polymorphisms in nlrp1 gene and susceptibility to autoimmune thyroid...

Polymorphisms in NLRP1 gene and susceptibility to autoimmunethyroid disease

ASEM ALKHATEEB1, YOUSEF JARUN1, & REEMA TASHTOUSH2

1Department of Genetics and Biotechnology, Jordan University of Science and Technology, Irbid, Jordan, and 2Ibn Alnafees

Hospital, Irbid, Jordan

AbstractThe autoimmune thyroid disorders, or AITDs, comprise 2 related disorders, Graves’ disease and Hashimoto thyroiditis.In AITD, immune system produces antibodies against autothyroid antigens. The etiology of AITDs involves a complexinteraction between genetic predisposing factors and environmental triggering factors. Variations in NACHT leucine-rich repeat protein 1(NLRP1) gene a key regulator of the innate immunity have been shown to confer risk for vitiligo andseveral autoimmune diseases. In this study we hypothesize that variants in NLRP1 gene might be involved in thesusceptibility to autoimmune thyroid disease. Five single nucleotide polymorphisms (SNPs) in NLRP1 were genotypedin 207 AITD patients and 220 normal controls. We found that NLRP1 rs12150220 T allele (OR ¼ 1.273, 95% CI:0.971–1.670, p ¼ 0.040) and NLRP1 rs2670660 G allele (OR ¼ 1.264, 95% CI: 0.965–1.656, p ¼ 0.044) weresignificantly associated with AITD compared with controls. These results suggest that NLRP1 may be involved inthe pathogenesis of AITD.

Keywords: Thyroid, NLRP1, Polymorphism, Association, Gene

Introduction

Autoimmune thyroid diseases (AITDs), typically

including Hashimoto’s thyroiditis (HT) (OMIM

140300) and Graves’ disease (GD) (OMIM 275000),

are among the most common human autoimmune

diseases. Over the last few years, hundreds of genetic

polymorphisms have been reported that predispose to

multiple autoimmune diseases [1], with many shared

across various autoimmune diseases [2]. Candidate

gene studies have found links between AITDs and a

large number of immunoregulatory genes [3].

Recently, the NLRP1 gene (OMIM 606636),

previously NALP1, located on chromosome 17p13,

has been linked to vitiligo and associated auto-

immunity, including AITD [4–6]. The NLRP1 gene

encodes NLRP1 protein, a member of the nucleo-

tide oligomerization domain-like receptors (NLRs)

family. The NLRs, a group of cytoplasmic pattern

recognition receptors, nonspecifically recognize

microbial products, such as lipopolysaccharides,

thereby stimulating innate immunity. The primary

function of human NLRP1 is caspase activation,

forming a multiprotein complex known as the

inflammasome, which helps in the processing and

maturation of multiple cytokines [7,8].

Besides being associated with autoimmune vitiligo

(with other autoimmunity), variations in the NLRP1

gene have been reported to confer risk for auto-

immune Addison’s disease and type 1 diabetes [9,10],

Alzheimer Disease [11], and Celiac disease [12],

and systemic lupus erythematosus [13]. Duo to the

reported association between autoimmune thyroid

and vitiligo [14] and the suggested shared genetic

relationship between the two diseases [15], we

thought to investigate polymorphisms in NLRP1

with thyroid patients since common allelic variation

may exist in these two diseases. We analyzed 5 single

nucleotide polymorphisms around NLRP1 to deter-

mine whether it is associated with AITD.

Materials and methods

Patients and controls

A total of 207 Jordanian Arab patients, 184 (88%)

females and 23 (12%) males, diagnosed with auto-

immune thyroid disease were included in the study. All

Correspondence: Asem Alkhateeb, Department of Biotechnology and Genetics, Jordan University of Science and Technology, P. O. Box 3030,Irbid 22110, Jordan. E-mail: [email protected]

Autoimmunity, May 2013; 46(3): 215–221q Informa UK, Ltd.ISSN 0891-6934 print/1607-842X onlineDOI: 10.3109/08916934.2013.768617

Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

patients were regular patients from Ibn Al-Nafees

hospital and diagnosed by a single endocrinologist

clinician (author: Dr. Reema Tashtosh). Diagnosis was

made and confirmed by all or part of the following:

clinical findings; symptoms and signs, thyroid function

test (TFT), thyroid antibodies, thyroid scan, and

thyroid radioactive iodine uptake.

