pharmacological nad-boosting strategies improve...

MOL #97204

1

Pharmacological NAD-boosting strategies improve mitochondrial homeostasis in human

Complex I-mutant fibroblasts

Roberta Felici, Andrea Lapucci, Leonardo Cavone, Sara Pratesi, Rolando Berlinguer-Palmini and

Alberto Chiarugi

Department of Health Sciences, Section of Clinical Pharmacology and Oncology, University of

Florence, Florence, Italy RF, AL, LC, AC

Department of Experimental and Clinical Medicine, University of Florence, Florence, Italy S.P.

School of Electric and Electronic Engineering - Institute of Neuroscience, Newcastle University,

Newcastle, United Kingdom RBP

This article has not been copyedited and formatted. The final version may differ from this version.Molecular Pharmacology Fast Forward. Published on March 18, 2015 as DOI: 10.1124/mol.114.097204

at ASPE

T Journals on Septem

ber 1, 2020m

olpharm.aspetjournals.org

Dow

nloaded from

http://molpharm.aspetjournals.org/

MOL #97204

2

Running Title

NAD boosting strategies and mitochondrial defects

Author for Correspondence:

Roberta Felici, Ph.D.

Department of Health Sciences

Section of Clinical Pharmacology and Oncology

University of Florence

Viale Pieraccini 6

50139 Firenze

Italy

Phone: +39-055-4271230

Fax: +39-055-4271280

Email: [email protected]

Number of text pages: 22

Number of tables: 0

Figures: 5

References: 40

Number of words in the Abstract: 245

Introduction: 677

Discussion: 801

Abbreviations

ATP5D, ATP synthase H+ transporting mitochondrial F1 complex delta subunit; NRF, nuclear

respiratory factor; CI, complex I; COX, cytochrome c oxidase; mtDNA, mitochondrial DNA; MTT, 3-

(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; nDNA, nuclear DNA; NDUFS1, NADH

dehydrogenase (ubiquinone) Fe-S protein 1; NDUFV2, NADH dehydrogenase (ubiquinone)

flavoprotein 2; ND2, NADH dehydrogenase 2; NR, nicotinamide riboside; NRF-1/2, nuclear

respiratory factor 1/2; OXPHOS, oxidative phosphorylation; PARP, poly(ADP-ribose) polymerase;

PGC1α/β, peroxisome proliferator-activated receptor gamma coactivator 1-alpha/beta; Phe, 6-(5H)-


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

3

phenanthridinone; PJ34, [N-(6-oxo-5,6-dihydrophenanthridin-2-yl)-N,N-dimethylacetamide.HCl];

PPCR1, peroxisome proliferator-activated receptor gamma, coactivator-related 1; ROS, reactive

oxygen species; TFAM, mitochondrial transcription factor A; TFB1M, mitochondrial transcription

factor B1; TFB2M, mitochondrial transcription factor B2; TMRE, tetramethylrhodamine ethyl ester.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

4

Abstract

Mitochondrial disorders are devastating genetic diseases for which efficacious therapies are still an

unmet need. Recent studies report that increased availability of intracellular NAD obtained by

inhibition of the NAD-consuming enzyme poly (ADP-ribose) polymerase (PARP)-1 or

supplementation with the NAD-precursor nicotinamide riboside (NR) ameliorates energetic

derangement and symptoms in mouse models of mitochondrial disorders. Whether these

pharmacological approaches also improve bioenergetics of human cells harbouring mitochondrial

defects is unknown. It is also unclear whether the same signaling cascade is prompted by PARP-1

inhibitors and NR supplementation to improve mitochondrial homeostasis. Here, we show that

human fibroblasts mutant for NDUFS1 subunit of respiratory Complex I have similar ATP, NAD and

mitochondrial content compared to control cells, but show reduced mitochondrial membrane

potential. Interestingly, mutant cells also show increased transcript levels of mtDNA but not nDNA

respiratory complex subunits, suggesting activation of a compensatory response. At variance with

prior work in mice, however, NR supplementation but not PARP-1 inhibition increased intracellular

NAD content in NDUFS1 mutant human fibroblasts. Conversely, PARP-1 inhibitors but not NR

supplementation increased transcription of TFAM and mtDNA-encoded respiratory complexes

constitutively induced in mutant cells. Still, both NR and PARP-1 inhibitors restored mitochondrial

membrane potential and increased organelle content, as well as oxidative activity of NDUFS1-

deficient fibroblasts. Overall, data provide the first evidence that in human cells harbouring a

mitochondrial respiratory defect exposure to NR or PARP-1 inhibitors activate different signaling

pathways not invariantly prompted by NAD increases, but equally able to improve energetic

derangement.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

5

Introduction

Mitochondrial diseases are devastating disorders due to various defects of mitochondrial

functioning such as deficiencies in electron transport chain, protein importation, fusion/fission as

well as regulation of programmed cell death. Mutations in nuclear or mitochondrial genes typically

underpin the etiology of these disorders (Wallace, 1999;Dimauro and Schon, 2008). Despite the

identification of the primary genetic defects, pathogenesis of mitochondrial disorders is not well

understood. An intricate cascade of detrimental signals and metabolic impairment originates from

the primary genetic mutations, and is responsible for cell demise and clinical symptoms (Kleist-

Retzow et al., 1998;Skladal et al., 2003). Given the extreme difficulty in finding a cure for these

genetic disorders, identification and targeting of death pathways prompted by the original gene

defect represents a feasible strategy of relevance to symptomatic treatment of mitochondrial

disease patients (Moslemi and Darin, 2007).

