pharmacological nad-boosting strategies improve...
TRANSCRIPT
MOL #97204
1
Pharmacological NAD-boosting strategies improve mitochondrial homeostasis in human
Complex I-mutant fibroblasts
Roberta Felici, Andrea Lapucci, Leonardo Cavone, Sara Pratesi, Rolando Berlinguer-Palmini and
Alberto Chiarugi
Department of Health Sciences, Section of Clinical Pharmacology and Oncology, University of
Florence, Florence, Italy RF, AL, LC, AC
Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy S.P.
School of Electric and Electronic Engineering - Institute of Neuroscience, Newcastle University,
Newcastle, United Kingdom RBP
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
2
Running Title
NAD boosting strategies and mitochondrial defects
Author for Correspondence:
Roberta Felici, Ph.D.
Department of Health Sciences
Section of Clinical Pharmacology and Oncology
University of Florence
Viale Pieraccini 6
50139 Firenze
Italy
Phone: +39-055-4271230
Fax: +39-055-4271280
Email: [email protected]
Number of text pages: 22
Number of tables: 0
Figures: 5
References: 40
Number of words in the Abstract: 245
Introduction: 677
Discussion: 801
Abbreviations
ATP5D, ATP synthase H+ transporting mitochondrial F1 complex delta subunit; NRF, nuclear
respiratory factor; CI, complex I; COX, cytochrome c oxidase; mtDNA, mitochondrial DNA; MTT, 3-
(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; nDNA, nuclear DNA; NDUFS1, NADH
dehydrogenase (ubiquinone) Fe-S protein 1; NDUFV2, NADH dehydrogenase (ubiquinone)
flavoprotein 2; ND2, NADH dehydrogenase 2; NR, nicotinamide riboside; NRF-1/2, nuclear
respiratory factor 1/2; OXPHOS, oxidative phosphorylation; PARP, poly(ADP-ribose) polymerase;
PGC1α/β, peroxisome proliferator-activated receptor gamma coactivator 1-alpha/beta; Phe, 6-(5H)-
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
3
phenanthridinone; PJ34, [N-(6-oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide.HCl];
PPCR1, peroxisome proliferator-activated receptor gamma, coactivator-related 1; ROS, reactive
oxygen species; TFAM, mitochondrial transcription factor A; TFB1M, mitochondrial transcription
factor B1; TFB2M, mitochondrial transcription factor B2; TMRE, tetramethylrhodamine ethyl ester.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
4
Abstract
Mitochondrial disorders are devastating genetic diseases for which efficacious therapies are still an
unmet need. Recent studies report that increased availability of intracellular NAD obtained by
inhibition of the NAD-consuming enzyme poly (ADP-ribose) polymerase (PARP)-1 or
supplementation with the NAD-precursor nicotinamide riboside (NR) ameliorates energetic
derangement and symptoms in mouse models of mitochondrial disorders. Whether these
pharmacological approaches also improve bioenergetics of human cells harbouring mitochondrial
defects is unknown. It is also unclear whether the same signaling cascade is prompted by PARP-1
inhibitors and NR supplementation to improve mitochondrial homeostasis. Here, we show that
human fibroblasts mutant for NDUFS1 subunit of respiratory Complex I have similar ATP, NAD and
mitochondrial content compared to control cells, but show reduced mitochondrial membrane
potential. Interestingly, mutant cells also show increased transcript levels of mtDNA but not nDNA
respiratory complex subunits, suggesting activation of a compensatory response. At variance with
prior work in mice, however, NR supplementation but not PARP-1 inhibition increased intracellular
NAD content in NDUFS1 mutant human fibroblasts. Conversely, PARP-1 inhibitors but not NR
supplementation increased transcription of TFAM and mtDNA-encoded respiratory complexes
constitutively induced in mutant cells. Still, both NR and PARP-1 inhibitors restored mitochondrial
membrane potential and increased organelle content, as well as oxidative activity of NDUFS1-
deficient fibroblasts. Overall, data provide the first evidence that in human cells harbouring a
mitochondrial respiratory defect exposure to NR or PARP-1 inhibitors activate different signaling
pathways not invariantly prompted by NAD increases, but equally able to improve energetic
derangement.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
5
Introduction
Mitochondrial diseases are devastating disorders due to various defects of mitochondrial
functioning such as deficiencies in electron transport chain, protein importation, fusion/fission as
well as regulation of programmed cell death. Mutations in nuclear or mitochondrial genes typically
underpin the etiology of these disorders (Wallace, 1999;Dimauro and Schon, 2008). Despite the
identification of the primary genetic defects, pathogenesis of mitochondrial disorders is not well
understood. An intricate cascade of detrimental signals and metabolic impairment originates from
the primary genetic mutations, and is responsible for cell demise and clinical symptoms (Kleist-
Retzow et al., 1998;Skladal et al., 2003). Given the extreme difficulty in finding a cure for these
genetic disorders, identification and targeting of death pathways prompted by the original gene
defect represents a feasible strategy of relevance to symptomatic treatment of mitochondrial
disease patients (Moslemi and Darin, 2007).