Those patients with Graves’ disease were complain-

ing from clinical symptoms and signs of thyrotoxicosis

which included but not limited to weight loss,

palpitation, sweating, heat intolerance, diarrhea, hair

losing, menstrual irregularity and Graves’ ophthalmo-

pathy. Their TFT showed suppressed thyroid stimu-

lating hormone (TSH) and elevated Triiodothyronine

(T3) hormone and/or Thyroxine (T4) hormone. The

diagnosis of Graves’ disease was confirmed by thyroid

scan which showed diffuse goiter and by radioiodine

uptake which was markedly elevated (.30%).

Those patients with Hashimoto’s thyroiditis were

complaining from clinical symptoms and signs of

hypothyroidism which included but not limited to

weight gain, cold intolerance, constipation, menstrual

irregularity, infertility, fatigue, generalized weakness

and sleepiness. Their TFT showed elevated TSH and

low T3 and T4 hormones. Thyroid antibodies against

thyroid peroxidase were extremely elevated in all

of them.

This study includes 220 control samples, 188

(85%) females and 32 (15%) males. All controls were

blood donors without any history of autoimmune

diseases from King Abdullah University Hospital and

Ibn Al-Nafees Hospital from in Irbid. The study was

approved by the institutional review board in Jordan

University of Science and Technology.

Genomic DNA extractions

Peripheral whole blood samples from participants

were collected in EDTA tubes under aseptic con-

ditions and stored at 48C after gentle mixing of tubes.

All participants’ information including gender, age,

and clinical history were taken after the participant

signed a consent form and answered the question-

naire. All DNA samples were extracted from whole

blood using Wizard genomic DNA purification kits

according to the manufacturer’s recommendations

(Promega, Madison, MA). One ml of isolated DNA

was subjected to Nanodrop (ND-1000) to check the

concentration of nucleic acid (.50 ng/ ml) and purity

(1.8–2.0) against RNA and proteins.

Genotyping NLRP1 SNPs

We studied 5 SNPs across NLRP1 gene, two promoter

region SNPs (rs8182352 and rs2670660), one in

IVS15 (rs6502867), and two in the coding sequences

(rs2301582 and rs12150220). All genotypes were

obtained by polymerase chain reaction – restriction

fragment length polymorphism (PCR-RFLP) pro-

cedure. PCR amplicons were amplified by specific

primers (Table 1) designed by primer3 software [16]

and checked using UCSC in silico PCR (human

genome browser, http://genome.ucsc.edu).

A 25-ml PCR reaction had been done by mixing

12.5 ml 2x master mix (dNTPs, MgCl2, Taq

polymerase, PCR buffer and loading and tracking

dye, and Gotaq green mix) (Promega, Madison, MA)

with 1 ml of forward and reverse primer (final

concentration 0.4 mM) and 1–2 ml of genomic DNA

(,250 ng) finally completing the total volume by

nuclease free water. The amplification reaction was

done by a thermal cycler (Applied Biosystems, USA)

using touchdown PCR program of 948C for 7 minutes,

Table 1. PCR primers used for genotyping NLRP1 SNPs.

SNP Location* Primers (F ¼ Forward, R ¼ Reverse) Amplicon Size (bp)

rs8182352 [C/T] 67.2 kb 50 F: 50AACCGTGCTGTCTCAGCATA30 269

R: 50TTTTTGTTAAGTGGTCTTTCCAGA30

rs2670660 [A/G] 31.2 kb 50 F: 50CTTGAGGATGAAAGCCGTGT30 296

R: 50TGAAAGAGCATGTTTGGGTTT30

rs650287 [C/T] IVS15 F: 50AAGCCCATCCTCTTTCCACT30 246

R: 50ACTCTCCCCTGTATCGCTCA30

rs2301582 [G/A] Exon 11 F: 50GAGCAGAAGCTGCAGACACA30 229

R: 50AGTCCCCAAAGGCTTCGTAT30

rs12150220 [T/A} Exon 3 F: 50CCTGACGTTTCATCCAGAGG30 329

R: 50GCCCCTCTACTTCAACATGG30

* Map positions derived from Human Genome sequence, build 36.3.