Respiratory Complex I (CI) deficiency is one of the most common cause of oxidative

phosphorylation (OXPHOS) defects in childhood. Neurological symptoms occur at the age of ~4

months and the majority of patients die within the first 5 years of life (Dimauro and Schon,

2008;Spinazzola and Zeviani, 2009). A great deal of effort has been directed at identifying the

molecular mechanisms responsible for neurodegeneration in children affected by OXPHOS

defects. Evidence points to excessive production of reactive oxygen species (ROS) as the primary

cause of cell demise in these patients and in particular in those affected by CI deficiency (Fato et

al., 2008). Although pharmacological strategies able to counteract ROS-dependent oxidative stress

in mitochondrial disease patients has a strong therapeutic rationale (Murphy and Smith,

2007;Dimauro and Rustin, 2009) the identification of compounds reducing tissue degeneration in

children with respiratory chain disorders is still an unmet need (Dimauro and Mancuso, 2007).

During the last several years the biochemistry of pyridine nucleotide [NAD(H) and NADP(H)]

biosynthetic pathways has been revisited in detail, and two main concepts on NAD homeostasis

emerged. First, NAD-synthesizing enzymes and those responsible for its continuous consumption

regulate an unexpected, large array of key cellular processes (Canto and Auwerx, 2012;Chiarugi

et al., 2012;Koch-Nolte et al., 2009). Second, given that availability of pyridine nucleotides is


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

6

limiting several NAD-dependent processes, pharmacological approaches able to improve NAD

availability holds remarkable therapeutic potential for different human disorders (Dolle et al.,

2013;Houtkooper and Auwerx, 2012;Sauve, 2008).

As far as mitochondrial homeostasis is concerned, recent reports indicate that increased cellular

NAD availability improves organelles’ functioning and cell metabolism (Bai et al., 2011b;Bai et al.,

2011a;Pittelli et al., 2011;Canto et al., 2012;Cerutti et al., 2014;Khan et al., 2014). In this regard,

both pharmacological and genetic suppression of the major NAD-consuming enzyme poly(ADP-

ribose) polymerase (PARP)-1 increase NAD contents in different organs and overall oxidative

metabolism in mice (Bai et al., 2011b). Similarly, diet supplementation with the NAD precursor

nicotinamide riboside (NR) ameliorates metabolic defects of obese mice, boosts their energy

expenditure and, overall, reverts metabolic impairment (Canto et al., 2012). Recent contributions

report the ability of PARP-1 inhibitors or NR supplementation to improve mitochondrial defects and

muscle fitness in both healthy mice and in those with mitochondrial myopathy (Khan et al.,

2014;Cerutti et al., 2014;Pirinen et al., 2014). In keeping with this, diet supplementation with

additional NAD precursors such as nicotinamide or nicotinamide mononucleotide partially

normalizes mitochondrial defects in CI-deficient mouse cardiomyocytes (Karamanlidis et al., 2013).

As for the molecular mechanisms underpinning these therapeutic effects, it has been proposed

that NAD precursors increase cellular NAD content and the activity of the NAD-dependent

enzymes sirtuins (in particular Sirt1) which are master regulators of mitochondrial biogenesis,

respiration and energy production/expenditure (Bai et al., 2011b;Bai et al., 2011a).

Of note, NR is a NAD precursor present in daily diet (Bieganowski and Brenner, 2004), whereas

PARP-1 inhibitors reached the clinic for antineoplastic purposes, showing an acceptable safety

profile (Yap et al., 2011). In the present study, we evaluated the effects of NR or PARP-1 inhibition

on CI-deficient human fibroblasts obtained from a 6 month patient with progressive

leukoencephalopathy (Bugiani et al., 2004), in order to confirm data obtained in mice and help

defining the realistic translational potential of NAD-boosting strategies to mitochondrial disease

patients.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

7

Materials and Methods

Cell culturing

Control fibroblasts and patient’s fibroblasts (Iuso et al., 2006) were grown in Dulbecco’s modified

Eagle’s medium supplemented with 2 mM glutamine, 10% fetal bovine serum, and antibiotics.

Cultures were brought to 50 to 70% confluence and used for the experiments. Cells were exposed

to 6-(5H)-phenanthridinone (Phe), [N-(6-oxo-5,6-dihydrophenanthridin-2-yl)-N,N-

dimethylacetamide.HCl] (PJ34) or nicotinamide riboside (NR), directly dissolved in the culture

media. Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT)

assay and phase-contrast microscopy. An inverted Nikon TE-2000U microscope equipped with a

change-coupled device camera was used for cell visualization.

Measurement of mitochondrial membrane potential

Mitochondrial membrane potential was evaluated by means of flow cytometry (Felici et al., 2014).

