Plasmidic Expression of nemA and yafC* Increased Resistance ofEthanologenic Escherichia coli LY180 to Nonvolatile Side Productsfrom Dilute Acid Treatment of Sugarcane Bagasse and ArtificialHydrolysate

Aiqin Shi, Huabao Zheng, Lorraine P. Yomano, Sean W. York, Keelnatham T. Shanmugam, Lonnie O. Ingram

Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida, USA

Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes thataffect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with in-hibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to re-move furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleim-ide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutationsin SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon)in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hy-drolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity),in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinasein regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydro-lysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfuraltolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as sub-strates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sug-arcane bagasse hydrolysate.

Sugars derived from lignocellulosic residues have the potentialto serve as carbohydrate substrates for microbial fermentation

into biobased products with minimal impact on food and feed(1–3). However, the deconstruction of lignocellulose and hydro-lysis to sugar monomers requires harsh treatments, such as the useof dilute mineral acids at elevated temperatures (4, 5). Inhibitoryside products, such as furfural, soluble fragments from lignin, andacetic acid, are formed during dilute acid pretreatment; thesecompounds retard growth and fermentation. The removal of in-hibitors after dilute acid pretreatment typically involves addi-tional process steps, such as fiber separation, countercurrentwashing, and overliming (6, 7), all of which increase costs. Geneticengineering of resistance into biocatalysts represents a cost-effec-tive approach for inhibitor mitigation.

Furfural is the dominant inhibitor in dilute acid hydrolysatesof lignocellulose, a dehydration product of pentose sugars (pri-marily xylose). Many resistance genes associated with furfural tol-erance have been identified for ethanologenic Escherichia coliLY180 and other strains of E. coli (8–12). Resistant derivatives ofethanologenic E. coli LY180, such as strains EMFR9 (13) andSL100 (20), have been isolated after serial transfers in AM1 min-eral salts medium containing furfural (reagent) and in AM1 min-eral salts medium containing toxic levels of sugarcane bagassehydrolysate (SCBHz), respectively. Both selections resulted inmutants that are resistant to furfural, although SL100 is also resis-tant to other compounds. Despite the progress with furfural resis-tance, little progress has been reported with other inhibitors.

Artificial hydrolysates have been produced by heating xyloseand mineral acids to provide a simpler mixture of inhibitors. As

expected, furfural, a compound that increased the toxicity ofother inhibitors in binary mixtures, was the most abundantside product and inhibitor (1). Additional reaction products inartificial hydrolysates included glycolaldehyde, formate, lac-tate, acetate, lactaldehyde, phenolics, and pseudo-lignin (15–18). Vacuum evaporation has been shown to remove furfuralfrom hemicellulose hydrolysates and to reduce, but not elimi-nate, toxicity (19–21). Toxic nonvolatile compounds remainedafter furfural evaporation. Full toxicity was regained by therestoration of furfural (19).

In this study, we identified two genes that increase resistance tothe nonvolatile compounds in dilute acid hydrolysates of sugar-cane bagasse and in artificial hydrolysates. A vacuum-treated ar-tificial hydrolysate (PX). PX was prepared by autoclaving 5% xy-lose in 1% phosphoric acid for 2 h at 140°C). Volatile constituents

Received 26 October 2015 Accepted 24 January 2016

Accepted manuscript posted online 29 January 2016

Citation Shi A, Zheng H, Yomano LP, York SW, Shanmugam KT, Ingram LO. 2016.Plasmidic expression of nemA and yafC* increased resistance of ethanologenicEscherichia coli LY180 to nonvolatile side products from dilute acid treatment ofsugarcane bagasse and artificial hydrolysate. Appl Environ Microbiol82:2137–2145. doi:10.1128/AEM.03488-15.

Editor: R. M. Kelly, North Carolina State University

Address correspondence to Lonnie O. Ingram, ingram@ufl.edu.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.03488-15.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

April 2016 Volume 82 Number 7 aem.asm.org 2137Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

were removed under a vacuum to make PXV. PXV was used as aselection agent in broth to enrich for LY180 clones with plasmidscontaining resistance genes from SL100 (22). Two beneficial re-gions of the chromosome were identified: nemR=-nemA-gloA rnt=lhr and dkgB= yafC* yafD=. Clones expressing these genes weremore resistant to a vacuum-treated sugarcane bagasse hemicel-lulose hydrolysate and an artificial hydrolysate than the parentstrain (empty-vector control).

MATERIALS AND METHODSStrains and media. Two strains of ethanologenic E. coli were used in thisstudy: LY180 (23, 24) and SL100 (14, 22, 25). SL100 is a hydrolysate-resistant derivative of LY180, selected by serial transfers for more than ayear in AM1 mineral salts medium (26) containing sugarcane bagassehydrolysate (SCBHz). Except for plasmid constructions using Luriabroth, strains were grown and maintained on either AM1 medium alone,AM1 medium mixed with an artificial hydrolysate, or AM1 mediummixed with sugarcane bagasse hydrolysate. Xylose was added as needed toprovide 5% sugars. Media were adjusted to pH 6.5 prior to inoculation(incubation at 37°C).

SL100 chromosomal library. Chromosomal DNA from SL100 waspartially digested with Sau3A1 and was ligated (2- to 8-kbp fragments)into the dephosphorylated BamHI site of pUC19. TOP10F= chemicallycompetent cells were used as the host (100 mg ampicillin liter�1). Colo-nies were pooled and were used to prepare a chromosomal library ofplasmids.

Preparation of hydrolysates. An artificial hydrolysate (PX) was pre-pared by autoclaving a mixture of xylose (50 g liter�1) and phosphoricacid (10 g liter�1) for 2 h at 140°C (Hirayama autoclave, model HA-305M;Amerex Instruments, Inc., Lafayette, CA). SCBHz was prepared using aMetso-Valmet continuous digester with a screw feeder (185°C, 7.5 min, 8kg phosphoric acid per dry tonne sugarcane bagasse, 3 tonne h�1) asdescribed previously (19). Where indicated, volatiles such as furfural wereremoved from hydrolysates by evaporation (55°C) to half the originalweight. Weight loss was replaced with distilled water, and the productswere designated PXV and SCBHzV, respectively.

