phdthesismshanase

Thesis for Doctoral degree (PhD) 2011

Molecular Epidemiology of Extended-Spectrum Beta-Lactamases (ESBL) Producing Enterobacteriaceae from the Bugando Medical Centre, Mwanza, Tanzania and the University of Giessen Medical Hospital, Germany

Stephen E. Mshana A Thesis Submitted in Fulfillment for the Requirement of the Award of Doctor of Philosophy (PhD) of the St. Augustine University of Tanzania

2011


ii

Department of Microbiology/Immunology, Weill Bugando University College of Health Sciences a Constituent College of St Augustine University of

Tanzania

MOLECULAR EPIDEMIOLOGY OF EXTENDED-SPECTRUM BETA-LACTAMASES (ESBL) PRODUCING ENTEROBACTERICEAE FROM THE BUGANDO MEDICAL CENTRE, MWANZA, TANZANIA AND THE UNIVERSITY OF GIESSEN MEDICAL HOSPITAL, GERMANY

Stephen Mshana

2011


iii

All previously published papers were reproduced with permission from the publisher. Published by Weill Bugando University College of Health and allied Sciences Stephen E. Mshana, 2011 ISBN 978-9987-9430-1-2 Printed by Druckerei Nicolai Shiffernberger Weg 113, 35394 Giessen, Germany


iv

MOLECULAR EPIDEMIOLOGY OF EXTENDED-SPECTRUM BETA-LACTAMASES (ESBL) PRODUCING ENTEROBACTERICEAE FROM THE BUGANDO MEDICAL CENTRE, MWANZA, TANZANIA AND THE UNIVERSITY OF GIESSEN MEDICAL HOSPITAL, GERMANY

ACADEMIC THESIS

Stephen E. Mshana

Supervisors:

Prof Trinad Chakraborty Professor/Director

Institute of Medical Microbiology Giessen Germany

Prof Eligius F Lyamuya Associate Professor/Deputy VC ARC

Muhimbili University of Health Sciences Department of Microbiology/Immunology


v

DECLARATION AND COPYRIGHT

I, Stephen E. Mshana hereby declare that the work presented in this thesis has not

been presented to any other University for similar degree award.

Signed .. Date..

This thesis is copyright material protected under the Berne Convention, the

copyright Act 1999 and International and national enactment, in that behalf on

intellectual property. It may not be reproduced by any means, in full or part, except

for short extract in fair dealing, for research or private study, critical scholarly

review or disclosure with acknowledgement, without written permission of the

Directorate of Postgraduate Studies on behalf of both the author and St Augustine

University of Tanzania (SAUT).


vi

TABLE OF CONTENTS DECLARATION AND COPYRIGHT...........................................................v

TABLE OF CONTENTS...............................................................................vi

LIST OF FIGURES......................................................................................ix

LIST OF TABLES.........................................................................................x

DEDICATION...............................................................................................xii

ACKNOWLEDGEMENT............................................................................xiii

ABSTRACT.................................................................................................xiv

CHAPTER ONE............................................................................................18

1.0 INTRODCUTION...................................................................................18

1.1 BACKGROUND.....................................................................................18

1.2 STATEMENT OF THE PROBLEM.......................................................20

1.3 RATIONALE OF THE STUDY.............................................................21

1.4 AIMS OF THE THESIS..........................................................................23

CHAPTER TWO...........................................................................................24

2.0 LITERATURE REVIEW........................................................................24

2.1 Definition of ESBLs and classification...................................................24

2.2 ESBLs types....25

2.3 Epidemiology of ESBL28

2.4 Detection of ESBL..30

2.6 Plasmid incompatibility groups...33

2.7 Escherichia coli and Klebsiella pneumonia Phylogenetic groups and

ESBL..33

2.8 Treatment options34

CHAPTER THREE...36

3.0 Material and methods...36

3.1 Study area ............................................................................................ 36


vii

3.2 Isolates ................................................................................................. 36

3.3 Susceptibility testing ............................................................................ 38

3.4 Amplification of ESBLs genes and ISEcp1 element ............................. 39

3.5 Sequencing ........................................................................................... 40

3.7 Recombinant techniques ....................................................................... 43

3.8 Pulse-Field Gel Electrophoresis (PFGE) ............................................... 44

3.9 Phylogenetic analysis ........................................................................... 45

3.10 Multilocus sequence typing (MLST) .................................................. 47

3.11 Biofilm assay...................................................................................... 47

3.12 Data analysis ...................................................................................... 48

3.13 Quality control ................................................................................... 48

3.14 Ethical consideration .......................................................................... 48

3.15 Limitations ......................................................................................... 49

CHAPTER FOUR..50

4.0 Results..50

4.1 Escherichia coli from Giessen .............................................................. 50

4.1.1 ESBL producing Isolates and Susceptibility Results .......................... 50

4.1.2 Characterization of isolates using PFGE and Phylogenetic grouping .. 51

4.1.3 Plasmid analysis and replicon typing ................................................. 53

4.1.4 ISEcp1 and Cloning results ................................................................ 53

4.2. Klebsiella pneumoniae isolates from Giessen, Germany ...................... 56

4.2.1 Isolates, ESBL alleles and susceptibility results ................................. 56

4.2.1 Location of blaCTX-M-15 ....................................................................... 57

4.3 Escherichia coli isolates from Bugando Medical Centre ....................... 60

4.3.2 Genetic relatedness ............................................................................ 60

4.3.3 Location and transferability of ESBL genes ....................................... 61

4.4: Klebsiella pneumoniae isolates from Bugando Medical Centre ............ 64

4.4.1 Bacterial isolates and susceptibility pattern ........................................ 64


viii

4.4.2 ESBL alleles ...................................................................................... 65

4.4.3 Genetic relatedness ............................................................................ 65

4.4.4 Location of ESBL genes .................................................................... 66

4.5. Enterobacter spp from Bugando Medical Centre .................................. 68

4.6. Comparison of Molecular Epidemiology of ESBL producing isolates

between BMC and IMMG .......................................................................... 76

CHAPTER IVE..79

5.0 Discussion ............................................................................................ 79

5.1 Isolates, ESBL alleles and Susceptibility results ................................... 79

5.2 Genetic relatedness of the isolates ........................................................ 82

5.3 Location of ESBL alleles ...................................................................... 85

5.3 Conclusion and recommendation .......................................................... 87

6.0 REFERENCES89


ix

LIST OF FIGURES Figure 1: Disk Approximation method. ...................................................... 31

Figure 2: Illustration for CTX-M-15 and ISEcp1 and 2.7kb plasmid .......... 43

Figure 3: Dichotomous decision tree to determine the phylogenetic group of

an Escherichia coli strain by using the results of PCR amplification of the

chuA and yjaA genes and DNA fragment TSPE4.C2. .................................. 45

Figure 4: Agarose gel showing chuA, yjaA and TSPE.C2 DNA fragments . 46

Figure 5: PFGE dendrogram of ESBL-producing Escherichia coli as

evaluated by Dice and UPGMA analysis. ................................................... 54

Figure 6: Agarose gel showing S1 nuclease PFGE-based sizing of plasmids

for 5 isolates. .............................................................................................. 55

Figure 7: LB plate showing Large (L) and small (S) colonies .................... 55

Figure 8: Agarose gel electrophoresis of products obtained by PCR from 3

large colonies and 3 small colonies............................................................. 56

Figure 9: Dendogram (UPGMA, DICE) showing the similarity for 24

Klebsiella pneumoniae ESBL Producers. ................................................... 59

Figure 10: Agarose gel showing S1 nuclease PFGE-based sizing of large

plasmids for 8 isolates. ............................................................................... 59

Figure 11: PFGE dendrogram of CTX-M-15 producing Escherichia coli. .. 63



Figure 13: PFGE dendrogram of ESBL producing Klebsiella pneumoniae 68



Figure 15: PFGE dendrogram rooted from XbaI digested Enterobacter

cloacae strain 263 of 18. ............................................................................. 72

Figure 16: Neighbor joining tree of Enterobacter spp based on 16SrRNA

DNA sequences in relation to the strain 247 BMC. ..................................... 75


x

LIST OF TABLES Table 1: Modified Bush Jacoby Medeiros Classification of -lactamases . 25

Table 2: Example of Biochemical tests which were used to identify

enterobacteriaceae ...................................................................................... 37

Table 3: Primers used for amplification and sequence of ESBL genes and IS

element ...................................................................................................... 41

Table 4: Interpretation of phylogenetic groups of Klebsiella pneumoniae ... 46

Table 5: Characteristics of Klebsiella pneumoniae isolates ......................... 58

Table 6: Characteristics of Escherichia coli selected as donors from different

.................................................................................................................. 63

Table 7: Representative strains of Klebsiella pneumoniae .......................... 69

Table 8: Demographics and clinical characteristics of neonates infected with

Enterobacter spp nov ................................................................................. 71

Table 9: Biochemical properties and percentage homology of genetic

markers between strain 247BMC and other closely related Enterobacter spp.

.................................................................................................................. 74

Table 10: Comparison of Escherichia coli ESBL producing isolates from

Giessen and that from Bugando medical Centre ......................................... 77

Table 11: Comparison of Klebsiella pneumoniae ESBL producing isolates

from Giessen and that from Bugando medical Centre ................................. 78


xi

LIST OF ABBREVIATIONS

BMC: Bugando Medical Centre

Bla: Beta-lactamase gene

CLSI: Clinical and Laboratory Standards Institute (formerly NCCLS)

DAAD: Deutscher Akademischer Austausch Dienst

DNA: Deoxyribonucleic acid

ESBL: Extended-spectrum beta-lactamase

MIC: Minimum inhibitory concentration

MLST: Multilocus sequence typing

NCCLS: National Committee for Clinical Laboratory Standards (Now CLSI)

PCR: Polymerase chain reaction

PFGE: Pulsed Field Gel Electrophoresis

RNA: Ribonucleic acid

SHV: Sulfhydryl Variable

TEM: Temoniera

WBUCHS: Weill Bugando University College of Health Sciences

WHO: World Health Organization


xii

DEDICATION This thesis is dedicated to good health of all neonates at Bugando Medical Centre


xiii

ACKNOWLEDGEMENT

I am grateful to the patients who participated in the studies. The work has been

supported financially or otherwise by WBUCHS, Institute of Medical Microbiology

Giessen and DAAD

Prof Trinad Chakraborty, Dr Can Imirzalioglu, Prof Eligius Lyamuya and Prof

Eugen Doman have supervised my work in the most qualified, inspiring, supportive

and patient way possible. They have facilitated every aspect of my work and always

have been available for discussion, whether in person or via email.