NDUFS1 mutant fibroblasts were treated with vehicle, NR or with the PARP-1 inhibitors PJ34 (20

μM) or Phe (20 μM). Cells were then detached, incubated with tetramethylrhodamine ethyl ester

(TMRE) 2.5 nM, and analyzed with a Coulter EPICS XL flow cytometer (Beckman Coulter,

Fullerton, CA, USA) equipped with the EXPO32 Flow Cytometry ADC software (Beckman Coulter).

NAD and ATP quantification

NAD contents were quantified by means of an enzymatic cycling procedure (Felici et al., 2013).

Briefly, cells grown in a 48 well plate were killed with 50 ml HClO4 1N and then neutralized with an

equal volume of KOH 1N. After the addition of 100 ml of bicine 100 mM pH 8, 50 ml of the cell

extract was mixed with an equal volume of the bicine buffer containing 23 ml/ml ethanol, 0.17

mg/ml MTT, 0.57 mg/ml phenazine ethosulfate and 10 mg alcohol dehydrogenase. Mixture was

kept at room temperature for 20 minutes and then absorbance a 550 nm was measured. A

standard curve allowed quantification of NAD. The cellular ATP content were measured by means

of an ATPlite kit from PerkinElmer Life and Analytical Sciences (Zaventem, Belgium) as described

previously (Pittelli et al., 2011).


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

8

Evaluation of mtDNA content and respiratory subunits expression levels

Genomic DNA and total RNA were extracted from control and NDUFS1 mutant fibroblasts with the

nucleoSpin TriPrep kit (Macherey-Nagel), and real-time polymerase chain reaction was performed

as previously reported (Lapucci et al., 2011). Mitochondrial content was quantified by measuring

the ratio between mitochondrial D-loop and nuclear 18S gene amplification products (Lapucci et

al., 2011). The following primers were used: for COX1— forward 5’-

TACCAGGCTTCGGAATAATCTC-3’ and reverse 5’-GATAGCGATGATTATGGTAGCG-3’; for

COX2—forward 5’-CTCCTTGACGTTGACAATCG-3’ and reverse 5’-

CCACAGATTTCAGAGCATTGA-3’; for mt-ND2—forward 5’-AGGTGGATTAAACCAAACCCAG-3’

and reverse 5’-CGAGATAGTAGTAGGGTCGTGG-3’; for NDUFV2—forward 5’-

GCTGTTCTTCCAGTCCTGGATTTA -3’ and reverse 5’-CAGAGTTTCGAAGCATGCAGGGTG-3’;

for COX15—forward 5’-CCCTTTGAGGCCAGGGCAATAC-3’ and reverse 5’-

AATGCCAATCTACCATCGAGAGGCC-3’; for ATP5D—forward 5’-

ATGTCCTTCACCTTCGCCTCTCC -3’ and reverse 5’-GGAACCGCTGCTCACAAAGTATTTGG-3’;

for TFB1M—forward 5’-TGCAAGCAGCGAAGCAGCTATC-3’ and reverse 5’-

TTCAACCACCAGAAGTTCAGCG-3’; for TFB2M—forward 5’- CGATCGGAGATTGGCTGAGAC-

3’ and reverse 5’- TCACTTTCGAGCGCAACCAC-3’; for SIRT1—forward 5’-

CCCAGATCTTCCAGATCCTCAAGC -3’ and reverse 5’-GCAACCTGTTCCAGCGTGTCTATG-3’;

for TFAM—forward 5’-CCGGCTGTGGAAGTCGACTGCGC 3’ and reverse 5’-

TCCCTCCAACGCTGGGCAATTCTTC -3’; for PGC1α—forward 5’-

CCAGGTCAAGATCAAGGTCTCCAGG-3’ and reverse 5’-

ATATTCTTCCCTCTTCAGCCTCTCGTG-3’; for PGC1β—forward 5’-

CGAAGGAACTTCAGATGTGAGAGCAGA-3’ and reverse 5’-

GTCAGCACCTCGCACTCCTCAATCT --3’; for NRF-1—forward 5’-

GAAGATCAGCAAACGCAAACACAGGCCA-3’ and reverse 5’-

GAATAATTCACTTGGGCAACGGTGACCG-3’; for NRF-2—forward 5’-

GACCTCACCACACTCAACATTTCGGG-3’ and reverse 5’-


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

9

GCACTGATGCTGGAATAATTTGCACAGG-3’; for PPRC1—forward 5’-

CTCGCGGGCAGTCTACTGTAGGTA-3’ and reverse 5’-

GGACTACTTTGTCCAGCACTTCTCTCCA -3’; for 18S—forward 5’-

CGGCTACCACATCCAAGGAA-3’ and reverse 5’-GCTGGAATTACCGCGGCT-3’; for

Mitochondrial D-LOOP—forward 5’-CCCCTCACCCACTAGGATAC-3’ and reverse 5’-

ACGTGTGGGCTATTTAGGC-3’;

Results

Bioenergetics and mitochondrial content in NDUFS1 mutant fibroblasts

Fibroblasts from a patient with a NDUFS1 gene mutation (C1564A) were used as a model of CI

deficiency (Iuso et al., 2006). When compared with normal human fibroblasts, NDUFS1 mutant

cells showed equal content of ATP and NAD (Fig. 1A and B). Conversely, we found a ~20%

reduction of mitochondrial membrane potential in mutant cells (Fig. 1C). The latter result is in

keeping with impairment of Complex I-dependent respiration in NDUFS1 mutant fibroblasts (Iuso et

al., 2006). We also quantified mtDNA as an indicator of mitochondrial content (Lapucci et al.,

2011;Felici et al., 2014), and found that it did not differ between mutant and control fibroblasts (Fig.