Construction of pLOI5883 derivatives for gene expression. Plas-mids, strains, and primers are listed in Table 1. The coding regions (ATGto TAA) of individual genes (nemA, gloA, rnt) were amplified using SL100chromosomal DNA as a template unless specified otherwise. An artificialribosomal binding site was supplied on the primers. Amplified genes wereligated into the pLOI5883 expression vector (EcoRI to HindIII [see Fig. S1in the supplemental material]) between the Ptrc promoter and the rrnBterminator (11, 15) to construct pLOI5908 (nemA), pLOI5909 (gloA), andpLOI5910 (rnt). These three adjacent genes were also amplified togetherand ligated to construct pLOI5911 (nemA-gloA rnt). Similar plasmidswere constructed for yafC (pLOI5913), yafC* (pLOI5914), and a combi-nation of nemA and yafC* (pLOI5926). Sequences were confirmed bySanger sequencing. An inducer (10 �M isopropyl-�-D-thiogalactopyra-noside [IPTG]) was added where indicated.

Enrichment for clones conferring resistance to PXV. The SL100chromosomal library was transformed into LY180 (parent), grown over-night in 100 ml AM1 mineral salts medium (250-ml flask) with 5% xyloseand 100 �g ml�1 ampicillin (37°C, 50 rpm), and inoculated (optical den-sity at 550 nm [OD550], 0.1) into 100 ml AM1 broth with 80% (vol/vol)PXV. Although little growth was observed after 48 h, cells were harvestedby centrifugation (10 min, 2,000 � g) and were transferred to fresh AM1broth containing 80% (vol/vol) PXV. Growth was abundant after 24 h.Plasmids were extracted, transformed into LY180, and tested for resis-tance to AM1 broth with 80% (vol/vol) PXV by measuring ethanol pro-duction (see Fig. S2 in the supplemental material).

Measuring toxicity. The toxicity of hydrolysates was tested by mea-suring ethanol production in tube cultures (13- by 100-mm tubes; 4 mlbroth) containing mixtures of water, hydrolysate, and the constituents ofAM1 medium (26). Cultures were inoculated to an initial OD550 of 0.1 and

were incubated for 48 h at 37°C (13, 19). Due to color, ethanol production(determined by gas chromatography) and visual observation of cells wereused to measure fermentation and confirm growth. In some experiments,cells were harvested by centrifugation, washed twice in AM1 medium, andresuspended in AM1 medium. This removed soluble color and allowed anestimation of cell growth by turbidity. In all cases, the shapes of the OD550

curves were very similar to the ethanol measurements, indicating a close re-lationship (see Fig. S3 in the supplemental material).

Assay of NemA reductase activity. NemA reductase activity was mea-sured as the N-ethylmaleimide (NEM)-dependent oxidation of NADPH(27, 28) unless stated otherwise. For enzyme assays, cells (50 ml) grown inAM1 xylose broth containing 100 mM morpholinepropanesulfonic acid(MOPS) (pH 7) were harvested by centrifugation at an OD550 of approx-imately 1, washed twice with 10 ml of cold potassium phosphate buffer (50mM; pH 7.0), and resuspended in phosphate buffer (3 ml). After disrup-tion with 0.1-mm glass spheres for 20 s using a FastPrep-24 instrument(MP Biomedicals LLC, Santa Ana, CA, USA), cell debris was removed bycentrifugation (20 min, 14,000 � g). The soluble protein fraction was usedfor assays of NEM-dependent activity at 22°C in 50 mM potassium phos-phate (pH 7.0) with 0.2 mM NADPH, 0.1 mM NEM, cell extracts, and avacuum-treated hydrolysate (PXV or SCBHzV) as indicated. Protein wasmeasured with the bicinchoninic acid (BCA) reagent using bovine serumalbumin as a standard. Vacuum-treated hydrolysates were tested as inhib-itors of NemA activity using NEM as the electron acceptor. Vacuum-treated hydrolysates were also tested as inducers of NemA activity inLY180 and as sources of electron acceptors (without NEM) for NemAreductase using protein lysates of LY180(pLOI5908). One unit of activityis defined as the amount of enzyme that converts 1 �M NADPH toNADP� min�1.

Additional experiments were conducted to explore the potential pro-teolysis of NemA. Disrupted cell extracts were prepared from LY180grown with 5% SCBHzV (induced) and AM1 medium alone (unin-duced). Extracts were diluted 1:1 with phosphate buffer, and a mixture ofequal amounts of induced and uninduced extracts was also made. Allthree samples were incubated for 9 h at 37°C. NemA activity was measuredat time zero and at 3, 6, and 9 h. No loss of activity was observed withuninduced or induced LY180 extracts.

Expression of nemA as measured by real-time PCR. The expression ofnemA mRNA was determined by use of polA as a reference gene. RNA wasisolated as described previously (23). Message abundance was compared forthe parent strain, LY180, and the mutant strain, SL100, after growth in thepresence and absence of vacuum-treated 5% SCBHz (inducer).

Bench-scale fermentations. Hydrolysate resistance genes were ex-pressed from pLOI5883 derivatives in LY180 during bench-scale fermen-tations (19) in AM1 medium (300 ml broth) containing 20% (vol/vol)SCBHzV. The results were compared to those for controls (empty vector)grown in the same medium and in AM1 medium without a hydrolysate.Sufficient xylose and glucose were added to provide 100 g total sugarliter�1 (75 g glucose liter�1 and 25 g xylose liter�1), amounts similar tothose for the hydrolysis of cellulose and hemicellulose. Fermentationswere maintained at 37°C and pH 6.5 (by the automatic addition of 2 Mpotassium hydroxide). Mixtures were inoculated with a 24-h broth cul-ture to provide an initial OD550 of 0.10 (approximately 0.05 g [dry weightof cells] liter�1).

Analyses. Ethanol was measured as described previously (19) using anAgilent 6890N gas chromatograph equipped with flame ionization detec-tors and a 15-m HP-Plot Q Megabore column. Furfural and xylose weremeasured using an Agilent 1200 high-performance liquid chromatograph(HPLC) with an Aminex HPX-87P column. Experiments were conductedat least twice with three replicates each. Results are reported as averageswith standard deviations. Significance was inferred (P � 0.05) from atwo-tailed Student t test by use of GraphPad Prism software for compu-tations.