Table 2. RFLP enzymes and expected fragments for each allele.

SNP Enzyme Fragments generated (bp)

rs8182352 [C/T] BsaJI T: no cut

C: two fragments generated (122 þ 147)

rs2670660 [A/G] ApoI G: no cut

A: two fragments generated (262 þ 34)

rs650287 [C/T] AccI C: no cut

T: two fragments generated (124 þ 122)

rs2301582 [G/A] NspI G: no cut


rs12150220 [T/A} BseRI T: no cut


A. Alkhateeb et al.216

Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

followed by 18 cycles of 948C for 30 seconds, 668C for

30 seconds and 728C for 30 seconds, every subsequent

cycle decreasing the annealing temperature by 0.58C

then followed by 25 cycles of 948C for 30 seconds,

598C for 30 seconds and 728C for 30 seconds and final

extension of 728C for 7 minutes for all NLRP1 SNPs.

RFLP was used to determine the genotypes. Table 2

shows the restriction enzymes used for genotyping the

5 SNPs. RFLP reactions were done according to

the manufacturer protocols (New England Biolabs).

PCR amplicons and RFLP fragments were separated

on 2% agarose gels in 1X TBE buffer with ethidium

bromide (1 mg/ml) at 120 volt and visualized using a

UV transilluminator and detection system. Band sizes

were compared with a 50-bp ladder marker.

DNA sequencing

Direct sequencing of PCR-amplified fragments

was performed to confirm the RFLP detected

variants. Sequencing was performed in both directions

(forward and reverse). The purification of PCR

Table 3. Demographic comparison between AITD cases and

controls.

AITD patients Controls

Total 207 220

Hashimoto’s Thyroiditis 154

Graves’ Disease 53

Gender, n (%)

Male 23 (12%) 32 (15%)

female 184 (88%) 188 (85%)

Age (years)

Mean(^SD) 37.06 ^ 13.06 30.86 ^ 7.14

Table 4. Allelic and genotypic frequencies of NLRP1 polymorphisms in AITD cases and controls.

SNP nt position

NLRP1

region Cases Control OR (95% CI)

p-value

(a)

p-value

(b)

p-value

(c)

p-value

(d)

p-value

(e)

rs8182352 [C/T] 5,495,711 67.2 kb 50 207 220

TT 48 (0.23) 58 (0.26)

TC 108 (0.52) 112 (0.51)

CC 51 (0.25) 50 (0.23)

T (major) 204 (0.49 228 (0.52) 0.903 (0.690–1.181)

C (minor) 210 (0.51) 212 (0.48) 1.107 (0.846–1.448)

0.229 0.729 0.45 0.45 0.64

rs2670660 [A/G] 5,459,730 31.2 kb 50 207 220

GG 44 (0.21) 39 (0.18)

GA 113 (0.55) 110 (0.5)

AA 50 (0.24) 71 (0.32)

A (major) 213 (0.52) 252 (0.57) 0.790 (0.690–1.181)

G (minor) 201 (0.48) 188 (0.43) 1.264 (0.965–1.656)

0.044 0.165 0.08 0.06 0.36

rs6502876 [C/T] 5,361,052 IVS15 207 220

TT 103 (0.50) 95 (0.43)

TC 86 (0.42) 105 (0.48)

CC 18 (0.08) 20 (0.09)

T (major) 292 (0.70) 295 (0.67) 1.176 (0.88–1.572)

C (minor) 122 (0.30) 145 (0.33) 0.850 (0.635–1.136)

0.423 0.382 0.26 0.17 0.89

rs2301582 [G/A] 5,376,987 Exon 11 207 220

GG 107 (0.52) 128 (0.58)

GA 84 (0.41) 78 (0.35)

AA 16 (0.07) 14 (0.07)

G (major) 298 (0.72) 334 (0.76) 0.815 (0.660–1.107)

A (minor) 116 (0.28) 106 (0.24) 1.226 (0.903–1.66)

0.083 0.348 0.19 0.18 0.58

rs12150220 [T/A] 5,426,091 Exon 3 207 220

TT 41 (0.20) 38 (0.17)

TA 112 (0.54) 104 (0.47)

AA 54 (0.26) 78 (0.36)

A (major) 220 (0.53) 260 (0.59) 0.785 (0.598–1.029)

T (minor) 194 (0.47) 180 (0.41) 1.273 (0.971–1.670)

0.04 0.111 0.07 0.04 0.5

OR, odds ratio. CI, confidence interval. (a) Minor Allele association p-value; (b) Overall genotype association p-value; (c) Additive model

(AA . AB . BB) association p-value; (d) Dominant model (BB, AB vs. AA) association p-value; (e) Recessive model (BB vs. AB, AA)

association p-value. A ¼ major allele, B ¼ minor allele.