1D), suggesting therefore that mitochondrial dysfunction prompted by NDUFS1 mutation does not

affect mitochondrial biogenesis. Finally, we asked whether respiratory defect due to NDUFS1

mutation alters expression levels of respiratory complex subunits as a sort of compensatory

strategy. We therefore quantified in both cell types transcript levels for different respiratory complex

subunits encoded by nuclear or mitochondrial DNA (nDNA and mtDNA, respectively). Interestingly,

data shown in Fig. 1E indicate that mutant fibroblasts had higher transcript levels exclusively of

those subunits encoded by mtDNA such as COX1, COX2 and ND2 (Fig. 1E). This prompted us to

analyze expression levels of transcripts for different regulators of mitochondrial gene transcription

and found that only TFB1M and PCCR1 were more abundant (about 3- and 4-fold, respectively) in

mutant compared to control fibroblasts (Fig. 1F).


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

10

Effects of PARP-1 inhibitors on mitochondrial homeostasis of NDUFS1 mutant fibroblasts

Reportedly, genetic suppression of PARP-1 or chronic treatment with PARP-1 inhibitors increases

intracellular NAD contents and mitochondrial biogenesis in mouse models of mitochondrial

disorders (Cerutti et al., 2014). In order to reproduce these findings in human cells, we exposed

NDUFS1-deficient fibroblasts for 7 days to chemical inhibitors of PARP-1 such as PHE and PJ34.

We first checked for possible drug-induced cytotoxicity by means of intracellular ATP quantitation

or LDH release assay, but found no evidence of changes in energy content or cell death (Fig. 2A

and not shown). Remarkably, PARP-1 inhibition did not increase NAD contents of NDUFS1 mutant

fibroblasts (Fig. 2B), whereas sufficed to augment their mitochondrial membrane potential (Fig. 2C

and D). Furthermore, exposure to PHE and PJ34 increased mitochondrial content (Fig. 2E),

consistent with the notion that suppression of PARP-1 activity promotes mitochondrial biogenesis

in mice (Bai et al., 2011b). In light of our recent finding that both PHE and PJ34 increase

expression of respiratory complex subunits in different tissues of Ndufs4 KO mice (Felici et al.,

2014), we asked whether this also occurs in human cells harboring a mitochondrial defect.

NDUFS1 deficient fibroblasts were therefore exposed to PARP-1 inhibitors for 7 days, and

expression levels of respiratory complex subunits encoded by nDNA or mtDNA analyzed.

Interestingly, we found that PHE and PJ34 increased transcript levels of different respiratory

complex subunits encoded by mtDNA, having no effects on those encoded by nuclear genes (Fig.

2F and G). This finding prompted us to evaluate whether pharmacological inhibition of PARP-1

altered expression levels of mitochondrial transcription factors such as TFAM, TFB1M, TFB2M,

NRF1, NRF2, and PPCR1 (Scarpulla et al., 2012). In light of the key role of Sirt-1 and PGC1α/β in

mitochondrial biogenesis, their transcript levels were evaluated as well. As shown in Fig. 2H, both

PHE and PJ34 had a selectively increased transcripts for TFAM, NRF1, NRF2 and PGC1β.

mRNAs for PGC1α were highly increased by PJ43 only, suggesting a non-specific effect, unrelated

to PARP-1 inhibition. Next, to understand whether the effects of PARP-1 inhibitors on NDUFS1

mutant fibroblasts translated into improved mitochondrial function, we evaluated fibroblast ability to

reduce MTT which is a prototypical index of mitochondrial respiratory activity (Berridge and Tan,

1993). Of note, MTT reduction activity was increased by a 7 day incubation to PHE or PJ34 (Fig 2.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

11

I and J). We also evaluated the effects of the two inhibitors on cultured fibroblasts from healthy

subjects and found analogous results for ATP, NAD, mtDNA and TMRE. As for transcripts of

respiratory subunits we found that in normal cells COX2 mRNA was not increased by the two

compounds (Supplementary Fig. S1).

Effects of NR on mitochondrial homeostasis of NDUFS1 mutant fibroblasts

In addition to PARP-1 inhibition, exposure to NAD precursors is an alternative pharmacological

strategy to increase intracellular NAD content. Among NAD precursors, NR has been intensively

investigated as a NAD-boosting molecule because of its ability to cross the plasmamembrane and,

at variance with nicotinamide, its inability to inhibit NAD-hydrolyzing enzymes such as PARP-1 and

sirtuins (Chi and Sauve, 2013). We therefore exposed NDUFS1 mutant fibroblasts to NR for 2 or 7

days and evaluated whether it affected mitochondrial homeostasis in a way similar to PARP-1

inhibitors. As shown in Fig. 3A and B, exposure to NR did not affect ATP contents after 2 or 7 days

of treatment, whereas led to a 24% increase in those of NAD after 7 days of incubation. Akin to

PARP-1 inhibitors, a 7 day incubation with NR increased mitochondrial membrane potential (Fig.

