poorly repaired mismatches in heteroduplex dna are hyper … · 2002. 7. 5. · pm104 pm105 pmlo6...

Copyright 0 1996 by the Genetics Society of America

Poorly Repaired Mismatches in Heteroduplex DNA are Hyper-Recombinagenic in Saccharomyces cerevisiae

P. Manivasakam," Susan M. Rosenbergt and P. J. Hastings"

*Department of Genetics, University of Alberta, Edmonton, Alberta T6G 2E9, Canada and +Department of Biochemistly, University of Alberta, Edmonton, Alberta T6G 2H7, Canada

Manuscript received January 5 , 1994 Accepted for publication November 3, 1995

ABSTRACT In yeast meiotic recombination, alleles used as genetic markers fall into two classes as regards their

fate when incorporated into heteroduplex DNA. Normal alleles are those that form heteroduplexes that are nearly always recognized and corrected by the mismatch repair system operating in meiosis. High PMS (postmeiotic segregation) alleles form heteroduplexes that are inefficiently mismatch repaired. We report that placing any of several high PMS alleles very close to normal alleles causes hyperrecombination between these markers. We propose that this hyperrecombination is caused by the high PMS allele blocking a mismatch repair tract initiated from the normal allele, thus preventing corepair of the two alleles, which would prevent formation of recombinants. The results of three point crosses involving two PMS alleles and a normal allele suggest that high PMS alleles placed between two alleles that are normally corepaired block that core pair.^

C HROMOSOMES are aligned precisely in homolo- gous recombination by basepairing a strand from

one DNA molecule with a strand from another. If genetic markers are present in this region of heteroduplex DNA, mismatches occur in the heteroduplex. In yeast meiotic recombination, most of such m i s matches are repaired by mismatch repair proteins to give homoduplex DNA (reviewed by PETES et al. 1991). Thus, normal alleles are those that are recognized effi- ciently and repaired when incorporated into a DNA heteroduplex. By contrast, high PMS (postmeiotic segregation) alleles form mismatches that are repaired poorly by the mismatch repair system. Only three sorts of high PMS allele are known in yeast: (1) G to C (or C to G) transversions can produce a poorly repaired C- C base mismatch (MUSTER-NASSAL and KOLODNER 1986; BISHOP et al. 1989; LICHTEN et al. 1990; see SCHAR and KOHLI 1993 for data from Schizosaccharomyces pombe) when present in a heteroduplex with the wild-type. (2) Palindromes (NAG et al. 1989), and (3) some deletions (WHITE et al. 1988) appear to form special heteroduplex DNA structures o r sequences that are also poorly mismatch repaired. It has been noted that when some G to C transversions are placed between 4 to 20 basepairs away from a normal allele, hyperrecombination between the transversion and normal allele is seen (MOORE et al. 1988). Results of NAG, WHITE and PETES (1989) suggested that this might also be true when a palindromic high PMS allele is used.

In this paper we report that hyperrecombination ap-

Corresponding author P. Manivasakam, Department of Molecular and Cellular Toxicology, Harvard School of Public Health, 665 Hun- tington Ave., Boston, MA 021 15. E-mail: [email protected]

Genetics 142 407-416 (February, 1996)

pears to be general property of crosses in which high PMS alleles are placed very close to normal alleles. We observe hyperrecombination using several different high PMS alleles, representing all three sorts, which we have created in the HZSl gene of Saccharomyces cereuisiae. We address the question of the molecular mechanism by which such hyperrecombination occurs. A model is proposed in which the high PMS allele blocks an other- wise long mismatch repair tract initiated by the normal allele, and thus causes hyperrecombination by preventing corepair of the two close markers (an outcome that yields nonrecombinant molecules). The model is tested further with three point crosses involving two PMS alleles and a normal allele.

MATERIALS AND METHODS

Yeast strains and culture: Haploid yeast strains are presented in Table 1. Diploid yeast strains are presented in Table 2. The sequences of various his1 mutations and their relative positions in the gene are given in Table 3. The sequences of preexisting his1 mutations are from SA\7AGE et al. (1989). Data showing that hisI-49 is a high PMS allele were given by HAS TINGS (1984). Media and basic genetic procedures such as mating, isolation and sporulation of diploids, and auxotrophic marker identification were done using standard methods (SHERMAN et al. 1982).