I sincerely thank my colleagues in Tanzania Dr Erasmus Kamugisha, Dr Mange

Manyama, Dr Benson Kidenya, Dr Mariam Mirambo and Dr Peter Rambau for their

technical support.

Also I would like to acknowledge the technical support provided by the members of

the Department of Microbiology/Immunology of WBUCHS and Institute of

Medical Microbiology Giessen. I thank Mary Louise Shushu, Claudia Neumann,

Hezron Bassu, Alpha Boniface, Isabell Trur, Kirsten Bommersheim and Alexandra

Amend-Foerster for their excellent technical assistance.

Last, but not least, I thank my wife Neema Mshana my daughter Patricia Stephen

and my parents (Sarah Mchami and Eliatosha Mshana), who have supported me

wholeheartedly through this process, without them I would not have accomplished

this work.


xiv

ABSTRACT

Antimicrobial resistance is fast becoming a global concern with rapid increases in

multi-drug-resistant Gram negative bacteria. The prevalence of extended spectrum-

beta lactamase (ESBL)-producing clinical isolates increases the burden of

implementing infectious disease management globally especially in developing

countries. Escherichia coli and Klebsiella pneumoniae producing ESBLs are a

major problem in hospitals worldwide, causing hospital and community acquired

infections. They are usually resistant to multiple common antibiotics thus limiting

treatment options. This thesis presents work done on the molecular epidemiology of

ESBL producing isolates from a tertiary Hospital in Tanzania and compared it with

that of a University Hospital in Giessen, Germany.

Characterization was done on a total of non-repetitive 64 Escherichia coli and 24

Klebsiella pneumoniae isolates from Germany and a total 32 Escherichia coli and

92 non-repetitive Klebsiella pneumoniae as well as 18 strains comprising a novel

Enterobacter spp from Tanzania. All isolates were from clinical specimens

including urine, wound swab, pus and blood. Identification and phenotypic analysis

was done using in-house biochemical assays, API 20E, VITEK and wherever

necessary 16s rDNA was used for taxonomic determination. Antimicrobial

susceptibility testing of the isolates was performed using disc diffusion method and

occasionally by the E-test. Genotyping of ESBL alleles, phylogenetic grouping

using species-specific primers, and plasmid incompatibility group typing were

determined using specific oligonucleotide primers following by amplification using


xv

the polymerase-chain reaction (PCR). Multilocus sequence-typing (MLST) by DNA

sequencing and pulsed-field gel electrophoresis (PFGE) were used to determine

clonality of the isolates. Location of ESBL alleles in the respective strains was

identified using transformation, conjugation techniques and subsequently confirmed

by southern blot hybridization using blaCTX-M-15 specific probes.

Escherichia coli formed the majority of ESBL-producing isolates from Giessen

University Hospital (56%), while at Bugando Medical Centre most of ESBL

producing isolates were Klebsiella pneumoniae (69%). Thirty two Escherichia coli

from Bugando Medical Centre formed 22 PFGE clusters while only 6 PFGE

clusters were seen among 63 Escherichia coli from Giessen University hospital

(p=0.0011). Also Multiple ST clones were observed in isolates from Bugando

Medical Centre. The blaCTX-M-15 allele, encoding an extended spectrum -lactamase,

was found to be predominant allele in these two hospitals, in Escherichia coli this

allele was carried in multiple conjugative IncF plasmids. In Klebsiella pneumoniae

the blaCTX-M-15 was found in the chromosomal location in isolates from Germany

while the allele in Klebsiella pneumonia isolates from Bugando Medical Centre was

found in multiple conjugative plasmids with size ranging from 25kb to 483kb. As

with Escherichia coli a high diversity of Klebsiella pneumoniae isolates from

Bugando Medical Centre was observed.

In conclusion, high prevalence of ESBL producing Escherichia coli and Klebsiella

pneumoniae was observed in a tertiary hospital in Tanzania. The blaCTX-M-15 was

predominant allele in Giessen and at Bugando Medical Centre Mwanza, K.


xvi

pneumoniae harboring blaCTX-M-15 is a common nosocomial pathogen in a tertiary

hospital in Tanzania and the gene is carried in multiple conjugative plasmids. There

is significant variation of molecular epidemiology of ESBL isolates in these two

hospitals. More work should be done globally especially in developing countries in

the diagnosis and surveillance of ESBL producing isolates.


xvii

LIST OF PUBLICATIONS

I. Mshana SE., Kamugisha E, Mirambo M, Chakraborty T, and Lyamuya E.

Prevalence of multiresistant Gram-negative organisms in a tertiary hospital in

Mwanza, Tanzania. BMC Research Notes 2009, 2:49

II. Mshana, SE, Imirzalioglu C, Hossain H, Hain T, Domann E, Chakraborty T.

Conjugative IncFI plasmids Carrying CTX-M-15 among Escherichia coli

ESBL producing isolates at a University hospital in Germany. BMC Infectious

Diseases 2009, 9:97 (Highly accessed)

III. Kayange N, Kamugisha E, Jeremiah S, Mwizamholya DL and Mshana SE.

Predictors of positive blood culture and deaths among neonates with

suspected neonatal sepsis in a tertiary hospital, Mwanza- Tanzania. BMC

Pediatrics 2010, 10:39 (Highly accessed).

IV. Mshana SE, Imirzalioglu C, Hain T, Domann E, Lyamuya EF, Chakraborty

T. Multiple ST clonal complexes, with a predominance of ST131, of

Escherichia coli harbouring blaCTX-M-15 in a tertiary hospital in Tanzania.

Clinical Microbiology and Infection 2011, DOI: 10.1111/j.1469-

0691.2011.03518.x

V. Mshana SE, , Gerwing L, Minde M, Hain T, Domann E, Lyamuya EF and

Chakraborty T, Imirzalioglu C. Outbreak of a novel Enterobacter spp

carrying blaCTX-M-15 in a neonatal unit of a tertiary Hospital Tanzania.

International Journal of Antimicrobial and Chemotherapy 2011, 38 (3), 265-

269

VI. Mshana SE, Torsten Hain, Eugen Domann, Eligius F Lyamuya, Trinad

Chakraborty and Can Imirzalioglu. Predominance of Klebsiella pneumoniae

ST14carrying CTX-M-15 causing neonatal sepsis in Tanzania. BMC

Infectious Diseases 2013, 13:466(Highly accessed).


18

CHAPTER ONE

1.0 INTRODCUTION

1.1 BACKGROUND

Emergence of resistance to -lactam antibiotics began even before the first -

lactam, penicillin was developed. The first -lactamase was identified in

Escherichia coli prior to the release of penicillin for use in medical practice [1].

Most of gram-negatives bacteria possess naturally occurring chromosomally

mediated -lactamases; due to the selective pressure exerted by -lactam producing

soil organisms found in the environment [2]. The first plasmid mediated -

lactamase was discovered in 1965 in Escherichia coli isolated from a patient named

Temoniera in Greece hence designated TEM [3]. Its presence on various plasmids

and its association with a transposon has facilitated the spread of TEM-1 to other

bacteria within a few years after its isolation. Indeed TEM-1 has spread worldwide

and is now found among different species of the family Enterobacteriaceae [4].

Another common plasmid mediated -lactamase found in Klebsiella spp and

Escherichia coli is SHV-1(named after the Sulfhydryl-variable active site). The first

report of plasmid encoded -lactamase capable of hydrolyzing the extended

spectrum cephalosporins was published in 1983 [5]. A Klebsiella ozaenae isolate

from Germany passed a -lactamase SHV-2 which efficiently hydrolyzed

cefotaxime and to a lesser extent ceftazidime [5]. Recently another type of ESBL

(CTX-M) has been described, these enzymes preferentially hydrolyze cefotaxime

over ceftazidime and they also hydrolyze cefepime with high efficiency [6, 7].


19

Today over 100 CTX-M ESBL types have been describe, these ESBLs have been

found worldwide in many different genera of the family Enterobacteriaceae and

Pseudomonas aeruginosa [7].

In clinical strains, CTX-M-encoding genes have commonly been located on

plasmids that vary in size from 7kb-260kb [7-11]. Few studies which have done

replicons types of these plasmids have established that majority of these plasmids

are IncFII plasmids, either alone or in association with Inc FIA and FIB [8, 9]. One

study had reported the presence of IncFI alone in one isolate in Turkey [10]. Other

Inc groups like IncI1, IncN have been reported [8]. Most of these plasmids are

conjugative with conjugation frequency ranges from 10-2-10-7 and they have been

found to have multiple resistant genes [11].

Recently, the intercontinental emergence of the ciprofloxacin-resistant E. coli

O25:H4 ST-131 clonal group producing blaCTX-M-15 and characterized by an

extensive virulence profile has been described in the hospital and community

settings of several countries including France, Portugal, Canada, Korea, Spain,

Lebanon, and Switzerland, Russia, Hungary, Austria and Germany [12, 13].