Respiratory Complex I (CI) deficiency is one of the most common cause of oxidative
phosphorylation (OXPHOS) defects in childhood. Neurological symptoms occur at the age of ~4
months and the majority of patients die within the first 5 years of life (Dimauro and Schon,
2008;Spinazzola and Zeviani, 2009). A great deal of effort has been directed at identifying the
molecular mechanisms responsible for neurodegeneration in children affected by OXPHOS
defects. Evidence points to excessive production of reactive oxygen species (ROS) as the primary
cause of cell demise in these patients and in particular in those affected by CI deficiency (Fato et
al., 2008). Although pharmacological strategies able to counteract ROS-dependent oxidative stress
in mitochondrial disease patients has a strong therapeutic rationale (Murphy and Smith,
2007;Dimauro and Rustin, 2009) the identification of compounds reducing tissue degeneration in
children with respiratory chain disorders is still an unmet need (Dimauro and Mancuso, 2007).
During the last several years the biochemistry of pyridine nucleotide [NAD(H) and NADP(H)]
biosynthetic pathways has been revisited in detail, and two main concepts on NAD homeostasis
emerged. First, NAD-synthesizing enzymes and those responsible for its continuous consumption
regulate an unexpected, large array of key cellular processes (Canto and Auwerx, 2012;Chiarugi
et al., 2012;Koch-Nolte et al., 2009). Second, given that availability of pyridine nucleotides is
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
6
limiting several NAD-dependent processes, pharmacological approaches able to improve NAD
availability holds remarkable therapeutic potential for different human disorders (Dolle et al.,
2013;Houtkooper and Auwerx, 2012;Sauve, 2008).
As far as mitochondrial homeostasis is concerned, recent reports indicate that increased cellular
NAD availability improves organelles’ functioning and cell metabolism (Bai et al., 2011b;Bai et al.,
2011a;Pittelli et al., 2011;Canto et al., 2012;Cerutti et al., 2014;Khan et al., 2014). In this regard,
both pharmacological and genetic suppression of the major NAD-consuming enzyme poly(ADP-
ribose) polymerase (PARP)-1 increase NAD contents in different organs and overall oxidative
metabolism in mice (Bai et al., 2011b). Similarly, diet supplementation with the NAD precursor
nicotinamide riboside (NR) ameliorates metabolic defects of obese mice, boosts their energy
expenditure and, overall, reverts metabolic impairment (Canto et al., 2012). Recent contributions
report the ability of PARP-1 inhibitors or NR supplementation to improve mitochondrial defects and
muscle fitness in both healthy mice and in those with mitochondrial myopathy (Khan et al.,
2014;Cerutti et al., 2014;Pirinen et al., 2014). In keeping with this, diet supplementation with
additional NAD precursors such as nicotinamide or nicotinamide mononucleotide partially
normalizes mitochondrial defects in CI-deficient mouse cardiomyocytes (Karamanlidis et al., 2013).
As for the molecular mechanisms underpinning these therapeutic effects, it has been proposed
that NAD precursors increase cellular NAD content and the activity of the NAD-dependent
enzymes sirtuins (in particular Sirt1) which are master regulators of mitochondrial biogenesis,
respiration and energy production/expenditure (Bai et al., 2011b;Bai et al., 2011a).
Of note, NR is a NAD precursor present in daily diet (Bieganowski and Brenner, 2004), whereas
PARP-1 inhibitors reached the clinic for antineoplastic purposes, showing an acceptable safety
profile (Yap et al., 2011). In the present study, we evaluated the effects of NR or PARP-1 inhibition
on CI-deficient human fibroblasts obtained from a 6 month patient with progressive
leukoencephalopathy (Bugiani et al., 2004), in order to confirm data obtained in mice and help
defining the realistic translational potential of NAD-boosting strategies to mitochondrial disease
patients.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
7
Materials and Methods
Cell culturing
Control fibroblasts and patient’s fibroblasts (Iuso et al., 2006) were grown in Dulbecco’s modified
Eagle’s medium supplemented with 2 mM glutamine, 10% fetal bovine serum, and antibiotics.
Cultures were brought to 50 to 70% confluence and used for the experiments. Cells were exposed
to 6-(5H)-phenanthridinone (Phe), [N-(6-oxo-5,6-dihydrophenanthridin-2-yl)-N,N-
dimethylacetamide.HCl] (PJ34) or nicotinamide riboside (NR), directly dissolved in the culture
media. Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT)
assay and phase-contrast microscopy. An inverted Nikon TE-2000U microscope equipped with a
change-coupled device camera was used for cell visualization.
Measurement of mitochondrial membrane potential
Mitochondrial membrane potential was evaluated by means of flow cytometry (Felici et al., 2014).
NDUFS1 mutant fibroblasts were treated with vehicle, NR or with the PARP-1 inhibitors PJ34 (20
μM) or Phe (20 μM). Cells were then detached, incubated with tetramethylrhodamine ethyl ester
(TMRE) 2.5 nM, and analyzed with a Coulter EPICS XL flow cytometer (Beckman Coulter,
Fullerton, CA, USA) equipped with the EXPO32 Flow Cytometry ADC software (Beckman Coulter).
