phylogenetic relationships of megophryid frogs of the genus

Molecular Phylogenetics and Evolution xxx (2010) xxx–xxx

ARTICLE IN PRESS

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/ locate /ympev

Phylogenetic relationships of megophryid frogs of the genus Leptobrachium(Amphibia, Anura) as revealed by mtDNA gene sequences

Masafumi Matsui a,*, Amir Hamidy a,b, Robert W. Murphy c,d, Wichase Khonsue e, Paul Yambun f,Tomohiko Shimada a,g, Norhayati Ahmad h,i, Daicus M. Belabut h,j, Jian-Ping Jiang k

a Graduate School of Human and Environmental Studies, Kyoto University, Kyoto 606-8501, Japanb Museum Zoologicum Bogoriense, Research Center for Biology, Indonesian Institute of Sciences, Gd. Widyasatwaloka, Jl. Raya Jakarta Bogor km 46, Cibinong West Java, Indonesiac Centre for Biodiversity and Conservation Biology, Royal Ontario Museum, 100 Queen’s Park, Toronto, Ont., Canada M5S 2C6d State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, The Chinese Academy of Sciences, Kunming 650223, PR Chinae Department of Biology, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailandf Research and Education Division, Sabah Parks, P.O. Box 10626, Kota Kinabalu 88806, Sabah, Malaysiag Faculty of Bioenvironmental Science, Kyoto Gakuen University, Kameoka, Kyoto 621-8555, Japanh Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysiai Institute for Environment and Development (LESTARI), Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysiaj Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysiak Chengdu Institute of Biology, The Chinese Academy of Sciences, Chengdu 610041, PR China

a r t i c l e i n f o

Article history:Received 24 October 2009Revised 17 February 2010Accepted 9 March 2010Available online xxxx

Keywords:LeptobrachiumVibrissaphoraSundalandIndochinaSouthern ChinamtDNAPhylogenetics

1055-7903/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.ympev.2010.03.014

* Corresponding author. Fax: +81 75 753 6846.E-mail address: [email protected] (M. M

Please cite this article in press as: Matsui, M., evealed by mtDNA gene sequences. Mol. Phyloge

a b s t r a c t

By investigating genealogical relationships, we estimated the phylogenetic history and biogeography inthe megophryid genus Leptobrachium (sensu lato, including Vibrissaphora) from southern China, Indo-china, Thailand and the Sundaland. The genealogical relationships among the 30 named and unnamedtaxa were estimated using 2009 bp of sequences from the mitochondrial DNA genes 12S rRNA, tRNAval,and 16S rRNA using maximum parsimony, maximum likelihood, and Bayesian inference methods. Thegenus Leptobrachium was a well-supported monophyletic group that contained two major clades. Oneclade had three subclades primarily from disjunct regions including Borneo, Peninsular Malaysia andJava, and Thailand. The Bornean subclade included one species each from the Philippines and Sumatra.The other major clade consisted of two subclades, one from Indochina and the other from southern China(Vibrissaphora). Divergence times estimated an old evolutionary history of each subclade, one that couldnot be explained by the geohistory of Southeast Asian major landmasses.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

The megophryid genus Leptobrachium Tschudi, 1838 (type spe-cies L. hasseltii from Java) is diagnosed by having a broad head andthin limbs (Dubois and Ohler, 1998). The genus is often consideredto contain two subgenera, Vibrissaphora Liu, 1945, with adult malesbearing spines on upper lip, and Leptobrachium, which is withoutsuch spines (Ohler et al., 2004). Vibrissaphora is distributed insouthern China and Indochina, and it includes five to seven species(Frost, 2009; Rao and Wilkinson, 2008; Fei et al., 2009). SubgenusLeptobrachium is distributed from Indochina to Sundaland and itcontains 15–17 species (Frost, 2009; Fei et al., 2009). Using DNAsequence data, both Zheng et al. (2008) and Rao and Wilkinson(2008) place Vibrissaphora within the genus Leptobrachium, andneither group of researchers recognizes subgenera. However, this

ll rights reserved.

atsui).

t al. Phylogenetic relationshipsnet. Evol. (2010), doi:10.1016/

taxonomic conclusion is made without exploring the extent of ge-netic diversity within Sundaland and neither study includes thetype species of the genus.

Sundaland contains the Malay Peninsula and the Indonesian is-lands of Sumatra, Java, Bali, Borneo, and smaller islands west of theMakassar and Lombok straits. All of these areas are linked by theshallow-water (<200 m) Sunda Shelf, which was exposed duringperiods of low sea level in the Pleistocene. The eastern boundaryof Sundaland is Wallace’s Line where the Indomalayan and Austral-asian faunas meet. Studies of some anuran lineages from Sunda-land indicate that species distributions and phylogenies arestrongly related to the geological history of this region (e.g., Emer-son et al., 2000; Inger and Voris, 2001; Brown and Guttman, 2002;Matsui et al., 2010).

Seven species of Leptobrachium are known from Sundalandand peninsular Thailand as follows: L. hasseltii Tschudi, 1838;L. montanum Fischer, 1885; L. abbotti (Cochran, 1926); L. hendricksoniTaylor, 1962; L. nigrops Berry and Hendrickson, 1963; L. gunungense

of megophryid frogs of the genus Leptobrachium (Amphibia, Anura) as re-j.ympev.2010.03.014

http://dx.doi.org/10.1016/j.ympev.2010.03.014

mailto:[email protected]

http://www.sciencedirect.com/science/journal/10557903

http://www.elsevier.com/locate/ympev


2 M. Matsui et al. / Molecular Phylogenetics and Evolution xxx (2010) xxx–xxx

ARTICLE IN PRESS

Malkmus, 1996, and L. smithi Matsui, Nabhitabhata, and Panha,1999. Among these species, L. montanum, L. abbotti, and L. gunun-gense are endemic to Borneo and L. smithi is mainly distributedin Thailand and the northern part of Peninsular Malaysia, as wellas through Myanmar to Assam, India (Sengupta et al., 2001).Leptobrachium hendricksoni is distributed from southern Thailandthrough the Malay Peninsula to western Borneo and Sumatra,and L. nigrops occurs on the Malay Peninsula, Belitung Island, andwestern Borneo. How and when they obtained their present-daydistributions in the Sunda Islands are biogeographically interestingtopics.

In Leptobrachium, taxonomic problems span from the supra-specific category to the species level. The name L. hasseltii was ap-plied to many Southeast Asian populations (Inger, 1954, 1966;Berry, 1975) until Inger et al. (1995) clarified that L. hasseltii fromBorneo was not conspecific with the Javanese population. They ap-plied the names L. montanum and L. abbotti to Bornean species.However, some populations, such as those from the Philippines,are still referred to as L. hasseltii because of the absence of a taxo-nomic reassessment. Iskandar (1998) and Matsui et al. (1999) sug-gested that true L. hasseltii was likely restricted to Java andadjacent islands, and Dubois and Ohler (1998) suggested the pos-sible occurrence of more than one species of Leptobrachium on Java,based on a large extent of variation in female body size of Leptob-rachium (sensu lato). Such taxonomic arguments still need to beclarified.

These uncertainties mainly derive from the use of a few speci-mens from limited ranges. Intra- and interspecific variation is inad-equately assessed. Some critical characteristics useful for speciesidentification are lost upon preservation of museum vouchers.Molecular data and phylogenetic analyses can enable the identifi-cation of species and a higher level taxonomy in Leptobrachium.In this study, we use mtDNA gene sequences from various popula-tions of Leptobrachium, especially from Sundaland, to evaluate thetaxonomic status of many populations and hypothesize the evolu-tionary history of the species in this genus.

2. Materials and methods

2.1. Sampling design

We examined a total of 80 partial DNA sequences of the mito-chondrial DNA genes 12S rRNA, tRNAval, and 16S rRNA from 30species/subspecies of the genus Leptobrachium (sensu lato) andsix outgroup species (Figs. 1 and 2 and Table 1). Our own samplingof Leptobrachium consisted of 60 specimens of 21 taxa mainlyobtained from Sundaland and Indochina, including several unde-scribed or unidentified taxa including the following: Leptobrachiumsp. 1, a Sumatran species that has distinct eye color (Hamidy andMatsui, 2010); Leptobrachium sp. 2, a Philippine species oftencalled L. hasseltii; Leptobrachium sp. 3 from Gwa, Myanmar, cata-logued as L. hasseltii (Zheng et al., 2008); Leptobrachium sp. 4 fromPilok, Thailand, a dried carcass whose identification was difficult;and Leptobrachium sp. 5, which resembles Vibrissaphora but lacksmale labial spines. We used Leptolalax heteropus (Boulenger,1900) and Pelodytes punctatus (Daudin, 1802) as outgroup taxa.DNA sequences from GenBank were obtained for 11 Indochineseand Chinese species of Leptobrachium (sensu lato) and the follow-ing four outgroup species: Oreolalax rhodostigmatus Hu and Fei inLiu, Hu, and Fei, 1979 (EF397248: Fu et al., 2007), Megophrys nasuta(Schlegel, 1858) (DQ283342: Frost et al., 2006), Pelobates fuscus(Laurenti, 1768) (DQ283113: Frost et al., 2006), and Scaphiopus hol-brookii (Harlan, 1835) (DQ283156: Frost et al., 2006). LeptolalaxDubois, 1980 and Oreolalax Myers and Leviton, 1962 are the sistergroup of Leptobrachium (Lathrop, 1997; Zheng et al., 2004, 2008; Fu

Please cite this article in press as: Matsui, M., et al. Phylogenetic relationshipsvealed by mtDNA gene sequences. Mol. Phylogenet. Evol. (2010), doi:10.1016/

et al., 2007), whereas Pelobates Wagler, 1830 (Pelobatidae Bona-parte, 1850), Pelodytes Bonaparte, 1838 (Pelodytidae Bonaparte,1850), and Scaphiopus Holbrook, 1836 (Scaphiopodidae Cope,1865) form a monophyletic sister group with Megophryidae (Gar-cía-París et al., 2003; Dubois, 2005).

Voucher specimens/tissues are stored in ABTC (Australian Bio-logical Tissue Collection, South Australian Museum), BOR (BORNE-ENSIS collection, University Malaysia Sabah), IEBR (Institute ofEcology and Biological Resources, Hanoi, Vietnam), KUHE (KyotoUniversity, Graduate School of Human and Environmental Studies),MDK (Department of Conservation and Ecotourism, Faculty of For-estry, Bogor Agricultural Institute), MNHN (Museum Nationald’Histoire Naturelle, Paris), MZB (Museum Zoologicum Bogor-iense), ROM (Royal Ontario Museum), SP (Sabah Parks), UKM (Uni-versity Kebangsaan Malaysia), UM (University Malaya), and UTA(Department of Biology, University Texas at Arlington).

2.2. Preparation of DNA, PCR and DNA sequencing

We obtained tissues from frozen or ethanol (95–99%) preservedspecimens and extracted total genomic DNA using standard Phe-nol–chloroform extraction procedure (Hillis et al., 1996). Wehomogenized tissues in 0.6 ml STE buffer containing 10 mM Tris/HCl, pH 8.0, 100 mM NaCl and 1 mM EDTA, pH 8.0. We added Pro-teinase K (0.1 mg/ml) to the homogenate solutions and digestedproteins for 4–12 h at 55 �C. The solution was treated with phenoland chloroform/isoamyl alcohol and DNA was precipitated withethanol. DNA precipitates were dried and then resuspended in0.6 ml TE (10 mM Tris/HCl, 1 mM EDTA, pH 8.0) and 1 ll was sub-jected to polymerase chain reaction (PCR). The PCR cycle includedan initial denaturation step of 5 min at 94 �C and 33 cycles of dena-turation for 30 s at 94 �C, primer annealing for 30 s at 48–50 �C,and extension for 1 min 30 s at 72 �C. Primers used in PCR areshown in Table 2. The PCR products purified using polyethyleneglycol (PEG, 13%) precipitation procedures were used directly astemplates for Cycle Sequencing Reactions with fluorescent-dye-la-beled terminator (ABI Big Dye Terminators v.3.1 cycle sequencingkit). The sequencing reaction products were purified by ethanolprecipitation following the manufacture’s protocol and then runon an ABI PRISM 3130 genetic analyzer. All samples were se-quenced in both directions using the same primers as for PCR.