Because of its wide distribution, the O25:H4 ST-131 clonal group represents a

highly epidemic group that is able to acquire different mechanisms of resistance,

sometimes including ESBL production [12]. Extensive studies investigating the

association of the Multilocus sequence typing (MLST) clonal complex ST131 and

blaCTX-M-15 have been done in developed countries, while very few studies have been

done in developing countries [12, 13]. Worldwide dissemination of blaCTX-M-15


20

seems to be linked to this clonal complex which is a member of the phylogenetic

group B2 and characterized by co-resistance to several classes of antibiotics e.g.

aminoglycosides, quinolones, co-trimoxazole (SXT) and tetracycline [12, 13].

This study was done to characterize ESBLs isolates from Bugando Medical Center

and Institute of Medical Microbiology Giessen and compare the ESBLs allele,

plasmids incompatibility (Inc) groups and PFGE clones of the isolates. The

predominance of blaCTX-M-15 in these two institutions associated with conjugative

IncF plasmids of variable sizes 25kb-291kb is reported in this thesis. It also reports

the extensive heterogeneity of Escherichia coli and Klebsiella pneumoniae carrying

blaCTX-M-15 from Tanzania and we report here for the first time the presence of

Escherichia coli ST131 in Tanzania and identify a novel Enterobacter spp carrying

blaCTX-M-15 that is associated with outbreaks in pediatric wards..

1.2 STATEMENT OF THE PROBLEM

Antimicrobial resistance is fast becoming a global concern with rapid increases in

multidrug resistant organisms. The prevalence of ESBL producing clinical isolates

is more than 20% in Asia and South Africa [7, 14]. In Muhimbili Tanzania more

than 80% of isolates are resistant to ampicillin and 25% of Escherichia coli isolates

were ESBL producers [15] and recently in Muhimbili more than 45% of

Escherichia coli and Klebsiella pneumoniae have been found to produce ESBL

[16]. In Giessen Germany, the Escherichia coli ESBL producing isolates are on the

increase, most of them are resistant to multiple antibiotics. In Giessen, there was

more than 2 fold increase of Klebsiella pneumoniae ESBL producing isolates in


21

2007 when compared to 2006 from 4.5% to 11.6% [Unpublished]. CTX-M ESBL

types have been reported in Germany and Tanzania, CTX-M type has been found to

be associated with multiple resistant genes [7, 15].

Antimicrobial agents are the most important tools available for managing infectious

diseases. Some of the ESBL producing isolates are untreatable so prevention will be

crucial in controlling infection with these resistant organisms. Therefore it is

essential to address this issue as a cornerstone to prevent the emergence of

multiresistant organisms. This study aims at characterizing ESBL-producing

isolates in two distinct geographical locations, located 8000km apart, viz., in

Giessen Germany and Mwanza, Tanzania. It addresses their emergence and

compares the molecular epidemiology between these institutions.

1.3 RATIONALE OF THE STUDY

In developed countries the use of antibiotics is strictly controlled, this is not the case

in a developing country like Tanzania. There is limited information on molecular

epidemiology of ESBL isolates in Tanzania. Inappropriate use of antibiotics is

rampant in several places in Tanzania, a situation that provides a conducive ground

for the outbreak of resistant organisms. The treatment of bacterial infection at BMC

is largely empirical with no laboratory results in most instances to guide therapy.

There is no data on common gram negatives isolates and their susceptibility pattern

from different units and there is also no data on ESBL among common isolates like

Escherichia coli, Klebsiella pneumoniae, Enterobacter spp etc. Treatment option

for ESBL isolates is expensive and is often at times not available in resource-limited


22

settings like Tanzania. Controlling the spread and occurrence of these isolates is

therefore very important. This study was undertaken to estimate the magnitude of

ESBL in Bugando Medical Centre and compare its molecular epidemiology to that

of Giessen University Hospital. Information obtained from this study will contribute

towards developing evidence-informed policy on rational use of antimicrobial

agents, control and prevention of emergence of multidrug resistant microbial strains

in Tanzania.


23

1.4 AIMS OF THE THESIS

1. To determine the distribution of ESBL isolates in different patient care units

at Bugando Medical Centre (BMC) and Institute of Medical Microbiology

Giessen

2. To determine the prevalence of ESBL alleles among ESBL isolates from

both institutions.

3. To ascertain molecular epidemiology of ESBL isolates using plasmid

analysis, phylogenetic groups, PFGE and MLST.

4. To compare the molecular epidemiology of ESBL isolates from Bugando

Medical centre and those from Giessen University Hospital.


24

CHAPTER TWO

2.0 LITERATURE REVIEW

2.1 Definition of ESBLs and classification

There is no consensus regarding the precise definition of ESBLs; a commonly used

working definition is that ESBLs are -lactamases capable of conferring bacterial

resistance to penicillin, first, second and third generation cephalosporins and

aztreonam (but not the cephamycins or carbepenems) by hydrolyzing these

antibiotics and which are inhibited by -lactamase inhibitors such as clavulanic acid

[18, 19]. These enzymes can be classified according to two general schemes; the

Ambler molecular classification scheme and the Bush-Jacoby-Medeiros functional

classification system [18]. The Ambler schemes divides -lactamases into four

major classes (A to D). The basis of this classification scheme rests upon protein

homology and not phenotypic characteristics. Class A, C and D are serine -

lactamase and class B is metallo- -lactamases [18, 19]. The Bush-Jacoby Medeiros

scheme groups these enzymes according to functional similarity (substrate and

inhibitor profile). This classification scheme is of more relevance to physicians or

microbiologists in diagnostic laboratory because it considers -lactamase inhibitor

and -lactam substrates that are clinically relevant (Table 1).


25

Table 1: Modified Bush Jacoby Medeiros Classification of -lactamases [18] Functional group Substrate

profile Molecular

Class Inhibitor Example

1 Cephalosporinase C OXA AmpC,MIR-1

2a Penicillinase A Clav S.aureus

2b Broad spectrum A Clav Tem-1/2,SHV-1

2be

Extended

A

Clav

Tem-3-29,Tem-46,Tem 104, SHV 2-28, CTX-M types

2br Inhibitor resistant A - Tem-30-41(IR 1-12)

2c Carbenicillinase A AER-1 ( C), CARB-3

2d Oxacillinase D Clav PSE-1

2e Cephalosporinase A Clav OXA-1, OXA-2,10

2f Carbepenemase Clav IPM-1,NmcA, Smc1-3

3 Metalloenzymes A - S. maltophilia

4 Penicillinase B B. cepacia (c)

2.2 ESBLs types

TEM: The TEM type ESBLs are derivatives of TEM-1 and TEM-2. TEM -1 was

first reported in 1965 from the patient named Temoniera hence the designation

TEM [4]. It is the most commonly encountered -lactamase among gram negative

bacteria [19]. TEM-1 which is not an ESBL can hydrolyze ampicillin at greater

extent than oxacillin, carbenicillin or cephalothin and cannot hydrolyze extended

spectrum cephalosporins such as ceftriaxone, cefotaxime, ceftazidime etc [4]. It is

inhibited by clavulanic acid. TEM-2 has the same hydrolytic profile as TEM-1, but


26

it has more active native promoter and different isoelectric point of 5.6 compared to

5.4 of TEM-1 [20]. TEM-13 has a similar hydrolytic profile as TEM-1 and TEM-2.

TEM-1, 2 and 13 are not Extended Spectrum Beta-Lactamases. Currently over 100

TEM-type -lactamases have been described of which most of them are ESBLs

(http://www.lahey.org/Studies/temtable.asp). Their isoelectric points range from 5.2

to 6.5 [20, 21]. In Tanzania TEM- ESBL type has been reported [15].

SHV: SHV refers to Sulfhydryl variable. The SHV types, used to be more

frequently found in clinical isolates than any other type of ESBL. The first SHV that

hydrolyze extended spectrum -lactam antibiotics was isolated from Klebsiella

ozaenae in 1983 in Germany [5]. This enzyme was found to differ with parent

enzyme SHV-1 by replacement of glycine with serine at 238th position and it was

designated SHV-2. SHV types of ESBLs have been detected in a wide range of

enterobacteriaceae and outbreaks of SHV producing Pseudomonas spp and

Acinetobacter spp have been reported [22]. Unlike TEM-type -lactamases, there

are few derivatives of SHV-1; more than 50 SHV varieties have been described

worldwide [23]. SHV ESBL alleles have been reported in Tanzania and Germany.

CTX-M: CTX-M is a recently described family of ESBLs; these enzymes

hydrolyze cefotaxime more than ceftazidime and they also hydrolyze cefepime with

high efficiency [24, 25]. Tazobactam exhibits a better inhibitory effect towards

CTX-M than sulbactam and clavulanate [26]. Genes for these enzymes are located

on the plasmids generally ranging from 7-260kb of size [7]. Plasmids have acquired

these genes from chromosomes of Kluyvera spp [27]. CTX-M type has been


27

reported in most parts of the world, and it is believed that it might be the most

frequent type of ESBLs in the world [7]. More than 113 CTX-M varieties are

currently known [http://www.lahey.org/Studies/other.asp]. The blaCTX-M-15 allele is

considered to be predominant in many countries and it has also been reported in

Tanzania and Germany [7, 15]. We here report this allele from isolates in Giessen

University Hospital and those from Bugando Medical Centre.

OXA- Beta lactamases: The OXA- -lactamases are so named because of their

oxacillin hydrolyzing abilities. These -lactamases are characterized by their ability

to hydrolyze cloxacillin and oxacillin 50% more than benzyl penicillin [28, 29].

They predominantly occur in Pseudomonas spp, but have been detected in many

other gram negative bacteria [28]. Most of OXA-type -lactamases do not

hydrolyze extended spectrum cephalosporins to a significant degree, they are not

ESBLs. OXA-10 weakly hydrolyze cefotaxime, ceftriaxone and aztreonam. Other

OXA ESBLs derived from OXA-10 includes OXA-14, 16, 15, 18, 19, 28, 31, 32,

and 45 [28, 29].