Shi et al.

2138 aem.asm.org April 2016 Volume 82 Number 7Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

RESULTS AND DISCUSSIONVacuum treatment removed furfural and decreased the toxicityof an artificial hydrolysate. Previous studies have shown that xy-lose can be heated in dilute sulfuric acid to produce an artificialhydrolysate (17). However, the Florida process (25) for lignocel-lulose fermentation uses phosphoric acid pretreatment instead ofsulfuric acid to avoid the need for exotic metallurgy. We con-firmed that a similar brown, toxic artificial hydrolysate (PX) canbe made from xylose and phosphoric acid (2 h at 140°C) in theabsence of lignin and cellulose. The resulting PX contained 13.6mM furfural (Table 2). AM1 broth containing 40% (vol/vol) PXwas sufficiently toxic to completely inhibit the growth (as deter-mined by visual examination) and fermentation of the parentalstrain, LY180 (Fig. 1A). SL100, a mutant of LY180 selected forresistance to sugarcane bagasse hydrolysate (SCBHz), was alsomore resistant to PX than LY180 and required 60% (vol/vol) PXfor a similar degree of inhibition. Furfural removal by vacuum

treatment (PXV) (Table 2) reduced the toxicity of hydrolysates toboth LY180 and SL100 (Fig. 1B). Ethanol production by LY180was partially inhibited with 60% (vol/vol) PXV and fully inhibitedwith 80% (vol/vol) PXV. Ethanol production by SL100 was inhib-ited by less than one-third with 80% (vol/vol) PXV. Prior selectionfor resistance to SCBHz with SL100 also coselected for resistance

TABLE 1 Bacterial strains, plasmids, and primers

Strain, plasmid, or primer Relevant characteristic(s) or sequence Source or reference(s)

StrainsLY180 �frdBC::(frgZm celYEc) �ldhA::(frgZm casABKo) adhE::(frgZm estZPp FRT) �ackA::FRT

rrlE::(pdc adhA adhB FRT) �mgsA::FRT23

SL100 LY180 improved for hydrolysate tolerance 22TOP10F= F=[lacIqTn10 (Tetr)] mcrA �(mrr-hsdRMS-mcrBC) �80lacZ�M15 �lacX74 recA1 araD139

�(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG �

Invitrogen (Carlsbad, CA)

PlasmidspUC19 bla lacZ ori New England BiolabspLOI5883 lacIq Ptrc rrnB terminator bla RSF1010 11, 19pLOI5905 Plasmid from library selection strain AQ23 This studypLOI5906 Plasmid from library selection strain AQ35 This studypLOI5907 Plasmid from library selection strain AQ49 This studypLOI5908 nemA gene in pLOI5883 This studypLOI5909 gloA gene in pLOI5883 This studypLOI5910 rnt gene in pLOI5883 This studypLOI5911 nemA-gloA-rnt genes in pLOI5883 This studypLOI5912 Plasmid from library selection and in strain AQ78 This studypLOI5913 yafC gene in pLOI5883 This studypLOI5914 yafC mutant (yafC*) in pLOI5883 This studypLOI5926 nemA-yafC* in pLOI5883 This study

PrimersnemA Forward, AGTGAATTCAAGGAGATATACCATGTCATCTGAAAAACTGTATTCCCC This study

Reverse, AGTAAGCTTTTACAACGTCGGGTAATCGGTATgloA Forward, AGTGAATTCAAGGAGATATACCATGCGTCTTCTTCATACCATGC This study

Reverse, AGTAAGCTTTTAGTTGCCCAGACCGCGrnt Forward, AGTGAATTCAAGGAGATATACCATGTCCGATAACGCTCAACTTAC This study

Reverse, AGTAAGCTTATTACACCTCTTCGGCGGCnemA-gloA-rnt Forward, AGTGAATTCAAGGAGATATACCATGTCATCTGAAAAACTGTATTCCCC This study

Reverse, AGTAAGCTTATTACACCTCTTCGGCGGCnemRA upstream Forward, CATTAACGGGTCTGGTCGGT This study

Reverse, GCAGAAATTTGCGTGGCTTM13 Forward (�20), GTAAAACGACGGCCAG This study

Reverse, CAGGAAACAGCTATGACnemA sequencing Forward, AATGTGGTGTCCGGCATCA This study

Reverse, CGCACGTCTGGTACTGGAAyafC and yafC* Forward, AGTGAATTCAAGGAGATATACCATGAAAGCCACGTCGGAAG This study

Reverse, AGTAAGCTTTTAAGCCTCTCTGACAGCTCC99 A sequencing Forward, GCAGGTCGTAAATCACTGC This study

Reverse, CTTCTCTCATCCGCCAAAACnemA-yafC* Forward, GGATGGAAGCTTGGCTGTTTTGGCGG This study

TABLE 2 Concentrations of xylose and furfural in artificial andsugarcane bagasse hydrolysates

Dilute acid hydrolysate

Concn (mM)

Xylose Furfural

PX 296.7 � 5.5 13.6 � 1.4PX � vacuum 296.0 � 3.2 0.0 � 0.0SCBHz 275.4 � 1.7 20.6 � 1.3SCBHz � vacuum 274.5 � 1.9 0.0 � 0.0

Genes Promote Fermentation of Sugars

April 2016 Volume 82 Number 7 aem.asm.org 2139Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

to volatile (primarily furfural) and nonvolatile inhibitors in theartificial hydrolysate (heated xylose in a phosphoric acid solu-tion). These results confirmed that SL100 is a potential source ofgenes for resistance to residual toxins in PXV.