NAD and ATP quantification
NAD contents were quantified by means of an enzymatic cycling procedure (Felici et al., 2013).
Briefly, cells grown in a 48 well plate were killed with 50 ml HClO4 1N and then neutralized with an
equal volume of KOH 1N. After the addition of 100 ml of bicine 100 mM pH 8, 50 ml of the cell
extract was mixed with an equal volume of the bicine buffer containing 23 ml/ml ethanol, 0.17
mg/ml MTT, 0.57 mg/ml phenazine ethosulfate and 10 mg alcohol dehydrogenase. Mixture was
kept at room temperature for 20 minutes and then absorbance a 550 nm was measured. A
standard curve allowed quantification of NAD. The cellular ATP content were measured by means
of an ATPlite kit from PerkinElmer Life and Analytical Sciences (Zaventem, Belgium) as described
previously (Pittelli et al., 2011).
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
8
Evaluation of mtDNA content and respiratory subunits expression levels
Genomic DNA and total RNA were extracted from control and NDUFS1 mutant fibroblasts with the
nucleoSpin TriPrep kit (Macherey-Nagel), and real-time polymerase chain reaction was performed
as previously reported (Lapucci et al., 2011). Mitochondrial content was quantified by measuring
the ratio between mitochondrial D-loop and nuclear 18S gene amplification products (Lapucci et
al., 2011). The following primers were used: for COX1— forward 5’-
TACCAGGCTTCGGAATAATCTC-3’ and reverse 5’-GATAGCGATGATTATGGTAGCG-3’; for
COX2—forward 5’-CTCCTTGACGTTGACAATCG-3’ and reverse 5’-
CCACAGATTTCAGAGCATTGA-3’; for mt-ND2—forward 5’-AGGTGGATTAAACCAAACCCAG-3’
and reverse 5’-CGAGATAGTAGTAGGGTCGTGG-3’; for NDUFV2—forward 5’-
GCTGTTCTTCCAGTCCTGGATTTA -3’ and reverse 5’-CAGAGTTTCGAAGCATGCAGGGTG-3’;
for COX15—forward 5’-CCCTTTGAGGCCAGGGCAATAC-3’ and reverse 5’-
AATGCCAATCTACCATCGAGAGGCC-3’; for ATP5D—forward 5’-
ATGTCCTTCACCTTCGCCTCTCC -3’ and reverse 5’-GGAACCGCTGCTCACAAAGTATTTGG-3’;
for TFB1M—forward 5’-TGCAAGCAGCGAAGCAGCTATC-3’ and reverse 5’-
TTCAACCACCAGAAGTTCAGCG-3’; for TFB2M—forward 5’- CGATCGGAGATTGGCTGAGAC-
3’ and reverse 5’- TCACTTTCGAGCGCAACCAC-3’; for SIRT1—forward 5’-
CCCAGATCTTCCAGATCCTCAAGC -3’ and reverse 5’-GCAACCTGTTCCAGCGTGTCTATG-3’;
for TFAM—forward 5’-CCGGCTGTGGAAGTCGACTGCGC 3’ and reverse 5’-
TCCCTCCAACGCTGGGCAATTCTTC -3’; for PGC1α—forward 5’-
CCAGGTCAAGATCAAGGTCTCCAGG-3’ and reverse 5’-
ATATTCTTCCCTCTTCAGCCTCTCGTG-3’; for PGC1β—forward 5’-
CGAAGGAACTTCAGATGTGAGAGCAGA-3’ and reverse 5’-
GTCAGCACCTCGCACTCCTCAATCT --3’; for NRF-1—forward 5’-
GAAGATCAGCAAACGCAAACACAGGCCA-3’ and reverse 5’-
GAATAATTCACTTGGGCAACGGTGACCG-3’; for NRF-2—forward 5’-
GACCTCACCACACTCAACATTTCGGG-3’ and reverse 5’-
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
9
GCACTGATGCTGGAATAATTTGCACAGG-3’; for PPRC1—forward 5’-
CTCGCGGGCAGTCTACTGTAGGTA-3’ and reverse 5’-
GGACTACTTTGTCCAGCACTTCTCTCCA -3’; for 18S—forward 5’-
CGGCTACCACATCCAAGGAA-3’ and reverse 5’-GCTGGAATTACCGCGGCT-3’; for
Mitochondrial D-LOOP—forward 5’-CCCCTCACCCACTAGGATAC-3’ and reverse 5’-
ACGTGTGGGCTATTTAGGC-3’;
Results
Bioenergetics and mitochondrial content in NDUFS1 mutant fibroblasts
Fibroblasts from a patient with a NDUFS1 gene mutation (C1564A) were used as a model of CI
deficiency (Iuso et al., 2006). When compared with normal human fibroblasts, NDUFS1 mutant
cells showed equal content of ATP and NAD (Fig. 1A and B). Conversely, we found a ~20%
reduction of mitochondrial membrane potential in mutant cells (Fig. 1C). The latter result is in
keeping with impairment of Complex I-dependent respiration in NDUFS1 mutant fibroblasts (Iuso et
al., 2006). We also quantified mtDNA as an indicator of mitochondrial content (Lapucci et al.,
2011;Felici et al., 2014), and found that it did not differ between mutant and control fibroblasts (Fig.