Other ESBLs types include PER1-2, VEB-1-2, GES, SFO and IBC. PER type

ESBL share only 25 to 27% homology with known TEM and SHV type ESBLs.

This enzyme was first detected in pseudomonas and later in salmonella and

acinetobacter [30]. VEB-1 has greatest homology (38%) with PER-1 and PER-2

[31]. It has higher level resistance to ceftazidime, cefotaxime and aztreonam, which

is reversed by clavulanic acid. This enzyme is plasmid mediated; it was first

isolated from a Vietnamese child hospitalized in France [31, 32]. Other VEB


28

enzymes have been described in Kuwait and China [33, 34]. GES, SFO and IBC are

examples of non-TEM, non SHV ESBLs and have been found in a wide range of

geographical locations [35, 36].

2.3 Epidemiology of ESBL

ESBL epidemiology should be considered at different levels, namely the level of

single patient, of a single medical institution and a wider geographical scale. Each

of these levels, it depends on evolutionary phenomenon that occurs in ESBL

producing strains [36]. Interspecies dissemination of an ESBL gene carrying

plasmids in multi-bacterial infection/colonization cases has been reported [7, 11,

14]. ESBLs have been found in wide range of gram negative rods, with the majority

of strains harbouring these enzymes belonging to the family of enterobacteriaceae.

Escherichia coli and Klebsiella pneumoniae are important ESBL producing

organisms in the enterobacteriaceae family [37, 38]. Non-enterobacteriaceae ESBL

producers are rare, with Pseudomonas aeruginosa being the most important. ESBL

producers are usually selected in hospitals, although outbreaks have been reported

in nursing home facilities [37]. The distribution of ESBL isolates in the hospitals is

common in the wards where patients have a higher risk for infections such as ICU,

surgical wards, neonatal wards, chronic care facilities etc [39]. In these units

outbreaks are common, and most outbreaks are attributed to plasmid transfer or

clonal spread [40]. In some studies ESBL coding genes have been identified in

multiple plasmids present in bacterial strains and ESBL genes are usually located in


29

transposon or integrons which strongly facilitate horizontal transfer of these genes

[7, 41].

ESBL producing isolates are currently a major problem in hospitalized patients

worldwide [41, 42, 43, 44]. The prevalence of ESBLs among clinical isolates varies

between countries and from institution to institution. In the USA the prevalence

among Enterobacteriaceae ranges from 0-25% depending on the institution with

national average being 3% (http://www.cdc.gov/ncidod/hip/surve). For Germany,

Austria and Switzerland a multi-center study of the Paul Ehrlich Society in 2001

detected ESBL rate of 0.8 for Escherichia coli and 8.2% for K. pneumoniae. In

Germany, the study involving the GENARS hospital network in 2004 found 1.7%

and 7.1% for Escherichia coli and Klebsiella pneumoniae, respectively [38]. For

southern European countries ESBL rates of more than 50% have been reported. In

Japan the survey which involved 196 institutions found


30

pneumoniae [7, 12, 44]. In this thesis extensive description is done on ESBL

regarding plasmids, ST and phylogenetic analysis.

Specific ESBL allele can be predominant in a certain country or region. For

example TEM-10 has been responsible for several outbreaks in USA [36]; TEM-3

is common in France but has not been detected in USA. The blaCTX-M-15 has spread

all over the country in Lebanon in both hospital and in the community acquired

ESBL enterobacteriaceae [7, 44, 45]. Recently blaCTX-M-15 has been reported to be

predominant in many countries such as UK, Poland, Italy, Spain, Lebanon and

others [7, 18, 24, 25, 45].

2.4 Detection of ESBL

Several methods have been used to screen and confirm the presence of Extended

Spectrum Lactamase [46]. These methods can differ between countries and

Clinical Microbiology Laboratories. The Clinical Laboratory and Standard Institute

(CLSI) proposed disk diffusion methods for screening ESBL producing Escherichia

coli, Klebsiella pneumoniae and Proteus mirabilis [47]. Cefpodoxime, ceftazidime,

aztreonam, cefotaxime or ceftriaxone can be used, the use of more than one of these

discs increase sensitivity of detection [46]. With any zone of diameter that may

indicate suspicion of ESBL production, phenotypic confirmation should be done

[47, 48]. Cefpodoxime 10g has been found to be more sensitive than other

cephalosporins for screening ESBL production, CLSI recommends, the isolate with

zone diameter 17mm should be confirmed for ESBL production [47]. In broth

dilution tests a MIC of 2g/ml for cefpodoxime, ceftazidime, cefotaxime and


31

aztreonam is an indication for phenotypic confirmation of ESBL production and

warrants phenotypic confirmation [47].

Disk Approximation method (Double disc synergy): This is simple and reliable

method for detection of ESBL production. The disc that contains oxyimino lactam

(30g) is placed 30mm apart (center - centre) from amoxicillin- clavulanate disk

(20/10g) clear extension of the edge of the inhibition zone towards amoxicillin-

clavulanate disk is interpreted as positive ESBL production (Figure 1). The

sensitivity of the test can be increased by reducing the distance to 20mm [46, 47].

Three dimensional tests can also be used to confirm ESBL production [49]. In this

method the standard inoculum of test organisms is inoculated on Muller Hinton agar

plate, a slit is cut on agar plate in which a broth suspension of test organism is

placed; antibiotic disc is placed 3-4mm from the slit [49]. Distortion of circular

inhibition zone is interpreted as positive ESBL production. This method is very

sensitive in detecting ESBL production, but is more labor intensive than other

methods.

Figure 1: Disk Approximation method. AMC, Amoxicillin clavulanic acid; CAZ ceftazidime; CRO, ceftriaxone

CRO

AMC

CAZ


32

Combine disk test (Inhibitor potentiated disk test): Cephalosporins disks

(cefotaxime 30g, ceftazidime 30 g, Cefpodoxime 30g) with and without 10g

clavulanic acid are placed on Muller Hinton agar inoculated with test organisms

[50]. An increase in the inhibition zone diameter of 5mm in cephalosporins disk

combined with clavulanic acid, compared to cephalosporins alone, indicates ESBL

production. MIC reduction test can also be used; an 8 fold reduction in the MIC of

cephalosporin in presence of clavulanic acid, using E Test or broth micro/macro

dilution indicates ESBL production [46-48, 51]. There is commercially available E

tests for ESBL detection; one side contains a gradient of cephalosporin (MIC 0.5-

32g/ml) and other side the same gradient with a constant concentration of 4g/ml

clavulanic acid [46].

BD Phoenix Automated Microbiology system: The phoenix ESBL test uses the

growth response to cefpodoxime, ceftazidime and cefotaxime to detect ESBL

production [48, 51]. VITEK ESBL Cards: Wells containing cards are inoculated,

the reduction in growth of cephalosporins well contains clavulanic acid; when

compared to with level of growth in well with cephalosporin alone indicates

presence of ESBL production [51].

Molecular detection methods: These include DNA probes, PCR, oligotyping,

PCR-RFLPs and nucleotide sequencing. Molecular methods can detect different

variants of ESBL but they can be labor intensive and expensive to be adopted as

routine methods [7, 11, 20, 51].


33

2.6 Plasmid incompatibility groups

Most of ESBL genes are plasmid mediated and few studies which have done a

characterization of their replicons using PCR based replicon typing have found that

the majority of these plasmids to be IncFII plasmids, either alone or in association

with Inc FIA and FIB [8, 9]. One study reported the presence of Inc FI alone in one

isolate in Turkey [10]. Other Inc groups like IncI1, IncN, and IncP have been

reported [9]. In this thesis we confirm association of IncF plasmids and blaCTX-M-15,

also we report association of Inc FI alone and blaCTX-M-15 in 63 Escherichia coli

isolates from Giessen, Germany

2.7 Escherichia coli and Klebsiella pneumonia Phylogenetic

groups and ESBL

Population genetics analyses and determination of the phylogenetic relationships

between strains have proven to be extremely useful approaches to obtain insight

into the epidemiological pattern of bacterial species and the evolution of

pathogenicity [52, 53]. Phylogenetic analyses have grouped Escherichia coli strains

into four main phylogenetic groups (A, B1, B2 and D) [52]. Virulent extra-

intestinal strains belong mainly to group B2 and to a lesser extent to group D

whereas most commensals strains belong to group A. Studies have found most of

the ESBL producing E. coli belong to group B2 [53]. Commensals Escherichia coli

(group A) have also been found to produce ESBL [54]. Klebsiella pneumoniae

isolates fall into three phylogenetic groups named KpI, KpII and KpIII. KpI

comprises the majority of Klebsiella pneumoniae isolates; in Brisse et al [55] more


34

than 80.3% of isolates were KpI. In the few studies that determine phylogenetic

groups among Klebsiella pneumoniae ESBL isolates found that most of ESBL

isolates belonged to KpI; also they demonstrated an association between blaCTX-M-10

and KpIII [55].

Multi-locus sequence typing (MSLT) also has been used to trace the epidemiology

of the ESBL producing isolates, and in contrast to pulsed field gel electrophoresis

(PFGE) this provides interlaboratory and comparison in different countries [56, 57,

58]. Extensive studies have been done in developed countries among Escherichia

coli ESBL producing isolates [12, 13, 58]. Using this method the rapid and

international spread of blaCTX-M-15 has been mainly associated with the global

dissemination of Escherichia coli clonal strain ST-131 O25:H4 and ST-405 [12, 13,

58].

