultaneous injection is the easiest method for examination of the antibacterial effects of phage or drug in vivo (404). Furthermore, the bacteria and the phage immediately transferred into blood. As this is thought to be the most suitable in vivo situation for the phage –bacterium interaction. (404) In an effort to enhance the phage treatment, a new phage, 3S Ф, was isolated , characterized , and tested against artificial E.coli infection in a mice model of intestinal and deep skin lesion with MDR E.coli infected mice was allowed to digest bacterial cells and developed diarrhea after 24 hr. mice was kept under observation, infected mice was lethargic and weak. Recovery of the animals was achieved by applying one dose of phage per day directly and continued for one week on the lesion and maintaining a continuous supply of phage in the drinking water. Convalescence of the animal has shown that 3S ϕ was active against systemic and local bacterial infections (Fig-35). Similarly skin burn lesion was infected by E.coli-N and U9 ϕ application was carry out after one week that infection was stabilized. Complete recovery was observed after one week treatment with U9 ϕ (Fig-39) The effectiveness of phage in treatment of experimental diarrhea caused by MDR E.coli and superficial infection in mice strongly suggested that MDR E.coli is susceptible for both oral and local application of this phage. Similarly U9 Ф was used as therapeutics for deep skin cut and burn lesion infected with E.coli-N, recovery was noticeable after 24 hr. of treatment (Fig-36). Treatment was confirmed on 3 days chronic lesion (Fig-37) and effectiveness of U9 Ф was observed by complete recovery of infected mices within a week. However, clinical trial conducted in Eastern Europe showed that oral phage enters the bloodstream (9), we assume that ϕ3S is easily tolerated by the host defense system and phage particles may remove from the circulatory system in a short period of time after lysing the MDR E.coli in infected mice . The possibility of bacterial resistance to phage is unquestionably an obstacle in the development of an effective phage therapy system (404). Data from the literature help to understand that, even if the bacteria develop phage resistance, new phage that can have lytic activity against respective host bacteria can be isolated. It is also possible to prepare a mixture of different strains of phages that can attach to different receptors may prevent the emergence of a bacterial-phage resistant during phage treatment. Furthermore, may be by genetic modification of therapeutic phage the broad host range of them can enhance.
27
Our results support the other investigators (405), that preparation of cocktail phage strains with different antigenicity can be more effective for phage therapy. In this study 3S lysate contain one type of phage (Fig-21) while U9 (Fig-16) and PS5 (Fig-17A) contained mixture of particles. We can presume that presence of mixture of phage and killer particles enhanced the effectiveness of phage therapy (Fig-34, 39) We also attempted to test the efficacy of ϕ PS5 and ϕ 3S on chronic bacterial skin infection (6 days old infection) of control mices. In these mices the lesion was not cleared by the innate immunity of the animals had shown healing by respective lytic phages. Results have been demonstrated that, complete recovery due to treatment with the phage-bacterium interaction has proved that phage therapy was successful even after establishment of infection. In all experiments, mices were recovered due to rapid bacterial lysis and no mortality was observed. Phage-treated mice, in fact, remained healthy, weeks after treatment. The above result become more convincing when examined in the context of numerous reports documenting phage efficacy in vivo against several bacterial species (405) including S.aureus (407), E.coli (408), P. aeruginosa (409) methacilin-resistant Staphylococcus aureus (404) and vancomycin-resistant Enterococcus faecium. (404) It has been recently emphasized that, during the retrospective history of using phage administration by different routs in several countries, there have been almost no report of serious complication related to their use (410) as phages are common entities in the environment and regularly consumed in foods, the development of neutralizing Abs should not be a significant obstacle during the initial treatment of acute infection, because the kinetics of phage action or lytic enzymes is much faster than production of neutralizing Abs by host (410). Our study provide clear evidence that, not only superficial infection lytic phage can be locally applied but also can be used in systematic infections. It is interesting to note that CpG motifs of ϕ DNA may have potential to enhance efficacy of antimicrobial therapies and DNA vaccine development. And little studied E.coli phages, to control bacterial infection shows therapeutic promise. Since the increasing of bacterial resistant to antibiotics is worldwide problem, use of these phages can be an alternative strategy to combat this threat. However, it is quite clear that the safe use of these phages as therapeutic tolls require complete information of their genome properties. Finally, our serological and bioinformatics analysis suggested that phage treatment is potential and useful tools for the treatment of Pseudomonas and E.coli infections. Given the encouraging results of these experiments, it may be useful to develop more sophisticated experiments that portray normal clinical situation and possible widespread use of phage treatment as clinical therapy for humans in Pakistan. Pronounced similarity in PCR product and Pol and env genes of HIV-1 genome has warrant us to determine precise relation of env gene with PS5 Ф genome.
28
Further studies will be required to finalized the candidacy of phage as a tool for therapeutic purpose on human and to evaluate any possible side effects. Pharmacokinetics effect of phage therapy and tissue tropism of phages used to determine the prolong clearance of phage from bloodstream of eukaryotes host and accumulation of phage in spleen or other filtering organ e.g kidney, liver, etc. where they remain for weeks cell will help us to better understand the molecular mechanism of phage-host interaction and then they can be use for phage therapy or candidates for co-therapy with antibiotics.
REFERENCES: 1-Hankin, E. H. 1896. L'action bactericide des eaux de la Jumna et du Gange sur le vibrion du cholera. Ann. Inst. Pasteur 10:511. 2-Samsygina, G. A., and E. G. Boni. 1984. Bacteriophages and phage therapy in pediatric practice. Pediatria 4:67-70. 3-Vieu, J. F., F. Guillermet, R. Minck, and P. Nicolle. 1979. Donnees actuelles sur les applications therapeutiques des bacteriophages. Bull. Acad. Natl. Med. 163:61. 4-Twort, F. W. 1915. An investigation on the nature of ultramicroscopic viruses. Lancet ii:1241. 5-Summers, W. C. 1999. Felix d'Herelle and the origins of molecular biology. Yale University Press, New Haven, Conn. 6-D'Herelle, F. 1917. Sur un microbe invisible antagoniste des bacilles dysentériques. C. R. Acad. Sci. (Paris) 165:373-375. 7-Bordet, J., and M. Ciuca. 1921. Remarques sur l'historique de recherches concernant la lyse microbienne transmissible. Compt. Rend. Soc. Biol. 84:745-747. 8-Twort, F. W. 1920. Researches on dysentery. Br. J. Exp. Pathol. 1:237-243. 9- Alexander Sulakvelidze,,* Zemphira Alavidze, and J. Glenn Morris Jr. 2001, Bacteriophage Therapy . Antimicrobial Agents and Chem. 45: 649-659 10- Summers, W. C. 1999. Felix d'Herelle and the origins of molecular biology. Yale University Press, New Haven, Conn. 11- Bruynoghe, R., and J. Maisin. 1921. Essais de thérapeutique au moyen du bacteriophage. C. R. Soc. Biol. 85:1120-1121. 12- Rice, T. B. 1930. Use of bacteriophage filtrates in treatment of suppurative conditions: report of 300 cases. Am. J. Med. Sci. 179:345-360.
13- Schless, R. A. 1932. Staphylococcus aureus meningitis: treatment with specific bacteriophage. Am. J. Dis. Child. 44:813-822. 14- Stout, B. F. 1933. Bacteriophage therapy. Texas State J. Med. 29:205-209.
15- Payne, R.J.H., Jansen, V.A.A.2001. Understanding bacteriophage therapy as a density-dependent kinetic process. J. Theor. Biol. 208:37-48
16- Weber-Dabrowska, B., Mulczyk, M., Górski, A. (2001)Therapy of infections in cancer patients with bacteriophages. CLIN APPL IMMUNOL REV 1:131-134.
17- Pirisi, A. 2000 .Phage therapy—advantages over antibiotics. Lancet 356:1418
18- Ho, K. 2001. Bacteriophage therapy for bacterial infections: Rekindling a memory from the pre-antibiotics era. Perspectives in Biology and Medicine 44:1-16.
19- Smith, H. W., and M. B. Huggins. 1982. Successful treatment of experimental Escherichia coli infections in mice using phages: its general superiority over antibiotics. J. Gen. Microbiol. 128:307-318
20 -Smith, H. W., and M. B. Huggins. 1983. Effectiveness of phages in treating experimental E. coli diarrhoea in calves, piglets and lambs. J. Gen. Microbiol. 129:2659-2675
21- Smith, H. W., and M. B. Huggins. 1987. The control of experimental E. coli diarrhea in calves by means of bacteriophage. J. Gen. Microbiol. 133:1111-1126
22- Smith, H. W., M. B. Huggins, and K. M. Shaw. 1987. Factors influencing the survival and multiplication of bacteriophages in calves and in their environment. J. Gen. Microbiol. 133:1127-1135 23- Anonymous. 1983. Phage therapy. Lancet iii:1287-1288. 24- Anpilov, L. I., and A. A. Prokudin. 1984. Preventive effectiveness of dried polyvalent Shigella bacteriophage in organized collective groups. Voenno-Med. Zh. 5:39-40.
25- Babalova, E. G., K. T. Katsitadze, L. A. Sakvarelidze, N. S. Imnaishvili, T. G. Sharashidze, V. A. Badashvili, G. P. Kiknadze, A. N. Meipariani, N. D. Gendzekhadze, E. V. Machavariani, K. L. Gogoberidze, E. I. Gozalov, and N. G. Dekanosidze. 1968. Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol. Immunobiol. 2:143-145. 26- Barrow, P. A., and J. S. Soothill. 1997. Bacteriophage therapy and prophylaxis: rediscovery and renewed assessment of potential. Trends Microbiol. 7:268-271. 27- Levin, B., and J. J. Bull. 1996. Phage therapy revisited: the population biology of a bacterial infection and its treatment with bacteriophage and antibiotics. Am. Naturalist 147:881-898 28- Soothill, J. S., J. C. Lawrence, and G. A. J. Ayliffe. 1988. The efficacy of phages in the prevention of the destruction of pig skin in vitro by Pseudomonas aeruginosa. Med. Sci. Res. 16:1287-1288 29- Soothill, J. S. 1992. Treatment of experimental infections of mice by bacteriophage. J. Med. Microbiol. 37:258-261 30- Soothill, J. S. 1994. Bacteriophage prevents destruction of skin grafts by Pseudomonas aeruginosa. Burns 20:209-211 31- Bogovazova, G. G., N. N. Voroshilova, and V. M. Bondarenko. 1991. The efficacy of Klebsiella pneumoniae bacteriophage in the therapy of experimental Klebsiella infection. Zh. Mikrobiol. Epidemiol. Immunobiol. 4:5-8 32- Bogovazova, G. G., N. N. Voroshilova, V. M. Bondarenko, G. A. Gorbatkova, E. V. Afanas'eva, T. B. Kazakova, V. D. Smirnov, A. G. Mamleeva, I. A. Glukharev, E. I. Erastova, I. A. Krylov, T. M. Ovcherenko, A. P. Baturo, G. V. Yalsyk, and N. A. Arefyeva. 1992. Immunobiological properties and therapeutic effectiveness of preparations from Klebsiella bacteriophages. Zh. Mikrobiol. Epidemiol. Immunobiol. 3:30-33 33- Abdul-Hassan, H. S., E. El-Tahan, B. Massoud, and R. Gomaa. 1990. Bacteriophage therapy of pseudomonas burn wound sepsis. Ann. Medit. Burn Club 3:262-264.