1D), suggesting therefore that mitochondrial dysfunction prompted by NDUFS1 mutation does not
affect mitochondrial biogenesis. Finally, we asked whether respiratory defect due to NDUFS1
mutation alters expression levels of respiratory complex subunits as a sort of compensatory
strategy. We therefore quantified in both cell types transcript levels for different respiratory complex
subunits encoded by nuclear or mitochondrial DNA (nDNA and mtDNA, respectively). Interestingly,
data shown in Fig. 1E indicate that mutant fibroblasts had higher transcript levels exclusively of
those subunits encoded by mtDNA such as COX1, COX2 and ND2 (Fig. 1E). This prompted us to
analyze expression levels of transcripts for different regulators of mitochondrial gene transcription
and found that only TFB1M and PCCR1 were more abundant (about 3- and 4-fold, respectively) in
mutant compared to control fibroblasts (Fig. 1F).
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
10
Effects of PARP-1 inhibitors on mitochondrial homeostasis of NDUFS1 mutant fibroblasts
Reportedly, genetic suppression of PARP-1 or chronic treatment with PARP-1 inhibitors increases
intracellular NAD contents and mitochondrial biogenesis in mouse models of mitochondrial
disorders (Cerutti et al., 2014). In order to reproduce these findings in human cells, we exposed
NDUFS1-deficient fibroblasts for 7 days to chemical inhibitors of PARP-1 such as PHE and PJ34.
We first checked for possible drug-induced cytotoxicity by means of intracellular ATP quantitation
or LDH release assay, but found no evidence of changes in energy content or cell death (Fig. 2A
and not shown). Remarkably, PARP-1 inhibition did not increase NAD contents of NDUFS1 mutant
fibroblasts (Fig. 2B), whereas sufficed to augment their mitochondrial membrane potential (Fig. 2C
and D). Furthermore, exposure to PHE and PJ34 increased mitochondrial content (Fig. 2E),
consistent with the notion that suppression of PARP-1 activity promotes mitochondrial biogenesis
in mice (Bai et al., 2011b). In light of our recent finding that both PHE and PJ34 increase
expression of respiratory complex subunits in different tissues of Ndufs4 KO mice (Felici et al.,
2014), we asked whether this also occurs in human cells harboring a mitochondrial defect.
NDUFS1 deficient fibroblasts were therefore exposed to PARP-1 inhibitors for 7 days, and
expression levels of respiratory complex subunits encoded by nDNA or mtDNA analyzed.
Interestingly, we found that PHE and PJ34 increased transcript levels of different respiratory
complex subunits encoded by mtDNA, having no effects on those encoded by nuclear genes (Fig.
2F and G). This finding prompted us to evaluate whether pharmacological inhibition of PARP-1
altered expression levels of mitochondrial transcription factors such as TFAM, TFB1M, TFB2M,
NRF1, NRF2, and PPCR1 (Scarpulla et al., 2012). In light of the key role of Sirt-1 and PGC1α/β in
mitochondrial biogenesis, their transcript levels were evaluated as well. As shown in Fig. 2H, both
PHE and PJ34 had a selectively increased transcripts for TFAM, NRF1, NRF2 and PGC1β.
mRNAs for PGC1α were highly increased by PJ43 only, suggesting a non-specific effect, unrelated
to PARP-1 inhibition. Next, to understand whether the effects of PARP-1 inhibitors on NDUFS1
mutant fibroblasts translated into improved mitochondrial function, we evaluated fibroblast ability to
reduce MTT which is a prototypical index of mitochondrial respiratory activity (Berridge and Tan,
1993). Of note, MTT reduction activity was increased by a 7 day incubation to PHE or PJ34 (Fig 2.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
11
I and J). We also evaluated the effects of the two inhibitors on cultured fibroblasts from healthy
subjects and found analogous results for ATP, NAD, mtDNA and TMRE. As for transcripts of
respiratory subunits we found that in normal cells COX2 mRNA was not increased by the two
compounds (Supplementary Fig. S1).
Effects of NR on mitochondrial homeostasis of NDUFS1 mutant fibroblasts
In addition to PARP-1 inhibition, exposure to NAD precursors is an alternative pharmacological
strategy to increase intracellular NAD content. Among NAD precursors, NR has been intensively
investigated as a NAD-boosting molecule because of its ability to cross the plasmamembrane and,
at variance with nicotinamide, its inability to inhibit NAD-hydrolyzing enzymes such as PARP-1 and
sirtuins (Chi and Sauve, 2013). We therefore exposed NDUFS1 mutant fibroblasts to NR for 2 or 7
days and evaluated whether it affected mitochondrial homeostasis in a way similar to PARP-1
inhibitors. As shown in Fig. 3A and B, exposure to NR did not affect ATP contents after 2 or 7 days
of treatment, whereas led to a 24% increase in those of NAD after 7 days of incubation. Akin to
PARP-1 inhibitors, a 7 day incubation with NR increased mitochondrial membrane potential (Fig.
3C, D) as well as mitochondrial content (Fig. 3E). Interestingly, however, NR had no effects on
expression levels of nDNA- or mtDNA-encoded respiratory complex subunits (Fig. 3F).