3C, D) as well as mitochondrial content (Fig. 3E). Interestingly, however, NR had no effects on

expression levels of nDNA- or mtDNA-encoded respiratory complex subunits (Fig. 3F).

Notwithstanding the inability of NR to activate transcription of respiratory complex subunits, MTT

reduction capacity of NDUFS1 mutant fibroblasts was augmented after a 7 day exposure to the

NAD precursor (Fig. 3G and H). We also evaluated the effects of NR on cultured fibroblasts from

healthy subjects and found analogous results for ATP, NAD, mtDNA, TMRE and transcripts of

respiratory subunits (Supplementary Fig. S2). Finally, we evaluated whether NR also affects

mRNA levels for mitochondrial transcription regulatory genes such as TFAM, TFB1M, TFB2M,

NRF1, NRF2, PPCR1, SIRT-1 and PGC1α/β (Scarpulla et al., 2012). Interestingly, as shown in

Fig. 3I, NR increased by about 3-fold selectively transcripts for PGC1α and PGC1β.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

12

Discussion

In the present study we report that two pharmacological strategies previously shown to increase

intracellular NAD content such as PARP-1 inhibition and NR supplementation improve

mitochondrial homeostasis of human fibroblasts carrying a NDUFS1 mutation. These findings

strengthen prior work in mice showing that suppression of PARP-1 activity or diet supplementation

with NR ameliorates symptoms in experimental models of mitochondrial disorders (Cerutti et al.,

2014). The present study, however, provides the first evidence that, at least in human cells, the two

pharmacological approaches do not activate the same signalling pathways. Indeed, only NR

supplementation was capable of increasing intracellular NAD content in NDUFS1 mutant

fibroblasts, whereas only PARP-1 inhibitors increased transcription of TFAM and mtDNA-encoded

respiratory complex subunits. Still, both NR and PARP-1 inhibitors increased mitochondrial

membrane potential, organelle content, as well as MTT reduction capacity. The inability of PARP-1

inhibitors to increase cellular NAD content is in contrast with prior work (Bai et al., 2011b), but

consistent with a recent contribution showing that PJ34 does not augment NAD content in different

organs of Ndufs4 KO mice (Felici et al., 2014). At present we do not know the reason(s) of this

apparent inconsistency. Evidence that inhibitors of PARP-1 do not increase NAD content in mouse

tissues (Felici et al., 2014) and human cells rules out that the inconsistency might be merely due to

specie differences. We speculate that different treatment paradigms and/or disease models may

explain why treatment with chemical PARP-1 inhibitors is not invariantly related to NAD increases

in cells or tissues. Even the higher apparent potency of PJ34 with respect to PHE for some

parameters we have investigated here, may not be absolute, but related to the model or cell

function analysed.

We also show that NR supplementation increases cellular NAD contents as well as mitochondrial

membrane potential and content. However, the inability of NR to induce transcriptional activation

of respiratory complex subunits indicates that an increased availability of NAD in human cells

affects only specific parameters of mitochondrial homeostasis. Reportedly, improved mitochondrial

functioning by increased NAD contents is due activation of the Sirt1/PGC1α axis (Canto et al.,

2012;Bai et al., 2011b;Cerutti et al., 2014). In this light, given that NAD contents are not increased


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

13

by PARP-1 inhibitors in NDUFS1 mutant cells, we reason that the chemicals affect TFAM and

respiratory complex subunit transcription as well as or mitochondrial membrane potential in a

Sirt1/PGC1α independent manner. Most likely, the transcriptional effects of PHE and PJ34 are due

to their impact on PARP-1-dependent epigenetic regulation of gene expression. Indeed,

pharmacological modulation of PARP-1 significantly alters gene expression profiles in different cell

types in a positive or negative fashion according to the specific gene and its transcriptional context

(Krishnakumar et al., 2008;Frizzell et al., 2009;Krishnakumar and Kraus, 2010). PARP-1 activity

not only regulates formation of supramolecular complexes at the promoter levels, but also plays a

key role at the level of nascent RNA (Soldatenkov et al., 2002). Further, excessive formation of

poly(ADP-ribose) by PARP-1 at transcriptional active sites impairs basal transcriptional machinery

(Soldatenkov et al., 2002). In this light, the finding that NDUFS1 mutant fibroblasts constitutively

express higher transcript levels of respiratory complex subunits compared to control cells is of

particular relevance. It is likely, indeed, that basal induction of these genes renders their

transcriptional apparatus sensitive to PARP-1 inhibitors. Also, accumulation of reactive oxygen

radicals [which are well known triggers of PARP-1 activation (Luo and Kraus, 2012)] in mutant

NDUFS1 fibroblasts (Iuso et al., 2006) can further contribute to sensitization of these cells to

PARP-1 inhibitors. Evidence that in PHE- and PJ34-exposed cells TFAM transcription was induced

concomitant with that of those respiratory subunits which are constitutively induced corroborates

the hypothesis that epigenetic modification triggered by PARP-1 inhibitors in NDUFS1 fibroblasts

promotes a transcriptional program already primed by the respiratory deficit. The constitutive,

selective induction of respiratory complex subunits encoded by mtDNA suggests that NDUFS1

mutation and ensuing derangement of mitochondrial homeostasis is sensed by the cells that

activates transcription of mitochondrial respiratory genes as a sort of compensatory strategy.