34- Lang, G., P. Kehr, H. Mathevon, J. M. Clavert, P. Sejourne, and J. Pointu. 1979. Bacteriophage therapy of septic complications of orthopaedic surgery. Rev. Chir. Orthop. Reparatrice Appar. Mot. 1:33-37. 35- Vieu, J. F., F. Guillermet, R. Minck, and P. Nicolle. 1979. Donnees actuelles sur les applications therapeutiques des bacteriophages. Bull. Acad. Natl. Med. 163:61. 36- Alisky, J., K. Iczkowski, A. Rapoport, and N. Troitsky. 1998. Bacteriophages show promise as antimicrobial agents. J. Infect. 36:5-15 37- Barrow, P. A., and J. S. Soothill. 1997. Bacteriophage therapy and prophylaxis: rediscovery and renewed assessment of potential. Trends Microbiol. 7:268-271. 38- Carlton, R. M. 1999. Phage therapy: past history and future prospects. Arch. Immunol. Ther. Exp. 5:267-274. 39- http://www.evergreen.edu/user/t4/phagetherapy/phagethea.html 40-Babalova, E. G., K. T. Katsitadze, L. A. Sakvarelidze, N. S. Imnaishvili, T. G. Sharashidze, V. A. Badashvili, G. P. Kiknadze, A. N. Meipariani, N. D. Gendzekhadze, E. V. Machavariani, K. L. Gogoberidze, E. I. Gozalov, and N. G. Dekanosidze. 1968. Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol. Immunobiol. 2:143-145. 41-Bogovazova, G. G., N. N. Voroshilova, V. M. Bondarenko, G. A. GorbatkAfanas'eva, T. B. Kazakova, V. D. Smirnov, A. G. Mamleeva, I. A. Glukharev, E. II. A. Krylov, T. M. Ovcherenko, A. P. Baturo, G. V. Yalsyk, and N. A. ArefImmunobiological properties and therapeutic effectiveness of preparations frombacteriophages. Zh. Mikrobiol. Epidemiol. Immunobiol. 3:30-33 42-Cislo, M., M. Dabrowski, B. Weber-Dabrowska, and A. Woyton. 1987. Bacteriophage treatment of suppurative skin infections. Arch. Immunol. Ther. Exp. 2:175-183. 43-Ioseliani, G. D., G. D. Meladze, N. S. Chkhetiia, M. G. Mebuke, and N. I. Kiknadze. 1980. Use of bacteriophage and antibiotics for prevention of acute postoperative empyema in chronic suppurative lung diseases. Grudn. Khir. 6:63-67 44-Kochetkova, V. A., A. S. Mamontov, R. L. Moskovtseva, E. I. Erastova, E. I. Trofimov, M. I. Popov, and S. K. Dzhubalieva. 1989.
Phagotherapy of postoperative suppurative-inflammatory complications in patients with neoplasms. Sov. Med. 6:23-26 45-Kucharewicz-Krukowska, A., and S. Slopek. 1987. Immunogenic effect of bacteriophage in patients subjected to phage therapy. Arch. Immunol. Ther. Exp. 5:553-561. 46-Kwarcinski, W., B. Lazarkiewicz, B. Weber-Dabrowska, J. Rudnicki, K. Kaminski, and M. Sciebura. 1994. Bacteriophage therapy in the treatment of recurrent subphrenic and subhepatic abscess with jejunal fistula after stomach resection. Pol. Tyg. Lek. 49:535 47-Litvinova, A. M., V. M. Chtetsova, and I. G. Kavtreva. 1978. Evaluation of efficacy of the use of E. coli-Proteus bacteriophage in intestinal dysbacteriosis in premature infants. Vopr. Okhr. Materin. Det. 9:42-44. 48-Meladze, G. D., M. G. Mebuke, N. S. Chkhetia, N. I. Kiknadze, G. G. Koguashvili, I. I. Timoshuk, N. G. Larionova, and G. K. Vasadze. 1982. The efficacy of staphylococcal bacteriophage in treatment of purulent diseases of lungs and pleura. Grudn. Khir. 1:53-56 49-Miliutina, L. N., and N. V. Vorotyntseva. 1993. Current strategy and tactics of etiotropic therapy of acute intestinal infections in children. Antibiot. Khimioter. 1:46-53. 50-Schless, R. A. 1932. Staphylococcus aureus meningitis: treatment with specific bacteriophage. Am. J. Dis. Child. 44:813-822. 51-Sakandelidze, V. M., and A. N. Meipariani. 1974. Use of combined phages in suppurative-inflammatory diseases. Zh. Mikrobiol. Epidemiol. Immunobiol. 6:135-136. 52-Sakandelidze, V. M. 1991. The combined use of specific phages and antibiotics in different infectious allergoses. Vrach. Delo 3:60-63 53- Slopek, S., I. Durlakowa, B. Weber-Dabrowska, A. Kucharewicz-Krukowska, M. Dabrowski, and R. Bisikiewicz. 1983. Results of bacteriophage treatment of suppurative bacterial infections. I. General evaluation of the results. Arch. Immunol. Ther. Exp. 31:267-291.
54- Slopek, S., I. Durlakowa, B. Weber-Dabrowska, A. Kucharewicz-Krukowska, M. Dabrowski, and R. Bisikiewicz. 1983. Results of bacteriophage treatment of suppurative bacterial infections. II. Detailed evaluation of the results. Arch. Immunol. Ther. Exp. 31:293-327 55- Slopek, S., I. Durlakowa, B. Weber-Dabrowska, M. Dabrowski, and A. Kucharewicz-Krukowska. 1984. Results of bacteriophage treatment of suppurative bacterial infections. III. Detailed evaluation of the results obtained in a further 150 cases. Arch. Immunol. Ther. Exp. 32:317-335 56- Slopek, S., A. Kucharewicz-Krukowska, B. Weber-Dabrowska, and M. Dabrowski. 1985. Results of bacteriophage treatment of suppurative bacterial infections. IV. Evaluation of the results obtained in 370 cases. Arch. Immunol. Ther. Exp. 33:219-240 57- Slopek, S., A. Kucharewicz-Krukowska, B. Weber-Dabrowska, and M. Dabrowski. 1985. Results of bacteriophage treatment of suppurative bacterial infections. V. Evaluation of the results obtained in children. Arch. Immunol. Ther. Exp. 33:241- 58- Slopek, S., A. Kucharewicz-Krukowska, B. Weber-Dabrowska, and M. Dabrowski. 1985. Results of bacteriophage treatment of suppurative bacterial infections. VI. Analysis of treatment of suppurative staphylococcal infections. Arch. Immunol. Ther. Exp. 33:261-273 59- Slopek, S., B. Weber-Dabrowska, M. Dabrowski, and A. Kucharewicz-Krukowska. 1987. Results of bacteriophage treatment of suppurative bacterial infections in the years 1981-1986. Arch. Immunol. Ther. Exp. 35:569-583 60- Stroj, L., B. Weber-Dabrowska, K. Partyka, M. Mulczyk, and M. Wojcik. 1999. Successful treatment with bacteriophage in purulent cerebrospinal meningitis in a newborn. Neurol. Neurochir. Pol. 3:693-698. 61- Tolkacheva, T. V., E. M. Abakumov, V. A. Martynova, and T. V. Golosova. 1981. Correction of intestinal dysbacteriosis with biological preparations in acute leukemia. Probl. Gematol. Pereliv. Krovi 7:29-33.
62- Weber-Dabrowska, B., M. Dabrowski, and S. Slopek. 1987. Studies on bacteriophage penetration in patients subjected to phage therapy. Arch. Immunol. Ther. Exp. 35:563-568 63- Zhukov-Verezhnikov, N. N., L. D. Peremitina, E. A. Berillo, V. P. Komissarov, V. M. Bardymov, A. G. Khvoles, and L. B. Ugryumov. 1978. A study of the therapeutic effect of bacteriophage agents in a complex treatment of suppurative surgical diseases. Sov. Med. 12:64-66 64- Kaczkowski, H., B. Weber-Dabrowska, M. Dabrowski, Z. Zdrojewicz, and F. Cwioro. 1990. Use of bacteriophages in the treatment of chronic bacterial diseases. Wiad. Lek. 43:136-141 65- Babalova, E. G., K. T. Katsitadze, L. A. Sakvarelidze, N. S. Imnaishvili, T. G. Sharashidze, V. A. Badashvili, G. P. Kiknadze, A. N. Meipariani, N. D. Gendzekhadze, E. V. Machavariani, K. L. Gogoberidze, E. I. Gozalov, and N. G. Dekanosidze. 1968. Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol. Immunobiol. 2:143-145 66- Ioseliani, G. D., G. D. Meladze, N. S. Chkhetiia, M. G. Mebuke, and N. I. Kiknadze. 1980. Use of bacteriophage and antibiotics for prevention of acute postoperative empyema in chronic suppurative lung diseases. Grudn. Khir. 6:63-67 67- Shabalova, I. A., N. I. Karpanov, V. N. Krylov, T. O. Sharibjanova, and V. Z. Akhverdijan. 1995. Pseudomonas aeruginosa bacteriophage in treatment of P. aeruginosa infection in cystic fibrosis patients, p. 443. In Proceedings of IX International Cystic Fibrosis Congress. International Cystic Fibrosis Association, Zurich, Switzerland 68- Proskurov, V. A. 1970. Use of staphylococcal bacteriophage for therapeutic and preventive purposes. Zh. Mikrobiol. Epidemiol. Immunobiol. 2:104-107 69- Pavlenishvili, I., and T. Tsertsvadze. 1993. Bacteriophagotherapy and enterosorbtion in treatment of sepsis of newborns caused by gram-negative bacteria. Pren. Neon. Infect. 11:104 70-. Perepanova, T. S., O. S. Darbeeva, G. A. Kotliarova, E. M. Kondrat'eva, L. M. Maiskaia, V. F. Malysheva, F. A. Baiguzina, and N. V. Grishkova. 1995. The efficacy of bacteriophage preparations in treating inflammatory urologic diseases. Urol. Nefrol. 5:14-17.