2.8 Treatment options

Most of the ESBL isolates harbour the plasmids which confer co-resistance to

aminoglycosides and co-trimoxazole (SXT) [59]. Also there is strong association

between ESBL production and resistance to quinolones [7, 59, 60]. Klebsiella

pneumoniae ESBL isolates have been found to be deficient in porins and showed

active efflux of quinolones also some of the plasmids carrying blaCTX-M genes

harbor genes for quinolones resistance and most of the blaCTX-M ESBL types

hydrolyze 4th generation cephalosporins [61].


35

Quinolones can be used as treatment of choice in urinary tract infection, if there is

no in vitro resistance [60]. Carbepenems should be regarded as treatment of choice

for ESBL producing organisms as ESBL- producing strains are uniformly sensitive

to carbepenems and also there is a base of clinical experience [59, 60]. Few studies

have reported the use of tigecycline [62]. In the present thesis the majority of ESBL

producing isolates were multiply resistant to gentamicin, SXT, tetracycline and

ciprofloxacin; they were all sensitive to carbepenems and all isolates from Giessen

Germany were sensitive to tigecycline.


36

CHAPTER THREE

3.0 Material and Methods

3.1 Study area

The isolates analyzed in this study were from Bugando Medical Centre (BMC)

which has bed capacity of 800 and the Institute of Medical Microbiology Giessen

(IMMG). BMC is a referral hospital and serves as University teaching hospital for

Weill Bugando Medical College. The Institute of Medical Microbiology Giessen

handles all specimens for microbiological examination from Giessen University

Hospital which has bed capacity of more than 1500.

3.2 Isolates

A total of 116 ESBL isolates from Giessen University hospital were analyzed. The

majority of these included Escherichia coli 66 (57%), Klebsiella pneumoniae 24

(20.6%), Enterobacter cloacae 8 (6%) and others 18 (15%) (Enterobacter

gergoviae, Citrobacter freundii, Proteus mirabilis, Sternotrophomonas

maltophilia). From BMC more than 1000 routine clinical specimens were processed

and 133 ESBL producing isolates were analyzed of which 92(69%) were Klebsiella

pneumoniae, 32(18%) Escherichia coli and 17 (13%) Enterobacter spp.

Pure cultures of clinical isolates were identified using a set of in-house biochemical

tests (Table 2). Isolates exhibiting ambiguous taxonomic classification were retested

with API 20E (BioMerieux, France), VITEK (BioMerieux, France) and Phoenix-

NMIC/ID-64 (Becton Dickson) following the manufacturers instructions. In few

cases 16S-rDNA studies were done using primers described previously [63]. In


37

isolates from Giessen polymicrobial infections occurred in three cases of UTI; the

first case with significant count of both Escherichia coli and Enterobacter cloacae,

the second with Escherichia coli and Enterobacter gergoviae and the third with

Klebsiella pneumoniae in the urine sample and Escherichia coli in the blood

culture.

Table 2: Example of Biochemical tests which were used to identify enterobacteriaceae [46]

I= Yellow/Yellow, II= Red/ Yellow, III= Black coloration due to H2S, D = Differential, W= few give positive results, Lact=Lactose, KIA=Kligler Iron Agar,

Species Lac

KIA ORN LYS IND Ure CIT MOT Glucose Rhamnose

K .pneumoniae + I - + - + + - + +

K. oxytoca + I - + + + + - + +

Escherichia coli + d I or II d + + - - + + +

Ent. aerogenes +d I or II + + - - + + +

Ent cloacae + d I or II + - - + w + + +

Citr diversus +d I or II + - + + + + +

Serr marcescens - II + + - d w + 10% -

Serr liqufaciens - II + D - - + 10% -

Hafnia alvei - II + + - - + + +

Prov rettgeri - II - - + +w + + - -

Prov stuartii - II - - + - + + - -

Morg. morganii - II + - + +w - d -

Prot mirabilis - III + - - +s d + + -

Prot vulgaris - III - - + +s - + d -

Salmonella - III + + - - d + + +

Citro freundii + III + - - + + + + +


38

ORN=Ornithine decarboxylase, LYS=Lysine decarboxylase, IND=Indole, CIT=Citrate

3.3 Susceptibility testing

Routine susceptibility was determined using the disk diffusion method on Mueller-

Hinton agar (Thermofisher, UK) as recommended by the Clinical and Laboratory

Standard Institute (CLSI) [47]. Susceptibility was tested against ampicillin (10 g),

amoxycillin/clavunate (20/10g), ampicillin/sulbactam (10/10g), tetracycline (30

g), gentamicin (10 g), tobramycin (10 g), SXT (1.25/23.75 g), ciprofloxacin

(5 g), moxifloxacin (5 g), 20 cefpodoxime (10 g), ceftazidime (30 g),

cefepime (30 g), imipenem (10 g) and meropenem (10 g) (BD BBL, USA). All

isolates resistant to multiple cephalosporins were confirmed for ESBL production

using double disk synergy (Disk approximation method Figure 1). Bacterial

colonies were resuspended in saline to a turbidity of 0.5 McFarland standards and

inoculated on a Muller Hinton agar plate. Disks containing ceftazidime (30 g) and

cefotaxime (30 g) were placed 20 mm center to center to the

amoxycillin/clavunate (20/10g) disk. The plates were incubated at 37C for 18-

20h. An enhanced zone of inhibition towards the amoxycillin/clavunate (20/10 g)

disk indicated positive ESBL production [46, 47, 64]. The MIC for cefepime and

tigecycline were determined using E tests ranging 0.016-256 g /ml (AB Biodisk,

Solna, Sweden) according to the manufacturers instructions and the Clinical

Laboratory and Standard Institute (CLSI). Bacteria were cultured on LB agar plate

(BD BBL, USA) for 18h at 37C and colonies resuspended in sterile saline to 0.5

McFarland standards. Each suspension was inoculated on a 90-mm diameter


39

Mueller Hinton agar plate and E test strips were applied as recommended by the

manufacturer. Results were recorded after 16-20h of incubation. Quality of media,

antibiotic disks and E test strips were controlled with Escherichia coli ATCC

25922. Isolates with a MIC of 8g/ml for cefepime and a MIC of 2g/ml for

tigecycline were considered resistant according to the CLSI [46, 47].

3.4 Amplification of ESBLs genes and ISEcp1 element

A single colony of each organism was inoculated into 5ml of LB broth (BD BBL,

USA) and incubated for 18hrs at 370C while shaking. Cells from 2ml of overnight

culture were harvested by centrifugation at 13000rpm for 5 minutes. The

supernatant was discarded and cells were suspended in 500l of sterile distilled

water. The suspension was incubated for 10 minutes at 95oC to lyse the cells, and

then centrifuged at full speed for 10 minutes to remove cellular debris. Five

microlitres of supernatant was used as template DNA in the PCR reaction [11, 65].

PCR amplification of TEM, SHV and CTX-M genes were performed as described

previously using primers in Table 3. For amplification, 5 l of template DNA was

added to a 45l mixture containing 200M of dNTP mixtures (Roche, Switzerland)

0.4M of each primer, 2.5U taq polymerase (Invitrogen, USA) and appropriate

buffer (0.2 l MgCl2, 2.5 l KCL, 0.5l 10% Tween 20, 1l of Gelatin and 3.8l of

pure water). The reaction was performed in Gene Amp PCR system 9700 thermo

cycler (Applied Biosystems, USA) under the following conditions: Initial

denaturation at 94oC for 5 minutes followed by 35 cycles of 30 seconds

denaturation at 94oC, 30 seconds annealing at 58oC, 60 seconds extension at 72oC,


40

and a final extension at 72oC for 7 minutes. For SHV, the annealing temperature

used was 55oC [65]. Using the published sequence of a 92kb plasmid carrying

blaCTX-M-15 (GenBank accession AY044436), primer sets (4, 5 table 3) was designed

to amplify the ISEcp1 element in blaCTX-M-15 carrying Escherichia coli and K.

pneumoniae isolates [11]. The reaction mixture was the same as for the ESBL

genes, except that an annealing temperature of 62C was used. PCR products were

detected with ethidium bromide fluorescence using the Bio-Rad image system (Bio-

Rad, UK) after 1 hour electrophoresis in 1% TBE agarose gel. Positive controls for

TEM, SHV and CTX-M were used in every run.

3.5 Sequencing

PCR products were purified using Invitek purification kit (Invitek, Berlin Germany)

following the manufacturers instructions. Reverse and forward sequence reactions

were done using the corresponding primers used for amplification, and sequencing

was performed using the automated sequencer ABI Prism 3100 (Applied

Biosystems, USA). In case of isolates from Tanzania all PCR products were

sequenced (LGC genomics GmbH, Berlin Germany) using the same primers plus

additional set of primers (CTF) to cover mutation that differentiate blaCTX-M-15 from

blaCTX-M-28. The resulting sequences were compared with known sequences using

DNASTAR software (DNASTAR Inc, Madison, USA) and the Basic Local

Alignment Search Tool (BLAST, NCBI).


41

3.6 Location and transferability of ESBL genes

Plasmids were extracted using alkaline lysis method as describe previously [10] and

transformed into Escherichia coli DH10 by electroporation at 1.8kv, using Gene-

Pulser (Bio-Rad, UK). Transformants were selected on LB agar containing 30g/ml

cefotaxime (Sigma, Germany) [11, 65].