2.3. Phylogenetic analysis

Aligned, concatenated sequences of 12S rRNA, tRNAval, and 16SrRNA yielded a total 2009 bp positions. We used Chromas Pro soft-ware (Technelysium Pty Ltd., Tewntin, Australia) to edit the se-quences, and align them using the ClustalW option of Bioedit(Hall, 1999). The initial alignments were then checked by eyeand adjusted slightly. Phylogenetic trees were constructed usingmaximum parsimony (MP), maximum likelihood (ML), and Bayes-ian inference (BI). MP trees, obtained using PAUP�4.0b10 (Swof-ford, 2002), involved a heuristic search with the tree bisectionrecognition (TBR) branch-swapping algorithm, and 100 randomadditions replicates. Transitions and transversions were equallyweighted, and gaps were treated as missing data. ML analysis wereperformed by Treefinder version June 2007 (Jobb et al., 2004), withthe general time-reversible (GTR) model of DNA evolution with agamma shape parameter (G), identified as the best-fitting modelunder the Akaike information criterion implemented in Kakusan3 (Tanabe, 2007). BI and Bayesian posterior probabilities (BPP)were estimated using MrBayes 3.0b4 (Huelsenbeck and Ronquist,2001), under the GTR model with G and proportion of invariablesites (I), selected by MrModeltest2.2 (Nylander, 2004). BI used foursimultaneous Metropolis coupled Monte Carlo Markov chains for6,000,000 generations. We sampled a tree every 100 generations



Fig. 1. Map of Southeast Asia showing sampling localities of Leptobrachium (sensu lato) and related species included in this study. Sample numbers are included in Table 1.Triangle: Subclade I; reverse triangle: Subclade II; filled square: Subclade III; circle: Subclade IV; open square: Subclade V.

M. Matsui et al. / Molecular Phylogenetics and Evolution xxx (2010) xxx–xxx 3

ARTICLE IN PRESS

and calculated a consensus topology for 30,001 trees after discard-ing the first 30,000 trees (burn-in = 3,000,000).

Strength of nodal support in the MP analyses used non-para-metric bootstrapping (MPBS; Felsenstein, 1985) with 1000 pseu-doreplicates in PAUP�, and 100 replicates were used for the MLtree (MLBS). A priori, we regarded tree nodes with bootstrap value70% or greater as sufficiently resolved (Huelsenbeck and Hillis,1993), and those between 50% and 70% as tendencies. In the BIanalysis, nodes with a BPP of 95% or greater were considered sig-nificant (Leaché and Reeder, 2002).


2.4. Estimation of divergence time

We estimated the divergence times using a Bayesian relaxedmolecular clock calculated in BEAST (Drummond and Rambaut,2007) using 60 million generations under a GTR+G+I substitutionmodel and uncorrelated log-normal ‘‘relaxed” clock rate model(Drummond et al., 2006). We sampled the MCMC chain every1000 generations, for a total of 10 million samples, and assessedconvergence to the stationary distribution through inspection ofthe likelihood and parameter sample plots in Tracer version 1.4



Fig. 2. Maximum likelihood (ML) phylogram of 2009 bp of 12S rRNA, tRNAval and 16S rRNA mitochondrial genes for samples of Leptobrachium (sensu lato) and relatedspecies. Sample numbers are included in Table 1. Numbers above branches represent bootstrap supports for maximum parsimony (MP) /ML/ and Bayesian posteriorprobabilities. Asterisks indicate nodes with full bootstrap supports for ML and MP (100%) inferences and Bayesian posterior probabilities (PP = 100%).


ARTICLE IN PRESS

(Rambaut and Drummond, 2007). A burn-in of the first one millionsamples was used.

Three external calibration points provided by Roelants et al.(2007) were used to estimate dates of the cladogenic events. The


divergence time between Pelodytes and Pelobatidae + Megophryi-dae was assumed to be 143.1 MYBP (95% Credibility Interval [CI]of 120.8–166.1 MYBP), between Pelobates and Asian members at114.6 MYBP (CI 93.2–135.9), and between Leptolalax and



Table 1Sample of Leptobrachium (sensu lato) and outgroup species used for mtDNA analysis in this study together with the information on voucher, collection locality and GenBankaccession numbers. UN: Unnumbered. See text for voucher abbreviations.

Sample no Species Voucher Locality GeneBank

1 L. montanum lineage 1 KUHE UN larva Indonesia, S. Kalimantan, Banjar, Paramasan AB5303912 L. montanum lineage 1 KUHE 42812 Indonesia, S. Kalimantan, Banjar, Paramasan AB5303923 L. montanum lineage 1 BOR 22008 Malaysia, Sabah, Tawau AB5303934 L. montanum lineage 1 BOR 04B019 Malaysia, Sabah, Tawau AB5303945 L. montanum lineage 1 KUHE 42813 Indonesia, C. Kalimantan, Lamandau, Belantikan AB5303956 L. montanum lineage 1 KUHE 42815 Indonesia, C. Kalimantan, Lamandau, Belantikan AB5303967 L. montanum lineage 1 KUHE 17306 Malaysia, Sarawak, Matang, Serapi AB5303978 L. montanum lineage 1 KUHE UN larva Malaysia, Sarawak, Matang, Serapi AB5303989 L. montanum lineage 1 MDK 01 Indonesia, W. Kalimantan, Betung Kerihun, Nanga Bungo AB53039910 Leptobrachium sp. 1 KUHE 42805 Indonesia, Sumatra, Lampung, Liwa, Kubu Perahu AB53040011 Leptobrachium sp. 1 MZB Amp 15862 Indonesia, Sumatra, Lampung, Liwa, Kubu Perahu AB53040112 Leptobrachium sp. 1 UTA_A53689 Indonesia, Sumatra, Jambi, betw. Tanpa and Sungai penuh AB53040213 L. gunungense BOR 22956 Malaysia, Sabah, Kinabalu, Mesilau AB53040314 L. gunungense SP 3825a Malaysia, Sabah, Kinabalu, Sungai Carson AB53040415 L. abbotti BOR 12866 Malaysia, Sabah, Crocker, Ulu Kimanis AB53040516 L. abbotti KUHE 39295 Malaysia, Sabah, Kinabalu, Poring AB53040617 L. abbotti BOR 04B018 Malaysia, Sabah, Tawau AB53040718 L. montanum lineage 2 BOR 08481 Malaysia, Sabah, Crocker, Ulu Kimanis AB53040819 L. montanum lineage 2 SP 21481 Malaysia, Sabah, Kinabalu, Silau-silau AB53040920 Leptobrachium sp. 2 ABTC 76306 Philippines, Mindanao, Davao AB53041021 L. hendricksoni KUHE 15336 Malaysia, Penang AB53041122 L. hendricksoni KUHE 52403 Malaysia, Peninsula, Kelantan, Pasir Puteh AB53041223 L. hendricksoni UKM HC110 Malaysia, Peninsula, Trengganu, Hulu Trengganu AB53041324 L. hendricksoni KUHE UN tissue Malaysia, Peninsula, Trengganu, Sekayu AB53041425 L. hendricksoni MDK 10 Indonesia, Sumatra, Jambi, Bungo AB53041526 L. hendricksoni KUHE UN tissue Indonesia, Sumatra, S. Sumatra, Lahat AB53041627 L. hendricksoni KUHE 15680 Malaysia, Peninsula, Selangor, Kuala Lumpur AB53041728 L. hendricksoni KUHE 52150 Malaysia, Peninsula, Johor, Endau Rompin, Selai AB53041829 L. hasseltii KUHE 42807 Indonesia, Sumatra, Lampung, Liwa, Kubu Perahu AB53041930 L. hasseltii KUHE 42808 Indonesia, Sumatra, Lampung, Liwa, Kubu Perahu AB53042031 L. hasseltii MZB UN tissue Indonesia, W. Java, Gede-Pangrango National Park AB53042132 L. hasseltii UTA_A53688 Indonesia, W. Java, Bogor, Cisarua Safari Park AB53042233 L. hasseltii KUHE 42818 Indonesia, C. Java, Purworejo, Kaligesing AB53042334 L. hasseltii KUHE 42820 Indonesia, Java, Yogyakarta, Kulon Progo, Kiskendo AB53042435 L. nigrops MZB Amp1790 Indonesia, Belitung, Tanjung Pandang AB53042536 L. nigrops MZB Amp1791 Indonesia, Belitung, Tanjung Pandang AB53042637 L. nigrops KUHE 15430 Malaysia, Peninsula, Selangor, Kuala Lumpur AB53042738 L. nigrops KUHE 15658 Malaysia, Peninsula, Selangor, Kuala Lumpur AB53042839 L. nigrops UKM HC0727 Malaysia, Peninsula, Pahang, Temerloh AB53042940 L. nigrops KUHE 42587 Malaysia, Sarawak, Kanowit AB53043041 L. nigrops KUHE 42590 Malaysia, Sarawak, Kanowit AB53043142 L. smithi KUHE 19281 Thailand, Loei, Phu Luang AB53043243 L. smithi KUHE 19282 Thailand, Loei, Phu Luang AB53043344 L. smithi KUHE 19834 Thailand, Mae Hong Son, Phasua WF AB53043445 L. smithi KUHE 19939 Thailand, Kanchanaburi, Pilok AB53043546 L. smithi KUHE 20200 Thailand, Phetchaburi, Kaeng Krachan AB53043647 L. smithi KUHE 20201 Thailand, Phetchaburi, Kaeng Krachan AB53043748 L. smithi KUHE 23342 Thailand, Trang, Kaochong AB53043849 L. smithi UM D0139 Malaysia, Perlis, Langkawi AB53043950 L. smithi CAS 222215 Myanmar, Kyaik Hto EF67227151 Leptobrachium sp. 3 CAS 222293 Myanmar, Rakhine State, Gwa Township, Rakhine DQ28323952 Leptobrachium sp. 4 KUHE UN tissue Thailand, Kanchanaburi, Pilok AB53044053 V. l. liui IZCASH 30020 China, Hunan, Man Shan EF54419654 V. l. yaoshanensis KUHE UN larva China, Guanxi, Huapin AB53044155 V. leishanensis IZCASH 30004 China, Guizhou, Leigong Shan EF54420056 V. jiulongshanensis IZCASH 30034 China, Zhejiang, Jiulong Shan EF54420557 L. chapaense lineage 1 KUHE UN tissue Thailand, Doi Angkang AB53044258 L. chapaense lineage 1 ROM 41243 China, Yunnan, 14.9 km SE of Simao AB53044359 L. chapaense lineage 1 KUHE 19122 Thailand, Chiang Mai, Doi Intanon AB53044460 L. chapaense lineage 1 IZCASH 30048 China, Yunnan, Longling EF54423961 V. boringii IZCASH 30021 China, Sichuan, Emei Shan EF54420762 Leptobrachium sp. 5 KUHE 34396 Laos, Xamneua, Phupan AB53044563 V. echinata MNHN 1999.5657 Vietnam, Lao Cai, Sa Pa AB53044664 V. ailaonica IZCASH 30046 China, Yunnan, Ailao Shan EF54422565 V. promustache IZCASH 30044 China, Yunnan, Dawei Shan EF54424066 L. chapaense lineage 2 AMNH 163791 Vietnam, Ha Giang, Vi Xuyen, Cao Bo DQ28305267 L. chapaense lineage 3 ROM 32176 Vietnam, Vinh Phu, Tam Dao EF54423268 L. hainanense KUHE UNL China, Hainan, Wuzhi Shan AB53044769 L. chapaense lineage 3 MNHN 1997.5249 Vietnam, Ben En AB53044870 L. mouhoti FMNH 261758 Vietnam, Pichrada EF67227271 L. pullum IEBR 2780 Vietnam, Kon Tum, Kon Plong AB53044972 V. ngoclinhensis IEBR 2827 Vietnam, Kon Tum, Ngoc Linh Mountain AB53045073 L. xanthospilum ROM 32177 Vietnam, Gia Lai, Tram Lap AB530451

(continued on next page)


ARTICLE IN PRESS

Please cite this article in press as: Matsui, M., et al. Phylogenetic relationships of megophryid frogs of the genus Leptobrachium (Amphibia, Anura) as re-vealed by mtDNA gene sequences. Mol. Phylogenet. Evol. (2010), doi:10.1016/j.ympev.2010.03.014


Table 1 (continued)

Sample no Species Voucher Locality GeneBank

74 L. banae ROM 32200 Vietnam, Gia Lai, Krong Pa AB53045275 Oreolalax rhodostigmatus CIB ZYCA746 China, Guizhou, Da Fang EF39724876 Leptolalax heteropus KUHE 15487 Malaysia, Peninsula, Perak, Larut AB53045377 Megophrys nasuta FMNH 236525 Malaysia, Sabah, Crocker, Tenom DQ28334278 Pelobates fuscus A. Haas Collection Germany, Thuringia, Geroda, Triptis DQ28311379 Pelodytes punctatus MNHN 2000.2401 France, Villemoisiau AB53045480 Scaphiophus holbrookii AMHH A168434 USA, Florida, Alachua DQ283156

Table 2Primers used in this study.