Cloning and sequencing of genes from SL100 that increasetolerance of vacuum-treated hydrolysates. Differences in resis-tance to PXV between LY180 and SL100 provided a basis for theselection of genes conferring resistance (Fig. 1B; also see Fig. S2 inthe supplemental material). Strain LY180 was transformed with aplasmid library of SL100 chromosomal fragments, and transfor-mants were selected for growth in AM1 broth (5% xylose) con-taining sufficient PXV (80% [vol/vol]) to inhibit ethanol produc-tion and growth (by visual examination). Cells grew well after thesecond transfer and were harvested for plasmid purification.The resulting plasmids were back-transformed into LY180, di-luted, and spread on AM1 solid medium (2% xylose) with 100�g/ml ampicillin. A total of 475 clones were screened fromthree independent plasmid libraries of SL100. Each clone wastested for ethanol production in tube cultures containing 80%(vol/vol) PXV. Examples of the results of colony screening areshown in Fig. 1C. Positive clones produced 6-fold- to 10-fold-higher levels of ethanol than the control (empty pUC19 vector)and negative clones.

DNA fragments in 15 clones (those with the highest ethanoltiters) were sequenced. Many were siblings with identical frag-ments of SL100 DNA, confirming the rigor of the selection. Allclones fell into two groups (Fig. 2; see also Table S4 in the supple-mental material). Twelve clones contained a large fragment with=nemR-nemA-gloA rnt lhr= (six unique fragments plus siblings),and three contained smaller fragments with =dkgB yafC yafD= (twounique fragments plus one sibling).

Sequencing revealed that the nemR gene was incomplete in theplasmids with the large fragments and was unlikely to function.The nemA, gloA, and rnt genes were complete and did not containmutations. The nemA and gloA genes are part of the cellular de-fense system for cytoplasmic detoxification (27). The rnt gene en-codes RNase T, an exonuclease involved in trimming stable RNAsand in tRNA maturation (29–32). Although no mutations were

found in the cloned =nemRA-gloA, rnt, or lhr= region, a chromo-somal mutation in SL100 was found in the upstream regulatoryregion of nemR. This mutation was absent in LY180 and couldaffect nemRA-gloA expression (Fig. 2A). The yafC gene encodes aputative transcriptional regulator of unknown function (33). Asingle base mutation was found in the C terminus of the yafCcoding region (D275G), designated yafC* (Fig. 2B) (present inSL100). This mutation (D275G) could alter the function of YafCand the expression of regulated genes.

Testing subclones with single genes related to hydrolysatetolerance. Each of the genes in the large nemA fragment (=nemR-

FIG 1 Effect of vacuum evaporation on the toxicity of an artificial hydrolysate (PX) containing 50 g liter�1 xylose and 10 g liter�1 phosphoric acid (2 h at 140°C).(A) Toxicity to LY180 (parent) and SL100 (mutant selected for resistance to sugarcane bagasse hydrolysate) of PX without a vacuum treatment to removevolatiles. ETOH, ethanol. (B) Toxicity after vacuum treatment. (C) Example of results of screening for LY180 clones harboring pUC19 derivatives that expressSL100 genes and confer resistance to an 80% (vol/vol) vacuum-treated artificial hydrolysate (PXV) in AM1 medium. Clones with the highest ethanol productioncontained SL100 nemA genes. Clones with intermediate ethanol production contained SL100 yafC* genes.

FIG 2 Two chromosomal regions of SL100 with genes that increased resis-tance to a vacuum-treated artificial hydrolysate (PXV). The cloned fragmentsencompassing nemR= to lhr= and dkgB= to yafD= are shown between doubleforward slashes. Nucleotide mutations are shown as boxed capital letters. (A)Larger fragment with nemA. Although the cloned fragment did not containany mutations, the adjacent repressor gene (nemR) contained a mutation inthe upstream regulatory region. This mutation was present in strain SL100 andabsent in strain LY180. The nemR mutation could affect the expression ofnemA and other downstream genes. (B) Smaller fragment with yafC*. Thesmaller fragments contained a single nucleotide mutation (boxed capital let-ters) in the carboxy-terminal region of this predicted LysR-type regulator,designated yafC*. This mutation was present in SL100 but absent in LY180 andcould affect the expression and function of many genes. Deletion of this genehas been shown to decrease survival after ionizing radiation (33).

Shi et al.

2140 aem.asm.org April 2016 Volume 82 Number 7Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

nemA-gloA rnt), yafC (LY180), and yafC* (SL100) were clonedinto expression vector pLOI5883 (see Fig. S1 in the supplementalmaterial). An artificial ribosomal binding site was supplied by theprimers used for amplification (nemA, gloA, rnt, and yafC*).SL100 served as a template for all the genes except yafC (wild typefrom LY180). Each gene was ligated into pLOI5883 (RSF1010-based expression vector) (see Fig. S1 in the supplemental material)to produce pLOI5908, pLOI5909, pLOI5910, pLOI5913, andpLOI5914, respectively (Table 1). Two combinations of geneswere also constructed (nemA-gloA rnt with intergenic regions[pLOI5911] and nemA yafC* [pLOI5926]).

Expression plasmids were transformed into LY180, and thetransformants were tested for ethanol production in AM1 me-dium containing 80% (vol/vol) PXV (Fig. 3A) and in AM1medium containing 20% (vol/vol) SCBHzV (Fig. 3B). WithAM1 containing 80% (vol/vol) PXV (without IPTG), ethanolproduction was significantly increased (P � 0.05) over that withthe empty vector (pLOI5883) by plasmids expressing nemA(pLOI5908), the 3-gene combination (pLOI5911), or the nemA-yafC* combination (pLOI5926). The addition of IPTG caused asmall but significant (P � 0.05) increase in ethanol production byLY180(pLOI5908), expressing nemA, and LY180(pLOI5911), ex-

pressing the 3-gene combination. When the transformants weretested in AM1 medium containing 20% (vol/vol) SCBHzV,ethanol production was significantly increased (P � 0.05) byplasmids expressing nemA (pLOI5908), yafC* (pLOI5914), the3-gene combination (pLOI5911), or the nemA-yafC* combina-tion (pLOI5926) over that with the empty-vector control(pLOI5883) or yafC (wild type), with or without IPTG. Theaddition of the inducer provided a small benefit for nemA con-structs but was detrimental for yafC* constructs (Fig. 3A and B).Plasmids expressing gloA, rnt, or yafC individually were of littlebenefit with 80% (vol/vol) PXV or 20% (vol/vol) SCBHzV. How-ever, plasmids expressing the 3-gene combination (pLOI5911) orthe nemA-yafC* combination (pLOI5926) were significantly bet-ter (P � 0.05) at ethanol production than the plasmid expressingnemA alone when tested with 20% (vol/vol) SCBHzV (Fig. 3B).This plasmid-mediated increase in resistance was specific for non-volatile components of hydrolysates and did not increase resis-tance to furfural (Fig. 3C). LY180 expressing nemA alone or in anycombination exhibited an increase in resistance to vacuum-treated hydrolysates (PXV and SCHzV). None of the expressionvectors increased furfural tolerance in LY180 (Fig. 3C).