Table 3: Primers used for amplification and sequence of ESBL genes and IS element Target Primer

name Sequence(5-3) Product

size References

1. blaTEM TEM-F TCCGCTCATGAGACAATAACC 931bp 65

TEM-R TTGGTCTGACAGTTACCAATGC

2. blaCTX-M CTX-F TCTTCCAGAATAAGGAATCCC 909bp 65

CTX-R CCGTTTCCGCTATTACAAAC

3. blaSHV SHV-F TGGTTATGCGTTATATTCGCC 868bp 65

SHV-F GGTTAGCGTTGCCAGTGCT

4. tnpA tnpA- F GCAGGTGATCACAACC 1800bp Article II

tnpA- R GCGCATACAGCGGCACACTTCCTAAC

5. CTX/tnpA F GTATCAAAGCTTCATGCTCACGGCGGG 3185bp Article II

R GGAAAAAAGCTTAGGTGATCACAACCG

6. CTF CT-F GACAGACTATTCATGTTGTTG 419bp Article 1V

CT-R CGATTGCGGAAAAGCACGTC

7. ChuA ChuA.1 GACGAACCAACGGTCAGGAT 279bp 66

ChuA. 2 TGCCGCCAGTACCAAAGACA

8. yjaA YjaA.1 TGAAGTGTCAGGAGACGCTG 211bp 66

YjaA.2 ATGGAGAATGCGTTCCTCAAC

9. TSPE4.C TspE4C2.1 GAGTAATGTCGGGGCATTCA 152bp 66

TspE4C2.2 CGCGCCAACAAAGTATTACG


42

Conjugation was carried out using overnight cultures with Escherichia coli CC118

as a recipient strain and randomly selected clinical isolates of Escherichia coli and

Klebsiella pneumoniae, representing different PFGE-based clusters, respectively, by

mixing them at the ratio 2:1 on LB agar and incubation overnight at 37C.

Transconjugants were selected by suspending the growth in 1ml of PBS and 100l

of 100 -10-4 dilutions were plated on LB agar containing rifampicin 300 /ml and

100 g/ml ampicillin. The denominator was calculated from 1ml of original donor

cells by diluting to 10-8. The transconjugants were tested for ESBL production

followed by PCR amplification of ESBL gene. All transconjugants plasmids were

sized using PFGE SI nuclease digestion as described previously [67] followed by

southern blotting and hybridization using digoxygenin (DIG)-labeled blaCTX-M-15

amplicon probes, prepared according to the manufacturers instruction (DIG High

Prime DNA labeling and Detection Starter Kit II, Roche, Germany). PCR based

replicon typing was done to selected isolates and their transconjugants using

primers pairs which recognize FIA, FIB, FII, FrepB, I1, P, A/C, X, HI1,HI2, L/M,

FIC, Y, W,T, K and N replicons [9]. Sequencing was done to confirm the detected

replicons using the same primers. All recombinant techniques were performed

under biosafety cabinet.

10. gyrA gyrA-A CGCGTACTATACGCCATGAACGTA 441bp 55

gyrA-C ACCGTTGATCACTTCGGTCAGG

11. parC2 parC2-1 GGCGCAACCCTTCTCCTAT 55

parC2-3 GAGCAGGATGTTTGGCAGG


43

3.7 Recombinant techniques

The blaCTX-M-15 gene together with its insertion elements was cloned into a 2.7kb

plasmid (pSU2719Cm) [68] (Figure 2). Using primer 5 in table 3 the CTX-M/tnpA

gene was amplified and the 3.185kb product was purified from the gel using

QIAEX II Gel extraction kit (QIAGEN, Germany). Plasmids were extracted from

an over night culture of DH10 using QIAprepR Spin Miniprep Kit (QIAGEN,

Germany). Plasmids and vector were restricted with Hind III (MBI fermentas).

Mixtures were purified using Invitek purification kit (Invitek, Germany) followed

by dephosphorylation of the vector and ligation performed at 16C overnight [68].

The cloned plasmid was used to transform TOP-10R Escherichia coli chemically

and transformants were selected by plating on LB plate with 30g/ml ampicillin and

25g/ml chloramphenicol. Twenty randomly selected colonies (large and small)

were screened for the presence cloned gene into a plasmid using M13 F, M13 rev

and CTX-M specific primers.

Figure 2: Illustration for CTX-M-15 and ISEcp1 and 2.7kb plasmid


44

3.8 Pulse-Field Gel Electrophoresis (PFGE)

PFGE was performed according to the Pulse Net protocol of Centre for Disease

Control and Prevention (Atlanta, USA)

(http://www.cdc.gov/pulsenet/protocols.html). Incubation and washing steps were

prolonged as per recommendations. The agarose embedded DNA was restricted

with Xbal (New England Biolabs) at 37oC for 16hrs. Electrophoresis was performed

on 1% Agarose gel (Bio-Rad, UK) 0.5X TBE buffer (Sigma). For Escherichia coli

the PFGE conditions were 6V, 2.2s-54s pulse, for 20hrs, for Klebsiella pneumoniae

were 6V, 5s-50s for 26hrs. Electrophoresis was conducted using CHEF Drive II

(Bio-Rad, UK). Strain differentiation by PFGE analysis was achieved by

comparison of band patterns using Gelcompar II (Applied Maths, Belgium).

Patterns were normalized on basis of the molecular weight marker. The similarity

coefficient (SAB) of sample pairs was calculated based on band positions by using

the DICE metric [69]. The genetic relationships among isolates were computed by

cluster analysis performed on the matrix of genetic similarities. Cluster analysis was

performed by means of the unweighted paired group method using arithmetic

average (UPGMA) [70]. Dendograms were generated to visualize relationships

among the isolates. The cut-off in the dendograms was calculated at a SAB of 0.99

as a threshold for defining clone of genetically similar isolates and SAB of 0.8 to

define cluster of isolates. The discriminatory power of the applied PFGE typing

method was assessed by calculating the discriminatory index D based on application

of Simpsons index of diversity as described previously [70, 71]. Molecular sizes of

the bands were calculated with Gelcompar II (Applied Maths) by using a calibration


45

curve based on a synthetic regression curve derived from the reference bands

(Lambda Ladder, Biolabs, USA).

3.9 Phylogenetic analysis

All Escherichia coli and Klebsiella pneumoniae ESBL isolates were grouped into

phylogenetic groups. For Escherichia coli Triplex PCR method described in

Clermont et al [66] was used. Three markers were used: chuA, yjaA and

TSPE4.C2, primers sequence are seen in Table 3, using these markers Escherichia

coli were grouped into A, B1, B2 and D phylogenetic groups (Figure 3 and Figure

4).

Figure 3: Dichotomous decision tree to determine the phylogenetic group of an Escherichia coli strain by using the results of PCR amplification of the chuA and yjaA genes and DNA fragment TSPE4.C2.


46

Figure 4: Agarose gel showing chuA, yjaA and TSPE.C2 DNA fragments

For Klebsiella pneumoniae phylogenetic grouping was done using PCR RFLP

analysis for gyrA gene and ParC amplification (Primers in table 3). Three groups

were expected KpI, KpII and Kp III. The gyrA product was restricted by HaeIII and

Taq1 expected fragments are seen in table 4 [55].

Table 4: Interpretation of phylogenetic groups of Klebsiella pneumoniae

KpI (Products) KpII KpIII

HaeIIIB 175-bp,174-bp and 92-bp

HaeIIIC 175-bp,129-bp,92-bp and 45-bp

175-bp,129-bp,92-bp and 45-bp

HaeIIID 267-bp,129-bp,92-bp and 45-bp

Taq1B 197-bp,142-bp, 93-bp and 9-bp

197-bp,142-bp,93-bp and 9-bp

Taq1E 197-bp, 151-bp and 93-bp

ParC - + -


47

3.10 Multilocus sequence typing (MLST)

MLST was carried out as previously described in Escherichia coli MLST website;

gene amplification and sequencing were performed by using the primers listed on

the Escherichia coli MLST website

(http://mlst.ucc.ie/mlst/dbs/Ecoli/documents/primersColi_html) and both strands

were sequenced. Allelic profile and ST determination was derived from the

Escherichia coli MLST website database.

3.11 Biofilm assay

Biofilm assay was performed to all Enterobacter spp from Tanzania. 100l of 1:100

diluted overnight cultures of test strains were dispensed in 96-well microtiter plates

(Becton Dickinson, Germany) containing 100 l LB medium per well. Test plates

were covered with its lid and incubated at 37C for 48 h without shaking. Biofilm

formation was assayed by staining of polystyrene-attached cells with crystal violet

(CV). Briefly after removal of medium and two washes with 150 l of phosphate

buffered saline (PBS) solution, surface-attached cells were covered with 160 l of

0.1% CV for 15 min. Following four subsequent washes with 200 l of PBS

solution, surface-bound CV was extracted by addition of 180 l of ethanol (96%)

and absorbance measurements obtained at 590 nm (A590) using spectrophotometer

[72].


48

3.12 Data analysis

All data were entered in log books and then in the computer using excel sheets. The

data were manually cleaned and final analysis was done as study objectives using

SPSS software and Gelcompar II (Applied Maths, Belgium).

3.13 Quality control

In all tests the use of positive and negative controls was adhered to, and reading of

tests was done by more than two people to avoid bias. Quality control strains were

used as described in methodology section. The API 20E and MIC determination

methods were used in cases where the results were not conclusive. The standard

operating procedures were established at Bugando Medical Centre and

reproducibility was ensured. All isolates have been preserved for future use and for

further identification if needed.

3.14 Ethical consideration

The study obtained clearance from BUCHS and BMC Research Ethics Committee.

The data obtained were used in routine management of the patients. In the cases

where ESBL producers were isolated proper control measures were instructed to

prevent dissemination to other patients. All patients with ESBL producer were

treated and managed appropriately, according to susceptibility results.


49

3.15 Limitations

Inappropriate use of antibiotics prior to specimen collection affected culture rate

results in specimens from BMC. Despite this limitation the study achieved its

objectives and recommendations were laid down.


50

CHAPTER FOUR

4.0 Results

4.1 Escherichia coli from Giessen

4.1.1 ESBL producing Isolates and Susceptibility Results

A total 63 non-replicative isolates of Escherichia coli from Giessen were found to

be ESBL producing phenotypically. These isolates were mainly recovered from

urine 35 (55.5 %), blood culture 6 (9.5%), sputum 5(7.9%) and swabs 17 (27 %).