Target Primer Sequence (50–30) Reference

12S rRNA and tRNAval 12Sh AAAGGTTTGGTCCTAGCCTT Cannatella et al. (1998)12SA-L AAACTGGGATTAGATACCCCACTAT Palumbi et al. (1991)L1507 TACACACCGCCCGTCACCCTCTT Made in this study12SFLeptobrachium CCGCCAAGTCCTTTGGGTTT Modified from Goebel et al. (1999)H1548 TACCATGTTACGACTTTCCTCTTCT Matsui et al. (2005a)

16 S rRNA L1879 CGTACCTTTTGCATCATGGTC Made in this study16sl2021 CCTACCGAGCTTAGTAATAGCTGGTT Tominaga et al. (2006)16L-1 CTGACCGTGCAAAGGTAGCGTAATCACT Hedges (1994)H1923 AAGTAGCTCGCTTAGTTTCGG Made in this studyH2315Leptobrachium TCGTTGTTACTAGTYCTAACAT Made in this study16sh2715 AAGCTCCATAGGGTCTTCTCGTC Tominaga et al. (2006)16H1 CTCCGGTCTGAACTCAGATCACGTAGG Hedges (1994)


ARTICLE IN PRESS

Oreolalax + Leptobrachium 43.8 MYBP (CI 32.0–58.7). However,using external calibrations only might result in very old estimates(Matsui et al., 2010). Thus, we applied a date of 1.40 MYBP (CI0.90–1.90) for two insular populations of L. hasseltii as estimatedby Matsui et al. (2005b) for Odorrana hosii (Boulenger, 1891) fromSundaland.

2.5. Variation in iris color

Iris color has served as a valuable diagnostic morphologicalcharacteristic for species of Leptobrachium (Dubois and Ohler,1998; Lathrop et al., 1998; Matsui et al., 1999). We accumulateddata for this character from our own observations and descriptionsand photographs in the literature. We hypothesized the evolutionof iris color by mapping the data on the phylogenetic tree.

3. Results

3.1. Sequence and statistics

Sequence statistics for the three gene fragments and for thecombined alignment including all nucleotide positions are pro-vided in Table 3. The aligned 12S rRNA, tRNAval, and 16S rRNA dataset consisted of 2009 characters, in which 925 sites were variable,and 800 potentially phylogenetically informative. MP analysisyielded four most parsimonious trees of 4089 steps, a consistencyindex of 0.401 and retention index of 0.818. The ML analysisproduced a topology with ln L �21943.875 (gamma shape param-

Table 3Alignment statistics for fragments of the 12S rRNA, tRNAval, and 16S rRNA (allnucleotide positions included); number of base bairs (bp), number of variable sites(vs), number of parsimony informative sites (pi), the transition–transversion ratiogiven for ingroups only (ti/tv).

bp vs pi ti/tv

12S rRNA 475 161 138 1.175tRNAval 71 38 35 3.90016S rRNA 1463 726 627 1.271Combined 2009 925 800 1.288


eter = 0.290; nucleotide frequencies: A = 0.347, C = 0.210, G =0.173, and T = 0.270). BI calculated average parameter estimatesfor nucleotide frequencies of A = 0.373, C = 0.206, G = 0.144 andT = 0.276, a gamma shape parameter 0.662, and proportion ofinvariable sites of 0.297.

3.2. Phylogenetic relationships

All analyses resulted in essentially the same topologies. Theydiffered only in associations at poorly supported nodes. The MLtree (Fig. 2) infers the following sets of relationships:

(i) Monophyly of Leptobrachium sensu lato (Leptobrachium andVibrissaphora) with respect to Oreolalax and Leptolalax wassupported in all trees (MPBS = 71%, MLBS = 78%, BPP = 98%).

(ii) Leptobrachium sensu lato was divided into two basal mono-phyletic lineages, Clade A (all Sundaland and most Thai spe-cies; all support values = 100%) and Clade B (primarilyChinese and Indochinese species associated with Vibrissa-phora: MPBS = 78%, MLBS = 93%, BPP = 100%).

(iii) Clade A contained three monophyletic subclades whoserelationships to each other were unresolved. Subclade I con-sisted of species from Borneo, Sumatra, and Mindanao, Phil-ippines (all values 100%), Subclade II encompassed speciesmainly from Peninsular Malaysia and Java (MPBS = 76%,MLBS = 100%, BPP = 100%), and Subclade III contained Thai-Myanmar species (all values 100%).

(iv) In Subclade I, Leptobrachium sp. 2 from Mindanao (samplenumber 20) was a sister lineage to the clade containing Bor-nean and Sumatran species. In the latter clade (all values100%), L. montanum lineage 2 from Kinabalu (18, 19) formedthe sister species to the clade of the remaining Bornean andSumatran species (MPBS = 93%, MLBS = 97%, BPP = 100%).The latter clade contained two sublineages. First, L. monta-num lineage 1 (populations 1–9 from Sabah, Sarawak, andKalimantan, including Paramasan, the type locality ofL. montanum; MPBS = 70%, MLBS = 65%, BPP = 100%) wasunited with Leptobrachium sp. 1 from Sumatra (10–12; allvalues 100%). Second, L. abbotti (15–17; all values 100%) and



Table 4Estimated divergence times (MY) of main divergences of Leptobrachium (sensu lato).

Combination Mean CI

Leptobrachium/Oreolalax 51.8 (36.2–68.5)Leptobrachium Clade A/Clade B 46.4 (31.6–61.4)Leptobrachium Subclade IV/Subclade V 35.8 (21.1–49.4)Leptobrachium Subclades I + II/Subclade III 34.0 (22.5–45.7)Leptobrachium Subclade I/Subcclade II 31.0 (20.7–42.5)L. nigrops/L. hendricksoni + L. hasseltii 25.5 (16.0–34.7)L. banae/other Vietnamese species 19.6 (10.3–29.6)Leptobrachium sp. 2 (Philippines)/Bornean

and Sumatran species19.0 (11.3–27.4)

L. hendricksoni/L. hasseltii 18.8 (11.0–27.2)Leptobrachium sp. 4/other Thai-Myanmar species 16.6 (8.6–25.4)L. chapaense lineagae 2/other species in Subclade IV 16.4 (7.8–26.3)Within L. nigrops 15.8 (8.2–24.1)L. xanthospilum/other Vietnamese species 15.7 (7.8–24.9)L. montanum lineage 2/other Bornean

and Sumatran species14.2 (8.6–21.0)

L. abbotti + L. gunungense/L. montanumlineage 1 + Leptobrachium sp. 1

11.2 (6.5–16.6)

Leptobrachium sp. 3/L. smithi 9.8 (4.8–15.7)V. l. liui/V. promustache 9.7 (3.6–16.7)Within L. hendricksoni 7.8 (4.0–12.2)L. montanum lineage 1/Leptobrachium sp. 1 6.1 (3.5–9.1)L. abbotti/L. gunungense 5.5 (2.0–9.9)Within L. montanum lineage 1 5.0 (3.0–7.5)Within L. smithi 4.0 (2.0–6.4)Within L. hasseltii 2.8 (1.4–4.5)L. hainanense/L. chapaense lineage 3 (Tam Dao) 2.6 (0.7–4.7)


ARTICLE IN PRESS

L. gunungense (13, 14; all values 100%) from Sabah, formed amonophyletic clade (MPBS = 96%, MLBS = 97%, BPP = 100%).The clade containing L. montanum lineage 1 was not univer-sally supported to be monophyletic (MPBS = 70%, MLBS =65%, BPP = 100%). Thus, its sister species relationship withLeptobrachium sp. 1 needs to be verified.

(v) Subclade II contained three species, of which all samplesclustered together with 100% support: L. hendricksoni(21–28) from Peninsular Malaysia and Sumatra, L. hasseltii(29–34) from Java and Sumatra, and L. nigrops (35–41) fromPeninsular Malaysia, Belitung Island, and Sarawak. Of these,L. hendricksoni and L. hasseltii were sister species(MPBS = 78%, MLBS = 89%, BPP = 100%). Peninsular MalayanL. hendricksoni was paraphyletic, with respect to northernpopulations forming a sister group with Sumatran popula-tions (MPBS = 83%, MLBS = 83%, BPP = 100%), and not withsouthern Malayan populations. In L. hasseltii, relationshipsof populations from western Java, central Java, and Sumatrawere unresolved. In contrast, three genetically divergent lin-eages were discovered within L. nigrops. The populationfrom Sarawak (40, 41) was the sister group of a well-sup-ported (MPBS = 100%, MLBS = 99%, MPP = 100%) clade com-prised of animals from Peninsular Malaysia (37–39) andBelitung Island (35, 36). Uncorrected p-distances were large,averaging 9.3% between Peninsular Malaysia and Belitung,11.7% between Borneo and Belitung, and 11.2% between Bor-neo and Malay Peninsula.

(vi) In Subclade III, populations of L. smithi (42–50) from Thailand,Langkawi Island of Malaysia, and Myanmar formed a mono-phyletic clade (MPBS = 100%, MLBS = 99%, BPP = 100%), butthe relationships among these individuals were unresolved.Leptobrachium sp. 3 from Gwa, Myanmar (51) was the sisterspecies to this clade and this association received full support.Together, these taxa formed the sister group of Leptobrachiumsp. 4 from Pilok, Thailand (52) and with full support.

(vii) Clade B was comprised of two subclades. Subclade IV pri-marily contained Vibrissaphora (all values 100%), and Subc-lade V consisted primarily of Indochinese species ofLeptobrachium (all values 100%).

(viii) Subclade IV consisted of three main clades. Leptobrachiumchapaense (Bourret, 1937) lineage 2 (66) from Ha Gian,northern Vietnam, and it formed the sister species of theremaining species. The latter clade received full supportand V. promustache Rao et al., 2006 (65) was the sister spe-cies of the other species (MPBS = 77%, MLBS = 100%,BP = 98%), in which several sublineages had unresolved rela-tionships to each other. These sublineages included full sup-port for five clades as follows: first, a clade containingV. echinata Dubois and Ohler, 1998 (63) from Vietnam andV. ailaonica Yang, Chen, and Ma in Yang, Ma, Chen, and Li,1983 (64) from China; second, Leptobrachium sp. 5 (62) fromLaos; third, V. boringii Liu, 1945 (61) from China; fourth, afully supported clade containing L. chapaense lineage 1(57–60) from Thailand and China; and fifth, a clade consist-ing of V. l. liui Pope, 1947 (53), V. l. yaoshanensis Liu and Hu inHu, Tian, and Wu, 1978 (54), V. leishanensis Liu and Hu in Hu,Zhao, and Liu, 1973 (55) and V jiulongshanensis Wei andZhao, 1981 (56) from China (MPBS = 99%, MLBS = 100%,BPP = 100%). In the last clade, two subspecies of V. liui weremonophyletic (MPBS = 98%, MLBS = 100%, BP = 100%).