Notwithstanding the inability of NR to activate transcription of respiratory complex subunits, MTT
reduction capacity of NDUFS1 mutant fibroblasts was augmented after a 7 day exposure to the
NAD precursor (Fig. 3G and H). We also evaluated the effects of NR on cultured fibroblasts from
healthy subjects and found analogous results for ATP, NAD, mtDNA, TMRE and transcripts of
respiratory subunits (Supplementary Fig. S2). Finally, we evaluated whether NR also affects
mRNA levels for mitochondrial transcription regulatory genes such as TFAM, TFB1M, TFB2M,
NRF1, NRF2, PPCR1, SIRT-1 and PGC1α/β (Scarpulla et al., 2012). Interestingly, as shown in
Fig. 3I, NR increased by about 3-fold selectively transcripts for PGC1α and PGC1β.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
12
Discussion
In the present study we report that two pharmacological strategies previously shown to increase
intracellular NAD content such as PARP-1 inhibition and NR supplementation improve
mitochondrial homeostasis of human fibroblasts carrying a NDUFS1 mutation. These findings
strengthen prior work in mice showing that suppression of PARP-1 activity or diet supplementation
with NR ameliorates symptoms in experimental models of mitochondrial disorders (Cerutti et al.,
2014). The present study, however, provides the first evidence that, at least in human cells, the two
pharmacological approaches do not activate the same signalling pathways. Indeed, only NR
supplementation was capable of increasing intracellular NAD content in NDUFS1 mutant
fibroblasts, whereas only PARP-1 inhibitors increased transcription of TFAM and mtDNA-encoded
respiratory complex subunits. Still, both NR and PARP-1 inhibitors increased mitochondrial
membrane potential, organelle content, as well as MTT reduction capacity. The inability of PARP-1
inhibitors to increase cellular NAD content is in contrast with prior work (Bai et al., 2011b), but
consistent with a recent contribution showing that PJ34 does not augment NAD content in different
organs of Ndufs4 KO mice (Felici et al., 2014). At present we do not know the reason(s) of this
apparent inconsistency. Evidence that inhibitors of PARP-1 do not increase NAD content in mouse
tissues (Felici et al., 2014) and human cells rules out that the inconsistency might be merely due to
specie differences. We speculate that different treatment paradigms and/or disease models may
explain why treatment with chemical PARP-1 inhibitors is not invariantly related to NAD increases
in cells or tissues. Even the higher apparent potency of PJ34 with respect to PHE for some
parameters we have investigated here, may not be absolute, but related to the model or cell
function analysed.
We also show that NR supplementation increases cellular NAD contents as well as mitochondrial
membrane potential and content. However, the inability of NR to induce transcriptional activation
of respiratory complex subunits indicates that an increased availability of NAD in human cells
affects only specific parameters of mitochondrial homeostasis. Reportedly, improved mitochondrial
functioning by increased NAD contents is due activation of the Sirt1/PGC1α axis (Canto et al.,
2012;Bai et al., 2011b;Cerutti et al., 2014). In this light, given that NAD contents are not increased
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
13
by PARP-1 inhibitors in NDUFS1 mutant cells, we reason that the chemicals affect TFAM and
respiratory complex subunit transcription as well as or mitochondrial membrane potential in a
Sirt1/PGC1α independent manner. Most likely, the transcriptional effects of PHE and PJ34 are due
to their impact on PARP-1-dependent epigenetic regulation of gene expression. Indeed,
pharmacological modulation of PARP-1 significantly alters gene expression profiles in different cell
types in a positive or negative fashion according to the specific gene and its transcriptional context
(Krishnakumar et al., 2008;Frizzell et al., 2009;Krishnakumar and Kraus, 2010). PARP-1 activity
not only regulates formation of supramolecular complexes at the promoter levels, but also plays a
key role at the level of nascent RNA (Soldatenkov et al., 2002). Further, excessive formation of
poly(ADP-ribose) by PARP-1 at transcriptional active sites impairs basal transcriptional machinery
(Soldatenkov et al., 2002). In this light, the finding that NDUFS1 mutant fibroblasts constitutively
express higher transcript levels of respiratory complex subunits compared to control cells is of
particular relevance. It is likely, indeed, that basal induction of these genes renders their
transcriptional apparatus sensitive to PARP-1 inhibitors. Also, accumulation of reactive oxygen
radicals [which are well known triggers of PARP-1 activation (Luo and Kraus, 2012)] in mutant
NDUFS1 fibroblasts (Iuso et al., 2006) can further contribute to sensitization of these cells to
PARP-1 inhibitors. Evidence that in PHE- and PJ34-exposed cells TFAM transcription was induced
concomitant with that of those respiratory subunits which are constitutively induced corroborates
the hypothesis that epigenetic modification triggered by PARP-1 inhibitors in NDUFS1 fibroblasts
promotes a transcriptional program already primed by the respiratory deficit. The constitutive,
selective induction of respiratory complex subunits encoded by mtDNA suggests that NDUFS1
mutation and ensuing derangement of mitochondrial homeostasis is sensed by the cells that
activates transcription of mitochondrial respiratory genes as a sort of compensatory strategy.
