planner sep 17 t: cell parts d : explain the relationships between the cell parts table of contents...
TRANSCRIPT
![Page 1: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/1.jpg)
Planner Sep 17T: Cell PartsD: Explain the relationships between the cell parts Table of Contents Date Description page #9/11 Traits Lab 42-439/13 Genetics Discussion 44-459/16 Cell Parts 46-479/17 Yarn Model 48-49
Get Out…• Agenda, folder, and notebook
DO NOW page 48- Explain why the nucleus is considered the brain of the cell.
Agenda1. Do Now2. Yarn Model 3. Yarn Questioning4. Vocabulary 5. Exit Ticket
![Page 2: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/2.jpg)
YARN MODEL OF DNA/GENES/CHROMOSOMES
![Page 3: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/3.jpg)
The yarn represents DNA.
DNA is a tiny, long, thin chemical. How does the yarn resemble DNA?
![Page 4: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/4.jpg)
If we looked closely at the DNA inside each of your cells,
it would look like a twisted ladder. Sort of like this…
Look againat the yarn.
How does the yarn remind you of DNA?
![Page 5: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/5.jpg)
Did you notice the letters in the image of DNA?
What are the four letters?
![Page 6: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/6.jpg)
These four substances
are what allow DNA to be a type of
chemical code.
![Page 7: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/7.jpg)
Putting them together, you might get something like this…
![Page 8: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/8.jpg)
You’ve seen codes before. Look at this code:
19-3-9-5-14-3-5 18-15-3-11-19
Anyone know what this code says?
![Page 9: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/9.jpg)
Decoded, it means….
Science Rocks!
(A=1, B=2, etc.)
![Page 10: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/10.jpg)
DNA carries the information (the code) that tells your cells how to make traits.
This code, for example…
ATTCGTAAACGCGAATTGCTCA GATTCGTAAACGCGAATTGCTCAG
might give you dark eyes.
![Page 11: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/11.jpg)
What are some examples of traits?
![Page 12: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/12.jpg)
Eye color
![Page 13: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/13.jpg)
Can Roll Tongue Cannot Roll Tongue
![Page 14: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/14.jpg)
![Page 15: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/15.jpg)
A section of code (DNA) that gives information for building a single trait is called a GENE.
Genes
![Page 16: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/16.jpg)
On your yarn, the different colors represent different genes. Perhaps the green section has the code for eye color.
Maybe the pink section has the code for earlobe shape.
![Page 17: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/17.jpg)
How many different genes do you have on your yarn DNA?
On real DNA you might have hundreds of genes since real
DNA is very, very long.
![Page 18: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/18.jpg)
Sometimes these long, loose strands of DNA
need to get organized.
For example, this happens before cells divide.
![Page 19: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/19.jpg)
Organized DNA is called a chromosome.
Your next task is to create a chromosome.
![Page 20: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/20.jpg)
Hold one end of the yarn DNA against the popsicle stick and carefully wind the yarn DNA
around the stick in a single layer.
![Page 21: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/21.jpg)
Now, you have a chromosome.
Are the genes still there? How do you know?
What are genes made of?
![Page 22: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/22.jpg)
How does your model compare
to this actual CHROMOSOME?
This is really a duplicated (or doubled)
chromosome.
![Page 23: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/23.jpg)
Summary Questions:
![Page 24: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/24.jpg)
What part of this model represents DNA? Genes?
![Page 25: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/25.jpg)
Compare and Contrast DNA before and after it is in a chromosome.
![Page 26: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/26.jpg)
Which do you think is easier to see in a microscope loose DNA or DNA organized into chromosomes? Why?DNA strands lying between 2 silicon pillars. 12/3/12
![Page 27: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/27.jpg)
Fact First Questions:
![Page 28: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/28.jpg)
The yarn represents DNA.
Explain how yarn and DNA are similar.
![Page 29: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/29.jpg)
The yarn colors represent genes.
How are the yarn colors and genes related?
![Page 30: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/30.jpg)
DNA is a chemical code made up of 4 substances: A, T, C, and G.
How is the DNA chemical code used?
![Page 31: Planner Sep 17 T: Cell Parts D : Explain the relationships between the cell parts Table of Contents DateDescription page # 9/11 Traits Lab 42-43 9/13 Genetics](https://reader035.vdocument.in/reader035/viewer/2022070413/5697bff41a28abf838cbd458/html5/thumbnails/31.jpg)
Chromosomes are formed when DNA gets organized.
Explain the advantages of DNA creating chromosomes.