NLRP1 in Autoimmune Thyroid Disease 217

Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

product and sequencing reactions were done by

Macrogen Company (Korea). The sequences were

analyzed using Bioedit software available online

(http://www.mbio.ncsu.edu/bioedit/bioedit.html).

Statistical analysis

Hardy–Weinberg equilibrium (HWE) for each locus

in patients and controls we used SVS7 software

(http://www.goldenhelix.com/SNP_Variation/index.

html) and confirmed by Haploview 4.2. Significance

differences in genotypic and allelic frequencies

between AITD patients and controls were estimated

by x2, Fisher test and odds ratio (OR) with 95%

confidence interval to identify association using SVS7

and confirmed by open epi online software (http://

www.openepi.com/). A p-value ,0.05 was considered

as an indication of statistical significance. Since 5

SNPs were analyzed, a formal Bonferroni multiple

testing correction required a significance threshold of

p ¼ 0.01. P values are presented in text without

correction. Haploview 4.2 was used to calculate

linkage disequilibrium (LD, Pairwise D’) between

NLRP1 region SNPs in AITD patients and controls.

Results

This study included 207 unrelated Jordanian Arab

AITD patients with age average 37.1 ^ 13.1 and

220 unrelated normal Jordanian Arab individuals

with age average 30.9 ^ 7.1 (Table 3). All partici-

pants came from the same northern part of Jordan.

No significant difference was found between cases

and controls with regard to gender ( p ¼ 0.15) or

age ( p ¼ 0.18).

We genotyped 5 SNPs in NLRP1 region

(rs8182352, rs2670660, rs6502867, rs2301582 and

rs12150220). All SNPs’ frequencies were in Hardy

Weinberg equilibrium. Table 4 shows allelic and

genotypic distribution for the 5 NLRP1 SNPs. All

SNPs were very common, . 24%, for minor allele

among the controls. rs2670660 and rs12150220 are

found to be associated with the AITD ( p ¼ 0.040,

p ¼ 0.044), respectively, for the high-risk allele

(minor allele). The difference was not statistically

significant after correction for multiple testing using

conservative Bonferroni adjustment. The other 3

SNPs did not show any significant association. In

addition, we found that rs12150220 shows a

significant association ( p ¼ 0.040) with the domi-

nant model (TT, TA vs. AA). A marginal association

with rs267660 is also found with the dominant

model ( p ¼ 0.06).

Figure 1 shows linkage disequilibrium (LD)

between the 5 SNPs in NLRP1 gene in AITD

patients and controls and a strong LD (.0.7) between

(rs8182352, rs2670660, rs2301582 and rs12150220)

and weak LD with rs6502867 and other SNPs which

suggests that the 4 SNPs are within one LD block.

The construction of haplotypes from this one LD

Figure 1. Pairwise D’ values for linkage disequilibrium among

NLRP1 SNPs (rs8182352, rs2670660, rs6502867, rs2301582 and

rs12150220) in all samples. Strong linkage disequilibrium showed

with darker boxes.

Table 5. Haplotype association analysis of NLRP1 variation in all AITD samples.

SNP Haplotype Frequency

Haplotype rs8182352 T/C rs 2670660 A/G rs2301582 G/A rs12150220 A/T Cases Control p-value

1 T A G A 0.26 0.31 0.11

2 C G G T 0.12 0.12 0.88

3 C G A T 0.14 0.11 0.25

4 C A G A 0.1 0.09 0.8

5 C G G A 0.05 0.06 0.82

6 T G G A 0.04 0.05 0.66

7 T A G T 0.05 0.05 0.95

8 T G G T 0.06 0.04 0.23

9 C A G T 0.04 0.04 0.7

Other rare haplotypes had an overall frequency , 0.04 and are not shown in this table.


Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

block did not reveal significant differences between

AITD patients and controls (Table 5).

We then analyzed data after stratification according

to type of AITD (Graves’ or Hashimoto). In HT

cohort (154 cases), none of the SNPs showed any

significant association. In contrast, in GD cohort (53

cases) three SNPs rs8182352, rs2301582 and

rs2670660 showed allelic association with the minor

allele ( p ¼ 0.029, p ¼ 0.013 and p ¼ 0.045), respect-

ively. rs2301582 showed genotypic association

( p ¼ 0.05) and the OR for high-risk allele 1.69

(1.07–2.66) supporting association, And there was

marginal association with rs12150220 (Data not

shown). These associations did not remain signi-

ficant after Bonferroni conservative multiple testing

correction. In addition, haplotype frequency analysis

in Grave’s cases showed significant difference in

haplotype number 1 (Table 6).

We also analyzed data after stratification accor-

ding to gender and found similar results with females

(184 cases), but no association found with males

(23 cases) (data not shown). The difference in the

age mean between the patients and the controls was

minimized by excluding controls with the lowest age to

give more matched controls. All tests were repeated

with the age matched controls. Results did not differ

suggesting no age influence in this study (data not

shown).

Discussion

AITD is the most common multifactorial thyroid

disease worldwide, especially in women. With a

genetic component that contributes up to 80% of

the disease etiology [17]. This study is an association

study between NLRP1 polymorphisms with AITD

in Jordanian Arab patients. This is the first study to

examine the candidacy of NLRP1 as a susceptibility

gene for AITD.

NLRP1 is an important player in innate immunity.

It is believed that NLRP1 acts as scaffold of

inflammosome complex activating inflammatory

cytokines and regulating apoptotic pathways [18–20].

Our results showed an association between NLRP1

variants and AITD patients from Jordan. Previously

NLRP1 showed association with vitiligo [4,5],

Addison’s disease [9,10], Type I diabetes [9], and

celiac disease [12], and systemic lupus erythematosus

[13], which may indicate a specific role of NLRP1 in

organ-specific autoimmune disease.

Our study showed that that minor allele of

rs2670660 is associated with the disease. Previously,

this SNP showed association with Vitiligo in patients

from the United Kingdom, the United States,

Romania and Jordan [4–6]. Also it was found to be

associated with Type 1 diabetes in Norwegian

population [9] and with systemic lupus erythematosus

in Brazilian population [13], but did not show any

association with Addison’s disease in Norwegian and

polish populations, neither in type 1 diabetes of polish

patients [9,10]. It is a promoter SNP with unknown

contribution to the disease, functional studies are

needed to decipher its pathogenic contribution, if any.

Allele frequency of SNP rs267660 frequency (Table 7)

shows a close range between different populations

with highest in Italy population 54% and lowest in

Jordanian population 43%.

An association was found between rs12150220, a

non-synonymous coding SNP (L155H), in exon 3 and

AITD disease, which suggested that the high-risk

allele is the (T) allele. Whereas, other studies reported

association with the A allele in vitiligo, addison’s

disease and type 1 diabetes [4,9,10]. On the other

Table 6. Haplotype association analysis of NLRP1 variation in Graves’ disease.

SNP Haplotype Frequency

Haplotype rs8182352 T/C rs 2670660 A/G rs2301582 G/A rs12150220 A/T Cases Control p-value

1 T A G A 0.21 0.31 0.04

2 C G G T 0.12 0.12 0.99

3 C G A T 0.18 0.11 0.04

4 C A G A 0.11 0.09 0.46

5 C G G A 0.05 0.06 0.83

6 T G G A 0.03 0.05 0.28

7 T A G T 0.04 0.05 0.68

8 C A G T 0.03 0.04 0.53

9 T G G T 0.06 0.04 0.36

Other rare haplotypes had an overall frequency ,0.04 and are not shown in this table.

Table 7. Minor allele Frequency of NLRP1 rs2670660 (G) and

rs12150220 (T) in different populations.