Most of the isolates studied were from medical ward 29 (46%) and 7(11.1%) were

from ICU. Among 63 phenotypically confirmed ESBLs 61(96.8 %) were positive

for PCR amplification using specific primers for TEM and CTX-M. No isolates

were positive for SHV and 2(3.2 %) were negative in 3 attempts for the PCR-based

amplification reactions for TEM, SHV and CTX-M group 1. CTX-M had the

highest occurrence frequency and was found in 49(77.7 %) isolates. The blaCTX-M-15

was the commonest allele detected, it was found in 36 (57.1%) of all Escherichia

coli tested. Other ESBL alleles detected were CTX-M-3 (4.7%), CTX-M-1

(11.1%), CTX-M-28 (3.1%), TEM-144 (7.9%), TEM-126 (3.1%), TEM-105

(3.1%), TEM-150 (1.6%) and TEM-143 (3.1%) (Appendix 1). CTX-M-15 was

detected in all cases of polymicrobial infection. Twenty randomly selected blaCTX-M-

15-carrying Escherichia coli isolates were positive for the 1.8kb ISEcp1 element.

Co-trimoxazole (SXT) was transferable in 60% of isolates tested and gentamicin in

33% of cases, no transferable ciprofloxacin resistance was observed (Table 5).


51

The rate of resistance to gentamicin, ciprofloxacin, co-trimoxazole (SXT) and

tetracycline were 96.8%, 79.3%, 90.4% and 88.8%, respectively (Appendix 1). All

ESBL isolates were sensitive to carbapenems and tigecycline. The MIC distribution

of tigecycline ranges from 0.19 g/ml to 1.5 g/ml with a mean of 0.7569g/ml and

standard deviation of 0.474. All isolates carrying the CTX-M-15 allele were

resistant to cefepime (MIC 8g/ml). The majority of isolates carrying CTX-M-15

were significantly resistant to gentamicin, SXT, tetracycline and ciprofloxacin when

compared to other alleles (chi square 7.43, p=0.006). There was a significant

association between being resistant to cefepime and having CTX-M-15 allele, when

compared to other CTX M alleles. (p=0.00067, Fisher exact test) appendix 1.

4.1.2 Characterization of isolates using PFGE and Phylogenetic grouping

All of the 63 Escherichia coli were subjected to PFGE analysis. Analysis of PFGE-

patterns revealed that most of the isolates were heterogeneous. The genetic

relatedness of the isolates is illustrated in figure 5. The 63 Escherichia coli isolates

were assigned to 56 genotypes when, applying a similarity level of SAB of 0.99 as a

calculated threshold for clustering (black dashed line (X) in figure 5. The B2

phylogenetic group was common group found in 28 (44.4%), other groups detected

included A 20 (31.7%), D 10 (15.8%) and B1 5 (7.9%). The blaCTX-M-15 was found

in all phylogenetic groups (B2, 50%; B1, 8.1%; A, 32.4% and, 27%).


52

Table 5: Characteristics of Escherichia coli selected as donors from different PFGE clusters

*Transferable resistance, GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Co-trimoxazole. The rate of transferable antibiotic resistance for GM, SXT, TET, GM-SXT-TET, SXT-TET and GM-TET was 33%, 61%, 61%, 27%, 44% and 11% respectively

NO Phylogeny group

PFGE ESBL allele RESISTANCE Conjugation Inc group

12 B1 X13 CTX-M-15 GM,*SXT,*TET,CIP 10-9 FIA,FIB

19 A X13 CTX-M-15 GM,*SXT,TET,CIP 10-9 FIA,FIB

44 A X5 CTX-M-15,TEM-1 GM,CIP 10-9 FIA,FIB

48 D X13 CTX-M-15 *GM,CIP,*SXT,*TET 10-7 FIA,FIB

58 B2 X5 CTX-M-15 GM,CIP,SXT 10-4 FIA,FIB

66 A X9 CTX-M-15,TEM-1 *GM,CIP,*TET,*SXT 10-7 FIA,FIB

67 A X9 CTX-M-15,TEM-1 GM,CIP,*TET,*SXT 10-7 FIA,FIB

70 B2 X5 CTX-M-15,TEM-1 GM,*SXT,TET,CIP 10-9 FIA,FIB

81 D X6 CTX-M-28 CIP, SXT,*TET 10-9 FIB

90 A X12 CTX-M-3 *GM,CIP,SXT,*TET 10-9 FIA,FIB

92 B2 X5 CTX-M-15 GM, TET, SXT 10-9 FIA,FIB

95 A X9 CTX-M-1 SXT 10-8 FIA,FIB

103 B2 X12 CTX-M-15,TEM-1 *GM, CIP,*TET, SXT 10-7 FIA, FIB

79 B1 X5 CTX-M-15,TEM-1 *GM,CIP,*TET,*SXT 10-7 FIA

54 A X9 CTX-M-15, TEM-1

GM,CIP, *TET, *SXT 10-6 FIA

102 B2 X1 CTX-M-15, TEM-1

GM,CIP,*TET, *SXT 10-7 FIA

110 D X4 CTX-M-15 *GM,CIP,*SXT,*TET 10-9 FIA,FIB

112 B2 X4 CTX-M-15 GM,CIP,*SXT,TET 10-9 FIA,FIB


53

4.1.3 Plasmid analysis and replicon typing

Variable sizes of plasmids were detected. The majority of transconjugants had

plasmids ranging from 145.5kb-194kb. A 145.5kb plasmid was found in 65% of

isolates tested and uniformly positive for hybridization with the blaCTX-M- 15, FIA

and FIB DIG-labelled DNA probes. On other occasions hybridization was positive

for plasmids ranging between 97kb-145.5kb or 194kb of size (Figure 6). In one

isolate the CTX-M-gene was located in a 242.5kb IncF1 plasmid. All clinical

isolates and transconjugants had Inc FI group using PCR based replicon typing

(PBRT). The DNA sequences of these replicons were homologous to published

sequence representing the detected replicon. No plasmids belonging to the Inc

groups FII, FII, IncN and IncI1 were detected.

4.1.4 ISEcp1 and Cloning results

All of the 10 randomly selected blaCTX-M-15-carrying Escherichia coli isolates were

positive for the 1.8kb ISEcp1 element. Nine of the 10 randomly selected blaCTX-M-15-

carrying K. pneumoniae had short PCR products of ISEcp1 with 7 isolates

exhibiting fragment sizes of 450bp and 2 isolates of 530bp, respectively. One

isolate was negative for the PCR reaction. Sequencing of the short products

revealed >99% identity with the ISEcp1 element. The CTX-M-15/tnpA was

successfully cloned in 2.7kb plasmid (pSU2719Ccm) (Figure 2) and used to

transform Escherichia coli TOP-10R Topo-10 cells. Two phenotypically identical

transformants were observed on LB plate with 30g/ml cefotaxime and 25g/ml

chloramphenicol. PCR for CTX-M-15 was positive in all the transformants.


54

Figure 5: PFGE dendrogram of ESBL-producing Escherichia coli as evaluated by Dice and UPGMA analysis.

The diagram also shows the isolates, ESBL genotypes PFGE groups and Phylogenetic group, of the isolates, A dashed line Z, SAB=0.97, X dashed line SAB=0.8.


55

Figure 6: Agarose gel showing S1 nuclease PFGE-based sizing of plasmids for 5 isolates.

Lane 2, 4, 6 were not treated by SI nuclease, note the common 145.5kb plasmid

LB agar plate containing 30g/ml cefotaxime and 25g/ml chloramphenicol

revealed phenotypically small and large colonies in a 1:1 ratio (Figure 7). All of the

10 randomly selected small colonies contained the entire CTX-M-15/tnpA unit

within the cloning site.

Figure 7: LB plate showing Large (L) and small (S) colonies


56

For 6 of the 10 randomly selected large colonies, the CTX-M-15/tnpA unit was not

present within the cloning site. Moreover, for all large colonies tested, the CTX-M-

15/tnpA-PCR reaction consistently revealed a ladder of smaller with distinct sizes

(Figure 8).

Figure 8: Agarose gel electrophoresis of products obtained by PCR from 3 large colonies and 3 small colonies.

Lanes 1, 2 and 3 depict results from small colonies and, 4, 5 and 6 from large colonies, respectively. M denotes the 1kb molecular mass marker (Bio-Rad). All large colonies were without insert, these were positive for specific CTX-M PCR (results not shown).

4.2. Klebsiella pneumoniae isolates from Giessen, Germany

4.2.1 Isolates, ESBL alleles and susceptibility results

Twelve (50%) of the 24 ESBL producing K. pneumoniae were recovered from

urine specimens. All isolates were grouped into phylogenetic group KpI. PFGE had

3 clusters using SAB 0.8 (B1-B3) (Figure 9). Cluster B3 formed the majority of our

isolates 19 (79%), within this cluster there was 10 (A3) isolates which had identical

PFGE pattern (SAB 0.997). These identical isolates were from wards A (20%), B

(50%), C (10%), G (10%) and I (10%) (Figure 9). The blaCTX-M genes were found in

20(83%) of Klebsiella pneumoniae isolates. BlaCTX-M-15 was the commonest allele


57

found 16(66%). Other alleles found were blaCTX-M-3 (16.6%), TEM-104 (8.3%) and

TEM-54 (4.1%). TEM-1 was found in association with CTX-M-alleles in 19 (95%)

of cases. Isolate no 71, was within the A3 clone, and despite phenotypically ESBL

appearance it was negative for ESBL gene, only TEM-1 gene was found. No isolate

carrying SHV ESBL gene was detected. In investigating the presence of ISEcp1, it

was noted that all isolates gave 500bp amplicon instead of the expected 1.8kb

amplicon. Random sequencing of four of these products indicated that they were

similar to ISEcpl in Klebsiella pneumoniae with more than 98% identity. The

primer set gave the desired product of 1,885bp using control Escherichia coli with

blaCTX-M-15 gene (data not shown). All isolates with CTX-M-15 gene were resistant

to cefepime with MIC >24g/ml and also all isolates were resistant to gentamicin,

tetracycline ciprofloxacin and sulphamethaxazole/trimethoprim (Table 5). All

isolates were found to be sensitive to carbepenems and tigecycline.