Plasmids with various genes were also transformed into SL100,

FIG 3 Plasmid expression of cloned SL100 genes increased the resistance of LY180 to hydrolysates. The pLOI5883 expression vector is included as a control(empty vector). An inducer (IPTG) was added as indicated. Shown is ethanol production by LY180 constructs with 80% (vol/vol) PXV (A), 20% (vol/vol)SCBHzV (B), or 10 mM furfural (C) in AM1 medium or by SL100 constructs with 35% (vol/vol) SCBHzV in AM1 medium (D).

Genes Promote Fermentation of Sugars

April 2016 Volume 82 Number 7 aem.asm.org 2141Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

and the transformants were tested for resistance to 35% (vol/vol)SCBHzV (Fig. 3D). Although the effects were small, SL100 con-taining plasmids expressing nemA alone, gloA alone, or the 3-genecombination produced more ethanol (P � 0.05) than the vectorcontrol or SL100 containing plasmids expressing rnt alone, yafC*alone, or the combination of nemA and yafC*. It was not surpris-ing that none of the constructs with yafC* increased the resistanceof SL100 to SCBHzV, since the yafC* mutation is already presenton the SL100 chromosome. In contrast, the combination of nemAand yafC* was the most beneficial for ethanol production byLY180 in SCBHzV (Fig. 3B).

The addition of IPTG was generally beneficial for ethanol pro-duction with plasmid constructs lacking yafC or yafC*, a putativetranscriptional regulator. The addition of IPTG decreased ethanolproduction in all constructs containing yafC or yafC*. Increasingthe expression of this putative regulator appears to hinder cellularfunctions.

Vacuum-treated hydrolysates contain substrates for NemA.NemA is a versatile NADPH-dependent flavoprotein reductase(old yellow enzyme) capable of reducing a broad range of or-ganic compounds, including electrophiles (quinones, glyoxals,

trinitrotoluene) (27) and even inorganic substrates, such asnitrates and chromates (28, 34). Considering the diversity ofcompounds formed by acid treatment of xylose (17, 35), it isnot surprising that some components of PXV (Fig. 4, left) andSCBHzV (Fig. 4, center) can serve as electron acceptors forNemA/NADPH (Table 3). Although activity in LY180 was lowwith a hydrolysate as the sole source for electron acceptors, theactivity in LY180 harboring the nemA expression vector(pLOI5908) was twice that with the respective vector controls,in agreement with measurements of nemA-encoded activity.With vacuum-treated hydrolysates as potential substrates, ac-tivity plateaued or declined with increases in the concentra-tions of PXV and SCBHzV Fig. 4, left and center). These unex-pected kinetics can be attributed in part to the dual action ofhydrolysate components as both substrates for NemA and in-hibitors of NemA activity with NEM as the substrate.

Vacuum-treated hydrolysates contain inhibitors of N-ethyl-maleimide reduction by NemA. NemA activity is typicallymeasured with NEM as the electron acceptor, although thephysiological substrate for this enzyme is unknown (36, 37).The NEM-dependent activity of this enzyme was inhibited by

FIG 4 Effects of vacuum-treated hydrolysates on NemA activity. (Left and center) A vacuum-treated artificial hydrolysate (PXV) or a vacuum-treated sugarcane bagassehydrolysate (SCBHzV) can serve as a substrate for NADPH-dependent reduction by NemA (open symbols with broken lines, right axis). Vacuum-treated hydrolysatesalso inhibit N-ethylmaleimide reduction by NemA (filled symbols with solid lines, left axes). (Right) Induction of NemA activity (with NEM as the electron acceptor).Shown is the activity induced in LY180 and SL100 during growth in AM1 medium alone (control), with vacuum-treated PX, and with vacuum-treated SCBHz (filledbars, left axis). IPTG-induced NemA activity in LY180 harboring pLOI5908 (open bar, right axis) is also included for purposes of comparison.

TABLE 3 Hydrolysate as a substrate and an inhibitor of NemA activity in protein extracts of LY180

Hydrolysate and concn (%)

Sp act (U mg�1) of NemA in LY180 harboring the following plasmid with the indicated substrate:

nemA expression vector Empty vector

Hydrolysate NEM (0.1 mM) Hydrolysate NEM (0.1 mM)

None 0.0127 � 0.0004 1.0940 � 0.0430 0.0100 � 0.0004 �0.0020 � 0.0004

PXV6.25 0.034 � 0.006 0.438 � 0.02512.5 0.034 � 0.008 0.238 � 0.014 0.015 � 0.001 �0.004 � 0.00125 0.039 � 0.0048 0.108 � 0.014 0.016 � 0.001 �0.002 � 0.001

SCBHzV0.125 0.018 � 0.004 0.416 � 0.0360.25 0.018 � 0.003 0.281 � 0.0165 0.011 � 0.001 �0.002 � 0.0010.625 0.020 � 0.003 0.128 � 0.002 0.008 � 0.001 �0.002 � 0.0011.25 0.007 � 0.002 0.014 � 0.004

Shi et al.

2142 aem.asm.org April 2016 Volume 82 Number 7Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

the addition of the vacuum-treated hydrolysate PXV (Table 3;Fig. 4, left) or SCBHzV (Table 3; Fig. 4, center). SCBHzV was amore potent inhibitor. The addition of 1.25% (vol/vol) SCB-HzV to the reaction mixture was sufficient to inhibit 99% of theNemA activity with NEM as the substrate (1.1 U mg�1 proteinwithout an inhibitor). In contrast, the addition of 25% (vol/vol) PXV to the reaction mixture inhibited only 90% of NemAactivity. Both hydrolysates appear to contain a combination ofsubstrates and inhibitors that affect NemA activity. The dose-dependent inhibition by hydrolysates may be responsible forthe unusual kinetics observed when hydrolysates were tested assources of electron acceptors for NemA activity (Fig. 4, left andcenter).