71- Peremitina, L. D., E. A. Berillo, and A. G. Khvoles. 1981. Experience in the therapeutic use of bacteriophage preparations in suppurative surgical infections. Zh. Mikrobiol. Epidemiol. Immunobiol. 9:109-110 72- Pokrovskaya, M. P., L. C. Kaganova, M. A. Morosenko, A. G. Bulgakova, and E. E. Skatsenko. 1942. Treatment of wounds with bacteriophages, 2nd ed. State Publishing House "Medgiz,", Moscow, USSR 73- Anpilov, L. I., and A. A. Prokudin. 1984. Preventive effectiveness of dried polyvalent Shigella bacteriophage in organized collective groups. Voenno-Med. Zh. 5:39-40. 74- Zhukov-Verezhnikov, N. N., L. D. Peremitina, E. A. Berillo, V. P. Komissarov, V. M. Bardymov, A. G. Khvoles, and L. B. Ugryumov. 1978. A study of the therapeutic effect of bacteriophage agents in a complex treatment of suppurative surgical diseases. Sov. Med. 12:64-66
75-Gene mayer, Microbiology and Immunology .School of Medicine .on-line.2007.University of South Carolina. G
75- Bacteriophages, Virus/www.infoseck.com
76- Prescott, L. (1993). Microbiology, Wm. C. Brown Publishers, ISBN 0-697-01372-3
77-Mc Grath S and van Sinderen D . (2007). Bacteriophage: Genetics and Molecular Biology, 1st ed., Caister Academic Press. ISBN 978-1-904455-14-1 .
78-Fiers W et al., Complete nucleotide-sequence of bacteriophage MS2-RNA - primary and secondary structure of replicase gene, Nature, 260, 500-507, 1976
79- Cann A.J: Principles of Molecular Virology. Academic Press, 2nd Edition, 1997
80-KennethTodar , Ken Todar's Microbial World .2006.University of Wisconsin-Madison Department of Bacteriology
81-Nicas,T.I.;Hancock,R.E.W.J.Bacteriol.,1983,153,281
82-Georgopapadakou,N.H.Antimicrob agent.Chemother.,1993,37,2045
83-McMurry,L.,:Petrucci,R.E.:Levy,S.B.Proc.Natl.Acad.Sci.USA.1980,77,3974
84-Nikaido,H.J.Bacteriol.1996,178,5853
85-Bush,K.; Sykes,R.B.Antimicrob.Agents Chemother.,1986.30,6
86-Kaur,K.;Pratt,R.F.Biochemistry ,2001,40,4610
87- National Institute of Allergy and Infectious Diseases,2001; Bethesda, MD 20892
88- National Institutes of Health,june 2001 - Bethesda, MD 20892
89- Antimicrobial resisanance, http:// www.niaid.nih.gov.
90-d"The Stalinist Antibiotics Alternative" (New York Times, Mar. 2000),
91-Unconventional solution , clinical problem.http://www.phagebiotech.com
92-Kochetkova, V. A., A. S. Mamontov, R. L. Moskovtseva, E. I. Erastova, E. I. Trofimov, M. I. Popov, and S. K. Dzhubalieva. 1989. Phagotherapy of postoperative suppurative-inflammatory complications in patients with neoplasms. Sov. Med. 6:23-26
93-Meladze, G. D., M. G. Mebuke, N. S. Chkhetia, N. I. Kiknadze, G. G. Koguashvili, I. I. Timoshuk, N. G. Larionova, and G. K. Vasadze. 1982. The efficacy of staphylococcal bacteriophage in treatment of purulent diseases of lungs and pleura. Grudn. Khir. 1:53-56
94-Sakandelidze, V. M. 1991. The combined use of specific phages and antibiotics in different infectious allergoses. Vrach. Delo 3:60-63
95-Smith, H. W., and M. B. Huggins. 1982. Successful treatment of experimental Escherichia coli infections in mice using phages: its general superiority over antibiotics. J. Gen. Microbiol. 128:307-318
96-Meladze, G. D., M. G. Mebuke, N. S. Chkhetia, N. I. Kiknadze, G. G. Koguashvili, I. I. Timoshuk, N. G. Larionova, and G. K. Vasadze.
1982. The efficacy of staphylococcal bacteriophage in treatment of purulent diseases of lungs and pleura. Grudn. Khir. 1:53-56
76 97-Chernomordik, A. B. 1989. Bacteriophages and their therapeutic-prophylactic use. Med. Sestra 6:44-47.
98-Yao, J. D. C., and R. C. Moellering, Jr. 1995. Antimicrobial agents, p. 1474-1504. In P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, D.C.
99-Chopra, I., J. Hodgson, B. Metcalf, and G. Poste. 1997. The search for antimicrobial agents effective against bacteria resistant to multiple antibiotics. Antimicrob. Agents Chemother. 41:497-503
100-Silver, L. L., and K. A. Bostian. 1993. Discovery and development of new antibiotics: the problem of antibiotic resistance. Antimicrob. Agents Chemother. 37:377-383
101-Slopek, S., B. Weber-Dabrowska, M. Dabrowski, and A. Kucharewicz-Krukowska. 1987. Results of bacteriophage treatment of suppurative bacterial infections in the years 1981-1986. Arch. Immunol. Ther. Exp. 35:569-583.
102-Cislo, M., M. Dabrowski, B. Weber-Dabrowska, and A. Woyton. 1987. Bacteriophage treatment of suppurative skin infections. Arch. Immunol. Ther. Exp. 2:175-183.
103-Prins, J. M., S. J. Deventer, E. J. Kuijper, and P. Speelman. 1994. Clinical relevance of antibiotic-induced endotoxin release. Antimicrob. Agents Chemother. 38:1211-1218
104-Salyers, A. A., and C. F. Amabile-Cuevas. 1997. Why are antibiotic resistance genes so resistant to elimination? Antimicrob. Agents Chemother. 41:2321-2325
105- Ilenchuk.T, vice president ,Biophage Pharma - Montreal, Canada 106- Intralytix, phage company ,Baltimore, Maryland, USA
107- Duc,kworth.D ,Gulig.P Department of Microbiology, University of Florida, Gainesville,USA
108- Kutter.E, Evergreen State College in Olympia, Washington,USA
109- Stone,R .2002.Stalin’s Forgotten Cure, Science Vol 298. 110- Carlton.R, Exponential Biotherapies Inc. (EBI), Washington,USA.
111-Eaton, M. D., and S. Bayne-Jones. 1934. Bacteriophage therapy. Review of the principles and results of the use of bacteriophage in the treatment of infections. JAMA 23:1769-1939
112-Krueger, A. P., and E. J. Scribner. 1941. Bacteriophage therapy. II. The bacteriophage: its nature and its therapeutic use. JAMA 19:2160-2277
113- Bogovazova, G. G., N. N. Voroshilova, and V. M. Bondarenko. 1991. The efficacy of Klebsiella pneumoniae bacteriophage in the therapy of experimental Klebsiella infection. Zh. Mikrobiol. Epidemiol. Immunobiol. 4:5-8
114- Bogovazova, G. G., N. N. Voroshilova, V. M. Bondarenko, G. A. Gorbatkova, E. V. Afanas'eva, T. B. Kazakova, V. D. Smirnov, A. G. Mamleeva, I. A. Glukharev, E. I. Erastova, I. A. Krylov, T. M. Ovcherenko, A. P. Baturo, G. V. Yalsyk, and N. A. Arefyeva. 1992. Immunobiological properties and therapeutic effectiveness of preparations from Klebsiella bacteriophages. Zh. Mikrobiol. Epidemiol. Immunobiol. 3:30-33
115- Babalova, E. G., K. T. Katsitadze, L. A. Sakvarelidze, N. S. Imnaishvili, T. G. Sharashidze, V. A. Badashvili, G. P. Kiknadze, A. N. Meipariani, N. D. Gendzekhadze, E. V. Machavariani, K. L. Gogoberidze, E. I. Gozalov, and N. G. Dekanosidze. 1968. Preventive value of dried dysentery bacteriophage. Zh. Mikrobiol. Epidemiol. Immunobiol. 2:143-145.
116- Adamia, R. S., E. A. Matitashvili, L. I. Kvachadze, V. I. Korinteli, D. A. Matoyan, M. I. Kutateladze, and T. G. Chanishvili. 1990. The virulent bacteriophage IRA of Salmonella typhimurium: cloning of phage genes which are potentially lethal for the host cell. J. Basic Microbiol. 10:707-716
117- Andriashvili, I. A., L. I. Kvachadze, R. P. Vashakidze, R. S. Adamia, and T. G. Chanishvili. 1986. Molecular mechanisms of DNA protection from restriction endonucleases in Staphylococcus aureus cells. Mol. Gen. Mikrobiol. Virusolol. 8:43-45.
118- Ochs, H. D., R. H. Buckley, R. H. Kobayashi, A. L. Kobayashi, R. U. Sorensen, S. D. Douglas, B. L. Hamilton, and M. S. Hershfield. 1992. Antibody responses to bacteriophage phi X174 in patients with adenosine deaminase deficiency. Blood 5:1163-1171.
119- Ochs, H. D., S. Nonoyama, Q. Zhu, M. Farrington, and R. J. Wedgewood. 1993. Regulation of antibody responses: the role of complement and adhesion molecules. Clin. Immunol. Immunopathol. 67:S33-S40
120- Bergh, O., K. Y. Borsheim, G. Bratbak, and M. Heldal. 1989. High abundance of viruses found in aquatic environments. Nature 340:467-468
121- Chavadze ,2005, phage therapy center,0179-Tbilisi, Georgia
122- Prescott, L. (1993). Microbiology, Wm. C. Brown Publishers, ISBN 0-697-01372-3
123- Wikipedia, Wikimedia Foundation, Inc.,11 September 2007. U.S. registered 501(c)(3)
124-Anne Belcher, Harnessing Viral Power, MIT Alumni Assoc., July 2005
125-Researchers build tiny batteries with viruses, MIT News Office, April 2006
126-Curtin JJ, Donlan RM (2006)Using bacteriophages to reduce formation of catheter-associated biofilms by Staphylococcus epidermidis, Antimicrob Agents Chemother, 2006 Apr; 50(4) 1268-75
127-Mc Grath S , van Sinderen D . (2007). Bacteriophage: Genetics and Molecular Biology, 1st ed., Caister Academic Press. ISBN 978-1-904455-14-1 .
128-Filby, G. 2007. "The Health Value Of Bacteriophages" Winston Churchill Fellowship.
129-Wolcott, R. 2007. Case Studies at the Wound Care Center, Lubbock, Texas
130- Smith, H. W., and M. B. Huggins. 1982. Successful treatment of experimental Escherichia coli infections in mice with phage: its general superiority over antibiotics. J. Gen. Microbiol. 128:307-318
131- Smith, H. W., and M. B. Huggins. 1983. Effectiveness of phages in treating experimental Escherichia coli diarrhoea in calves, piglets and lambs. J. Gen. Microbiol. 129:2659-2675
132- Smith, H. W., M. B. Huggins, and K. M. Shaw. 1987. The control of experimental Escherichia coli diarrhoea in calves by means of bacteriophages. J. Gen. Microbiol. 133:1111-1126
133- Bratbak, G., F. Thingstad, and M., Heldal. 1994. Viruses and the microbial loop. Microb. Ecol. 28:209-221.
134- Djordjevic, G. M., and T. R. Klaenhammer. 1998. Genes and gene expression in Lactococcus bacteriophages. Int. Dairy J. 7:489-508.