(ix) Subclade V comprised five lineages whose relationships toone another were unresolved. Of these five, Vietnamese L.mouhoti Stuart, Sok, and Neang, 2006 (70) and L. pullum(Smith, 1921) (71) formed a fully supported clade, as didChinese L. hainanense Ye and Fei in Ye, Fei, and Hu, 1993(68) and Vietnamese L. chapaense lineage 3 (67, 69). The


remaining lineages consisted of the Vietnamese speciesL. xanthospilum Lathrop, Murphy, Orlov, and Ho, 1998 (73),L. banae Lathrop, Murphy, Orlov, and Ho, 1998 (74), andV. ngoclinhensis Orlov, 2005 (72).

3.3. Divergence times

Large degrees of overlap in divergence time estimations wereobserved in the confidence intervals (CI). Separation of Leptobrach-ium sensu lato and Oreolalax was estimated to have occurred 51.8MYBP (CI 36.2–68.5) in the early Eocene (age adopted from Hollo-way and Hall (1998)). In the mid Eocene (50–42 MYBP), Leptob-rachium split into Clades A and B (Table 4).

Divergences of Subclades I–III and IV–V occurred nearly simul-taneously from the late Eocene (42–35 MYBP) to the early Oligo-cene (35–29 MYBP). Subclade III, from Thailand and Myanmar,separated from the common ancestor of Subclades I and II fromSundaland and Peninsular Malaysia. Soon thereafter, Subclade I,consisting species mainly from Borneo, and Subclade II, encom-passing species mainly from Peninsular Malaysia and Java, split.

In Clade A, speciation was initiated in the late Oligocene, 30–23MYBP when L. nigrops separated from L. hendricksoni and L. hasseltii.It continued in the early Miocene, 23–14 MYBP, with the followingevents: Leptobrachium sp. 2 on Mindanao split from the commonancestor of Bornean species and Sumatran Leptobrachium sp. 1;L. hendricksoni separated from L. hasseltii; Leptobrachium sp. 4 splitfrom the common ancestor of L. smithi and Leptobrachium sp. 3;and L. montanum lineage 2 was isolated from the other Borneanand Sumatran populations. Subsequently, in the late Miocene,14–5 MYBP, the common ancestor of L. montanum lineage 1 andLeptobrachium sp. 1 split from that of L. abbotti and L. gunungense.In addition, L. smithi split from Leptobrachium sp. 3 from Gwa,Myanmar, L. montanum lineage 2 split from Sumatran Leptobrach-ium sp. 1, and L. abbotti speciated from L. gunungense.

In the main Indochinese and Chinese clade, diversification oc-curred from the early Miocene (L. banae and other Leptobrachiumfrom Vietnam and Hainan in Subclade V; L. chapaense lineage 2from Ha Gian and the remaining species of Subclade IV including




ARTICLE IN PRESS

Vibrissaphora and L. chapaense lineage 1; L. xanthospilum and, otherVietnamese and Hainan Leptobrachium and V. ngoclinhensis) to thelate Miocene (Chinese V. promustache and V. liui). Intraspecificdivergence was suggested to have occurred as early as the lateMiocene, as exemplified by L. hendricksoni. However, most of theintraspecific divergence occurred in the Pliocene (5.0–1.8 MYBP)as expected and seen in L. montanum lineage 1, L. smithi, andL. hasseltii. Divergence in Indochina and China also occurred inthe Pliocene, as exemplified in L. hainanense and L. chapaense line-age 3. An exception to the recent diversification is seen in L. nigropswhere the population from Sarawak split from populations inPeninsular Malaysia and Belitung in the early Miocene, and thelatter populations diverged in the middle Miocene.

3.4. Iris color

In Clade A, a totally dark black iris predominated in Subclade I(L. montanum [lineages 1, 2], L. gunungense, L. abbotti and Leptob-rachium sp. 2) and Subcalde II (L. hasseltii and L. nigrops) (Table 5).However, the upper part of the iris was yellow, orange, scarlet, orred in L. hendricksoni (Subclade II) and L. smithi (Subclade III). Fur-thermore, in L. hendricksoni, the iris color varied from having coloronly on the upper part to being totally orange (in one juvenile).

Table 5Known variatin in the iris color of Leptobrachium (sensu lato). UN: Unnumbered. See text

Species Iris color Locality Vou

L. abbotti Completely black Borneo BORKU

L. gunungense Completely black Borneo BORL. hasseltii Completely black Java KU

MZSumatra KU

L. hendricksoni Upper half orange Peninsular Malaysia ABTKUKU

Completely orange Peninsular Malaysia KUUpper half red ? Ma

L. montanum lineage 1 Completely black Borneo BORKUKU

L. montanum lineage 2 Completely black Borneo BORL. nigrops Completely black Peninsular Malaysia KU

Belitung MZBorneo KU

L. smithi Upper half scarlet Thailand KUUpper half orange Thailand KU

KUKU

Peninsular Malaysia UMUpper half yellow Thailand KU

Leptobrachium sp. 1 Completely blue Sumatra MZCompletely grey Sumatra KU

Leptobrachium sp. 2 Completely black Philippines BroL. banae Upper half white Vietnam ROML. buchardi Upper half pale green Laos OhlL. chapaense lineage 1 Upper half blue China Yan

Upper half sky-blue Thailand KUL. chapaense lineage 2 Upper half white Vietnam BaiL. chapaense lineage 3 Upper half white Vietnam ROM

Upper half light-blue Vietnam DubL. guangxiense Upper half white China FeiL. hainanense Upper half light-blue China FeiL. huashen Upper half sky-blue China FeiL. mouhoti Upper outer margin orange red Cambodia StuL. pullum Upper half? scarlet Vietnam Sm

Upper half yellow Vietnam NguL. xanthospilum Upper half white Vietnam LatV. ailaonica Upper half light-blue China FeiV. boringii Upper half light green China Fei

Upper half bluish green China FeiV. echinata Upper half lime green Vietnam Dub


Leptobrachium sp. 1 (Subclade I) had totally blue iris in adults,although it was grey in a juvenile.

In Clade B, a light-colored (ranging from white through sky-blueto lime green) upper iris predominated both in Subclade IV (V. liui,V. jiulongshanensis, V. leishanensis, L. chapaense [lineages 1and 2],V. boringii, V. ailaonica, V. echinata, and L. promustache) and in Subc-lade V (L. chapaense lineage 3, L. hainanense, V. ngoclinhensis, L. ba-nae, and L. xanthospilum). As in Clade A, exceptions occurred. Theupper part of the iris in L. mouhoti and L. pullum (Subclade V)was yellow, scarlet, or orange red.

4. Discussion

4.1. Taxonomic considerations of Clade A

Subclade I consisted of species from Borneo, Sumatra, and Min-danao. The Philippine population (sample 20), which diverged atthe base of this subclade, has been treated as being L. hasseltii(Taylor, 1922; Inger, 1954, 1966; Alcala, 1986). However, L. hasseltiioccurs in Subclade II (see below). Therefore, the Philippinepopulation constituted an unnamed species, herein referred to asLeptobrachium sp. 2. Morphological studies also suggested thatthe Philippine population was not conspecific with L. hasseltii

for voucher abbreviations.

cher [Sample No.] and/or reference

04B018 [17]; BOR 04B110: BOR12866 [15]; KUHE 39294;HE 39295 [16]; KUHE 39296; SP 21669; SP 26559; SP 26590

22959 [13]; KUHE 39377HE 42818 [33]; KUHE 42820 [34]; MZB UN; KUHE 42821;B UN [31]; UTA A53688 [32]HE 42807 [29]; KUHE 42808 [30]; KUHE 42809C 4081; UKM HC 110 [23]; KUHE 15008; KUHE 15336 [21];

HE 15680 [27];HE 15756; KUHE 52150 [28]; KUHE 52403 [22]; MDK 10 [25]HE 52150 (Juvenile)nthey and Grossmann (1997)

04B019 [4]; BOR 22008 [3]; BOR 04B020; BOR 04B021; MDK UN;HE 17306 [7]; KUHE 42811; KUHE 42812 [2]; KUHE 42813 [5];HE 42814; KUHE 42815 [6]; KUHE 42816; KUHE 42817; MDK 01 [9]

08481 [18]; KUHE 39204; SP 21481 [19]HE 15430 [37]; KUHE 15658 [38]; KUHE 15706; KUHE 35433; UKM HC 072 [39]B Amp1790 [35]; MZB Amp1791 [36]HE 081122-1; KUHE 42587 [40]; KUHE 42590 [41]HE 19281 [42]; KUHE 19282 [43]HE 19393; KUHE 19394; KUHE 19395; KUHE 19518; KUHE 19538;HE 19832; KU; KUHE 23318HE 19834 [44]; KUHE 19937; KUHE 19938;HE 19939 [45]; KUHE 20000; KUHE 20032; KUHE 23342 [48]

D0136; UM D0139 [49]HE 20200 [46]; KUHE 20201 [47]B Amp 15862 [11]; UTA A53689 [12]HE 42805 [10](Juvenile)wn and Diesmos (2009)

32200 [74]; Lathrop et al. (1998), Nguyen et al. (2009)er et al. (2004)g (1991)

HE 19122 [59]; Dubois and Ohler (1998)n and Nguyen (2004)

32176 [67]; Lathrop et al. (1998)ois and Ohler (1998)

et al. (2009)(1999)et al. (2009)art et al. (2006), Nguyen et al. (2009)ith (1921)yen et al. (2009)

hrop et al. (1998), Nguyen et al. (2009)(1999), Fei et al. (2009)(1999)et al. (2009)ois and Ohler (1998)



Table 5 (continued)

Species Iris color Locality Voucher [Sample No.] and/or reference

Upper half blue Vietnam Ho et al. (1999)V. jiulongshanensis Upper half light greenish white China Fei et al. (2009)V. l. liui Upper half light green China Fei (1999), Fei et al. (2009)V. l. yaoshanensis Upper half light green China Fei (1999)

Upper half light greenish white China Fei et al. (2009)Upper half light-blue China CIB JX20071196

V. leishanensis Upper half light green China Fei (1999), Fei et al. (2009)V. ngoclinhensis Upper half white Vietnam Orlov (2005), Nguyen et al. (2009)V. promustache Upper half light-blue China, Vietnam Rao et al. (2006), Fei et al. (2009), Bain et al. (2009)


ARTICLE IN PRESS

(Inger, 1954; Inger et al., 1995; Dubois and Ohler, 1998). Becausepopulations from the various islands of the Philippines might differfrom the Mindanao population (Inger, 1954), further study is nec-essary to determine this population’s taxonomic status.

Frogs morphologically identified as L. montanum are paraphy-letic, and populations from the Kinabalu (19) and Crocker (18) re-gions of western Sabah (L. montanum lineage 2) form a lineagesister to the clade containing L. montanum from the other partsof Borneo (L. montanum lineage 1) (Fig. 1). Morphologically,L. montanum lineage 2 and L. gunungense from Kinabalu (13, 14)are difficult to distinguish, but their calls differ substantially(Malkmus, 1996; Malkmus et al., 2002; Matsui, unpublished data).Because Malkmus (1996) mainly worked on Kinabalu, he likelystudied L. montanum lineage 2. Given an uncorrected p-distanceof 5.7–5.8% between L. montanum lineage 2 and L. gunungense,and their different calls, these lineages undoubtedly constitute dis-tinct species. This position is further bolstered by the genealogicalrelationships because L. gunungense formed a sister group not withL. montanum lineage 2 but with L. abbotti (15–17), a result not ex-pected because L. gunungense is morphologically much more dis-similar to L. abbotti than to L. montanum lineage 2.

Specimens from the type locality of L. montanum, Paramasan,southern Kalimantan (1, 2), nested in L. montanum lineage 1 andthey are regarded as being true L. montanum. The lineage also con-tains specimens from eastern Sabah (3, 4), western Sarawak (7, 8),central Kalimantan (5, 6), and western Kalimantan (9). Furthermorphological and bioacoustic investigations are needed to deter-mine taxonomic identity these populations. A sister lineage,Leptobrachium sp. 1 from Jambi (12) and Lampung (10, 11), Suma-tra, surely forms an unnamed species. In these individuals, the irisis blue in color, though grayish in juveniles. This condition is verydistinct among Sundaland species of Leptobrachium (Hamidy andMatsui, 2010).