Vacuum-treated hydrolysates as inducers of nemA activity.The nemR operon contains three genes (nemR-nemA-gloA) thatare repressed by nemR in the absence of an inducer (27). In AM1medium without an inducer, NemA activity (with NEM as theelectron acceptor) in SL100 was �20-fold higher (0.09 U/mg pro-tein) than in lysates from LY180 (parent strain), a finding consis-tent with a role for NemA in hydrolysate resistance (Fig. 4, right).NemA activity in LY180 harboring the nemA expression plasmidpLOI5908 (1.1 U mg�1) (Fig. 4, right panel, right axis) was 13-foldhigher than that in SL100 (Fig. 4, right panel, left axis) and �250-fold higher than that in LY180 alone. NemA activity in LY180 wasinduced 2.5-fold and 8-fold (0.035 U) by growth in the presence of50% (vol/vol) PXV and 5% (vol/vol) SCBHzV, respectively. In

contrast, a high level of NemA activity was produced in SL100without any hydrolysate (0.09 U), increasing less than 2-fold when5% (vol/vol) SCBHzV was included during growth (Fig. 4, right).This partial derepression of nemA in SL100 is presumed to resultfrom the base mutation in the upstream regulatory region of nemRin SL100, a transcriptional regulator.

Transcriptional regulation of nemA was confirmed by measur-ing message levels (by real-time PCR) with polA as the referencegene. Induction with 5% (vol/vol) SCBHzV increased mRNA lev-els in LY180 5-fold over those in uninduced LY180. In the resistantmutant SL100, nemA mRNA was �200-fold more abundant thanin the parent strain.

Potential regulation by proteinases was also investigated. Dis-rupted cell extracts were prepared from LY180 grown with 5%SCBHzV (induced) or in AM1 medium alone (uninduced). Ex-tracts were diluted 1:1 with phosphate buffer, and a mixture ofequal amounts of induced and uninduced extracts was also made.All three samples were incubated for 9 h at 37°C. NemA activitywas measured at time zero and at 3, 6, and 9 h. No loss of NemAactivity was observed with uninduced or induced LY180 extracts,or with the mixture.

SL100 was more resistant to PXV and SCBHzV than the parentstrain and had higher uninduced levels of NemA activity. Expres-sion of nemA from plasmids in LY180 (the parent strain) increasedNemA activity and nemA mRNA expression and increased toler-ance to vacuum-treated hydrolysates. This effect was specific for

FIG 5 Plasmid expression of nemA and yafC* increases resistance to 20% (vol/vol) SCBHzV in AM1 medium during pH-controlled fermentation. Glucose andxylose were added to adjust the sugar concentration to 100 g liter�1. An empty vector (pLOI5883) in AM1 medium with or without a hydrolysate (labeled AM1)is included as a control. Fermentations were sampled for ethanol at 24-h intervals. (Top left) Total sugars; (top right) ethanol; (bottom left) glucose; (bottomright) xylose.

Genes Promote Fermentation of Sugars

April 2016 Volume 82 Number 7 aem.asm.org 2143Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

vacuum-treated hydrolysates and did not increase tolerance tofurfural. SL100 exhibited a further increase in resistance to vacu-um-treated hydrolysates when nemA and gloA genes were coex-pressed from a single plasmid, pLOI5911 (Fig. 3D).

Plasmid expression of resistance genes improved fermenta-tion performance. Plasmids containing nemA or yafC* wereexpressed individually in LY180 during batch fermentations of20% (vol/vol) SCBHzV in AM1 medium (supplemented withglucose and xylose to make 100 g total sugar liter�1). Underthese conditions, the maximum rate of ethanol productionwith LY180(pLOI5883) (empty-vector control) was approxi-mately half that observed without any hydrolysate added (Fig.5, top right). Production of 30 g ethanol liter�1 required 8 dayswith a hydrolysate and the empty vector but only 2 days in AM1medium without a hydrolysate. Expression of yafC* or nemA(individually) substantially improved ethanol production, re-ducing the time required to produce 30 g ethanol liter�1 to 3days.

These two genes may be useful for engineering hydrolysateresistance into future biocatalysts for renewable products.Plasmid expression of yafC has been shown to increase survivalof ionizing radiation (32). Both genes improved the rates ofgrowth (observations of turbidity) and sugar utilization (Fig. 5,top left and bottom). With either nemA or yafC*, fermentationof glucose was complete after 3 days, but with the empty vectorcontrol, it required more than 8 days. The fermentation ofxylose was partially inhibited by the addition of a hydrolysate.In a hydrolysate medium, xylose was used concurrently withglucose but at a much lower rate. After 2 days, the rate of xyloseutilization was increased by plasmids expressing nemA oryafC*. However, fermentations failed to completely utilize xy-lose even after 8 days. Without a hydrolysate, xylose fermenta-tion was completed after 4 days. Near-theoretical yields wereobtained from both sugars.

ACKNOWLEDGMENTS

We thank the Florida Crystals Corporation for providing sugarcane ba-gasse and Novozymes for providing cellulase enzymes. We also thankP. D. Karp and the EcoCyc team for providing an excellent physiology andgenetics resource.

This work was supported by grants from the U.S. Department of Ag-riculture (2011-10006-30358 and 2012-67009-19596), the U.S. Depart-ment of Energy’s Office of International Affairs (DE-PI0000031), BASF,the Florida Department of Agriculture and Consumer Services, and theUniversity of Florida, Institute of Food and Agricultural Sciences (IFAS).

FUNDING INFORMATIONFlorida Department of Agriculture and Consumer Services providedfunding to K. T. Shanmugam and Lonnie O. Ingram under grant numberSRD0008. U.S. Department of Agriculture (USDA) provided funding toK. T. Shanmugam and Lonnie O. Ingram under grant numbers 2011-10006-30358 and 2012-67009-19596. U.S. Department of Energy (DOE)provided funding to K. T. Shanmugam and Lonnie O. Ingram under grantnumber DE-PI0000031. BASF | BASF Corporation provided funding toK. T. Shanmugam and Lonnie O. Ingram under grant number 79278.