Nuclear respiratory factor (NRF)-1 might take part to this compensatory response. Indeed, NRF-1
promotes expression of numerous mitochondria regulating proteins including TFAM, and is
negatively regulated by PARP-1 activity (Hossain et al., 2009). PARP-1 inhibitors might therefore
unleash NRF-1 repression and indirectly promote expression of mtDNA-encoded respiratory
complex subunits.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
14
In conclusion, this study strengthens the therapeutic potential of NR and PARP-1 inhibitors in
treatment of mitochondrial diseases. Even though the safety profile and pharmacokinetics of NR in
humans is unknown, it can be speculated that, being this riboside a natural product present in daily
consumed foods such as milk and yeast (Bieganowski and Brenner, 2004), it is better tolerated
than PARP-1 inhibitors which are xenobiotics with significant genotoxic potential. NR might have,
therefore, a more rapid therapeutic application and clinical transferability.
Acknowledgments
The authors gratefully acknowledge S. Papa for the kind gift of NDUFS1 mutant cells.
Authorship Contributions
Participated in research design: Felici, Chiarugi
Conducted experiments: Felici, Lapucci, Cavone, Berlinguer-Palmini
Contributed new reagents or analytic tools: Pratesi
Performed data analysis: Felici
Wrote or contributed to the writing of the manuscript: Chiarugi, Felici
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
15
Reference List
Bai P, Canto C, Brunyanszki A, Huber A, Szanto M, Cen Y, Yamamoto H, Houten S M, Kiss B,
Oudart H, Gergely P, Menissier-de Murcia J, Schreiber V, Sauve A A and Auwerx J (2011a)
PARP-2 Regulates SIRT1 Expression and Whole-Body Energy Expenditure. Cell Metab 13:450-
460.
Bai P, Canto C, Oudart H, Brunyanszki A, Cen Y, Thomas C, Yamamoto H, Huber A, Kiss B,
Houtkooper R H, Schoonjans K, Schreiber V, Sauve A A, Menissier-de Murcia J and Auwerx J
(2011b) PARP-1 Inhibition Increases Mitochondrial Metabolism Through SIRT1 Activation. Cell
Metab 13:461-468.
Berridge MV and Tan A S (1993) Characterization of the Cellular Reduction of 3-(4,5-
Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide (MTT): Subcellular Localization, Substrate
Dependence, and Involvement of Mitochondrial Electron Transport in MTT Reduction. Arch
Biochem Biophys 303:474-482.
Bieganowski P and Brenner C (2004) Discoveries of Nicotinamide Riboside As a Nutrient and
Conserved NRK Genes Establish a Preiss-Handler Independent Route to NAD+ in Fungi and
Humans. Cell 117:495-502.
Bugiani M, Invernizzi F, Alberio S, Briem E, Lamantea E, Carrara F, Moroni I, Farina L, Spada M,
Donati M A, Uziel G and Zeviani M (2004) Clinical and Molecular Findings in Children With
Complex I Deficiency. Biochim Biophys Acta 1659:136-147.
Canto C and Auwerx J (2012) NAD+ As a Signaling Molecule Modulating Metabolism. Cold Spring
Harb Symp Quant Biol.
Canto C, Houtkooper R H, Pirinen E, Youn D Y, Oosterveer M H, Cen Y, Fernandez-Marcos P J,
Yamamoto H, Andreux P A, Cettour-Rose P, Gademann K, Rinsch C, Schoonjans K, Sauve A A
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
16
and Auwerx J (2012) The NAD(+) Precursor Nicotinamide Riboside Enhances Oxidative
Metabolism and Protects Against High-Fat Diet-Induced Obesity. Cell Metab 15:838-847.
Cerutti R, Pirinen E, Lamperti C, Marchet S, Sauve A A, Li W, Leoni V, Schon E A, Dantzer F,
Auwerx J, Viscomi C and Zeviani M (2014) NAD-Dependent Activation of Sirt1 Corrects the
Phenotype in a Mouse Model of Mitochondrial Disease. Cell Metab.
Chi Y and Sauve A A (2013) Nicotinamide Riboside, a Trace Nutrient in Foods, Is a Vitamin B3
With Effects on Energy Metabolism and Neuroprotection. Curr Opin Clin Nutr Metab Care 16:657-
661.
Chiarugi A, Dolle C, Felici R and Ziegler M (2012) The NAD Metabolome - a Key Determinant of
Cancer Cell Biology. Nat Rev Cancer 12:741-752.
Dimauro S and Mancuso M (2007) Mitochondrial Diseases: Therapeutic Approaches. Biosci Rep
27:125-137.
Dimauro S and Rustin P (2009) A Critical Approach to the Therapy of Mitochondrial Respiratory
Chain and Oxidative Phosphorylation Diseases. Biochim Biophys Acta 1792:1159-1167.
Dimauro S and Schon E A (2008) Mitochondrial Disorders in the Nervous System. Annu Rev
Neurosci 31:91-123.