Within Subclade II, L. nigrops, the sister species to the monophy-letic clade of L. hendricksoni and L. hasseltii, is characterized by hav-ing the smallest body size of all Leptobrachium and uniquelypointed finger and toe tips (Inger, 1966; Inger and Stuebing,1997). Populations from Peninsular Malaysia (37–39) and BelitungIsland (35, 36) are sister populations and together they form thesister lineage of the western Bornean (40, 41) population. Geneticdifferentiation among its allopatric populations is the greatestamong all species. Populations from Peninsular Malaysia, BelitungIsland, and Borneo have uncorrected p-distances ranging from 9.3%to 11.7%. Their geographical distinctiveness and level of geneticdifferentiation strongly suggest that each population deserves spe-cies recognition. Inger (1966) notes minor morphological differ-ences between Peninsular Malaysian and Bornean populations.Further morphological and acoustic studies will likely verify theirtaxonomic distinctiveness.

Leptobrachium hendricksoni is distinct in having black spots onits venter and an orange-colored upper (and sometimes whole) iris(Taylor, 1962; Inger, 1966; Matsui et al., 1999; Malkmus et al.,2002). On Peninsular Malaysia, this species is paraphyletic with re-spect to Sumatran populations. Interestingly, populations from the


northern part of Peninsular Malaysia (21–24) are the sister groupto the Sumatran populations (25, 26) and together these formthe sister group to the southern peninsular populations (27, 28).Genetic diversities in this species are much smaller (uncorrectedp-distances <2.3%) than those in L. nigrops, suggesting a uniqueevolutionary history. In this case, taxonomic recognition of theselineages may not be warranted.

Historically, the name L. hasseltii was applied to almost all pop-ulations of Leptobrachium (formerly as Megalophrys or Megophrys)ranging from southern China, Indochina, Thailand to northern In-dia, and through Sundaland to the Philippines (e.g., Smith, 1921;Bourret, 1937; Inger, 1954, 1966; Liu and Hu, 1961; Taylor, 1962;Berry, 1975). Matsui (in Frost, 1985) split several populations asdistinct species, although some authors have not recognized thesechanges (e.g., Alcala, 1986; Chanda, 1994; Zheng et al., 2008). Thetopotypic populations from Java (31–34) and the population fromLampung, southern Sumatra (29, 30) were monophyletic. Here,we have confirmed the occurrence of L. hasseltii on Sumatra and,based on specimen collection records in MZB, the species seemsto be restricted to this area. Central and northern Sumatra is occu-pied by L. hendricksoni. The range of L. hasseltii seems limited toJava, Sumatra, Bali, and several adjacent small islands (Iskandar,1998). The iris color of L. hasseltii is said to be scarlet (Iskandar,1998), as cited by Matsui et al. (1999). However, all of our samples,including those used herein, and L. nigrops, have a totally black iris,unlike its sister species L. hendricksoni.

Subclade III contained L. smithi from various localities of Thai-land, Myanmar (Kyaik Hto) and Malaysia (Langkawi Island),Leptobrachium sp. 3 from Myanmar (Gwa), and Leptobrachium sp.4 from Thailand (Pilok). Within L. smithi, populations from north-eastern Thailand (42, 43), western Thailand (44–47), southernThailand (48 = topotypic sample from Kaochong), including Lang-kawi Island (49), and Myanmar (50), formed a clade, but the rela-tionships among them remained unresolved. Intraspecific variationin body size and iris color noted by Matsui et al. (1999) was par-tially confirmed by us, but these populations did not exhibit signif-icant genetic differentiation between them. Populations from thesouthern and northern Isthmus Kra occurred in a well-known fau-nal and floral boundary in Sundaland (e.g., Tougard, 2001; De Bruynet al., 2005). Leptobrachium sp. 3 from Gwa, Myanmar (51) wasthe sister lineage to L. smithi. The data used in our analysis(DQ283239) were said to be from L. hasseltii (Frost et al., 2006)yet we could not examine the voucher specimen. This sequencewas more likely to have been from L. smithi rather than L. hasseltii.Large genetic uncorrected p-distance (6.0%) with L. smithi from an-other locality of Myanmar suggested that Leptobrachium sp. 3 rep-resented an undescribed species. Finally, Leptobrachium sp. 4 fromPilok, western Thailand (52) occurred sympatrically with L. smithi(45) and the genetic differentiation between them was great(uncorrected p-distance = 8.1%). Inthara et al. (2005) reported thatthe larval denticle formula of Leptobrachium sp. from Thon PhaPhum, Kanchanaburi, which is located very close to Pilok variedfrom 6(2–6)/7(1–6) to 8(2–8/7(1–6) (terminology following Altigand McDiarmid, 1999). The denticle formula for L. smithi ranged




ARTICLE IN PRESS

from 5(2–5)/5(1–4) to 7(2–7)/6(1–5) (Matsui et al., 1999). Unfortu-nately, we did not have a specimen of Leptobrachium sp. 4. Adultspecimens are needed to determine this population’s taxonomicstatus.

4.2. Taxonomic considerations of Clade B

In Subclade IV, Clade B, L. chapaense lineage 2 from Ha Giang,northern Vietnam (66) was the sister group of the other lineages.The population has been suggested to be an undescribed species(Zheng et al., 2008), and our results support this view. In the sisterlineage to L. chapaense lineage 2, V. promustache (65) was the sisterspecies to the clade encompassing five remaining lineages. Theserelationships are completely concordant with those of Zhenget al. (2008).

One lineage contained three Chinese sublineages: first, V. jiu-longshanensis from Zhejiang Province (56); second, V. leishanensisfrom Guizhou Province (55); and third, V. l. liui from Mangshan,Hunan Province (53) and V. l. yaoshanensis from Guangxi Province(54). Our results indicated that these four taxa were close geneti-cally to each other (uncorrected p-distances ranged from 1.5% be-tween V. l. liui and V. l. yaoshanensis to 3.0% between V. l. liui andV. jiulongshanensis). Zheng et al. (2008) recovered these threelineages but concluded that V. jiulongshanensis was a juniorsynonym of V. liui, incorrectly reflecting their phylogeny. Rao andWilkinson (2008) also obtained the three lineages but foundthat V. l. liui formed a clade with V. jiulongshanensis and not withV. l. yaoshanensis. Thus, they synonymized V. jiulongshanensis intoV. liui, but recognized V. yaoshanensis as a full species. We suggestthat additional work is required to confirm the taxonomic status ofthese taxa.

Rao and Wilkinson (2008) proposed the formation of a V. borin-giae species group comprised of V. boringiae (=boringii) (61), V. lei-shanensis, V. l. liui, V. l. yaoshanensis, and V. jiulongshanensis. We didnot resolve this group as a monophyletic lineage, and the associa-tion of these species was only weakly supported in Rao and Wilkin-son’s trees. Our tree supported Fei et al.’s (2009) V. liui speciesgroup including V. leishanensis, V. l. liui, V. l. yaoshanensis (V. jiulong-shanensis in the synonymy of V. l. liui). However, our analysis didnot support their V. boringii species group as including V. boringii,V. ailaonica (64), and V. promustache. Similarly, Rao and Wilkinson’s(2008) V. ailaonica species group, including V. ailaonica, V. echinata(63) and V. ngoclinhensis (72), was not supported; our results, andthose of Zheng et al. (2008), did not nest V. ngoclinhensis (SubcladeV) with V. ailaonica and V. echinata (Subclade IV). Certainly, V. ailao-nica and V. echinata are sister species (Dubois and Ohler, 1998;Ohler et al., 2000; Grosjean, 2001), but there remains an argumentas to whether they are conspecific (Ho et al., 1999; Zheng et al.,2008) or not (Ohler et al., 2000; Grosjean, 2001; Rao and Wilkinson,2008). The uncorrected p-distance between them was only 2.5%,the threshold of specific separation for other taxa. This low levelof divergence could reflect isolation-by-distance.

Leptobrachium chapaense lineage 1 from Thailand (57, 59) andYunnan, China (58, 60) and Leptobrachium sp. 5 from Laos (62)comprise the remaining two lineages of Subclade IV. Wide-rangingL. chapaense is surely a composite of more than one species (Raoet al., 2006; Zheng et al., 2008; Rao and Wilkinson, 2008). OurL. chapaense lineage 1 is the sister lineage of the population fromSa Pa, Vietnam, the type locality of L. chapaense (Zheng et al.,2008) and likely it is conspecific. Leptobrachium chapaense clusterswithin Vibrissaphora and this finding conforms to the morphologyof the tadpoles from Yunnan; Yang (1991) notes that Yunnan pop-ulations have a Y-shaped yellow marking on their tail, a character-istic of Vibrissaphora (Dubois and Ohler, 1998).

Our single male specimen of Leptobrachium sp. 5 from XamNeua, northeastern Laos likely represents an undescribed species.


Unfortunately, specimens of L. buchardi Ohler, Teynié, and David,2004 from southern Laos, which has a green colored upper iris,as ascertained from one female specimen, were not available forcomparison. The iris color in our male was not recorded and it islarger than the female suggesting, on one hand, the possibility oftheir conspecificity because of male-biased sexual size dimorphismin Vibrissaphora (Dubois and Ohler, 1998). On the other hand, giventhat the two specimens were collected more than 600 km instraight-line distance apart, conspecificity seems unlikely. It is alsopossible that our specimen is conspecific with L. huashen Fei andYe, 2005 from Yunnan Province, China. However, L. huashen is clo-sely related to L. chapaense (Fei and Ye, 2005; Rao and Wilkinson,2008). Likewise, L. guangxiense Fei, Mo, Ye, and Jiang in Fei, Hu,Ye, Huang et al. (2009) from Shangsi, Guangxi Province, Chinawas not available. However, based on the original description(Fei et al., 2009), the species seems to be a member of SubcladeIV of our study. Thus, we believe it more likely than not thatLeptobrachium sp. 5 represents an undescribed species.

Two populations of L. chapaense lineage 3 from northern Viet-nam (67, 69) and L. hainanense (68) formed a monophyletic line-age, as previously reported (Zheng et al., 2008). Lathrop et al.(1998) noted that the dorsal half of iris is white in specimens fromthe Tam Dao (67) population and not light-blue as in L. hainanense(Liu et al., 1973 as V. hasseltii; Matsui and Ota, 1995; Fei et al.,2009; see below). We, however, regard this difference to be withinthe normal range of variation, and tentatively conclude that thepopulation from Tam Dao, as well as Ben En, should be treated asL. hainanense. The uncorrected p-distance between these two local-ities and L. hainanense from Hainan Island were 1.8% and 3.0%,respectively. The latter value is comparable to the distance (3.0%)found between L. abbotti and L. gunungense from Borneo. Furtherwork is necessary to confirm taxonomic relationships and identityof these populations.

Unlike the result of Zheng et al. (2008), our study resolved Viet-namese L. mouhoti (70) as the sister species of L. pullum (71) andnot V. ngoclinhensis (72). As with Zheng et al.’s (2008) study,V. ngoclinhensis fell in Subclade V and this association differs fromRao and Wilkinson’s (2008) suggestion that the species is associ-ated with Vibrissaphora (Clade IV) based on morphological data.Although L. pullum is morphologically similar to L. smithi (Matsuiet al., 1999), these two species were distantly related genealogi-cally, being placed in Subclades V and III, respectively. Finally, Viet-namese L. xanthospilum (73) and L. banae (74) represented theremaining two lineages in Subclade V and our study supportedtheir specific status (Lathrop et al., 1998).