The funders had no role in study design, data collection and interpreta-tion, or the decision to submit the work for publication.

REFERENCES1. Zaldivar J, Martinez A, Ingram LO. 1999. Effect of selected aldehydes on

the growth and fermentation of ethanologenic Escherichia coli. Biotechnol

Bioeng 65:24 –33. http://dx.doi.org/10.1002/(SICI)1097-0290(19991005)65:1 24::AID-BIT4�3.0.CO;2-2.

2. Patel MA, Ou MS, Ingram LO, Shanmugam KT. 2005. Simultaneoussaccharification and co-fermentation of crystalline cellulose and sugar-cane bagasse hemicellulose hydrolysate to lactate by a thermotolerant ac-idophilic Bacillus sp. Biotechnol Prog 21:1453–1460. http://dx.doi.org/10.1021/bp0400339.

3. Hahn-Hägerdal B, Galbe M, Gorwa-Grauslund MF, Liden G, Zacchi G.2006. Bio-ethanol—the fuel of tomorrow from the residues of today.Trends Biotechnol 24:549 –556. http://dx.doi.org/10.1016/j.tibtech.2006.10.004.

4. Ingram LO, Lai X, Moniruzzaman M, Wood BE, York SW. 1997. Fuelethanol production from lignocellulose using genetically engineered bac-teria, p 57–73. In Saha BC, Woodward J (ed), Fuels and chemicals frombiomass. ACS Symposium Series 666. American Chemical Society Press,Washington, DC.

5. Taherzadeh MJ, Karimi K. 2007. Acid-based hydrolysis processes forethanol from lignocellulosic materials: a review. Bioresources 2:472– 499.

6. Martinez A, Rodriguez ME, York SW, Preston JF, Ingram LO. 2000.Effects of Ca(OH)2 treatments (“overliming”) on the composition andtoxicity of bagasse hemicellulose hydrolysates. Biotechnol Bioeng 69:526 –536. http://dx.doi.org/10.1002/1097-0290(20000905)69:5 526::AID-BIT7�3.0.CO;2-E.

7. Martinez A, Rodriguez ME, Wells ML, York SW, Preston JF, IngramLO. 2001. Detoxification of dilute acid hydrolysates of lignocellulose withlime. Biotechnol Prog 17:287–293. http://dx.doi.org/10.1021/bp0001720.

8. Wang X, Yomano LP, Lee JY, Sean SY, Zheng H, Mullinnix MT,Shanmugam KT, Ingram LO. 2013. Engineering furfural tolerance inEscherichia coli improves the fermentation of lignocellulosic sugars intorenewable chemicals. Proc Natl Acad Sci U S A 110:4021– 4026. http://dx.doi.org/10.1073/pnas.1217958110.

9. Glebes TY, Sandoval NR, Reeder PJ, Schilling KD, Zhang M, Gill RT. 2014.Genome-wide mapping of furfural tolerance genes in Escherichia coli. PLoSOne 9:e87540. http://dx.doi.org/10.1371/journal.pone.0087540.

10. Glebes TY, Sandoval NR, Gillis JH, Gill RT. 2015. Comparison ofgenome-wide selection strategies to identify furfural tolerance genes inEscherichia coli. Biotechnol Bioeng 112:129 –140. http://dx.doi.org/10.1002/bit.25325.

11. Sawisit A, Jantama K, Zheng HB, Yomano LP, York SW, ShanmugamKT, Ingram LO. 2015. Mutation in galP improved fermentation of mixedsugars to succinate using engineered Escherichia coli AS1600a and AM1mineral salts medium. Bioresour Technol 193:433– 441. http://dx.doi.org/10.1016/j.biortech.2015.06.108.

12. Skerker JM, Leon D, Price MN, Mar JS, Tarjan DR, Wetmore KM,Deutschbauer AM, Baumohl JK, Bauer S, Ibáñez AB, Mitchell VD, WuCH, Hu P, Hazen T, Arkin AP. 2013. Dissecting a complex chemicalstress: chemogenomic profiling of plant hydrolysates. Mol Syst Biol 9:674.http://dx.doi.org/10.1038/msb.2013.30.

13. Miller EN, Jarboe LR, Yomano LP, York SW, Shanmugam KT, IngramLO. 2009. Silencing of NADPH-dependent oxidoreductase genes (yqhDand dkgA) in furfural-resistant ethanologenic Escherichia coli. Appl Envi-ron Microbiol 75:4315– 4323. http://dx.doi.org/10.1128/AEM.00567-09.

14. Nieves IU, Geddes CC, Mullinix MT, Hoffman RW, Tong Z, Castro E,Shanmugam KT, Ingram LO. 2011. Injection of air into the headspaceimproves fermentation of phosphoric acid pretreated sugarcane bagasseby Escherichia coli MM170. Bioresour Technol 102:6959 – 6965. http://dx.doi.org/10.1016/j.biortech.2011.04.036.

15. Arfman N, Worrell V, Ingram LO. 1992. Use of the tac promoter andlacIq for the controlled expression of Zymomonas mobilis fermentativegenes in Escherichia coli and Zymomonas mobilis. J Bacteriol 174:7370 –7378.

16. Rasmussen H, Sorensen HR, Meyer AS. 2014. Formation of degradationcompounds from lignocellulosic biomass in the biorefinery: sugar reac-tion mechanisms. Carbohydr Res 385:45–57. http://dx.doi.org/10.1016/j.carres.2013.08.029.

17. Kumar R, Hu F, Sannigrahi P, Jung S, Ragauskas AJ, Wyman CE. 2013.Carbohydrate derived-pseudo-lignin can retard cellulose biological con-version. Biotechnol Bioeng 110:737–753. http://dx.doi.org/10.1002/bit.24744.

18. Karinen R, Vilonen K, Niemela M. 2011. Biorefining: heterogeneouslycatalyzed reactions of carbohydrates for the production of furfural andhydroxymethylfurfural. ChemSusChem 4:1002–1016. http://dx.doi.org/10.1002/cssc.201000375.

Shi et al.

