phylogenetic analysis of flatfish species (teleostei, pleuronectiformes) based on cytochrome oxidase...
DESCRIPTION
Aim: Molecular phylogenetic investigation of relationships among order Pleuronectiformes To make reconstruction the phylogenetic relationships based on Co-1 and Cyt-b gene sequencing among some flatfish species were made. To confirm or disprove the monophyly of the flatfish family Pleuronectidae and genus Pleuronectes several tree types were built.TRANSCRIPT
![Page 1: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/1.jpg)
Phylogenetic analysis of flatfish Phylogenetic analysis of flatfish species (Teleostei, species (Teleostei, Pleuronectiformes) based on Pleuronectiformes) based on cytochrome oxidase 1 cytochrome oxidase 1 ((Co-1)Co-1) and and cytochrome cytochrome b (Cyt-b) b (Cyt-b) genes genes
Sharina S.N., Kartavtsev Y.P.Sharina S.N., Kartavtsev Y.P.
![Page 2: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/2.jpg)
The phylogenetic relationships within the The phylogenetic relationships within the order are still problematicorder are still problematic
Fish mitochondrial DNA is now widely used Fish mitochondrial DNA is now widely used with phylogenetic purposeswith phylogenetic purposes
Most popular in phylogenetics are Most popular in phylogenetics are sequences ofsequences of cytochrome cytochrome bb ((Cyt-bCyt-b) ) and and cytochromecytochrome oxidaseoxidase 1 ( 1 (CCо-1о-1)) genes genes, , which which used for taxa comparison at the species-used for taxa comparison at the species-familyfamily level.level.
INTRODUCTIONINTRODUCTION
![Page 3: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/3.jpg)
AimAim:: Molecular phylogeneticMolecular phylogenetic investigation of investigation of relationships among order relationships among order PleuronectiformesPleuronectiformes
To make reconstruction the phylogenetic To make reconstruction the phylogenetic relationships based on relationships based on Co-1Co-1 andand Cyt-b Cyt-b gene sequencing gene sequencing among some flatfishamong some flatfish species were madespecies were made..
To confirm or disprove the monophyly of To confirm or disprove the monophyly of the flatfish familythe flatfish family Pleuronectidae and Pleuronectidae and genus genus Pleuronectes Pleuronectes several tree types several tree types were built.were built.
![Page 4: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/4.jpg)
Materials and methodsMaterials and methodsSSamples of the collectionamples of the collection
Kievka BayKievka Bay
Vostok BayVostok Bay
![Page 5: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/5.jpg)
FlatfisFlatfishh-1-F TCTTTAGATTTGCAATCTAACATGTA-1-F TCTTTAGATTTGCAATCTAACATGTA Flatfish-1-R GTCAGTAGCATTGTAATTCCTGCGGCFlatfish-1-R GTCAGTAGCATTGTAATTCCTGCGGC Flatfish-2-F TGGGCCCATCACATATTTACAGTCGGFlatfish-2-F TGGGCCCATCACATATTTACAGTCGG Flatfish-2-R CAGAGCGGTTATGTGGTTGGCTTGAFlatfish-2-R CAGAGCGGTTATGTGGTTGGCTTGAAA
(~1500 bp)(~1500 bp)
(Kartavtsev et al.(Kartavtsev et al., 200, 2007)7) Flatfish-cytb-F – ATGGCCAACCTCCGTAAATCCCACCCCCTTCFlatfish-cytb-F – ATGGCCAACCTCCGTAAATCCCACCCCCTTC Flatfish-cytb-R – CTGGGGCTCTGGACGCTGAGCTACTAGTGCFlatfish-cytb-R – CTGGGGCTCTGGACGCTGAGCTACTAGTGC
(~1441 bp)(~1441 bp)
20 spesies20 spesies of Pleuronectiformes of Pleuronectiformes for for Co-1Co-1 genegene
47 species47 species of Pleuronectiformes of Pleuronectiformes forfor Cyt-bCyt-b gene gene
2 species of Gadiformes as 2 species of Gadiformes as outgroupoutgroup
![Page 6: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/6.jpg)
Rooted consensus (50%) Rooted consensus (50%) MPMP-tree showing -tree showing phylogenetic phylogenetic interrelationships on the interrelationships on the basis of basis of Co-1 Co-1 sequence data. sequence data. In the nodes bootstrap In the nodes bootstrap support (n=1000) for MP and support (n=1000) for MP and NJ (NJ (MP/NJMP/NJ) are shown. The ) are shown. The tree was rooted with the tree was rooted with the sequences of two out-group sequences of two out-group species: species: GadiformesGadiformes..
![Page 7: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/7.jpg)
Rooted consensus (50%) Rooted consensus (50%) BABA-tree showing -tree showing phylogenetic phylogenetic interrelationships on the interrelationships on the basis of basis of Cyt-b Cyt-b sequence sequence data. In the nodes bootstrap data. In the nodes bootstrap support (n=1000) for NJ and support (n=1000) for NJ and MP and repetition MP and repetition frequencies for n=10frequencies for n=1066 simulated generations for BA simulated generations for BA ((BA/MP/NJBA/MP/NJ) are shown. The ) are shown. The tree was built based on the tree was built based on the TrN+I+GTrN+I+G model and was model and was rooted with the sequences of rooted with the sequences of two out-group species: two out-group species: GadiformesGadiformes..
![Page 8: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/8.jpg)
Hippoglossinae
Hippoglossoidinae
Pleuronectinae
![Page 9: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/9.jpg)
Conclusions:Conclusions: Family Pleuronectidae with high confidence may Family Pleuronectidae with high confidence may
be considered as monophyletic.be considered as monophyletic.
According the last systematical revision, we According the last systematical revision, we have sampled in the genus have sampled in the genus PleuronectesPleuronectes only only one species one species P. pinnifasciatusP. pinnifasciatus. Other species, . Other species, placed in different genera placed in different genera PseudopleuronectesPseudopleuronectes, , Liopsetta, Liopsetta, andand Lepidopsetta. Lepidopsetta.
The diagnostics of species (barcoding) based on The diagnostics of species (barcoding) based on Co-1Co-1 and and Cyt- bCyt- b gene sequences is highly gene sequences is highly effective because of low intraspecies and high effective because of low intraspecies and high interspecies variability of this markers.interspecies variability of this markers.
![Page 10: Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1) and cytochrome b (Cyt-b) genes Sharina S.N.,](https://reader036.vdocument.in/reader036/viewer/2022082601/5a4d1b567f8b9ab0599a95b6/html5/thumbnails/10.jpg)
THANKS FOR ATTENTIONTHANKS FOR ATTENTION!!