Nuclear respiratory factor (NRF)-1 might take part to this compensatory response. Indeed, NRF-1

promotes expression of numerous mitochondria regulating proteins including TFAM, and is

negatively regulated by PARP-1 activity (Hossain et al., 2009). PARP-1 inhibitors might therefore

unleash NRF-1 repression and indirectly promote expression of mtDNA-encoded respiratory

complex subunits.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

14

In conclusion, this study strengthens the therapeutic potential of NR and PARP-1 inhibitors in

treatment of mitochondrial diseases. Even though the safety profile and pharmacokinetics of NR in

humans is unknown, it can be speculated that, being this riboside a natural product present in daily

consumed foods such as milk and yeast (Bieganowski and Brenner, 2004), it is better tolerated

than PARP-1 inhibitors which are xenobiotics with significant genotoxic potential. NR might have,

therefore, a more rapid therapeutic application and clinical transferability.

Acknowledgments

The authors gratefully acknowledge S. Papa for the kind gift of NDUFS1 mutant cells.

Authorship Contributions

Participated in research design: Felici, Chiarugi

Conducted experiments: Felici, Lapucci, Cavone, Berlinguer-Palmini

Contributed new reagents or analytic tools: Pratesi

Performed data analysis: Felici

Wrote or contributed to the writing of the manuscript: Chiarugi, Felici


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

15

Reference List

Bai P, Canto C, Brunyanszki A, Huber A, Szanto M, Cen Y, Yamamoto H, Houten S M, Kiss B,

Oudart H, Gergely P, Menissier-de Murcia J, Schreiber V, Sauve A A and Auwerx J (2011a)

PARP-2 Regulates SIRT1 Expression and Whole-Body Energy Expenditure. Cell Metab 13:450-

460.

Bai P, Canto C, Oudart H, Brunyanszki A, Cen Y, Thomas C, Yamamoto H, Huber A, Kiss B,

Houtkooper R H, Schoonjans K, Schreiber V, Sauve A A, Menissier-de Murcia J and Auwerx J

(2011b) PARP-1 Inhibition Increases Mitochondrial Metabolism Through SIRT1 Activation. Cell

Metab 13:461-468.

Berridge MV and Tan A S (1993) Characterization of the Cellular Reduction of 3-(4,5-

Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide (MTT): Subcellular Localization, Substrate

Dependence, and Involvement of Mitochondrial Electron Transport in MTT Reduction. Arch

Biochem Biophys 303:474-482.

Bieganowski P and Brenner C (2004) Discoveries of Nicotinamide Riboside As a Nutrient and

Conserved NRK Genes Establish a Preiss-Handler Independent Route to NAD+ in Fungi and

Humans. Cell 117:495-502.

Bugiani M, Invernizzi F, Alberio S, Briem E, Lamantea E, Carrara F, Moroni I, Farina L, Spada M,

Donati M A, Uziel G and Zeviani M (2004) Clinical and Molecular Findings in Children With

Complex I Deficiency. Biochim Biophys Acta 1659:136-147.

Canto C and Auwerx J (2012) NAD+ As a Signaling Molecule Modulating Metabolism. Cold Spring

Harb Symp Quant Biol.

Canto C, Houtkooper R H, Pirinen E, Youn D Y, Oosterveer M H, Cen Y, Fernandez-Marcos P J,

Yamamoto H, Andreux P A, Cettour-Rose P, Gademann K, Rinsch C, Schoonjans K, Sauve A A


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

16

and Auwerx J (2012) The NAD(+) Precursor Nicotinamide Riboside Enhances Oxidative

Metabolism and Protects Against High-Fat Diet-Induced Obesity. Cell Metab 15:838-847.

Cerutti R, Pirinen E, Lamperti C, Marchet S, Sauve A A, Li W, Leoni V, Schon E A, Dantzer F,

Auwerx J, Viscomi C and Zeviani M (2014) NAD-Dependent Activation of Sirt1 Corrects the

Phenotype in a Mouse Model of Mitochondrial Disease. Cell Metab.

Chi Y and Sauve A A (2013) Nicotinamide Riboside, a Trace Nutrient in Foods, Is a Vitamin B3

With Effects on Energy Metabolism and Neuroprotection. Curr Opin Clin Nutr Metab Care 16:657-

661.

Chiarugi A, Dolle C, Felici R and Ziegler M (2012) The NAD Metabolome - a Key Determinant of

Cancer Cell Biology. Nat Rev Cancer 12:741-752.

Dimauro S and Mancuso M (2007) Mitochondrial Diseases: Therapeutic Approaches. Biosci Rep

27:125-137.

Dimauro S and Rustin P (2009) A Critical Approach to the Therapy of Mitochondrial Respiratory

Chain and Oxidative Phosphorylation Diseases. Biochim Biophys Acta 1792:1159-1167.

Dimauro S and Schon E A (2008) Mitochondrial Disorders in the Nervous System. Annu Rev

Neurosci 31:91-123.