135- Cresswell, N., P. R. Herron, V. A. Saunders, and E. M. H. Wellington. 1992. The fate of introduced streptomycetes, plasmid and phage populations in a dynamic soil system. J. Gen. Microbiol. 138:659-666
136- Pantastico-Caldas, M., K. E. Duncan, C. A. Istock, and J. A. Bell. 1992. Population dynamics of bacteriophage and Bacillus subtilis in soil. Ecology 73:1888-1902
137- Bergh, O., Y. Borsheim, G. Bratbak, and M. Heldal. 1989. High abundance of viruses found in aquatic environments. Nature 340:467-468
138- Bratbak, G., M. Heldal, S. Norland, and T. F. Thingstad. 1990. Viruses as partners in spring bloom microbial trophodynamics. Appl. Environ. Microbiol. 56:1400-1405.
139- Bratbak, G., F. Thingstad, and M., Heldal. 1994. Viruses and the microbial loop. Microb. Ecol. 28:209-221.
140- Hennes, K. P., and M. Simon. 1995. Significance of bacteriophages for controlling bacterioplankton growth in a mesotrophic lake. Appl. Environ. Microbiol. 61:333-340.
141- Wichels, A., S. F. Biel, H. R. Gelderblom, T. Brinkhoff, G. Muyzer, and C. Schutt. 1998. Bacteriophage diversity in the North Sea. Appl. Environ. Microbiol. 64:4128-4133.
142- Ashelford, K. E., M. J. Day, M. J. Bailey, A. K. Lilley, and J. C. Fry. 1999. In situ population dynamics of bacterial viruses in a terrestrial environment. Appl. Environ. Microbiol. 65:169-174
143-TACD –Trans Atlantic Costumer Dialogue ,2006, Antibiotics in Animal and Food Production, DOC NO. Food-01pp-99
144- Leverentz, B., Conway, W.S., Alavidze, Z., Janisiewicz, W.J., Fuchs, Y., Camp, M.J., Chighladze, E., Sulakvelidze, A. (2001). Examination of bacteriophage as a biocontrol method for salmonella on fresh-cut fruit: a model study. Journal of Food Protection 64:1116-1121
145- Wilkinson, M.H.F. (2001). Predation in the presence of decoys: An inhibitory factor on pathogen control by bacteriophages or bdellovibrios in dense and diverse ecosystems. J. Theor. Biol. 208:27-36
146- Flaherty, J.E., Jones, J.B., Harbaugh, B.K., Somodi, G.C., Jackson, L.E. (2000). Control of bacterial spot on tomato in the greenhouse and field with h-mutant bacteriophages .Hortscience 35:882-884
147- Park, S.C., Shimamura, I., Fukunaga, M., Mori, K.I., Nakai, T. (2000). Isolation of bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicida, as a candidate for disease control. Appl. Environ. Microbiol. 66:1416-1422
148- Weber-Dabrowska, B., Mulczyk, M., Gorski, A. (2000). Bacteriophage therapy of bacterial infections: An update of our institute's experience. Archivum Immunologiae et Therapiae Experimentalis 48:547-551
149- Hayes, W. 1968. . The genetics of bacteria and their viruses, 2nd ed. Blackwell Scientific Publications Ltd., London, United Kingdom
150- Van de Putte, P., S. Cramer, and M. Giphart-Gassler. 1980. Invertible DNA determines host specificity of bacteriophage Mu. Nature 286:218
151-Yarmolinsky, M. B., and N. Sternberg. 1988. Bacteriophage P1, p. 291-438. In R. Callendar (ed.), The bacteriophages, vol. 1. Plenum Press, New York, N.Y.
152- Harshey, R. M. 1988. Phage Mu, p. 193-234. In R. Callendar (ed.), The bacteriophages, vol. 1. Plenum Press, New York, N.Y.
153- Bergh, Ø., G. Børsheim, G. Bratbak, and M. Heldal. 1989. High abundance of viruses found in aquatic environments. Nature 340:467-468
154- Fuhrman, J. A., and C. A. Suttle. 1993. Viruses in marine planktonic systems. Oceanography 6:51-63.
155- Torrella, F., and R. Y. Morita. 1979. Evidence by electron micrographs for a high incidence of bacteriophage particles in the waters of Yaquina Bay, Oregon: ecological and taxonomical implications. Appl. Environ. Microbiol. 37:774-778
156- Hennes, K. P., and M. Simon. 1995. Significance of bacteriophages for controlling bacterioplankton growth in a mesotrophic lake. Appl. Environ. Microbiol. 61:333-340
157- Marsh, P., and E. M. H. Wellington. 1994. Phage-host interactions in soil. FEMS Microbiol. Ecol. 15:99-108.
158- Reanny, D. C. 1976. Extrachromosomal elements as possible agents of adaptation and development. Bacteriol. Rev. 40:552-590
159- Waterbury, J. B., S. W. Watson, F. W. Valois, and D. G. Franks. 1986. Biological and ecological characterization of the marine unicellular cyanobacterium Synechococcus. Can. Bull. Fish. Aquat. Sci. 214:71-120
160- Suttle, C. A., and A. M. Chan. 1994. Dynamics and distribution of cyanophages and their effect on marine Synechococcus spp. Appl. Environ Microbiol. 60:3167-3174
161- Waterbury, J. B., and F. W. Valois. 1993. Resistance to co-occurring phages enables marine Synechococcus communities to coexist with cyanophages abundant in seawater. Appl. Environ. Microbiol. 59:3393-3399
162- Proctor, L. M., and J. A. Fuhrman. 1990. Viral mortality of marine bacteria and cyanobacteria. Nature (London) 343:60-62.
163- Nelson JM, Chiller TM, Powers JH, Angulo FJ (2007). "Fluoroquinolone-resistant Campylobacter species and the withdrawal of fluoroquinolones from use in poultry: A public health success story". Clin Infect Dis 44: 977–80
164- Lord Soulsby of Swaffham Prior (2005). "Resistance to antimicrobials in humans and animals". Brit J Med 331: 1219–20
165- N Chanishvili, T Chanishvili, M. Tediashvili, P.A. Barrow (2001). "Phages and their application against drug-resistant bacteria". J. Chem. Technol. Biotechnol.) 76: 689–699
166- Babalova, E. G., K. T. Katsitadze, L. A. Sakvarelidze, N. S. Imnaishvili, T. G. Sharashidze, V. A. Badashvili, G. P. Kiknadze, A. N. Meipariani, N. D. Gendzekhadze, E. V. Machavariani, K. L. Gogoberidze, E. I. Gozalov, and N. G. Dekanosidze. (1968). "Preventive value of dried dysentery bacteriophage.". Zh. Mikrobiol. Epidemiol. Immunobiol. 2: 143–145
167-Pleczar M.J.E.C.S.Chan , N.R.Kreig 1986, Microbiology, McGraw Hill Book Company .PP-415-434
168-Pato ,M.(1989) Bacteriophage Mu.In:Mobile DNA (berg,D.E and Howe.MM., Eds).PP.23-52.American Microbiology Society for Microbiology.Washington
169-Ljungguist.E.and Bukhari.A.I.(1977).State of prophage Mu DNA upon induction Proc.Nati.Acad.Sci.USA.74:3143-3147
170-Pato, M.L and Waggoner .B.T.,(1981).Cellular location of Mu DNA replicas.J.Virol.38:249-255
171-Bukhari.A.I(1975) Reversal of mutator phage Mu integration J.Mol.Biol. 96:87-99
172-Ghelaridini,P.,liebort J.C.,Di Zenzo.G.Micheli,G.,D.Ari.R. and Paolozzi,L.(1994). A novel illegimate recombination event precise Mu excision and reintegration with gem prophage mutant Mil.Microbial.13:709-718
173- Ghelaridini,P.,liebort J.C., Fabozzi,G.Tomassini.B.,D. Ari,R. and Paolozzi.L.(1995) Reversal of Mu gemzts Mutation FEMS. Microbiol:Rev.17:171-176
174- Cann A.J: Principles of Molecular Virology. Academic Press, 2nd Edition, 1997 Chapters 2 and 5.
175-Davis,Dulbiecco,Microbiology,Harper International Edition
176-Microbiology Principles and Explorations Jacquelyn G.Black.Marymount University 4th edition New Jersey 07458
177-Saye, D.J., and R.V.Miller.1989. the aquatic environment;consideration of horizontal gene transmission in a a divers field habitat P.223-259.
178-Baros J.A.J.Listam,and R.Y.Morita 1978. incidence of Vibro parahaemolysticus bacteriophages and other Vibrio bacteriophage in Marine Samples .Appl environ Microbiol. 36:492-499
179-Kellen berger,E.1990.Form determination of bacteriophage Eur.J.Biochem.190:233-248
180-Borshein, K.Y., G.Bratbak, and M.Heldal 1990. Enumeration and biomass estimation of planktonic bacteria and viruses by transmission electron microscopy. Appl .Environ.Microbiol. 56:352-356
181-Girnberg. D.R.A. Baronat & J. Givnea , 1988.characterization of B278 a phage different from Mu that also produces auxotrophic mutations in E.coli K12 J.Gen.,Mic.134:1333-1338
182-Inove T.S.Matsuzaki, and A.Tanka,1995.A 26 Kda,Aouter membrane protein Ompk.Common to vibrio species is the receptor for a broad host range vibrophage,KVP40.FEMS .Microbial.Lett.125:101-106
183-Barrego J.J.,R.cornex M.A.Moringo E.Martinez Manzanares and P.Romero 1989.Coliphges as an indicator of fecal pollution in water. Their survival and productive infectivity in natural aquatic environments water Res.24:111-116
184-Borrego,J.J.,A.Marigo,A de vicents,R.Carnax, and P.Romero 1987, Coliphages as an indicator of faecal pollution in water, its relationship with indication and pathogenic microorganism, water Res 21: 1473-1480
185-Grabow.W.O.K., P.Coubrough,E.M.Nupen and B.W.Bareman 1984.Evaluation of Coliphages asinelicators of the virological quality of sewage polluited water. Water S.A.10:7-14
186-kott ,N.Y .Rose,S.Sperber and N.Betzer 1974.bacteriophages as viral pollution indications water Res.8:165-171
187-Yates ,M.V.,C.P. Gebra and L.M.Kelley.1985.Virus persistence in ground water.Appl.Environ.Microbiol.49:778-781
188-Brat G.,F.Thingstad,and M.Heldal 1994.Viruses and the Microbial loop Microb.Ecol.28:209-221
189-Furham ,J.A., and C.A. Suttle.1993.viruses in Marine planctonie system.Oceanography.6:51-63
190-Frank .II., and K.Mebus.1987. An electron microscopy study of bacteriophages from marine waters.Helgol.wiss meeresunters 41:385-414
191-Bergh,O.,K.Y.Bershain.G.Brat Bak, and M.heldal,1989.High abundances of viruses found in aquatic environments nature. 340:467-468
192-Suttle. C.A. M.Chan and M.T Cottvell 1990. infection of phytoplankton by viruses and reduction of premary productivity nature.134:467-469
193-Cattrell.M.T.,and C.A.Suttle.1995 .Genetic diversity of algal viruses which lyse the phtosyn theic picoflagellate micromonas pusilla.Appl.Environ Microbial 61:3088-3091
194-Bergh O.,K.Y.borshelm G.bratbak and M.halda.1989.high abundance of viruses found in aquntic environments nature (London) 340:467-468
195-Cochlan W.P., J.Walkner.G.F. Steward D.C.Smith and F.Azam 1993.Spatial distribution of viruses, bacteria and chlorophyl a in nortic, oceanic and estuarine environments.Mar.Ecol.prog.Sec 92:77-87
196-Hara and K., Terauchi, and kolke.1991.Abundance of viruses in marine waters: Assessments by epifluresence and transmission electron microscopy Appl.Environ.Microbiol.52:2731-2734
197-Proctor, L.M and J.A.Furham.1990.Viral mortality of Marine bacteria and cyanobacteria Nature (London) 343:60-62
198-Steward. G.f.,J.Wichner,W.P.Cachlan,D.C.smith and F.Azam.1992.Estimation of viruse production in the sea II.Feild results.Mar.Microb.Food Webs. 6:79-90
199-Weinbouer,M.G.,D Fuks, and P.Peduzzi, 1993. Disturbutaion of viruses and dissolved DNA along a coastal tropic gradient in the northern Adriatic Sea Appl. Environ microbiol.59:4074-4082
200-Tylor K.,1965 .Enzymetic deacetylation of Vi-Polysaccharide by Vi-Phage II.BioChem .Biophys.Res.Commum.20:752-756
201-Barrow, P., M. Lovell, and A. Berchieri, Jr. 1998. Use of lytic bacteriophage for control of experimental Escherichia coli septicemia and meningitis in chickens and calves. Clin. Diagn. Lab. Immunol. 5:294-298
202-Smith, H. W., and M. B. Huggins. 1983. Effectiveness of phages in treating experimental Escherichia coli diarrhoea in calves, piglets and lambs. J. Gen. Microbiol. 129:2659-2675
203-Smith, H. W., M. B. Huggins, and K. M. Shaw.1987 . The control of experimental Escherichia coli diarrhoea in calves by means of bacteriophages.J. Gen. Microbiol. 133:1111-1126.