Population rs2670660 rs12150220 Reference

Italy 54 51 12

Romania 48.9 – 5

Poland 47.8 53 10

Norway 45 47 9

US and UK Caucasians 43.7 56.2 4

Jordan 43 41 Current study


Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

hand, this SNP did not show association with vitiligo

patients from Jordan [6], polish diabetic patients [21]

or Vogt-Koyanagi-Harada (VKH) disease in patients

from Japan [22]. This SNP is located between the

pyrin (PYR) and NACHT domains of NLRP1 in a

region with no known peptide motifs. A recent

functional study was done for the high-risk haplotype

tagged with allele (A) rs12150220, the results showed

that mRNA and protein expression of NLRP1 and

inflammasome function were poorly modulated but

apoptoic pathways may be dysregulated [23]. When

the (T) allele frequency was compared, we found that

the SNP is very common and varied between 56% in

USA and UK to 41% in Jordan (Table 7).

This reversed association and different allele

frequency can be explained by the “filp flop”

phenomenon, in which multilocus effects and vari-

ation in interlocus correlation may contribute to such

phenomenon that develop from the different genetic

makeup of different populations [24].

We also found two additional SNPs to be associated

with GD samples: rs8182352 which was found to be

associated with vitiligo disease [4] and rs2301582

which is a non-synonymous coding SNP (M1029 V)

in exon 11 of NLRP1.

Haplotype analysis did not show significant

difference between AITD patients and controls. The

linkage disequilibrium pattern of the participants in

this study revealed that rs6502867 had weak linkage

with other SNPs that indicate it represent indepen-

dent association signal and that other SNPs are

considered as one block tagged with rs12150220, this

agrees with previous studies [4,5,10].

These findings suggest that NLRP1 increases

susceptibility to AITD. Recently, it was reported that

apoptosis and lesion of thyroid follicular cell (cell

injury) play important role in developing AITD [25].

NLRP1 play a role in cellular apoptosis through

stimulating caspase and inflammsome complex which

activates the proinflammatory cytokine IL-1b, which

is found to be in high level in patients with vitiligo. If it

is confirmed that NLRP1 polymorphisms are causal

for disease susceptibility not just in LD with other

variants or genes, then, inhibitors of IL-1b and

caspase, transcriptional regulator and Bcl2 proteins

may be possible targets for the treatment or prevention

of ATID.

Further research is necessary to elucidate the

precise mechanisms by which these genetic factors

influence the risk of developing AITD and to

determine how they might interact with environmen-

tal susceptibility factors. Such knowledge will increase

our understanding of the molecular pathology of the

disease and may contribute to the design of novel

therapeutic strategies

Acknowledgements

We thank all participants in this study. This work was

supported by a grant (# 214/2009) from the

Deanship of research of the Jordan University of

Science and Technology.

Declaration of interest: The authors declare no

conflict of interest. The authors alone are responsible

for the content and writing of the paper.

References

[1] Cho, J. H., and P. K. Gregersen. 2011. Genomics and the

multifactorial nature of human autoimmune disease. N. Engl.

J. Med 365: 1612–1623.

[2] Cotsapas, C., B. F. Voight, E. Rossin, et al. 2011. Pervasive

sharing of genetic effects in autoimmune disease. PLoS Genet

7(8): e1002254.

[3] Simmonds, M. J., and S. C. Gough. 2011. The search for the

genetic contribution to autoimmune thyroid disease: the never

ending story? Brief Funct. Genomics 10: 77–90.

[4] Jin, Y., C. M. Mailloux, K. Gowan, et al. 2007a. NALP1 in

vitiligo-associated multiple autoimmune disease. New Eng.

J. Med 356: 1216–1225.

[5] Jin, Y., S. A. Birlea, P. R. Fain, and R. A. Spritz. 2007b.

Genetic variations in NALP1 are associated with generalized

vitiligo in a Romanian population. J. Invest. Dermatol 127:

2558–2562.

[6] Alkhateeb, A., and F. Qarqaz. 2010. Genetic association of

NALP1 with generalized vitiligo in Jordanian Arabs. Arch.

Dermatol. Res 302: 631–634.

[7] Tschopp, J., F. Martinon, and K. Burns. 2003. NALPs: a novel

protein family involved in inflammation. Nat. Rev. Mol. Cell.

Biol 4: 95–104.

[8] Faustin, B., L. Lartigue, J. M. Bruey, et al. 2007. Reconstituted

NALP1 inflammasome reveals two-step mechanism of

caspase-1 activation. Mol. Cell 25: 713–724.