Dolle C, Skoge R H, Vanlinden M R and Ziegler M (2013) NAD Biosynthesis in Humans--Enzymes,

Metabolites and Therapeutic Aspects. Curr Top Med Chem 13:2907-2917.

Fato R, Bergamini C, Leoni S, Strocchi P and Lenaz G (2008) Generation of Reactive Oxygen

Species by Mitochondrial Complex I: Implications in Neurodegeneration. Neurochem Res 33:2487-

2501.

Felici R, Cavone L, Lapucci A, Guasti D, Bani D and Chiarugi A (2014) PARP Inhibition Delays

Progression of Mitochondrial Encephalopathy in Mice. Neurotherapeutics 11:651-664.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

17

Felici R, Lapucci A, Ramazzotti M and Chiarugi A (2013) Insight into Molecular and Functional

Properties of NMNAT3 Reveals New Hints of NAD Homeostasis Within Human Mitochondria.

PLoS One 8:e76938.

Frizzell KM, Gamble M J, Berrocal J G, Zhang T, Krishnakumar R, Cen Y, Sauve A A and Kraus W

L (2009) Global Analysis of Transcriptional Regulation by Poly(ADP-Ribose) Polymerase-1 and

Poly(ADP-Ribose) Glycohydrolase in MCF-7 Human Breast Cancer Cells. J Biol Chem 284:33926-

33938.

Hossain MB, Ji P, Anish R, Jacobson R H and Takada S (2009) Poly(ADP-Ribose) Polymerase 1

Interacts With Nuclear Respiratory Factor 1 (NRF-1) and Plays a Role in NRF-1 Transcriptional

Regulation. J Biol Chem 284:8621-8632.

Houtkooper RH and Auwerx J (2012) Exploring the Therapeutic Space Around NAD+. J Cell Biol

199:205-209.

Iuso A, Scacco S, Piccoli C, Bellomo F, Petruzzella V, Trentadue R, Minuto M, Ripoli M, Capitanio

N, Zeviani M and Papa S (2006) Dysfunctions of Cellular Oxidative Metabolism in Patients With

Mutations in the NDUFS1 and NDUFS4 Genes of Complex I. J Biol Chem 281:10374-10380.

Karamanlidis G, Lee C F, Garcia-Menendez L, Kolwicz S C, Jr., Suthammarak W, Gong G,

Sedensky M M, Morgan P G, Wang W and Tian R (2013) Mitochondrial Complex I Deficiency

Increases Protein Acetylation and Accelerates Heart Failure. Cell Metab 18:239-250.

Khan NA, Auranen M, Paetau I, Pirinen E, Euro L, Forsstrom S, Pasila L, Velagapudi V, Carroll C

J, Auwerx J and Suomalainen A (2014) Effective Treatment of Mitochondrial Myopathy by

Nicotinamide Riboside, a Vitamin B3. EMBO Mol Med 6:721-731.

Kleist-Retzow JC, Cormier-Daire V, De Lonlay P, Parfait B, Chretien D, Rustin P, Feingold J, Rotig

A and Munnich A (1998) A High Rate (20%-30%) of Parental Consanguinity in Cytochrome-

Oxidase Deficiency. Am J Hum Genet 63:428-435.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

18

Koch-Nolte F, Haag F, Guse A H, Lund F and Ziegler M (2009) Emerging Roles of NAD+ and Its

Metabolites in Cell Signaling. Sci Signal 2:mr1.

Krishnakumar R, Gamble M J, Frizzell K M, Berrocal J G, Kininis M and Kraus W L (2008)

Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes.

Science 319:819-821.

Krishnakumar R and Kraus W L (2010) PARP-1 Regulates Chromatin Structure and Transcription

Through a KDM5B-Dependent Pathway. Mol Cell 39:736-749.

Lapucci A, Pittelli M, Rapizzi E, Felici R, Moroni F and Chiarugi A (2011) Poly(ADP-Ribose)

Polymerase-1 Is a Nuclear Epigenetic Regulator of Mitochondrial DNA Repair and Transcription.

Mol Pharmacol Published ahead of print.

Luo X and Kraus W L (2012) On PAR With PARP: Cellular Stress Signaling Through Poly(ADP-

Ribose) and PARP-1. Genes Dev 26:417-432.

Moslemi AR and Darin N (2007) Molecular Genetic and Clinical Aspects of Mitochondrial Disorders

in Childhood. Mitochondrion 7:241-252.

Murphy MP and Smith R A (2007) Targeting Antioxidants to Mitochondria by Conjugation to

Lipophilic Cations. Annu Rev Pharmacol Toxicol 47:629-656.

Pirinen E, Canto C, Jo Y S, Morato L, Zhang H, Menzies K J, Williams E G, Mouchiroud L, Moullan

N, Hagberg C, Li W, Timmers S, Imhof R, Verbeek J, Pujol A, van L B, Viscomi C, Zeviani M,

Schrauwen P, Sauve A A, Schoonjans K and Auwerx J (2014) Pharmacological Inhibition of

Poly(ADP-Ribose) Polymerases Improves Fitness and Mitochondrial Function in Skeletal Muscle.

Cell Metab.