203- Parry, M. F. 1989. Epidemiology and mechanisms of antimicrobial resistance. Am. J. Infect. Control 17:286-294. 204-Grayson, M. L., and G. M. Eliopoulos. 1990. Antimicrobial resistance in the intensive care unit. Semin. Respir. Infect. 5:204-214. 205-Anonymous. 1991. Nosocomial transmission of multidrug-resistant tuberculosis among HIV-infected persons-Florida and New York, 1988-1991. Morbid. Mortal. Weekly Rep. 40:585- 591.
206-Suttle CA. Viruses in the sea. Nature. 2005;437:356–361.
207-Wommack KE, Colwell RR. Virioplankton: Viruses in aquatic ecosystems. Microbiol Mol Biol Rev. 2000;64:69–114.
208-Hambly E, Suttle CA. The viriosphere, diversity, and genetic exchange within phage communities. Curr Opin Microbiol. 2005;8:444–450 209-Wilhelm SW, Suttle CA. Viruses and nutrient cycles in the sea. Bioscience. 1999;49:781–788. 210-Park, S. C., I. Shimamura, M. Fukunaga, K. I. Mori, and T. Nakai. 2000. Isolation of bacteriophages specific to a fish pathogen, Pseudomonas plecoglossicida, as a candidate for disease control. Appl. Environ. Microbiol. 66:1416-1422
211-Cairns, J., G. S. Stent, and J. D. Watson. 1992. Phage and the origins of molecular biology, expanded ed. Cold Spring Harbor Laboratory Press, Plainview, N.Y.
212-Fuhrman, J. A. 1999. Marine viruses: biogeochemical and ecological effects. Nature 399:541-548 213-Wommack, K. E., and R. R. Colwell. 2000. Virioplankton: viruses in aquatic ecosystems. Microbiol. Mol. Biol. Rev. 64:69-114 214-Danovaro, R., A. Dell'Anno, A. Trucco, M. Serresi, and S. Vanucci. 2001. Determination of virus abundance in marine sediments. Appl. Environ. Microbiol. 67:1384-1387. 215-Danovaro, R., and M. Serresi. 2000. Viral density and virus-to-bacterium ratio in deep-sea sediments of the Eastern Mediterranean. Appl. Environ. Microbiol. 66:1857-1861. 216-Hewson, I., J. M. O'Neil, J. A. Fuhrman, and W. C. Dennison. 2001. Virus-like particle distribution and abundance in sediments and overlying waters along eutrophication gradients in two subtropical estuaries. Limnol. Oceanogr. 46:1734-1746
217-Wilhelm, S. W., and C. A. Suttle. 1999. Viruses and nutrient cycles in the sea. Bioscience 49:781-783.
218-Jiang, S. C., and J. H. Paul. 1998. Gene transfer by transduction in the marine environment. Appl. Environ. Microbiol. 64:2780-2787.
219-Paul, J. H. 1999. Microbial gene transfer: an ecological perspective. J. Mol. Microbiol. Biotechnol. 1:45-50.
220-Wommack,K.E.,and R.R. Colwell.2000.Virioplankton:viruses in aquatic ecosystems .Microbiol.Mol.Biol.Rev.64:69-114 221-Matthew K.Waldor, David I.Friedman , and Sankar L.Adhya.2005. Phages: their Role in Bacterial Pathogenesis and Biotechnology .ASM Press.Washengton DC.USA 222-.Cochran ,P.K.,C.A.Kellogg, and J.H.Paul. 1998.prophage induction of indigenous marine lysogenic bacteria by environmental pollutants.Mar.Ecol.Prog.Ser.164:125-133
223-Tapper,M.A.,and R.E.Hicks.1998.Temprate viruses and lysogeny in Lake superiorbacterioplankton.Limmol.Occeanoger.43:95-103 224-Weinbauer,M.G.,and C.A. Suttle.1999.lysogeny and prophage induction in coastal and offshore bacterial communities .Aquat.Microb.Ecol.18:217-225 225-Cochran ,P.K., and J.H.Paul.1998.seasonal abundance of lysogenic bacteria in a subtropical estuary .Appl.Environ.Microbiol.64:2308-2312 226-Jiang ,S.C.and J.H.Paul.1994.Seasonal and diel abundance of viruses and occurreof lysogeny/bacteriocinogeny in the marine environment.Mar.Ecol.Prog.Ser 104:163-17 227-Wilson, W.H., N.G.Carr, and N.H.Mann. 1996. The effect of phosphate statues on the kinetics of cyanophage infection in the oceanic cyanobacterium Synechoccus sp. WH 7803.J.Phycol.32:506-516 228-Bergh, O., K. Y. Borsheim, G. Bratbak, and M. Heldal. 1989. High abundance of viruses found in aquatic environments. Nature 340:467-468 229-Wommack, K. E., and R. R. Colwell. 2000. Virioplankton: viruses in aquatic ecosystems. Microbiol. Mol. Biol. Rev. 64:69-114 230-Wommack, K. E., J. Ravel, R. T. Hill, and R. R. Colwell. 1999. Hybridization analysis of Chesapeake Bay virioplankton. Appl. Environ. Microbiol. 65:241-250
231-Zhong, Y., F. Chen, S. W. Wilhelm, L. Poorvin, and R. E. Hodson. 2002. Phylogenetic diversity of marine cyanophage isolates and natural virus communities as revealed by sequences of viral capsid assembly protein gene g20. Appl. Environ. Microbiol. 68:1576-1584
232-Wiggins, B. A., and M. Alexander. 1985. Minimum bacterial density for bacteriophage replication: implications for significance of bacteriophages in natural ecosystems. Appl. Environ. Microbiol. 49:19-23.
233-Ventura, M., C. Canchaya, M. Kleerebezem, W. M. de Vos, R. J. Siezen, and H. Brussow. 2003. The prophage sequences of Lactobacilllus plantarum strain WCFS1. Virology 316:245-255.
234- Wagner, P. L., J. Livny, M. N. Neely, D. W. Acheson, D. I. Friedman, and M. K. Waldor. 2002. Bacteriophage control of Shiga toxin 1 production and release by Escherichia coli. Mol. Microbiol. 44:957-970.
235- Loessner, M. J., M. Rudolf, and S. Scherer. 1997. Evaluation of luciferase reporter bacteriophage A511::luxAB for detection of Listeria monocytogenes in contaminated foods. Appl. Environ. Microbiol. 63:2961-2965.
236- Kilic, A. O., S. I. Pavlova, S. Alpay, S. S. Kilic, and L. Tao. 2001. Comparative study of vaginal Lactobacillus phages isolated from women in the United States and Turkey: prevalence, morphology, host range, and DNA homology. Clin. Diagn. Lab. Immunol. 8:31-39
237- Weinbauer, M. G., and M. G. Hofle. 1998. Size-specific mortality of lake bacterioplankton by natural virus communities. Aquat. Microb. Ecol. 15:103-113.
238- Chibani-Chennoufi, S., J. Sidoti, A. Bruttin, E. Kutter, S. A. Sarker, and H. Brussow. 2004. Comparison of in vitro and in vivo bacteriolytic activity of Escherichia coli phages: implication for phage therapy. Antimicrob. Agents Chemother.
239- Bruttin, A., F. Desiere, N. d'Amico, J. P. Guerin, J. Sidoti, B. Huni, S. Lucchini, and H. Brussow. 1997. Molecular ecology of Streptococcus thermophilus bacteriophage infections in a cheese factory. Appl. Environ. Microbiol. 63:3144-3150
240- Boyd, E. F., and H. Brussow. 2002. Common themes among bacteriophage-encoded virulence factors and diversity among the bacteriophages involved. Trends Microbiol. 10:521-529
241- Nelson CR. Drug utilization in office practice. National Ambulatory Medical Care Survey, 1990. Adv Data 1993;232:1-12. 242- McCaig LF, Hughes JM. Trends in antimicrobial drug prescribing among office-based physicians in the United States. JAMA 1995;273:214-219. 243- McGavok H, Webb CH, Johnston GD, et al. Market penetration of new drugs in one United Kingdom region: implicationsfor general practitioners and administrators. BMJ 1993; 307:1118-20.