Dolle C, Skoge R H, Vanlinden M R and Ziegler M (2013) NAD Biosynthesis in Humans--Enzymes,
Metabolites and Therapeutic Aspects. Curr Top Med Chem 13:2907-2917.
Fato R, Bergamini C, Leoni S, Strocchi P and Lenaz G (2008) Generation of Reactive Oxygen
Species by Mitochondrial Complex I: Implications in Neurodegeneration. Neurochem Res 33:2487-
2501.
Felici R, Cavone L, Lapucci A, Guasti D, Bani D and Chiarugi A (2014) PARP Inhibition Delays
Progression of Mitochondrial Encephalopathy in Mice. Neurotherapeutics 11:651-664.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
17
Felici R, Lapucci A, Ramazzotti M and Chiarugi A (2013) Insight into Molecular and Functional
Properties of NMNAT3 Reveals New Hints of NAD Homeostasis Within Human Mitochondria.
PLoS One 8:e76938.
Frizzell KM, Gamble M J, Berrocal J G, Zhang T, Krishnakumar R, Cen Y, Sauve A A and Kraus W
L (2009) Global Analysis of Transcriptional Regulation by Poly(ADP-Ribose) Polymerase-1 and
Poly(ADP-Ribose) Glycohydrolase in MCF-7 Human Breast Cancer Cells. J Biol Chem 284:33926-
33938.
Hossain MB, Ji P, Anish R, Jacobson R H and Takada S (2009) Poly(ADP-Ribose) Polymerase 1
Interacts With Nuclear Respiratory Factor 1 (NRF-1) and Plays a Role in NRF-1 Transcriptional
Regulation. J Biol Chem 284:8621-8632.
Houtkooper RH and Auwerx J (2012) Exploring the Therapeutic Space Around NAD+. J Cell Biol
199:205-209.
Iuso A, Scacco S, Piccoli C, Bellomo F, Petruzzella V, Trentadue R, Minuto M, Ripoli M, Capitanio
N, Zeviani M and Papa S (2006) Dysfunctions of Cellular Oxidative Metabolism in Patients With
Mutations in the NDUFS1 and NDUFS4 Genes of Complex I. J Biol Chem 281:10374-10380.
Karamanlidis G, Lee C F, Garcia-Menendez L, Kolwicz S C, Jr., Suthammarak W, Gong G,
Sedensky M M, Morgan P G, Wang W and Tian R (2013) Mitochondrial Complex I Deficiency
Increases Protein Acetylation and Accelerates Heart Failure. Cell Metab 18:239-250.
Khan NA, Auranen M, Paetau I, Pirinen E, Euro L, Forsstrom S, Pasila L, Velagapudi V, Carroll C
J, Auwerx J and Suomalainen A (2014) Effective Treatment of Mitochondrial Myopathy by
Nicotinamide Riboside, a Vitamin B3. EMBO Mol Med 6:721-731.
Kleist-Retzow JC, Cormier-Daire V, De Lonlay P, Parfait B, Chretien D, Rustin P, Feingold J, Rotig
A and Munnich A (1998) A High Rate (20%-30%) of Parental Consanguinity in Cytochrome-
Oxidase Deficiency. Am J Hum Genet 63:428-435.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
18
Koch-Nolte F, Haag F, Guse A H, Lund F and Ziegler M (2009) Emerging Roles of NAD+ and Its
Metabolites in Cell Signaling. Sci Signal 2:mr1.
Krishnakumar R, Gamble M J, Frizzell K M, Berrocal J G, Kininis M and Kraus W L (2008)
Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes.
Science 319:819-821.
Krishnakumar R and Kraus W L (2010) PARP-1 Regulates Chromatin Structure and Transcription
Through a KDM5B-Dependent Pathway. Mol Cell 39:736-749.
Lapucci A, Pittelli M, Rapizzi E, Felici R, Moroni F and Chiarugi A (2011) Poly(ADP-Ribose)
Polymerase-1 Is a Nuclear Epigenetic Regulator of Mitochondrial DNA Repair and Transcription.
Mol Pharmacol Published ahead of print.
Luo X and Kraus W L (2012) On PAR With PARP: Cellular Stress Signaling Through Poly(ADP-
Ribose) and PARP-1. Genes Dev 26:417-432.
Moslemi AR and Darin N (2007) Molecular Genetic and Clinical Aspects of Mitochondrial Disorders
in Childhood. Mitochondrion 7:241-252.
Murphy MP and Smith R A (2007) Targeting Antioxidants to Mitochondria by Conjugation to
Lipophilic Cations. Annu Rev Pharmacol Toxicol 47:629-656.
Pirinen E, Canto C, Jo Y S, Morato L, Zhang H, Menzies K J, Williams E G, Mouchiroud L, Moullan
N, Hagberg C, Li W, Timmers S, Imhof R, Verbeek J, Pujol A, van L B, Viscomi C, Zeviani M,
Schrauwen P, Sauve A A, Schoonjans K and Auwerx J (2014) Pharmacological Inhibition of
Poly(ADP-Ribose) Polymerases Improves Fitness and Mitochondrial Function in Skeletal Muscle.
Cell Metab.