4.3. Taxonomic relationship of Leptobrachium and Vibrissaphora

Our results for the relationships of Leptobrachium and Vibrissa-phora were concordant with other recent molecular studies(Fu et al., 2007; Zheng et al., 2008; Rao and Wilkinson, 2008). Assummarized by Dubois and Ohler (1998), taxonomic recognitionof Leptobrachium and Vibrissaphora as genera, subgenera, or syn-onyms is controversial. Some authors (e.g., Fei et al., 2009) stilltreat them as different genera, while the others (e.g., Dubois andOhler, 1998; Ohler et al., 2004; Delorme et al., 2006) regard themas subgenera of Leptobrachium. Zheng et al. (2008) rejected themonophyly of both subgenera and relegated Vibrissaphora to syn-onymy in Leptobrachium without recognizing subgenera, as origi-nally proposed by Dubois (1983).

The taxonomic conclusions of Zheng et al. (2008), now followedby Frost (2009), requires reassessment because their result seemsto have been affected by inadequate sampling in Sundaland. Inall of our trees, the Sundaland species plus L. smithi (Clade A, Subc-lades I–III) were distinctly separated from Chinese and Indochinesespecies (Clade B, Subclades IV and V). Clades A, B, and C in Fig. 3 of



Fig. 3. Iris color in frogs of the genus Leptobrachium mapped onto the maximumlikelihood tree given in Fig. 2. (For interpretation of the references to color in thisfigure legend, the reader is referred to the web version of this paper.)


ARTICLE IN PRESS

Zheng et al. (2008) corresponds to our Subclades IV, V, and I + III,respectively. They found either, Subclades V and I + III formed amonophyletic group, which was sister to Subclade IV (MP tree),or these three lineages were trichotomic (BI tree). Our results re-jected both sets of relationships, and hence their conclusion.

In order for the taxonomy to reflect historical relationships, werecognize Clades A and B as subgenera. Because the current meg-ophryid taxonomy tends to recognize many genera that are neithersufficiently studied phylogenetically nor defined clearly morpho-logically, we refrain treating them as genera. Subgenus Leptobrach-ium (Clade A; type species L. hasseltii) can be characterized as themost inclusive clade containing species from the Philippines,Malaysia, Indonesia, Thailand, Myanmar, and India, but exclusiveof L. chapaense lineage 1 from Thailand. Subgenus Vibrissaphora(Clade B; type species V. boringii) is the most inclusive clade thatcontains species from Indochina and China, and including L. (V.)chapaense lineage 1 from Thailand.

Traditionally, male Vibrissaphora have been regarded as possess-ing nuptial spines on their upper labium during the breeding seasonand as having larger body sizes than females. Previously, these char-acteristics served to separate Vibrissaphora from Leptobrachium (seereview by Dubois and Ohler (1998)). However, the character labialspines no longer defines the group. The species L. banae, L. chapaense(for three lineages), L. guangxiense, L. hainanense, L. mouhoti, L. pullum,L. xanthospilum, and Leptobrachium sp. 5 grouped in Clade B. Inour new classification, these species, although lacking labial spines,should be placed in Leptobrachium (Vibrissaphora) together withV. ngoclinhensis. In this arrangement, the morphological diagnosisof Vibrissaphora is unclear and new characteristics should be


surveyed. Although detailed morphological study is necessary, amore broadened and flattened male upper lip of Leptobrachium(Vibrissaphora) may be a synapomorphy, and a character state thatseparates them from Leptobrachium (Leptobrachium), as observedbetween L. pullum and L. smithi (Matsui et al., 1999). The presenceof reversed sexual size dimorphism (Dubois and Ohler, 1998) and aY-shaped yellow marking on the tail of tadpoles should be also reas-sessed using a sufficient number of samples.

4.4. Evolutionary history of Leptobrachium

Divergence time estimations can provide valuable insights intothe biogeographic history of species and regions. Often the esti-mated dates have extensive variance and overlap, yet they canserve as biogeographical hypotheses in the absence of detailedgeological information, and can even predict unknown geologicalevents (Lindell et al., 2006; Riddle et al., 2008).

Time estimates (Table 4) suggested that Leptobrachium (sensulato) and Oreolalax formed in the early Eocene, and subsequentlydiverged into two major lineages (Clades A and B) in the mid Eo-cene. No stratigraphic events have been associated with the originof Clades A and B and the subsequent, nearly simultaneous diver-gences within them starting from the late Eocene to early Oligo-cene. However, the uplift of the Tibetan Plateau initiated about40 MYBP (Zhao and Morgan, 1985; Chung et al., 1998) and thiscaused changes in the Mekong drainage system (Brookfield,1998). This orogenesis is likely related to the speciation events.

Estimates for the age of Sundaland Leptobrachium predate thegeological separation of land masses in this region. For example,the Sunda Shelf became land-positive, forming a continuous landconnection between Java and mainland Southeast Asia, includingsome parts of Indochina, during periods of lowered sea levels inthe Pleistocene (<1.6 MYBP; Voris, 2000)). This very recent strati-graphic history is responsible for the recent cladogenic events assuggested by low levels of intraspecific genetic differentiation inLeptobrachium but it cannot account for older events. Most of thespeciation is estimated to have occurred sometime between thelate Oligocene to late Miocene (30.0–14.0 MYBP) in Clade A. Theseparation of L. nigrops from its common ancestor with L. hendrick-soni and L. hasseltii likely occurred in the late Oligocene, and speci-ation of the latter two species in the early Miocene. These ages arecomparable with those estimated for Clade B. The diversification ofL. banae from other Vietnamese and Hainan Leptobrachium, and forHa Gian L. chapaense lineage 2 from its sister taxa, likely occurredin the early Miocene.

Leptobrachium sp. 2 from Mindanao, Philippines was estimatedto have diverged from Bornean and Sumatran relatives at 19.0 (CI27.4–11.3) MYBP. This estimate does not contradict the idea thatMindanao became aerial about 25–30 MYBP in the late Oligocene(Brown and Alcala, 1994), but the route of faunal invasion remainsunclear (Inger, 1999).

Inger and Voris (2001) showed that disjunction of the MalayPeninsula from Borneo by the South China Sea (Fig. 1) occurredonce about 5 MYBP in the early Pliocene. This age corresponds tothe date of intraspecific divergence estimated in L. hendricksonifor populations in the northern Malay Peninsula and Sumatra.Although specimens from Sarawak, western Borneo (Inger, 1966)were not available, separation from the peninsular population isexpected at this age.

‘‘Intraspecific” divergence in L. nigrops is much older than thatobserved in the other species (Table 4). The mid Miocene date iscomparable to or even older than that in other lineages (see be-low). Inger (2005) surmised that the long-term continental con-nection between Borneo and the Malay Peninsula (50–5 MYBP)was once interrupted in the mid Miocene, 15 MYBP. This eventmight have isolated Bornean L. nigrops from Malay Peninsular




ARTICLE IN PRESS

and Belitung populations. Notwithstanding their morphologicalsimilarity, each of the populations currently called L. nigrops islikely a distinct species. The occurrence of L. nigrops on Belitung Is-land suggests the possibility of ‘‘land bridge” invasions by Leptob-rachium between Mainland Asia and Borneo.

Leptobrachium hendricksoni and L. nigrops are lowland speciesthat also occur in coastal swamps. Their ecology led Inger and Voris(2001) to associate them with Pleistocene dispersal between theMalay Peninsula and Borneo, while questioning their absence onSumatra. The presence of L. hendricksoni on Sumatra is now con-firmed, and its unique ecology does not seem to be related to Pleis-tocene dispersal. Leptobrachium hasseltii occurs at slightly higherelevations than does L. hendricksoni. On Java and southern Sumatra,we found L. hasseltii at altitudes of 300–1500 m a.s.l. However, thisaltitudinal distribution may have been secondarily acquired. With-in Java, most lowland forests have been logged and no longer exist.Only a few mountain forests remain today in the form of isolatedhabitat islands without corridors between them. This conditionprobably has prevented gene flow between populations from wes-tern and central Java.

Diversification in L. hasseltii is estimated to have occurred in themid Pliocene (Table 4). Available information on distributional pat-tern of this species is limited, but based on collection records in MZB,the westernmost distribution of L. hasseltii is the southern tip ofSumatra (Lampung), and the easternmost range includes the islandsof Bali and Kangean (Iskandar, 1998), which is the southeasternmostrange of the genus. The Lombok Strait, i.e., Wallace’s Line, separatingBali and Lombok, seems to have been the primary barrier preventingthe invasion of Leptobrachium to Wallacea.

Parapatric species of Leptobrachium occur on Borneo, wherespeciation occurred mostly in the Miocene, starting with the midMiocene separation of L. montanum lineage 2 from the commonancestor of the other species. Speciation continued with the splitof ancestors of L. montanum lineage 1 and Leptobrachium sp. 1,and slightly later the common ancestor of L. abbotti and L. gunun-gense. This was followed by speciation of L. abbotti and L. gunun-gense in the late Miocene. Intraspecific divergence occurred atthe Miocene–Pliocene boundary as shown by L. montanum lineage1. These very old dates of divergence in Borneo, especially on Mt.Kinabalu, are comparable to those of bufonid toads in the genusAnsonia (Matsui et al., 2010).

The boundary of upland L. montanum (two lineages combined)and lowland L. abbotti occurs at elevations from 800 to 1000 ma.s.l. (Inger et al., 1995). On Mt. Kinabalu, a narrow zone of symp-atry occurs between L. gunungense (1750–2200 m) and L. monta-num (900–1750 m), most probably our lineage 2 (Malkmus et al.,2002; our own observation). The third species, L. abbotti, occursat much lower elevations (500–900 m). Like the species in Borneo,Leptobrachium sp. 1 was found parapatric with L. hasseltii (Hamidyand Matsui, 2010). Interestingly, these sets of species are from dif-ferent lineages. Non-sister lineages may more easily segregatetheir niches than the sister taxa, which might be more similar inniche requirements.

Nearly simultaneous dates of divergence were estimated in thepredominantly Thai clade, where splits occurred between Leptob-rachium sp. 4 and the common ancestor of L. smithi and Leptobrach-ium sp. 3 in the early Miocene. Another speciation event occurredbetween L. smithi and Leptobrachium sp. 3 in the late Miocene. Sub-sequent intraspecific divergence in L. smithi was estimated to havebegun in the early Pliocene. The Isthmus of Kra, peninsular Thai-land, is usually noted as a major biogeographical transition zone(e.g., Tougard, 2001; De Bruyn et al., 2005), and it might have alsoaffected the evolution of Leptobrachium. However, the specificdate(s) of the disjunction is (are) not clear and simply estimatedto have occurred as a result of a Neogene (<23 MYBP) marinetransgression.


Diversification in the Indochinese–Chinese area initiated in theMiocene (Table 4). In the Indochinese clade, L. xanthospilum splitfrom the common ancestor of other Vietnamese and HainanLeptobrachium and V. ngoclinhensis in the early Miocene. In the Chi-nese clade, V. promustache and V. liui diverged in the late Miocene.Intraspecific divergence in these regions occurred mostly in the Pli-ocene. Our estimated date of separation between L. hainanense andVietnamese L. chapaense lineage 3, 2.6 (CI 0.7–4.7) MYBP, closelyconforms to the date of separation of these regions in the earlyPleistocene, about 2 MYBP (Chang et al., 2008).

In the Indochinese clade, the keratinized nuptial spines on theupper jaw of males seem to have been acquired after the middleMiocene, 15.7 (CI 7.8–24.9) MYBP by V. ngoclinhensis only. In theChinese clade, the spines seem to have evolved in the late Miocene,9.7 (CI 3.6–16.7) MYBP, after the basal split of L. chapaense lineage2, which lacks spines. Subsequently, the spines were secondarilylost in the ancestor of L. chapaense (=lineage 1). As indicated bythe different patterns of spine arrangement, labial spines likelyhave evolved independently in Chinese and Indochinese (V. ngo-clinhensis: Orlov, 2005; Rao et al., 2006) clades.

Each subclade is estimated to have an old evolutionary history.Divergence times are not easily explained by the geohistory ofSoutheast Asian major landmasses alone. In order to test hypothe-ses posed here, additional detailed paleogeographic evidence isnecessary.