244- McManus P, Hammond ML, Whicker SD, et al. Antibiotic use in the Australian community, 1990-1995. Med J Aust 1997; 167:124-7. 245- Gonzales R, Steiner JF, Sande MA. Antibiotic prescribing for adults with colds, upper respiratory tract infections, and bronchitisby ambulatory care physicians. JAMA 1997;278:901-904. 246- Nyquist AC, Gonzales R, Steiner JF, Sande MA. Antibiotic prescribing for children with colds, upper respiratory tract infections, and bronchitis. JAMA 1998;279:875-877. 247- Froom J, Culpepper L, Grob P, et al. Diagnosis and antibiotic treatment of acute otitis media: report from International Primary Care Network. BMJ 1990;300:582-6. 248- McConaghy JR. The evaluation and treatment of children with acute otitis media. J Fam Pract 2001;50:457-9. 249- Mainous AG 3rd, Zoorob RJ, Oler MJ, Haynes DM. Patient knowledge of upper respiratory infections: implications for antibiotic expectations and unnecessary utilization. J Fam Pract 1997;45:75-83. 250- Richman PB, Garra G, Eskin B, Nashed AH, Cody R. Oral antibiotic use without consulting a physician: a survey of ED patients. Am J Emerg Med 2001;19:57-60. 251- Wagner,P.L.,and M.K.Waldor . 2002 .bacteriophages control of bacterial virulence .Infect.Immun. 70:3985-3993. 252- Mattew K.Waldor,david I.Fridman, and Sankar L.Adhya. 2005. Phages. Their rol in bacterial pathogenisis and biotechnology .ASM press. Washington ,D.C. 253- Barksdale,L.,and S.B.Arden.1974.persisting bacteriophages infections, lysogeny and phage conversion ,Annu.Rev.Microbiol .28:265-297 254- Kaper,J.B.,and A.D.O’Brien. 1998 .Escherichia O157:H7 and other Shiga toxin-producing E.coli strains.ASM Press, Washington,D.C 255- Karch,H.,Schmidt,C.Janetzki-mittmann,J.scheef and M.Kroger. 1999-Shiga toxin even when different are encoded at identical positions
in the genomes of related temperate bacteriophages.Mol.Gen.Genet.262:600-607. 256- Neely,M.N.,and D.I Fridman. 1998. Functional and genetic analysis of regulatory regions of Coliphage H-19B: location of shiga-like toxin and lysis genes suggested a role for phage functions in toxin release .Mol. Microbiol. 28:1255-1267 257- Plukett,G.,III,D.J.Rose,T.J.Durfee and F.R.Blattner. 1999.Sequence of shiga toxin 2 phages 933 W from Escherchia coli O157:H7: shiga toxin as a phage late gene product,J.Bacteriol. 181:1767-1778. 258-Court,D.,C.Brady, M.Rosenberg,D.L.Wulff,M.Behr,M.mahoney and S.U.Izumi.1980.control of transcription termination: a rho-dependent termination site in bacteriophages lambda. J. Mol. Bacteriol/ 138:231-254. 259-Neely,M.N., and D.I.Friedman.2000.N-mediated transcription antitermination in lambdoid pahge H-19B is characterized by alternative NUT RNA structures and a reduced requirement for host factors. Mol.Microbiol.38:1074-1085. 260- Matsushio,A.K.Sato,H.Miyamoto,T.Yamamura , and T.Honda. 1999 .induction of prophages of enter hemorrhagic E.coliO157:H7 with norfloxacin. J. Bacteriol. 181:2257-2260. 261- Mitchell, T .J .,J. E.Alexander, P.J.Morgan and P.W.Andrew. 1997. Molecular analysis of virulent factors of Streptococcus pneumoniae.Sco Appl. Bacteriol. Symp. Ser. 26:62S-71S 263- Fattah,K.R. ,S.Mizutani, F.J.fattah, A.Mastushira and Y.Sugino . 2000, a comparison study of the immunity region of lambdoid phages including shiga –toxin-converting phages: Molecular bais for cross immunity .Gene Genet,Sys.75:223-233 264- Echols,H. ,L.Green, A.B.oppenheim, A.Oppenhim and A.Honigman. 1973. Role of the Cro gene in bacteriophages lambda development. J. Mol. Biol. 8:203-216. 265- Gannon,V.P.,C, Teerling,S.A.masri and C.L.Gyles. 1990. Molecular cloning and nucleotide sequencing of another variant of the E.coli Shiga-like toxin II family. J. Gen. Microbiol 136:1125-1135.
266- Grindley, N.O. 1983. transcription of Tn3 and related transposons. Cell 32: 3-5. 267-Figuera-Bossi, N.,and L.Bossi, 1999.Inducible prophages contribute to Salmonella virulence in mice.Mol.Microbiol. 33:167-176. 268- Frankel, G., A.D.philips,I .Rosenshine, G. Dougan, J.B.kaper, and S.knutton. 1998. Enteropathogenisis and enterohaemorrhagic E.coli more subversive elements.Mol.Microbiol. 30:911-921. 269- Johansen, B.K.,Y. Wasteson, P.E. Granum and S.Brynestad. 2001. Mosaic structure of shiga-toxin-2-encoding phages isolated from E.coliO157:H7 indicates frequent gene exchange between lambdoid phage genomes. Microbiology 147: 1929-1936. 270-Karaolis, D.K.,J. A.Jhonson , C.C. Bailey, E.C. Boedeker , J.B.Kaper and P.R.Reeves. 1998. a vibrio cholera pathogenisis island associated with epidemic and pandemic strains. Proc. Natl. Acad. Sci, USA 95:3134-3139 271- Kirby.J. E.trempy and S.Gottesman, 1994. Excision of P4-like crytic prophages leads to Alp protease expression in E.coli. J.bacteriol. 176:2068-2081.
272- Berg, C. M., and D. E. Berg. 1995. Transposable elements as tools for molecular analysis in bacteria, p. 38-68. In D. J. Sherratt (ed.), Mobile genetic elements. Oxford University Press, Oxford, England
273- Goryshin, I. Y., J. Jendrisak, L. M. Hoffman, R. Meis, and W. S. Reznikoff. 2000. Insertional transposon mutagenesis by electroporation of released Tn5 transposition complexes. Nat. Biotechnol. 18:97-100.
274- Mizuuchi, K. 1983. In vitro transposition of bacteriophage Mu: a biochemical approach to a novel replication reaction. Cell 35:785-794
275- Kleckner, N. 1979. DNA sequence analysis of Tn10 insertions: origin and role of 9 bp flanking repetitions during Tn10 translocation. Cell 16:711-720
276- Ray, D. S., and K. Kook. 1978. Insertion of the Tn3 transposon into the genome of the single-stranded DNA phage M13. Gene 4:109-119
277- Boeke, J. 2002. Putting mobile DNA to work: the toolbox, p. 24-37. In N. L. Craig, R. Craigie, R. Gellert and A. Lambowitz (ed.), Mobile DNA, 2nd ed. ASM Press, Washington D.C.
278-Casadaban, M. J. 1975. Fusion of Escherichia coli lac genes to ara promoter: a general technique using bacteriophage Mu-1 insertions. Proc. Natl. Acad. Sci. USA 72:809-813.
279- Pedulla,M.L,M.E.Ford,J.M.Houtz.2003-origion of highly mosaic mycobacteruiophage genomes.Cell.113:171-182. 280-Estella,L.A.,J.N.Sofoa and B.B flores. 1992. bacteriophages typing of L.monocytogenes cultures isolates from seafood J.food prort. 55:13-17. 281-Loessner,M.J.2001.improved procedure for bacteriophages typing of Listeria strains and evaluation of new phages. Appl. Environ. Microbiol.57:882-884. 282- Loessner,M.J .M.Busse. 2001.bacteriophages typing of Listera species .Appl.Envirion Microbiol. 56:12-19.
283- Bishai, W. R., and J. R. Murphy. 1988. Bacteriophage gene products that cause human disease, p. 683-724. In R. Calendar (ed.), The bacteriophages. Plenum Press, New York, N.Y.
284- Spanier, J. G., and P. P. Cleary. 1980. Bacteriophage control of antiphagocytic determinants in group A streptococci. J. Exp Med. 152:1393-1406 285- Guan, S., D. A. Bastin, and N. K. Verma. 1999. Functional analysis of the O-antigen glucosylation gene cluster of Shigella flexneri bacteriophage SfX. Microbiology 145:1263-1273. 286- Mavris, M., P. A. Manning, and R. Morona. 1997. Mechanism of bacteriophage SfII-mediated serotype conversion in Shigella flexneri. Mol. Microbiol. 26:939-950 287- Benchetrit, L. C., E. D. Gray, R. D. Edstrom, and L. W. Wannamaker. 1978. Purification and characterization of a hyaluronidase
associated with a temperate bacteriophage of group A, type 49 streptococci. J. Bacteriol. 134:221-228 288- Benchetrit, L. C., E. D. Gray, and L. W. Wannamaker. 1977. Hyaluronidase activity of bacteriophages of group A streptococci. Infect. Immun. 15:527-532. 289- Waldor, M. K. 1998. Bacteriophage biology and bacterial virulence. Trends Microbiol. 6:295-297 290- McDonough, M. A., and J. R. Butterton. 1999. Spontaneous tandem amplification and deletion of the Shiga toxin operon in Shigella dysenteriae 1. Mol. Microbiol. 34:1058-1069. 291- Ruzin, A., J. A. Lindsay, and R. P. Novick. 2001. Molecular genetics of SaPI1-a mobile pathogenicity island in Staphylococcus aureus. Mol. Microbiol. 41:365-377 292- Karaolis, D. K. R., S. Somara, D. R. Maneval, J. A. Johnson, and J. B. Kaper. 1999. A bacteriophage encoding a pathogenicity island, a type-IV pilus and a phage receptor in cholera bacteria. Nature 399:375-379
293- Yehle, C. O. 2000 . Genome-linked protein associated with the 5’ termini of bacteriophages ϕ105 DNA .J.Virol.27:776-783
294- Blasco , M. A., A. Bernard, L. Blanco and M. salas. 2001 . Characterization and mapping of the pyrophosphorolytic activity of phage ϕd9 DNA polymerase. J.Biol.Chem.266:7904-7909
295- Gutierrez, J., J. A. garcia M. Salsa,1988- characterization of origins of replication of ϕ29 DNA.Nucleic acid Res. 16:5895-5914
296- Serrano ,M.,I.Bartheleny and M.Salas, 1991 . Transcription activation at the distance by ϕ29 protein P4 effect of bent and non-bent interrening DNA seq, J.Mol.Biol. 219:403-414
297- Blanco. L.,A. Bernard and M.Salas . 1992 . evidence favouring the hypothesis of a conserved 3’-5’ exonuclease active site in DNA –dependent DNA polymerase. Gene. 112:139-144
298- Baker, T.A (1995) bacteriophages Mu: a transposing phage that integrate like retroviruses. Seminars in virology 6, 53-63
299- Karam, J.D(ed)(1994) molecular biology of bacteriophages T4. Washington DC: ASM press
300- http://www.ictvdb.rothamsted.ac.uk
301- Hildegard Etz, Duc Bui Minh, Carola Schellack, Eszter Nagy, and Andreas Meinke . 2001, Bacterial Phage Receptors, Versatile Tools for Display of Polypeptides on the Cell Surface p. 6924-6935, Vol. 183, No. 23
302- Charbit, A., A. Molla, W. Saurin, and M. Hofnung. 1988. Versatility of a vector for expressing foreign polypeptides at the surface of gram-negative bacteria. Gene 70:181-189
303- B. L. Geller1, H. T. Ngo2, D. T. Mooney1, P. Su3 and N. Dunn2 2005. Lactococcal 936-Species Phage Attachment to Surface of Lactococcus lactis J. Dairy Sci. 88:900-90
304-Beumer, J., E. Hannecart-Pokorni, and C. Godard. 1984. Bacteriophage receptors. Bull. Inst. Pasteur 82:173–253.