[9] Magitta, N. F., A. S. Bøe Wolff, S. Johansson, et al. 2009.

A coding polymorphism in NALP1 confers risk for auto-

immune Addison’s disease and type 1 diabetes. Genes Immun

10: 120–124.

[10] Zurawek, M., M. Fichna, D. Januszkiewicz-Lewandowska,

et al. 2010. A coding variant in NLRP1 is associated with

autoimmune Addison’s disease. Hum. Immunol 71: 530–534.

[11] Pontillo, A., E. Catamo, B. Arosio, D. Mari, and S. Crovella.

2012a. NALP1/NLRP1 Genetic variants are associated with

Alzheimer disease. Alzheimer Dis. Assoc. Disord 26(3):

277–281.

[12] Pontillo, A., A. Vendramin, E. Catamo, A. Fabris, and

S. Crovella. 2011. The Missense Variation Q705K in CIAS1/

NALP3/NLRP3 Gene and an NLRP1 haplotype are

associated with celiac disease. Am. J. Gastroenterol 106:

539–544.

[13] Pontillo, A., M. Girardelli, A. J. Kamada, et al. 2012b.

Polymorphisms in inflammasome genes are involved in the

predisposition to systemic lupus erythematosus. Autoimmu-

nity 45: 271–278.

[14] Alkhateeb, A., P. R. Fain, A. Thody, D. C. Bennett, and

R. A. Spritz. 2003. Epidemiology of vitiligo and associated

autoimmune diseases in Caucasian probands and their

families. Pigment Cell Res 16: 208–214.

[15] Spritz, R. A. 2010. Shared genetic relationships underlying

generalized vitiligo and autoimmune thyroid disease. Thyroid

20: 745–754.


Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

[16] Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for

general users and for biologist programmers. Methods Mol.

Biol 132: 365–386.

[17] Brix, T. H., K. O. Kyvik, K. Christensen, and L. Hegedus.

2001. Evidence for a major role of heredity in Graves’ disease:

a population- based study of two Danish twin cohorts. J. Clin.

Endocrinol. Metab 86: 930–934.

[18] Kummer, J. A., R. Broekhuizen, H. Everett, et al. 2007.

Inflammasome components NALP 1 and 3 show distinct but

separate expression profiles in human tissues, suggesting a site-

specific role in the inflammatory response. J. Histochem.

Cytochem 55: 443–452.

[19] Macaluso, F., M. Nothnagel, Q. Parwez, et al. 2007.

Polymorphisms in NACHT-LRR (NLR) genes in atopic

dermatitis. Exp. Dermatol 16: 692–698.

[20] Martinon, F., O. Gaide, V. Petrilli, A. Mayor, and J. Tschopp.

2007. NALP1 Inflammasomes: a central role in innate

immunity. Semin. Immunopathol 29: 213–229.

[21] Zurawek, M., M. Fichna, P. Fichna, D. Januszkiewicz, and

J. Nowak. 2011. No evidence for association of the

polymorphisms in NLRP1 gene with type 1 diabetes in

Poland. Diabetes Res. Clin. Pract 92: e49–51.

[22] Horie, Y., W. Saito, N. Kitaichi, et al. 2011. Evaluation

of NLRP1 gene polymorphisms in Vogt-Koyanagi-Harada

disease. Jpn. J. Ophthalmol 55: 57–61.

[23] Mailloux, C. M. 2010. Functional studies of postional

candidate genes in vitiligo and associated autoimmune

diseases, University of Colorado Health Sciences Center.

201 pages; 3416543. [Thesis].

[24] Lin, P. I., J. M. Vance, M. A. Pericak-Vance, and E. R. Martin.

2007. No gene is an island: The flip-flop phenomenon. Am.

J. Hum. Genet 80: 531–538.

[25] Kaczmarek, E., K. Lacka, D. Jarmolowska-Jurczyszyn,

A. Sidor, and P. Majewski. 2011. Changes of B and T

lymphocytes and selected apopotosis markers in Hashimoto’s

thyroiditis. J. Clin. Pathol 64: 626–630.


Aut

oim

mun

ity D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y W

ashi

ngto

n U

nive

rsity

Lib

rary

on

05/2

3/13

For

pers

onal

use

onl

y.

polymorphisms in nlrp1 gene and susceptibility to autoimmune thyroid...

Documents