4.5. Evolution of iris color

Although the data are limited, the color of the iris seems to varyontogenetically (Table 5). The iris color of L. hendricksoni in MalayPeninsular populations varies from being totally orange to havingcolor only on the upper part. This appears to be intraspecific vari-ation as individuals from these populations are monophyletic andconspecific. Similarly, in Leptobrachium sp. 1, juvenile grey iristransforms to blue in adults. Further, variation in iris color rangesfrom being light yellow to orange in L. smithi (Matsui et al.,1999), and specimens with differently colored iris are also judgedgenetically to be conspecific. The color of the upper part of the irisin Indochinese–Chinese species (Clade B in this study) has beenvariously described as being white and sky-blue, as well as sky-blue and lime, and lime and green (see Table 5). This continuousrange of color could be grouped as light-colored upper iris.Although iris color varies intraspecifically, the evolution of thecharacter can be estimated by the mapping generalized states inadults on the phylogeny (Fig. 3).

Matsui et al. (1999) once surmised that the light-colored upperiris might be the primitive condition in Leptobrachium, but theirhypothesis was not confirmed in this study. From the distributionof iris color on the tree (Fig. 3), a totally black iris is the plesiomor-phic state within Clade A. Within Clade B, the plesiomorphic stateis one of having a light color in the upper half of the iris. The yellowto scarlet color in the upper half of the iris, and sometimes also inthe lower half, is regarded as being apomorphic, having evolvedindependently in three subclades. A totally light-colored iris alsoappears to be an apomorphic character in Clade A. Because no spe-cies of the sister genus Oreolalax is known to have a bicolored ortotally dark iris (Liu and Hu, 1961; Zhao and Adler, 1993; Fei,1999; Yang and Rao, 2008), the plesiomorphic state in Leptobrach-ium cannot be identified.

Although iris color surely varies, even within a species, therange of variation seems to be limited. Thus, the character appearsto be useful for species identification and in estimating phyloge-netic relationships. In order to test hypotheses on the evolutionof iris color posed here, data are required from taxa whose charac-ter states remain unknown.




ARTICLE IN PRESS

Acknowledgments

MM is grateful to the following for their encouragements and/orpermission to conduct research and field companionship: H. Akiy-ama, L. Apin, K. Araya, A.-A. Hamid, T. Hikida, H. Ota, H. Kassim, J.J.Kendawong, K.B. Kueh, T. Kusano, D. Labang, M.B. Lakim, M. Mary-ati, the late J. Nabitabhata, K. Nishikawa, S. Panha, L.-H. Seng, A. Su-din, T. Sugahara, T. Tachi, M. Toda, and N.-S. Wong. MM is alsoindebted to A. Ohler and M. Delorme for exchanging tissue sam-ples, and N. Kuraishi and N. Yoshikawa for laboratory assistance.We also thank two anonymous reviewers for improving an earlyversion of the manuscript. The National Research Council of Thai-land, the Royal Forest Department of Thailand, the Economic-Plan-ning Unit (former Socio-Economic Research Unit) of Malaysia, theState Government of Sarawak, and Sabah Parks kindly permittedMM to conduct the project, and Chulalongkorn University, Univer-sity Malaya, Universiti Malaysia Sabah, Universiti KebangsaanMalaysia (UKM), JICA, and the Forest Department, Sarawak kindlyprovided all the facilities for conducting research. Field trips byMM were made possible by grants from The Monbusho Interna-tional Scientific Research Program (Field Research, 01041051,02041051, 04041068, 06041066, and 08041144), The Mon-bukagakusho through the Japanese Society for the Promotion ofSciences (JSPS: Field Research, 15370038, 20405013), UKM (OUP-PLW-14-59/2008), and TJTTP-OECF. AH thanks M.D. Kusrini, S. Kir-ono, G.B. Mandigani, D. Susanto, M. Harvey, E. Smith, K.L. Sanders,T.Q. Nguyen, D.A. Anggraeni, and J. Rhamadani for providing tissuesamples and to the Monbukagakusho for scholarship funding.RWM Funding for fieldwork was obtained through grants fromthe Natural Sciences and Engineering Research Council, Canada(Discovery Grant A3148), the Royal Ontario Museum (ROM) Foun-dation, and the ROM Volunteers Fieldwork Committee. All field-work was conducted using approved Animal Use Protocols.Fieldwork in Vietnam was assisted by N.L. Orlov, A. Lathrop, R.H.Bain, V.S. Cao, T.C. Ho and V.S. Nguyen; export permits were ob-tained with the assistance of V.S. Cao and the Institute of Ecologyand Biological Resources, Hanoi. Specimens in Hainan Island wereobtained while assisting H.-T. Shi, Hainan Normal University, andthose from Yunnan were obtained with the assistance of D.-Q.Rao, Kunming Institute of Zoology and N.L. Orlov; research exportpermits were obtained through the Chinese Academy of Sciences.

References

Alcala, A.C., 1986. Guide to Philippine Flora and Fauna 10, Amphibians and Reptiles.Xiv+195 p. Natural Resources Management Center, Ministry of NaturalResources and University of the Philippines, Quezon City.

Altig, R., McDiarmid, R.W. (Eds.), 1999. Body plan: development and morphology.In: Tadpoles. University of Chicago Press, Chicago, pp. 24–51.

Bain, R.H., Nguyen, T.Q., 2004. Herpetological diversity of Ha Giang province innortheastern Vietnam, with description of two new species. Am. Mus. Novit.3452, 1–42.

Bain, R.H., Nguyen, T.Q., Doan, K.V., 2009. First record of Leptobrachium promustachefrom Vietnam. Herpetol. Notes 2, 27–29.

Berry, P.Y., 1975. The Amphibian Fauna of Peninsular Malaysia. Tropical Press, KualaLumpur.

Bourret, R., 1937. Notes herpétologiques sur l’Indochine Française XIV–XV. AnnexeBull. Gén. Instr. Publique, Hanoi 1937, 1–80.

Brookfield, M.E., 1998. The evolution of great river systems of southern Asia duringthe Cenozoic India–Asia collision: rivers draining southwards. Geomorphology22, 285–312.

Brown, R.M., Diesmos, A.C., 2009. HerpWatch Philippines: an online biodiversityinformation product for Philippine herpetological diversity. Available from:<http://www.herpwatch.org/>.

Brown, R.M., Guttman, S.I., 2002. Phylogenetic systematics of the Rana signatacomplex of Philippine and Bornean stream frogs: reconsideration of Huxley’smodification of Wallace’s Line at the Oriental-Australian faunal zone interface.Biol. J. Linn. Soc. 76, 393–461.

Brown, W.C., Alcala, A.C., 1994. Philippine frogs of the family Rhacophoridae. Proc.Calif. Acad. Sci. 48, 185–220.


Cannatella, D.C., Hillis, D.M., Chippindale, P.T., Weght, L., Rand, A.S., Ryan, M.J., 1998.Phylogeny of frogs of the Physalaemus pustulosus species group, with anexamination of data incongruence. Syst. Biol. 47, 311–335.

Chanda, S.K., 1994. Anuran (Amphibia) fauna of northeast India. Mem. Zool. Surv.India 18, 1–143.

Chang, J., Wang, B., Zhang, Y.-Y., Liu, Y., Liang, W., Wang, J.-C., Shi, H.-T., Su, W.-B.,Zhang, Z.-W., 2008. Molecular evidence for species status of the endangeredHainan peacock pheasant. Zool. Sci. 25, 30–35.

Chung, S.L., Lo, C.H., Lee, T.Y., Zhang, Y.Q., Xie, Y.W., Li, X.H., Wang, K.L., Wang, P.L.,1998. Diachronous uplift of the Tibetan plateau starting 40 Myr ago. Nature394, 769–773.

De Bruyn, M., Nugroho, E., Hossain, Md.M., Wilson, J.C., Manther, P.B., 2005.Phylogeographic evidence for the existence of an ancient biogeographic barrier:Isthmus of Kra Seaway. Heredity 94, 370–378.

Delorme, M., Dubois, A., Grosjean, S., Ohler, M., 2006. Une nouvelle ergotaxinomiedes Megophryidae (Amphibia, Anura). Alytes 24, 6–21.

Drummond, A.J., Ho, S.Y.W., Philips, M.J., Rambaut, A., 2006. Relaxed phylogeneticsand dating with confidence. PLoS Biol. 4, 699–710.

Drummond, A.J., Rambaut, A., 2007. BEAST, Bayesian Evolutionary AnalysisSampling Trees, version 1.4.2. Available from: <http://beast.bio.edac.uk/>.

Dubois, A., 1983. Note preliminaire sur le genre Leptolalax Dubois, 1980(Amphibiens, Anoures), avec diagnose d’une espe‘ce nouvelle du Vietnam.Alytes 2, 147–153.

Dubois, A., 2005. Amphibia Mundi. 1.1.; An ergotaxonomy of recent amphibians.Alytes 23, 1–24.

Dubois, A., Ohler, A., 1998. A new species of Leptobrachium (Vibrissaphora) fromnorthern Vietnam, with a review of the taxonomy of the genus Leptobrachium(Pelobatidae, Megophryinae). Dumerilia 4, 1–32.

Emerson, S.B., Inger, R.F., Iskandar, D., 2000. Molecular systematics andbiogeography of the fanged frogs of Southeast Asia. Mol. Phylogenet. Evol. 16,131–142.

Fei, L. (Ed.), 1999. Atlas of Amphibians of China. Henan Science and TechnologyPress, Zhengzhou.

Fei, L., Ye, C.-Y., 2005. Two new species of Megophryidae from China. In: Fei, L., Ye,C.-Y., Jiang, J., Xie, F., Huang, Y. (Eds.), An Illustrated Key to Chinese Amphibians.Sichuan Publishing House of Science and Technology, Chungdu, pp. 253–255.

Fei, L., Hu, S.-Q., Ye, C.-Y., Huang, Y.-Z., et al., 2009. Fauna Sinica, Amphibia vol. 2 –Anura. Science Press, Beijing.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.

Frost, D.R. (Ed.), 1985. Amphibian Species of the World: A Taxonomic andGeographical Reference. Allen Press, Lawrence, Kansas.

Frost, D.R., 2009. Amphibian Species of the World: an Online Reference, version 5.3(12 February, 2009). Electronic database accessible at: http://research.amnh.org/herpetology/amphibia/index.php, American Museum of Natural History,New York, USA.

Frost, D.R., Grant, T., Faivovich, J.N., Bain, R.H., Haas, A., Haddad, C.F.B., de Sá, R.O.,Channing, A., Wilkinson, M., Donnellan, S.C., Raxworthy, C.J., Campbell, J.A.,Blotto, B.L., Moler, P., Drewes, R.C., Nussbaum, R.A., Lynch, J.D., Green, D.M.,Wheeler, W.C., 2006. The amphibian tree of life. Bull. Am. Mus. Nat. Hist. 297,1–370.

Fu, J.-Z., Weadick, C.J., Bi, K., 2007. A phylogeny of the high-elevation Tibetanmegophryid frogs and evidence for the multiple origins of reversed sexual sizedimorphism. J. Zool. 273, 315–325.

García-París, M., Buchholz, D.R., Parra-Olea, G., 2003. Phylogenetic relationships ofPelobatoidea re-examined using mtDNA. Mol. Phylogenet. Evol. 28, 12–23.

Goebel, A.M., Donnelly, J.M., Atz, M.E., 1999. PCR primers and amplificationmethods for 12S ribosomal DNA, the control region, cytochrome oxidase I,and cytochrome b in bufonids and other frogs, and an overview of PCR primerswhich have amplified DNA in amphibians successfully. Mol. Phylogenet. Evol.11, 163–199.

Grosjean, S., 2001. The tadpole of Leptobrachium (Vibrissaphora) echinatum(Amphibian, Anura, Megophryidae). Zoosystema 23, 143–156.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

Hamidy, A., Matsui, M., 2010. A new species of blue-eyed Leptobrachium (Anura:Megophryidae) from Sumatra, Indonesia. Zootaxa 2395, 34–44.

Hedges, S.B., 1994. Molecular evidence for the origin of birds. Proc. Natl. Acad. Sci.USA 91, 2621–2624.