305-Valyasevi, R., W. E. Sandine, and B. L. Geller. 1990. Bacteriophage KH receptor of Lactococcus lactis subsp. cremoris KH is the rhamnose of the extracellular wall polysaccharide. Appl. Environ. Microbiol. 56:1882–1892
306-Estrela, A. I., H. M. Pooley, H. de Lencastre, and D. Karamata. 1991. Genetic and biochemical characterization of Bacillus subtilis 168 mutants specifically blocked in the synthesis of the teichoic acid poly(3-O-b-D-glucopyranosyl-N- acetylgalactosamine 1-phosphate): gneA, a new locus, is associated with UDP-N-acetylglucos-amine 4-epimerase activity. J. Gen. Microbiol. 137:943–950.
307-Schafer, A., A. Geis, H. Neve, and M. Teuber. 1991. Bacteriophage receptors of Lactococcus lactis subsp. "diacetylactis" F7/2 and Lactococcus lactis subsp. cremoris Wg2-1. FEMS Microbiol. Lett. 77:69–74.
308-Valyasevi, R., W. E. Sandine, and B. L. Geller. 1994. Lactococcus lactis subsp. lactis C2 bacteriophage sk1 receptor involving rhamnose and glucose moieties in the cell wall. J. Dairy Sci. 77:1–6.
309-Quiberoni, A., J. I. Stiefel, and J. A. Reinheimer. 2000. Characterization of phage receptors in Streptococcus thermophilus using
purified cell walls obtained by a simple protocol. J. Appl. Microbiol. 89:1059–1065
310-Archibald, A. R. 1980. Phage receptors in gram-positive bacteria. Pages 7–26 in Receptors and Recognition, Series B, Vol. 7, Virus Receptors Part 1, Bacterial Viruses. L. L. Randall and L. Philipson, ed. Chapman and Hall, London, UK.
311-Monteville, M. R., B. Ardestani, and B. L. Geller. 1994. Lactococcal bacteriophages required a host cell wall carbohydrate and a plasma membrane protein for adsorption and ejection of DNA. Appl. Environ. Microbiol. 60:3204–3211 312-Dupont, K., T. Janzen, F. K. Vogensen, J. Josephsen, and B. Stuer-Lauridsen. 2004a. Identification of Lactococcus lactis genes required for bacteriophage adsorption. Appl. Environ. Microbiol. 70:5825–5832 313-Roberts, J., and R. Devoret. 1983. Lysogenic induction, p. 123-144. In R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 314-Carlose Canchaya, Caroline Prousx, Ghislain Fournouse, Anne Bruttine and Harald Brusscow.2003 . Prophage Genomics. MMBR, 67:2,238-276 315-Botstein,D 1980.A theory of modular evolution for bacteriophages.Ann.N.Y Acad.Sci.354:484-490
316- Botstein, D. 1980. A theory of modular evolution for bacteriophages. Ann. N. Y. Acad. Sci. 354:484-490.
317- Roger W. Hendrix , Margaret C. M. Smith , R. Neil Burns , Michael E. Ford, and Graham F. Hatfull .1999. Evolutionary relationships among diverse bacteriophages and prophages: All the world's a phage. PNAS. 96: 5, 2192-2197 318- Lawrence, J. G. & Ochman, H. (1998) Proc. Natl. Acad. Sci. USA 95, 9413-9417. 319- Elizabeth J. Summer,1 Carlos F. Gonzalez,2 Morgan Bomer,1 Thomas Carlile,1 Addie Embry,1 Amalie M. Kucherka,1 Jonte Lee,1
Leslie Mebane,1 William C. Morrison,1 Louise Mark,3 Maria D.
King,1 John J. LiPuma,4 Anne K. Vidaver, and Ry Young1*. 2006. Divergence and Mosaicism among Virulent Soil Phages of the Burkholderia cepacia Complex. J.Bacteriology.188:255-268
320- Hendrix, R. W., M. C. Smith, R. N. Burns, M. E. Ford, and G. F. Hatfull. 1999. Evolutionary relationships among diverse bacteriophages and prophages: all the world's a phage. Proc. Natl. Acad. Sci. USA 96:2192-2197
321-de la Cruz, F., and J. Davies. 2000. Horizontal gene transfer and the origin of species: lessons from bacteria. Trends Microbial. 8:128-133
322- Jain, R., M. C. Rivera, and J. A. Lake. 1999. Horizontal gene transfer among genomes: the complexity hypothesis. Proc. Natl. Acad. Sci. USA 96:3801-3806.
323- Krishnapillai, V. 1996. Horizontal gene transfer. J. Genet. 75:219-232.
324- Ochman, H., J. G. Lawrence, and E. A. Groisman. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature 405:299-304.
325- Syvanen, M. 1994. Horizontal gene-transfer—evidence and possible consequences. Annu. Rev. Genet. 28:237-261.
326- Davison, J. 1999. Genetic exchange between bacteria in the environment. Plasmid 42:73-91
327- Hacker, J., and J. B. Kaper. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641-679
328- Merlin, C., J. Mahillon, J. Nevera, and A. Toussaint. 2000. Gene recruiters and transporters: the modular structure of bacterial mobile elements, p. 363-409. In C. M. Thomas (ed.), The horizontal gene pool—bacterial plasmids and gene spread. Harwood Academic, Amsterdam, The Netherlands.
329- Hall, R. M., and H. W. Stokes. 1993. Integrons: novel DNA elements which capture genes by site-specific recombination. Genetica 90:115-132.
330- Hacker, J., and E. Carniel. 2001. Ecological fitness, genomic islands and bacterial pathogenicity—a Darwinian view of the evolution of microbes. EMBO Rep. 2:376-381
331- HIV-1 genomic map.2007.HIV sequence database http://HIV-1 map (HXB2).html
332-Klinman DM, Yamshchikov G, Ishigatsubo Y.1997. Contribution of CpG motifs to the immunogenicity of DNA vaccines J Immunol. 15;158(8):3635-9.
333-Ronald K.Scheule. 2000. The role of CpG motifs in Immunostimulation and gene therapy. Elsevier Science B.V. 119-134
334- Samuel J. Landry.2001.Immunoglobulin structure.article.
335-Arthur M Krieg.2000. The role of CpG motifs in innate immunity. Volume 12, Issue 1, 1 February, Pages 35-43
336-Koike, R., T. Iizuka, T. Watanabe, and N. Miyasaka. 2001. The GOR gene product cannot cross-react with hepatitis C virus in humans. Clin. Exp. Immunol. 124:429-434
337-Mishiro, S., K. Takeda, Y. Hoshi, A. Yoshikawa, T. Gotanda, and Y. Itoh. 1991. An autoantibody cross-reactive to hepatitis C virus core and a host nuclear antigen. Autoimmunity 10:269-273
338-E. BALESTRA, S. AQUARO, C.F. PERNO.2006. HIV/HCV co-infection: the magnitude of the problem. Journal of Biological Regulators and Homeostatic Agents. 0393-974X/138-06
339-Choo et al., 1991; Miller and Purcell, 1990; Muerhoff et al., 1995 340-Blight and Rice, 1997; Kolykhalov et al., 1996; Tanaka et al., 1995; Tanaka et al., 1996; Yamada et al., 1996 341-Stephanie T. Shi and Michael M. C. Lai.2006. HCV 5' and 3'UTR: When Translation Meets Replication. chapter 2 342-Matthew B Rogers, Nicola J Patron and Patrick J Keeling.2007. Horizontal transfer of a eukaryotic plastid-targeted protein gene to cyanobacteria. BMC Biology , 5:26doi
343-Kurth R. Oncogenes in retroviruses and cells. Naturwissenschaften. 1983 Sep;70(9):439-50 344-Robert J. Gifford. 2006. Evolution at the host-retrovirus interface BioEssays. Volume 28 Issue 12, Pages 1153 – 1156
345-Matt McIntosh. 2008. Retroviruses & Evolution .Gene expression. Article. February 08, 2008
346-Schmieger H, Schicklmaier P. Transduction of multiple drug resistance of Salmonella enterica serovar Typhimurium DT104. FEMS Microbiol Lett. 1999;170:251–6.
347-Willi K, Sandmeier H, Kulik EM, Meyer J. Transduction of antibiotic resistance markers among Actinobacillus actinomycetemcomitans strains by temperate bacteriophages Aa phi 23. Cell Mol Life Sci. 1997;53:904–10.
348-Pereira MS, Barreto VP, Siqueira-Junior JP. Phage-mediated transfer of tetracycline resistance in Staphylococcus aureus isolated from cattle in Brazil. Microbios. 1997;92:147–55.
349-Blahova J, Hupkova M, Babalova M, Krcmery V, Schafer V. Transduction of resistance to imipenem, aztreonam and ceftazidime in nosocomial strains of Pseudomonas aeruginosa by wild-type phages. Acta Virol. 1993;37:429–36.
350-Blanchard TJ, Poston SM, Reynolds PJ. Recipient characteristics in the transduction of methicillin resistance in Staphylococcus epidermidis. Antimicrob Agents Chemother. 1986;29:539–41.
351-Willi K, Sandmeier H, Kulik EM, Meyer J. Transduction of antibiotic resistance markers among Actinobacillus actinomycetemcomitans strains by temperate bacteriophages Aa phi 23. Cell Mol Life Sci. 1997 Dec;53(11-12):904-10
352-Blahová J, Hupková M, Babálová M, Krcméry V, Schäfer V. Transduction of resistance to Imipenem, Aztreonam and Ceftazidime in nosocomial strains of Pseudomonas aeruginosa by wild-type phages. Acta Virol. 1993 Dec;37(6):429-36
353-SHIZUKO IYOBE, HITOSHI SAGAI, AND SUSUMU MITSUHASHI. Tn2001, a Transposon Encoding Chloramphenicol Resistance in Pseudomonas aeruginosa JB Apr. 2001, p. 141-148 354-Denise L. Woodworth 1 Kenneth N. Kreuzer. A system of transposon mutagenesis for bacteriophage T4. Molecular Microbiology. 2006.Volume 6 Issue 10, Pages 1289 – 1296.
