polymerase chain reaction (pcr) nahla bakhamis. multiple copies of specific dna sequences;...
TRANSCRIPT
![Page 1: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/1.jpg)
Polymerase Chain Reaction (PCR)
Nahla Bakhamis
![Page 2: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/2.jpg)
Multiple copies of specific DNA sequences;
‘Molecular Photocopying’
![Page 3: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/3.jpg)
Polymerase Chain Reaction
• 1983;
In vitro enzymatic amplification of specific DNA sequences from the genome (2 regions of known sequence).
As many as billion times
G A A T G G C A C C A T T T A G C
C T T A C C G T G G T A A A T C G
![Page 4: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/4.jpg)
![Page 5: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/5.jpg)
PCR Properties:
Rapid & easy.Sensitive.Robust.Widespread applications;
Bioinformatics, forensics, medicine and genetic research.
![Page 6: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/6.jpg)
PCR uses:
• Replacement of cloning.• Diagnosis of chromosomes abnormalities (QF-PCR).• Diagnosis of single gene defect.• Searching for genes and mutations.• Cancer genetics.
![Page 7: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/7.jpg)
PCR requirements:
• Known DNA seq of target region.• Primers 18-25 bases. • Thermo-stable DNA polymerase Taq-polymerase• dNTPs• Thermal cycler.
![Page 8: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/8.jpg)
Reagents for PCR reaction:
• DNA template (1-5µL).• 2 primers (1-3µL); if excess Primer-dimer - complementary to 3’ end - length 18-25 bp - CG content 45-60% Master mix:a. Taq-polymerase b. dNTPs – deoxynucleoside triphosphates. c. Buffer d. Cofactors; Mg2+, Mn2+ and potassium ions
![Page 9: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/9.jpg)
Properties of the polymerase:
• Isolated from Thermus aquaticus.• Heat stable (half-life 30min at 95c).• No proof reading function in 3’to 5’ direction.• Primer extension up to 100bases/sec.
![Page 10: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/10.jpg)
Primer-dimer:
• Results from primers annealing each other at 3’ end due to complementarybases in the primers. • Extended primers are no longeravailable to prime target forPCR. • Polymerase amplify the dimer
atcggactatcga
gctatacttatggcca
atcggactatcgatatgaataccgga
tagcctgatagctatacttatggcca
![Page 11: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/11.jpg)
Primer-dimer:
![Page 12: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/12.jpg)
Stages in PCR:
1. Denaturation: Heat to separate ds (93-95c)2. Annealing: Primers bend to complementary seq (50-70c).3. Elongation: adding of dNTPs.
![Page 13: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/13.jpg)
![Page 14: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/14.jpg)
Analysis of PCR products:
• Gel electrophoresis• Southern hyperdization• Restriction digestion• Denaturing gradient gel electrophoresis DGGE: detect 95% of mutations • Florescent PCR
![Page 15: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/15.jpg)
Analysis of PCR products:Florescent PCR:
• Primers labelled with florescent molecule at 5’end • Products detected by laser analysis system: - exact sizing of PCR products - can use more than one colour of florescent
ABI 310 Prism
![Page 16: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/16.jpg)
Problems affecting PCR:
Problem Possible reasons
No product Primer annealing?
Product of incorrect size Primer annealing else where in the genome?
Several products formed Contamination?Several annealing sites?
![Page 17: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/17.jpg)
PCR rxn inhibitors:
Proteinase K ---- digest polymerasePhenol --------- denature the polymerase
![Page 18: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/18.jpg)
Advantages of PCR:
• Uses less patient DNA• Quick results (3hrs)• Usually no radioactive materials• Precise in determining sizes of alleles• Detect point mutation• Less expensive
![Page 19: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/19.jpg)
Limitations of PCR:
• Target DNA sequence must be known• Errors of Taq-polymerase• Size limitation (CG triplet repeats)
![Page 20: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/20.jpg)
PCR based technologies:1. Multiplex PCR: 1988
• Single template or multiple template • Different Pb length, to form distinct bands.• Target seq different enough. • Save time, effort• Cross hyperdization or miss-priming
![Page 21: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/21.jpg)
2. QF-PCR; Quantitative florescent PCR
• Primers tagged with florescent label; Different colour & size (polymorphic markers). • Used to know: -If the seq is present or not -No of copies in the sample • Analysed by; automated genetic analyser.
![Page 22: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/22.jpg)
QF PCR for prenatal diagnosis:
• Detect aneuploidy 13, 18, 21 & recently X chr. • CVS or amnio• results in less than 2 days• Looking for ratio 1:1 or 2:0 (normal)• Or 1:1:1, 2:1 or 3:0 (trisomy).
![Page 23: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/23.jpg)
![Page 24: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/24.jpg)
3.q-PCR; real time PCR:
• 1996• amplified DNA is detected as the reaction progresses ‘real-time’• Uses: genotyping, mutation detection, gene expression • Instrumentation: -ABI TaqMan: 96-well Block cycler with fluorimeter. -Roche Lightcycler: Glass capillary reaction tubes, 40 cycles in 15-20 min.
![Page 25: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/25.jpg)
3.q-PCR; real time PCR:
**Compare sample by normalising control
![Page 26: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/26.jpg)
4- RT-PCR:Reverse transcriptase PCR:
• Use mRNA as a template to produce cDNA; Reverse transcriptase enzyme • cDNA is then amplified to screen possible mutations directly.
Reverse transcriptase enzymeRNA cDNA qPCR
![Page 27: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/27.jpg)
Uses of RT-PCR:
Diagnosis of genetic diseases (RNA). Gene expression Insertion of eukaryotic genes into prokaryotes Studying the genomes of viruses composed of RNA; Influenza virus A HIV
![Page 28: Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’](https://reader035.vdocument.in/reader035/viewer/2022062409/5697bfeb1a28abf838cb8096/html5/thumbnails/28.jpg)
Thank you Questions?