Pittelli M, Felici R, Pitozzi V, Giovannelli L, Bigagli E, Cialdai F, Romano G, Moroni F and Chiarugi
A (2011) Pharmacological Effects of Exogenous NAD on Mitochondrial Bioenergetics, DNA Repair,
and Apoptosis. Mol Pharmacol 80:1136-1146.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
19
Sauve AA (2008) NAD+ and Vitamin B3: From Metabolism to Therapies. J Pharmacol Exp Ther
324:883-893.
Scarpulla RC, Vega R B and Kelly D P (2012) Transcriptional Integration of Mitochondrial
Biogenesis. Trends Endocrinol Metab 23:459-466.
Skladal D, Halliday J and Thorburn D R (2003) Minimum Birth Prevalence of Mitochondrial
Respiratory Chain Disorders in Children. Brain 126:1905-1912.
Soldatenkov VA, Chasovskikh S, Potaman V N, Trfimova I, Smulson M E and Drithschilo A (2002)
Transcriptional Repression by Binding of Poly(ADP-Ribose) Polymerase to Promoter Sequences. J
Biol Chem 277:665-670.
Spinazzola A and Zeviani M (2009) Disorders From Perturbations of Nuclear-Mitochondrial
Intergenomic Cross-Talk. J Intern Med 265:174-192.
Wallace DC (1999) Mitochondrial Diseases in Man and Mouse. Science 283:1482-1488.
Yap TA, Sandhu S K, Carden C P and de Bono J S (2011) Poly(ADP-Ribose) Polymerase (PARP)
Inhibitors: Exploiting a Synthetic Lethal Strategy in the Clinic. CA Cancer J Clin 61:31-49.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
20
Footnotes.
This work was supported by grants from Regione Toscana Health Projects 2009 (recipient A.C.)
and 2012 (recipient A. L.); Association of Amyotrophic Lateral Sclerosis (ARISLA); and Ente Cassa
di Risparmio di Firenze.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
21
Legends to Figures
Figure 1. Bioenergetics and mitochondrial content in NDUFS1 mutant fibroblasts. Comparison of
the ATP (A), NAD (B), mitochondrial membrane potential (C) and mtDNA content (D) between
control and NDUFS1 mutant fibroblasts under resting conditions. The transcript levels of nDNA-
encoded (COX15, NDUFV2, ATP5D) and mtDNA-encoded (COX1, COX2, ND2) respiratory
complex subunits in NDUFS1 control or deficient cells is shown in (E). Columns represent the
mean ± SEM of at least three experiments conducted in duplicate. **p<0.01, Student’s t-test.
Figure 2. Effects of PARP-1 inhibitors on mitochondrial homeostasis of NDUFS1 mutant
fibroblasts. Effects of a 7 day incubation of NDUFS1 mutant fibroblasts to PHE (30 µM) or PJ34
(20 µM) on ATP (A) and NAD (B). The effects of an exposure to PHE (µM) and PJ34 (µM) on
mitochondrial membrane potential (C, D), mtDNA content (E) and transcript levels of nDNA-
encoded (COX15, NDUFV2, ATP5D) and mtDNA-encoded (COX1, COX2, ND2) respiratory
complex subunits (F, G) is shown. (H) Effects of 7 day incubation to PHE (30 µM) and PJ34 (20
µM) on transcript levels of TFB1M, TFB2M, SIRT1, TFAM, PGC1α, PGC1β, NRF1, NRF2 and
PPCR1. Phase contrast microscopy visualization (I) and quantitation (J) of MTT reduction activity
of NDUFS1 fibroblasts under control conditions or after a 7 day incubation with PHE or PJ34.
Columns represent the mean ± SEM of at least three experiments conducted in duplicate. *p<0.05,
**p<0.01, ***p<0.001 ANOVA and Tukey’s post hoc test. In (I) an experiment representative of 4 is
shown. Bar=10 µm.
Figure 3. Effects of NR on mitochondrial homeostasis of NDUFS1 mutant fibroblasts. Effects of a 2
and 7 day incubation of NDUFS1 mutant fibroblasts to NR (0.1-10 mM) on ATP (A), NAD (B),
mitochondrial membrane potential (C, D) and mtDNA content (E). The effects of a 2 or 7 day
exposure to NR on transcript levels of nDNA-encoded (COX15, NDUFV2, ATP5D) and mtDNA-
encoded (COX1, COX2, ND2) respiratory complex subunits is shown in (F). Phase contrast
microscopy visualization (G) and quantitation (H) of MTT reduction activity of NDUFS1 fibroblasts
under control conditions or after a 2 or 7 day incubation with NR (0.1-10 mM). (I) Effects of 7 day
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
MOL #97204
22
incubation to NR 1 mM on transcript levels of TFB1M, TFB2M, SIRT1, TFAM PGC1α, PGC1β,
NRF-1, NRF-2 and PPCR1. Columns represent the mean ± SEM of at least three experiments
conducted in duplicate. *p<0.05, **p<0.01, ***p<0.001 ANOVA and Tukey’s post hoc test. In (G) an
experiment representative of 3 is shown. Bar=10 µm.
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204
at ASPE
T Journals on Septem
ber 1, 2020m
olpharm.aspetjournals.org
Dow
nloaded from