355-Gerard J. Criner, Gilbert E. D'Alonzo. Critical Care Study GuideText and ReviewPublished by Springer, 2002 ISBN 0387951644, 9780387951645 –page 732. 356-M. Sørum, P. J. Johnsen, B. Aasnes, T. Rosvoll, H. Kruse, A. Sundsfjord, and G. S. Simonsen. Prevalence, Persistence, and Molecular Characterization of Glycopeptide-Resistant Enterococci in Norwegian Poultry and Poultry Farmers 3 to 8 Years after the Ban on Avoparcin.2006-Appl Environ Microbiol. 2006 January; 72(1): 516–521. 357-Michel Arthur, Florence Depardieu, Peter Reynolds, and Patrice Courvalin. Moderate-Level Resistance to Glycopeptide LY333328 Mediated by Genes of the vanA and vanB Clusters in Enterococci. Antimicrob Agents Chemother. 1999 August; 43(8): 1875–1880. 358-Helen S. Garmory and Richard W. Titball. ATP-Binding Cassette Transporters Are Targets for the Development of Antibacterial Vaccines and Therapies. Infect Immun. 2004 December; 72(12): 6757–6763. 359-Young, J., and I. B. Holland. 1999. ABC transporters: bacterial exporters—revisited five years on. Biochim. Biophys. Acta 1461:177-200 360-Helen S. Garmory and Richard W. Titball. ATP-Binding Cassette Transporters Are Targets for the Development of Antibacterial Vaccines and Therapies. Infect Immun. 2004 December; 72(12): 6757–6763
361-Antje Pohl, Philippe F. Devauxand Andreas Herrmann. Function of prokaryotic and eukaryotic ABC proteins in lipid transport. doi:10.1016/j.bbalip.2004.12.007
362-Schneider, E. 2001. ABC transporters catalyzing carbohydrate uptake. Res. Microbiol. 152:303-310
363-Hosie, A. H. F., and P. S. Poole. 2001. Bacterial ABC transporters of amino acids. Res. Microbiol. 152:259-270.
364-Detmers, F. J. M., F. C. Lanfermeijer, and B. Poolman. 2001. Peptides and ATP binding cassette peptide transporters. Res. Microbiol. 152:245-258.
365-Igarashi, K., K. Ito, and K. Kashiwagi. 2001. Polyamine uptake systems in Escherichia coli. Res. Microbiol. 152:271-278
366-Claverys, J.-P. 2001. A new family of high-affinity ABC manganese and zinc permeases. Res. Microbiol. 152:231-243.
367-Kertesz, M. A. 2001. Bacterial transporters for sulfate and organosulfur compounds. Res. Microbiol. 152:279-290.
368-Self, W. T., A. M. Grunden, A. Hasona, and K. T. Shanmugam. 2001. Molybdate transport. Res. Microbiol. 152:311-321.
369-Köster, W. 2001. ABC transporter-mediated uptake of iron, siderophores, heme and vitamin B12. Res. Microbiol. 152:291-301.
370-Silver, R. P., K. Prior, C. Nsalai, and L. F. Wright. 2001. ABC transporters and the export of capsular polysaccharides from Gram-negative bacteria. Res. Microbiol. 152:357-364
371-Méndez, C., and J. A. Salas. 2001. The role of ABC transporters in antibiotic-producing organisms: drug secretion and resistance mechanisms. Res. Microbiol. 152:341-350.
372-van Veen, H. W., C. F. Higgins, and W. N. Konings. 2001. Multidrug transport by ATP binding cassette transporters: a proposed two-cylinder engine mechanism. Res. Microbiol. 152:265-274.
373-Goosen, N., and G. F. Moolenaar. 2001. Role of ATP hydrolysis by UvrA and UvrB during nucleotide excision repair. Res. Microbiol. 152:401-409
374-Arthur, M., Molinas, C., and Courvalin, P. (1992) J. Bacteriol. 174,2582-2591
375-Wright, G. D., Holman, T. R., and Walsh, C. T. (1993) Biochemistry 32,5057-5063
376-Stewart L. Fisher,Weihong Jiang, Barry L. Wanner, Christopher T. Walsh. Cross-talk between the Histidine Protein Kinase
VanS and the Response Regulator PhoB. 1995.Volume 270, Number 39, Issue of September 29, pp. 23143-23149.
377-Parkinson, J. S., and Kofoid, E. C. (1992) Annu. Rev. Genet. 26,76-112
378-Parkinson, J. S. (1993) Cell 73,857-871
379-Maeda, T., Wurgler-Murphy, S. M., and Saito, H. (1994) Nature 369,242-245
380-Ota, I. M., and Varshavsky, A. (1993) Science 262,566-569
381-Cheng, C., Kwok, S. F., Bleecker, A. B., and Meyerowitz, E. M. (1993) Science 262,539-544
382-Swanson, R. V., Alex, L. A., and Simon, M. I. (1994) Trends Biochem. Sci. 19,485-490
383-Igo, M. M., Ninfa, A. J., Stock, J. B., and Silhavy, T. J. (1989) Genes & Dev. 3,1725-1734
384-Ninfa, A. J., Ninfa, E. G., Lupas, A. N., Stock, A., Magasanik, B., and Stock, J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,5492-5496.
385-Skerker JM, Prasol MS, Perchuk BS, Biondi EG, Laub MT. Two-component signal transduction pathways regulating growth and cell cycle progression in a bacterium: a system-level analysis.2005. PLoS Biol. 3 e334
386-Zahn K, Blattner FR. Sequence-induced DNA curvature at the bacteriophage lambda origin of replication. 1995 Oct 3-9;317(6036):451-3
387-Il Joong Park, Wee Gyo Lee, Young Ae Lim, and Sung Ran Cho. Genetic Rearrangements of Tn1546-Like Elements in Vancomycin-Resistant Enterococcus faecium Isolates Collected from Hospitalized Patients over a Seven-Year Period.2007. p. 3903-3908, Vol. 45, No. 12
388-Nancye C. Clark,* Linda M. Weigel, Jean B. Patel, and Fred C. Tenover. Comparison of Tn1546-Like Elements in Vancomycin-Resistant Staphylococcus aureus Isolates from Michigan and Pennsylvania.2005. p. 470-472, Vol. 49, No. 1.
389-Kidwell, M.G. (2005). "Transposable elements.". in (ed. T.R. Gregory). The Evolution of the Genome. San Diego: Elsevier. pp. 165–221. ISBN 0-12-301463-8.
390-Abigail A. Salyers, Nadja B. Shoemaker. Broad host range gene transfer: plasmids and conjugative transposons.2006.FEMS. Volume 15 Issue 1-2, Pages 15 - 22 391-Salyers, A. A., and N. B. Shoemaker. 1996. Resistance gene transfer in anaerobes: new insights, new problems. Clin. Infect. Dis. 23(Suppl.):S36–S43. 392-Roberts, M. C., W. O. Chung, and D. E. Roe. 1996. Characterization of tetracycline and erythromycin resistance determinants in Treponema denticola. Antimicrob. Agents Chemother. 40:1690–1694. 393-Salyers, A. A., N. B. Shoemaker, L. Y. Li, and A. M. Stevens. 1995. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements. Microbiol. Rev. 59:579–590. 394-ABIGAIL A. SALYERS1* AND CARLOS F. AM´ABILE-CUEVAS. Why Are Antibiotic Resistance Genes So Resistant to Elimination? ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 1997, p. 2321–2325. 395-Ichizo Kobayashi. Life cycle of restriction–modification gene complexes, powers in genome evolution. Elsevier Science Volume 1246, December 2002, Pages 191-200 396-Thomas Rattei1, Mathias Walter2, Andreas Försch1, Hans-Werner Mewes1. Structuring the Horizontal Gene Pool.2007. GSF - National Research Centre for Environment and Health, Institute for Bioinformatics 397-Roger W. Hendrix, Margaret C. M. Smith, R. Neil Burns, Michael E. Ford, and Graham F. Hatfull. Evolutionary relationships among diverse bacteriophages and prophages: All the world’s a phage.1999. Proc Natl Acad Sci U S A. 1999 March 2; 96(5): 2192–2197
398-Chongwoo A. Kim and James U. Bowie. SAM domains: uniform structure, diversity of function.2003. Volume 28, Issue 12, December 2003, Pages 625-628 399-Dong Jiang, Haitao Guo, Chunxiao Xu, Jinhong Chang, Baohua Gu, Lijuan Wang, Timothy M. Block, and Ju-Tao Guo. Identification of Three Interferon-Inducible Cellular Enzymes That Inhibit the Replication of Hepatitis C Virus. J Virol. 2008 February; 82(4): 1665–1678 400-Kavita Deonarine, Monica C Panelli, Mitchell E Stashower, Ping Jin, Kina Smith, Herbert B Slade, Christopher Norwood, Ena Wang, Francesco M Marincola, and David F Stroncek. Gene expression profiling of cutaneous wound healing. J Transl Med. 2007; 5: 11 401-Church, D., S. Elsayed, O. Reid, B. Winston, and R. Lindsay. 2006. Burn wound infections. Clin. Microbiol. Rev. 19:403-434 402-Pruitt, B. A., Jr. 1984. The diagnosis and treatment of infection in the burn patient. Burns 11:79-91 403-Catherine S. McVay, Marisela Velásquez, and Joe A. Fralick. Phage Therapy of Pseudomonas aeruginosa Infection in a Mouse Burn Wound Model. Antimicrobial Agents and Chemotherapy, June 2007, p. 1934-1938, Vol. 51, No. 6 404-Ryohei Watanabe, Tetsuya Matsumoto, Go Sano, Yoshikazu Ishii, Kazuhiro Tateda,Yoshinobu Sumiyama, Jumpei Uchiyama, Shingo Sakurai, Shigenobu Matsuzaki, Shosuke Imai and Keizo Yamaguchi. Efficacy of Bacteriophage Therapy against Pseudomonas aeruginosa gut-derived Sepsis in Mice.2006. Antimicrob Agents Chemother. 2007 February; 51(2): 446–452. 405-Harald Brüssow. Phage therapy: the Escherichia coli experience. Microbiology 151 (2005), 2133-2140 406-Hagens, S., A. Habel, U. von Ahsen, A. von Gabain, and U. Blasi. 2004. Therapy of experimental Pseudomonas infections with a nonreplicating genetically modified phage. Antimicrob. Agents Chemother. 48:3817-3822. 407-Matsuzaki, S., M. Yasuda, H. Nishikawa, M. Kuroda, T. Ujihara, T. Shuin, Y. Shen, Z. Jin, S. Fujimoto, M. D. Nasimuzzaman, H.
Wakiguchi, S. Sugihara, T. Sugiura, S. Koda, A. Muraoka, and S. Imai. 2003. Experimental protection of mice against lethal Staphylococcus aureus infection by novel bacteriophage phi MR11. J. Infect. Dis. 187:613-624. 408-Barrow, P., M. Lovell, and A. Berchieri, Jr. 1998. Use of lytic bacteriophage for control of experimental Escherichia coli septicemia and meningitis in chickens and calves. Clin. Diagn. Lab. Immunol. 5:294-298. 409-Biswas, B., S. Adhya, P. Washart, B. Paul, A. N. Trostel, B. Powell, R. Carlton, and C. R. Merril. 2002. Bacteriophage therapy rescues mice bacteremic from a clinical isolate of vancomycin-resistant Enterococcus faecium. Infect. Immun. 70:204-210 410-Skurnik M, Strauch E. Phage therapy: facts and fictionInt J Med Microbiol. 2006 Feb;296(1):5-14. Epub 2005 Nov 15