4.2.1 Location of blaCTX-M-15

In three attempts made, the blaCTX-M-15 resistance gene was not transferable by

conjugation or transformation. Plasmid analysis using the method described above

revealed that the isolates harboured multiple plasmids of various sizes ranging from

less than 48.5kb to 436.5kb (Figure 10). The A3 clone had common plasmids of

48.5kb, 339.5kb and 388kb. Hybridization using the blaCTX-M-15 DIG labelled probe

located the gene to the chromosome of 6 isolates, representing different clusters

tested. PCR based replicon typing showed that most of our isolates had IncFI

plasmids 20(80%) and 3(12.5%) had Inc FI and IncFII plasmids. The DNA


58

sequence of the FIA and FIB in four randomly selected products was homologous to

previous published sequences.

Table 5: Characteristics of Klebsiella pneumoniae isolates ISOLATE WARD Phylogeneti

c group

PFGE

GROUP

ESBL type Antibiotics resistance

other than -Lactams

Incompatibility

Group

20 A KpI B1 CTX-M-3, Tem-1 GM,TET,SXT,CIP FIA,FIB

36 A KpI B1 CTX-M-15 GM,TET,SXT,CIP FII,FIA,FIB

61 G KpI B1 Tem-104 GM,TET,SXT,CIP FII,FIA,FIB

25 I KpI B2 Tem-54 GM,TET,SXT,CIP FII,FIA,FIB

57 C KpI B2 CTX-M-3,Tem-1 GM,TET FIA

76 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB


84 B KpI B3 CTX-M-15 GM,TET,SXT,CIP FIA,FIB

115 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA

116 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB



34 I KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB


31 C KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB


65 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 71 B KpI B3 Tem-1 GM,TET,SXT,CIP FIA,FIB


96 G KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB


89 C KpI B3 CTX-M-3,Tem-1 GM,TET,SXT,CIP FIA,FIB

5 C KpI B3 Tem-104 GM,TET,SXT,CIP ND

52 A KpI B3 CTX-M-3,Tem-1 GM,SXT,CIP FIA,FIB

*This isolate was ESBL phenotypically but no ESBL gene was found. GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Sulphamethaxazole/trimethoprim., ND: not done.


59

Figure 9: Dendogram (UPGMA, DICE) showing the similarity for 24 Klebsiella pneumoniae ESBL Producers. The line B indicates the 80% similarity. Note the clones A1-A3, Phylogenetic group, wards A-I, PFGE clusters and isolate numbers.

Figure 10: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates.


60

4.3 Escherichia coli isolates from Bugando Medical Centre

4.3.1 Distribution, susceptibility pattern and ESBL allele

Twenty seven (84%) and 5(16%) of the isolates were recovered from inpatient and

outpatients specimens, respectively, the majority of which originated from surgical

wards 16/27 (59%). The isolates were recovered from various clinical specimens:

wound swabs (n=11), urine (n=8), pus (n=7) and blood (n=6). All isolates were

found to be resistant to cefotaxime (MIC>30g/ml) and showed the classic ESBL

phenomenon on disk synergy test. The rate of resistance to non-beta-lactam

antibiotics tested was 100% to tetracycline, 93% to

sulphamethaxazole/trimethoprim and 84% to gentamicin and ciprofloxacin

respectively. All isolates were resistant to cefepime and sensitive to imipenem and

meropenem. Following PCR for ESBL alleles and subsequent sequencing of

amplicons, all isolates were found to carry blaCTX-M-15, while 8 isolates (25%) also

carried blaTEM-1 (Figure11). In all isolates tested, blaCTX-M-15 was linked to an

ISEcp1 element.

4.3.2 Genetic relatedness

Phylogenetic group typing assigned the majority of isolates, 24(75%), to

phylogenetic group B2. Group D, A and B1 were found for 2 (6%), 3 (9.3%) and 3

(9.3%) strains, respectively. Multiple clones were seen on PFGE and using a

similarity level (SAB) of 0.8, twenty two clusters (X1-X22) were seen among 32

isolates (Figure 11). There was no evidence for the presence of any large cluster.


61

Cluster X11 displayed a clonal relationship (SAB>0.99) amongst isolates of three

patients from an orthopedic ward.

MLST revealed multiple ST clonal complexes. ST131 was found in 12 (40%)

strains, other ST complexes associated with blaCTX-M-15 included ST38 (2), ST46 (1),

ST224 (1), ST405 (4), ST638 (3), ST648 (1) and ST827 (2). Two new ST clonal

complexes were found: ST1845 and ST1848 which were typed to the phylogenetic

group A; these isolates were recovered from wound swab and pus, respectively. All

Escherichia coli in clonal complex ST131 were in the phylogenetic groups B2. Of

the four ST405 complex isolates, 2 were classified as phylogenetic group D. A clear

association was seen between ST clonal complexes and PFGE patterns as isolates

with a PFGE pattern similarity (SAB) of more than 85% were also grouped into the

same ST complex (Figure 11).

4.3.3 Location and transferability of ESBL genes

PCR based replicon typing revealed that replicons FIA, FIB, FII and FrepB were

present in 30 clinical isolates and transconjugants in various combinations. The

commonest combination was FIA- FIB, which was demonstrated in 14 (47%) of

cases. IncFII was found in 8 (26%) cases. Fifteen randomly selected isolates were

found to carry IncF conjugative plasmids with a conjugation frequency ranging

from 10-3-10-7 per donor cells. Gentamicin-, sulphamethaxazole/trimethoprim- and

tetracycline-resistance was transferable in 7/15(46%) of cases, while gentamicin

resistance alone was transferable in 12/15(80%) of cases (Table 6).


62

Different plasmids were found to carry blaCTX-M-15 when using SI nuclease digestion

and DIG hybridization techniques to probe for their presence (Figure 12). Based on

the lambda ladder marker used, the estimated plasmids size ranged from 50kb-

291kb. The commonest plasmid was 291kb of size and was found in 6 (40%)

transconjugants


63

Figure 11: PFGE dendrogram of CTX-M-15 producing Escherichia coli.

Heterogeneity of the 32 Escherichia coli ESBL producers are seen on the dendrogram. The diagram also shows the isolate number, wards, specimen, ESBL allele, incompatibility groups, ST clonal complex as well as the PFGE cluster. Solid line X indicates SAB of 0.8 revealing 22 clusters (X1-X22). MOPD, medical outpatient department; NU, neonatal unit; CTC, care and treatment clinic; GOPD, gynecological outpatient department; NICU, neonatal ICU; (E4,E8,C9,E9,C6, J5), Surgical wards; VIP, First class ward.

Table 6: Characteristics of Escherichia coli selected as donors from different

PFGE clusters

S NO ISOLATE NO

Inc Group ST Conjugation frequency

Estimated Plasmid

Size

Transferable resistance

1 02 FIA,FIB ST131 10-7 291kb GM

2 18 FIB ST405 2.7*10-4 50kb GM,SXT,TET

3 22 FIB ST131 2.8*10-4 291kb GM,SXT,TET

4 32 FIA,FIB ST638 2.2*10-4 50kb GM,SXT,TET

5 76 FIA,FIB ST224 10-4 194kb GM,SXT

6 140 FIB ST827 10-4 242kb SXT,TET

7 170 FrepB ST648 10-5 97kb GM

8 187 FIA,FIB ST405 10-3 200kb GM,SXT

9 178 FIB ST131 10-4 242kb Beta lactams

10 181 FIB ST38 10-6 291kb GM,SXT,TET

11 51 FIA,FIB NT 10-5 291kb GM,SXT,TET

12 215 FIA,FIB ST405 10-7 145kb GM,SXT,TET

13 096 FIA,FIB ST131 4*10-4 242kb Beta lactams

14 182 FIB ST46 10-4 194kb GM,SXT

15 092 FII ST131 10-5 145kb GM,SXT,TET


64

ST: Sequence type, GM: Gentamicin, SXT: Co-trimoxazole, TET: Tetracycline

Figure 12: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates.

M (Lambda Marker) indicates the molecular weight marker. Plasmid size preparations from isolate number 02, 18, 32, 76, 215, 181, 182 and 092 reveal plasmids with size ranging from 50 kb to 291 kb which are indicated with arrows; B is corresponding gel after southern blot and DIG hybridization hybridized plasmids are shown with arrows

4.4: Klebsiella pneumoniae isolates from Bugando Medical Centre

4.4.1 Bacterial isolates and susceptibility pattern

A total of 92 Klebsiella pneumoniae isolates were found to be ESBL producers,

they formed 45% of all Klebsiella pneumoniae isolated over a period of 8 months.

Most of Klebsiella pneumoniae producing isolates were from inpatients 87 (94%).

The majority of isolates were recovered from blood culture from neonatal unit

39(64 %) and 22(36%) from neonatal ICU (NICU) (Figure 13). Nineteen isolates

(21 %) were from wound swabs and pus from surgical wards and 12(13%) were

A B


65

isolated from urine specimens from various wards (Figure 13). A higher rate of

resistance to commonly used non-beta lactams was observed in the hospital. All

isolates were found to be resistant to gentamicin and

sulphamethaxazole/trimethoprim; the rate of resistance to tetracycline and

ciprofloxacin were 98% and 54%, respectively. A total of 25(38%) isolates from

neonatal unit and NICU were resistant to ciprofloxacin compared to 17(68%) of

isolates from other wards (p


66

occurred in June 2009 isolates in cluster X8, followe

phdthesismshanase

Documents