Hillis, D.M., Mable, B.K., Larson, A., Davis, S.K., Zimmer, E.A., 1996. Nucleic acids IV:sequencing and cloning. In: Hillis, D.M., Mable, B.K., Moritz, C. (Eds.), MolecularSystematics, second ed. Sinauer, Sunderland, pp. 321–406.

Ho, T.C., Lathrop, A., Murphy, R.W., Orlov, N.L., 1999. A redescription of Vibrissaphoraailaonica with a new record in Vietnam. Russ. J. Herpetol. 6, 48–54.

Holloway, J.D., Hall, R., 1998. SE Asian geology and biogeography: an introduction.In: Hall, R., Holloway, J.D. (Eds.), Biogeography and Geological Evolution of SEAsia. Backhuys Publishers, Leiden, pp. 1–23.

Huelsenbeck, J.P., Hillis, D.M., 1993. Success of phylogenetic methods in the four-taxon case. Syst. Biol. 42, 247–264.

Huelsenbeck, J.P., Ronquist, F.R., 2001. MrBayes: Bayesian inference of phylogenetictrees. Bioinformatics 17, 754–755.

Inger, R.F., 1954. Systematics and zoogeography of Philippine Amphibia. Fieldiana:Zool. 33, 183–531.

Inger, R.F., 1966. The systematics and zoogeography of the Amphibia of Borneo.Fieldiana: Zool. 52, 1–402.


http://www.herpwatch.org/

http://beast.bio.edac.uk/

http://research.amnh.org/herpetology/amphibia/index.php

http://research.amnh.org/herpetology/amphibia/index.php



ARTICLE IN PRESS

Inger, R.F., 1999. Distribution of amphibians in Southern Asia and adjacent islands.In: Duellman, W.E. (Ed.), Patterns of Distribution of Amphibians: A GlobalPerspective. Johns Hopkins Univ. Press, Baltimore and London, pp. 445–482.

Inger, R.F., 2005. The frog fauna of Indo-Malayan region as it applies to Wallace’sline. In: Tuen, A.A., Das, I. (Eds.), Wallace in Serawak-150 years later, aninternational conference on biogeography and biodiversity. Institute ofBiodiversity and Environmental Conservation. Universiti Malaysia Sarawak,Kota Samarahan, pp. 82–90.

Inger, R.F., Stuebing, R.B., 1997. A Field Guide to the Frogs of Borneo. Nat. Hist. Publ.Sdn. Bhd, Kota Kinabalu.

Inger, R.F., Voris, H., 2001. The biogeographical relations of the fogs and snakes ofSundaland. J. Biogeogr. 28, 863–891.

Inger, R.F., Stuebing, R.B., Tan, F.-L., 1995. New species and new records of anuransfrom Borneo. Raffles Bull. Zool. 43, 115–131.

Inthara, C., Lauhachinda, V., Nabhitabhata, J., Chuaynkern, Y., Kumtong, P., 2005.Mouth part structures and distribution of some tadpoles from Thailand.Thailand Nat. Hist. Mus. J. 1, 55–78.

Iskandar, D.T., 1998. The Amphibians of Java and Bali. Puslitbang Biologi, LIPI, Bogor.Jobb, G., von Haeseler, A., Strimmer, K., 2004. Treefinder: a powerful graphical

analysis environment for molecular phylogenetics. BMC Evol. Biol. 4, 18.Lathrop, A., 1997. Taxonomic review of the megophryid frogs (Anura: Pelobatoidea).

Asiatic Herpetol. Res. 7, 68–79.Lathrop, A., Murphy, R.W., Orlov, N.L., Ho, C.T., 1998. Two new species of

Leptobrachium (Anura: Megophryidae) from the central highlands of Vietnamwith a redescription of Leptobrachium chapaense. Russ. J. Herpetol. 5, 51–60.

Leaché, A.D., Reeder, T.W., 2002. Molecular systematics of the eastern fence lizard(Sceloporus undulatus): a comparison of parsimony, likelihood, and Bayesianapproaches. Syst. Biol. 51, 44–68.

Lindell, J., Ngo, A., Murphy, R.W., 2006. Deep genealogies and the mid-peninsularseaway of Baja California. J. Biogeogr. 33, 1327–1331.

Liu, C., Hu, S., 1961. Tailless Batrachians of China. Science Press, Beijing.Liu, C.-C., Hu, S.-C., Fei, L., Huang, C.-C., 1973. On collections of amphibians from

Hainan Island. Acta Zool. Sin. 19, 385–404.Malkmus, R., 1996. Leptobrachium gunungense sp. N. (Anura: Pelobatidae) vom

Mount Kinabalu, Nord Borneo. Mitt. Zool. Mus. Berlin 72, 297–301.Malkmus, R., Manthey, U., Vogel, G., Hoffman, P., Kosuch, J., 2002. Amphibians and

Reptiles of Mount Kinabalu (North Borneo). ARG Gantner VerlagKommanditgesellschaft, Ruggell.

Manthey, U., Grossmann, W., 1997. Amphibien & Reptilien Südostasiens. Natur undTier Verlag, Münster.

Matsui, M., Ota, H., 1995. On Chinese herpetology. Herpetologica 51, 234–250.Matsui, M., Nabhitabhata, J., Panha, S., 1999. On Leptobrachium from Thailand with a

description of a new species (Anura: Pelobatidae). Jpn. J. Herpetol. 18, 19–29.Matsui, M., Ito, H., Shimada, T., Ota, H., Saidapur, S.K., Khonsue, W., Tanaka-Ueno, T.,

Wu, G., 2005a. Taxonomic relationships within the pan-oriental narrow-mouthtoad Microhyla ornata as revealed by mtDNA analysis (Amphibia, Anura,Microhylidae). Zool. Sci. 22, 489–495.

Matsui, M., Shimada, T., Ota, H., Tanaka-Ueno, T., 2005b. Multiple invasions of theRyukyu Archipelago by Oriental frogs of the subgenus Odorrana withphylogenetic reassessment of the related subgenera of the genus Rana. Mol.Phylogenet. Evol. 37, 733–742.

Matsui, M., Tominaga, A., Liu, W.-Z., Khonsue, W., Grismer, L.L., Diesmos, A.C., Das, I.,Sudin, A., Yambun, P., Yong, H.-S., Sukumaran, J., Brown, R.M., 2010.Phylogenetic relationships of Ansonia from Southeast Asia inferred frommitochondrial DNA sequences: systematic and biogeographic implications(Anura: Bufonidae). Mol. Phylogenet. Evol. 54, 561–570.

Nguyen, V.S., Ho, T.C., Nguyen, Q.T., 2009. Herpetofauna of Vietnam. EditionChimaira, Frankfurt am Main.

Nylander, J.A.A., 2004. MrModeltest v2. Program distributed by the author.Evolutionary Biology Centre, Uppsala University.


Ohler, A., Marquis, O., Swan, S., Grosjean, S., 2000. Amphibian biodiversity of HoangLien Nature Reserve (Lao Cai Province, northern Vietnam) with description oftwo new species. Herpetozoa 13, 71–87.

Ohler, A., Teynie, L.A., David, P., 2004. A green-eyed Leptobrachium (Anura:Megophryidae) from southern Laos. Raffles Bull. Zool. 52, 695–700.

Orlov, N.L., 2005. A new species of the genus Vibrissaphora Liu, 1945 (Anura:Megophryidae) from Mount Ngoc Linh (Kon Tum Province) and analysis of theextent of species overlap in the fauna of amphibians and reptiles of the north-west of Vietnam and central highlands. Russ. J. Herpetol. 12, 17–38.

Palumbi, S.R., Martin, A., Romano, S., McMillan, W.O., Stice, L., Grabowski, G., 1991.The Simple Fool’s Guide to PCR, Version 2.0. University of Hawaii, Honolulu.

Rambaut, A., Drummond, A.J., 2007. Tracer version 1.4. Available from: <http://tree.bio.ed.ac.uk/software/tracer>.

Rao, D.-Q., Wilkinson, J.A., 2008. Phylogenetic relationships of the mustache toadsinferred from mtDNA sequences. Mol. Phylogenet. Evol. 46, 61–73.

Rao, D.-Q., Wilkinson, J.A., Zhang, M.-W., 2006. A new species of the genusVibrissaphora (Anura: Megophryidae) from Yunnan Province, China.Herpetologica 62, 90–95.

Riddle, B.R., Dawson, M.N., Hadly, E.A., Hafner, D.J., Hickerson, M.J., Mantooth, S.J.,Yoder, A.D., 2008. The role of molecular genetics in sculpting the future ofintegrative biogeography. Prog. Phys. Geogr. 32, 173–202.

Roelants, K., Gower, D.J., Wilkinson, M., Loader, S.P., Biju, S.D., Guillaume, K., Moriau,L., Bossuyet, F., 2007. Global patterns of diversification in the history of modernamphibians. Proc. Natl. Acad. Sci. USA 104, 887–892.

Sengupta, S., Choudhury, N.K., Das, I., 2001. Leptobrachium smithi Matsui,Nabhitabhata and Panha, 1999 (Anura: Megophryidae), a new record forIndia. J. Bombay Nat. Hist. Soc. 98, 289–291.

Smith, M.A., 1921. New or little-known reptiles and batrachians from southernAnnam (Indo-China). Proc. Zool. Soc. Lond. 1921, 423–440.

Stuart, B.L., Sok, K., Neang, T., 2006. A collection of amphibians and reptiles fromhilly eastern Cambodia. Raffles Bull. Zool. 54, 129–155.

Swofford, D.L., 2002. PAUP�. Phylogenetic Analysis Using Parsimony (�and OtherMethods), Version 4. Sinauer Associates, Sunderland, MA.

Tanabe, A.S., 2007. Kakusan: a computer program to automate the selection of anucleotide substitution model and the configuration of a mixed model onmultilocus data. Mol. Ecol. Notes 7, 962–964.

Taylor, E.H., 1922. Additions to the herpetological fauna of the Philippine islands I.Philipp. J. Sci. 21, 161–206.

Taylor, E.H., 1962. The amphibian fauna of Thailand. Univ. Kansas Sci. Bull. 63, 265–599.

Tominaga, A., Matsui, M., Nishikawa, K., Tanabe, S., 2006. Phylogenetic relationshipsof Hynobius naevius (Amphibia: Caudata) as revealed by mitochondrial 12S and16S rRNA genes. Mol. Phylogenet. Evol. 38, 677–684.

Tougard, C., 2001. Biogeography and migration routes of large mammal faunas insoutheast Asia during the late middle Pleistocene: focus on the fossil and extantfaunas from Thailand. Palaeogeogr. Palaeoclimatol. Palaeoecol. 168, 337–358.

Voris, H.K., 2000. Maps of Pleistocene sea levels in Southeast Asia: shorelines, riversystems and time durations. J. Biogeogr. 27, 1153–1168.

Yang, D.-T. (Ed.), 1991. The Amphibian-Fauna of Yunnan. China Forestry Publ.House, Beijing.

Yang, D.-T., Rao, D. (Eds.), 2008. Amphibia and Reptilia of Yunnan. Yunnan Scienceand Technology Press, Kunming.

Zhao, E.M., Adler, K., 1993. Herpetology of China. Contr. Herpetol. 10, 1–522.Zhao, W.-L., Morgan, W.J., 1985. Uplift of Tibetan plateau. Tectonics 4, 359–369.Zheng, Y.-C., Mo, B.-H., Liu, Z.-J., Zeng, X.-M., 2004. Phylogenetic relationships of

megophryid genera (Anura: Megophryidae) based on partial sequences ofmitochondrial 16S rRNA gene. Zool. Res. 25, 205–213.

Zheng, Y.-C., Li, S.-Q., Fu, J.-Z., 2008. A phylogenetic analysis of the frog generaVibrissaphora and Leptobrachium, and the correlated evolution of nuptial spineand reversed sexual size dimorphism. Mol. Phylogenet. Evol. 46, 695–707.


http://tree.bio.ed.ac.uk/software/tracer

http://tree.bio.ed.ac.uk/software/tracer


phylogenetic relationships of megophryid frogs of the genus

Documents