Pittelli M, Felici R, Pitozzi V, Giovannelli L, Bigagli E, Cialdai F, Romano G, Moroni F and Chiarugi

A (2011) Pharmacological Effects of Exogenous NAD on Mitochondrial Bioenergetics, DNA Repair,

and Apoptosis. Mol Pharmacol 80:1136-1146.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

19

Sauve AA (2008) NAD+ and Vitamin B3: From Metabolism to Therapies. J Pharmacol Exp Ther

324:883-893.

Scarpulla RC, Vega R B and Kelly D P (2012) Transcriptional Integration of Mitochondrial

Biogenesis. Trends Endocrinol Metab 23:459-466.

Skladal D, Halliday J and Thorburn D R (2003) Minimum Birth Prevalence of Mitochondrial

Respiratory Chain Disorders in Children. Brain 126:1905-1912.

Soldatenkov VA, Chasovskikh S, Potaman V N, Trfimova I, Smulson M E and Drithschilo A (2002)

Transcriptional Repression by Binding of Poly(ADP-Ribose) Polymerase to Promoter Sequences. J

Biol Chem 277:665-670.

Spinazzola A and Zeviani M (2009) Disorders From Perturbations of Nuclear-Mitochondrial

Intergenomic Cross-Talk. J Intern Med 265:174-192.

Wallace DC (1999) Mitochondrial Diseases in Man and Mouse. Science 283:1482-1488.

Yap TA, Sandhu S K, Carden C P and de Bono J S (2011) Poly(ADP-Ribose) Polymerase (PARP)

Inhibitors: Exploiting a Synthetic Lethal Strategy in the Clinic. CA Cancer J Clin 61:31-49.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

20

Footnotes.

This work was supported by grants from Regione Toscana Health Projects 2009 (recipient A.C.)

and 2012 (recipient A. L.); Association of Amyotrophic Lateral Sclerosis (ARISLA); and Ente Cassa

di Risparmio di Firenze.


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

21

Legends to Figures

Figure 1. Bioenergetics and mitochondrial content in NDUFS1 mutant fibroblasts. Comparison of

the ATP (A), NAD (B), mitochondrial membrane potential (C) and mtDNA content (D) between

control and NDUFS1 mutant fibroblasts under resting conditions. The transcript levels of nDNA-

encoded (COX15, NDUFV2, ATP5D) and mtDNA-encoded (COX1, COX2, ND2) respiratory

complex subunits in NDUFS1 control or deficient cells is shown in (E). Columns represent the

mean ± SEM of at least three experiments conducted in duplicate. **p<0.01, Student’s t-test.

Figure 2. Effects of PARP-1 inhibitors on mitochondrial homeostasis of NDUFS1 mutant

fibroblasts. Effects of a 7 day incubation of NDUFS1 mutant fibroblasts to PHE (30 µM) or PJ34

(20 µM) on ATP (A) and NAD (B). The effects of an exposure to PHE (µM) and PJ34 (µM) on

mitochondrial membrane potential (C, D), mtDNA content (E) and transcript levels of nDNA-

encoded (COX15, NDUFV2, ATP5D) and mtDNA-encoded (COX1, COX2, ND2) respiratory

complex subunits (F, G) is shown. (H) Effects of 7 day incubation to PHE (30 µM) and PJ34 (20

µM) on transcript levels of TFB1M, TFB2M, SIRT1, TFAM, PGC1α, PGC1β, NRF1, NRF2 and

PPCR1. Phase contrast microscopy visualization (I) and quantitation (J) of MTT reduction activity

of NDUFS1 fibroblasts under control conditions or after a 7 day incubation with PHE or PJ34.

Columns represent the mean ± SEM of at least three experiments conducted in duplicate. *p<0.05,

**p<0.01, ***p<0.001 ANOVA and Tukey’s post hoc test. In (I) an experiment representative of 4 is

shown. Bar=10 µm.

Figure 3. Effects of NR on mitochondrial homeostasis of NDUFS1 mutant fibroblasts. Effects of a 2

and 7 day incubation of NDUFS1 mutant fibroblasts to NR (0.1-10 mM) on ATP (A), NAD (B),

mitochondrial membrane potential (C, D) and mtDNA content (E). The effects of a 2 or 7 day

exposure to NR on transcript levels of nDNA-encoded (COX15, NDUFV2, ATP5D) and mtDNA-

encoded (COX1, COX2, ND2) respiratory complex subunits is shown in (F). Phase contrast

microscopy visualization (G) and quantitation (H) of MTT reduction activity of NDUFS1 fibroblasts

under control conditions or after a 2 or 7 day incubation with NR (0.1-10 mM). (I) Effects of 7 day


at ASPE


ber 1, 2020m


Dow

nloaded from


MOL #97204

22

incubation to NR 1 mM on transcript levels of TFB1M, TFB2M, SIRT1, TFAM PGC1α, PGC1β,

NRF-1, NRF-2 and PPCR1. Columns represent the mean ± SEM of at least three experiments

conducted in duplicate. *p<0.05, **p<0.01, ***p<0.001 ANOVA and Tukey’s post hoc test. In (G) an

experiment representative of 3 is shown. Bar=10 µm.


at ASPE


ber 1, 2020m


Dow

nloaded from



at ASPE


ber 1, 2020m


Dow

nloaded from


pharmacological nad-boosting strategies improve...

Documents