2144 aem.asm.org April 2016 Volume 82 Number 7Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from

19. Geddes RD, Shanmugam KT, Ingram LO. 2015. Combining treatmentsto improve the fermentation of sugarcane bagasse hydrolysates by etha-nologenic Escherichia coli LY180. Bioresour Technol 189:15–22. http://dx.doi.org/10.1016/j.biortech.2015.03.141.

20. Frazer FR, McCaskey TA. 1989. Wood hydrolysate treatments for im-proved fermentation of sugars to 2,3-butanediol. Biomass 18:31– 42. http://dx.doi.org/10.1016/0144-4565(89)90079-6.

21. Curtis R, Hatt H. 1948. Equilibria in furfural-water systems under in-creased pressure and the influence of added salts upon the mutual solu-bilities of furfural and water. Aust J Sci Res 1:213–235.

22. Geddes CC, Mullinix MT, Nieves IU, Hoffman RW, Sagues WJ, YorkSW, Shanmugam KT, Erickson JE, Vermerris WE, Ingram LO. 2013.Seed train development for the fermentation of bagasse from sweet sor-ghum and sugarcane using a simplified fermentation process. BioresourTechnol 128:716 –724. http://dx.doi.org/10.1016/j.biortech.2012.09.121.

23. Miller EN, Jarboe LR, Turner PC, Pharkya P, Yomano LP, York SW,Nunn D, Shanmugam KT, Ingram LO. 2009. Furfural inhibits growth bylimiting sulfur assimilation in ethanologenic Escherichia coli strain LY180.Appl Environ Microbiol 75:6132– 6141. http://dx.doi.org/10.1128/AEM.01187-09.

24. Yomano LP, York SW, Shanmugam KT, Ingram LO. 2009. Deletion ofmethylglyoxal synthase gene (mgsA) increased sugar co-metabolism inethanol-producing Escherichia coli. Biotechnol Lett 31:1389 –1398. http://dx.doi.org/10.1007/s10529-009-0011-8.

25. Nieves IU, Geddes CC, Miller EN, Mullinnix MT, Hoffman RW, Fu Z,Ingram LO. 2011. Effect of reduced sulfur compounds on the fermenta-tion of phosphoric acid pretreated bagasse by ethanologenic Escherichiacoli. Bioresour Technol 102:5145–5152. http://dx.doi.org/10.1016/j.biortech.2011.02.008.

26. Martinez A, Grabar TB, Shanmugam KT, Yomano LP, York SW,Ingram LO. 2007. Low salt medium for lactate and ethanol production byrecombinant Escherichia coli B. Biotechnol Lett 29:397– 404. http://dx.doi.org/10.1007/s10529-006-9252-y.

27. Lee C, Shin J, Park C. 2013. Novel regulatory system nemRA-gloA forelectrophile reduction in Escherichia coli K-12. Mol Microbiol 88:395–412. http://dx.doi.org/10.1111/mmi.12192.

28. Robins KJ, Hooks DO, Rehm BH, Ackerley DF. 2013. Escherichia coliNemA is an efficient chromate reductase that can be biologically immo-

bilized to provide a cell free system for remediation of hexavalent chro-mium. PLoS One 8:e59200. http://dx.doi.org/10.1371/journal.pone.0059200.

29. Reuven NB, Deutscher MP. 1993. Multiple exoribonucleases are re-quired for the 3= processing of Escherichia coli tRNA precursors in vivo.FASEB J 7:143–148.

30. Li Z, Deutscher MP. 1995. The tRNA processing enzyme RNase T isessential for maturation of 5S RNA. Proc Natl Acad Sci U S A 92:6883–6886. http://dx.doi.org/10.1073/pnas.92.15.6883.

31. Li Z, Pandit S, Deutscher MP. 1998. 3= exoribonucleolytic trimming is acommon feature of the maturation of small, stable RNAs in Escherichiacoli. Proc Natl Acad Sci U S A 95:2856 –2861. http://dx.doi.org/10.1073/pnas.95.6.2856.

32. Li Z, Pandit S, Deutscher MP. 1999. Maturation of 23S ribosomal RNArequires the exoribonuclease RNase T. RNA 5:139 –146. http://dx.doi.org/10.1017/S1355838299981669.

33. Byrne RT, Chen SH, Wood EA, Cabot EL, Cox MM. 2014. Escherichiacoli genes and pathways involved in surviving extreme exposure to ioniz-ing radiation. J Bacteriol 196:3534 –3545. http://dx.doi.org/10.1128/JB.01589-14.

34. Williams RE, Rathbone DA, Scrutton NS, Bruce NC. 2004. Biotrans-formation of explosives by the old yellow enzyme family of flavoproteins.Appl Environ Microbiol 70:3566 –3574. http://dx.doi.org/10.1128/AEM.70.6.3566-3574.2004.

35. Antal MJ, Leesomboon T, Mok WS, Richards GN. 1991. Mechanism offormation of 2-furaldehyde from D-xylose. Carbohydr Res 217:71– 85.http://dx.doi.org/10.1016/0008-6215(91)84118-X.

36. Miura K, Tomioka Y, Suzuki H, Yonezawa M, Hishinuma T, MizugakiM. 1997. Molecular cloning of the nemA gene encoding N-ethylmaleimidereductase from Escherichia coli. Biol Pharm Bull 20:110 –112. http://dx.doi.org/10.1248/bpb.20.110.

37. Keseler IM, Mackie A, Peralta-Gil M, Santos-Zavaleta A, Gama-CastroS, Bonavides-Martinez C, Fulcher C, Huerta AM, Kothari A, Krum-menacker M, Latendresse M, Muniz-Rascado L, Ong Q, Paley S, Sch-roder I, Shearer A, Subhraveti P, Travers M, Weerasinghe D, Weiss V,Collado-Vides J, Gunsalus RP, Paulsen I, Karp PD. 2013. EcoCyc: fusingmodel organism databases with systems biology. Nucleic Acids Res 41:D605–D612. http://dx.doi.org/10.1093/nar/gks1027.

Genes Promote Fermentation of Sugars

April 2016 Volume 82 Number 7 aem.asm.org 2145Applied and Environmental Microbiology

on April 23, 2020 by guest

http://aem.asm

.org/D

ownloaded from