Random spore analysis: When sporulation was -90% complete, cells were harvested, suspended in 20% glusulase, digested for 2 hr, diluted in water and passed through a French pressure apparatus twice. Separation of ascospores was moni- tored by microscope. Appropriately diluted spore suspensions were plated on minimal and complete media to assess meiotic recombination frequencies.

Unselected tetrad dissection: Sporulated cells were ob- tained as above but then incubated in 10% glusulase, 10 min at 30°, diluted with water, streaked and then dissected onto

408 P. Manivasakam, S. M. Rosenberg and P. J. Hastings

TABLE 1

S. cereukiae haploid strains and genotypes

Haploid strain Relevant genotype" Source or reference

LZ21-IC LZ21-13c HPlO9-1C HP109-3B HP109-8D LZ244B LZ248A LZ2411 D HP119-11C HP119-88 PM5-3B HPOl7-3D HPOl7-SA LZ 10-2A LZ10-8B PM2-3B PM2-4B HP077-1D HP077-2B PM3-3D PM3-8C HP067-3A HP067-4B LZ21-1B LZ21-2A PM1-13 PM1-19 HPO19-1A HPO19-1C HP007-3B HP007-9A PM2 1

PM22

PM23

PM24

PM25 PM26 PM27 PM28 PM29 PM3 1

PM32 PM33 PM34 PM35 PM36 PM115-12D PM117-8C

MATa ura? leu2 MATa ura? horn3 arg6 trp2 leu2 MATa horn3 hisl-1 MATa hisl-1 MATa horn? hisl-1 MATa hisl-IS MATa hisl-IS MATa hisl-1S arg6 MATa hid-7 MATa hisl-7 leu2 MATa hisl-7 arg6 leu2 MATa hisl-19 MATa hid-19 MATa ura? hisl-30 trp2 MATa ura? hisl-30 MATa hisl-30 arg6 MATa horn? hisl-?O MATa urn? hisl-40 MATa ura? hisl-40 MATa ura3 hisl-40 arg6 MATa horn? hisl-4- MATa hisl-42 MATa hisl-42 MATa horn? hisl-40 arg6 trp2 leu2 MATa ura3 hisl-40 leu2 MATa hisl-49 arg6 MATa ura? horn? hisl-49 arg6 trp2 leu2 MATa hisl-51 MATa hisl-51 MATa hisl-315 leu2 MATa hisl-315 trp2 MATa ura3 horn3 hisl::URA?-Sal1 argd trp2 leu2 (HISl disruption at SalI site in

MATa ura? horn3 hisl::URA?-EcoRV arg6 trp2 leu2 (HIS1 disruption at EcoRV site

MATa ura? horn? hisl-260 arg6 trp2 leu2 (SalI site fill-in, gene replacement

MATa ura? horn? hisl-511 arg6 trp2 leu2 (BglII site fill-in, gene replacement in

MATa ura? horn? hisl-216 arg6 trp2 leu2 (gene replacement in PM21) MATa ura? horn? hisl-258 arg6 trp2 leu2 (gene replacement in PM1-19) MATa ura3 horn? hid-662 arg6 trp2 leu2 EcoRV site in (gene replacement in PM22) MATO ura? horn3 hisl-672 arg6 trp2 leu2 EcoRV site in (gene replacement in PM22) MATa ura? horn? hisl-876 arg6 trp2 .!a12 EcoRV site in (gene replacement in PM22) MATa ura3 horn3 hisl-258::URA?-EcoRV arg6 trp2 leu2 (disruption at EcoRV site

MATa ura3 hisl-40::URA3-SalI (disruption at SalI site in HP077-2B) MATa ura? hisl-?O::URA3-SalI trp2 (disruption at SalI site in LZ10-2A) MATa ura? hisl-258 hisl-40 (gene replacement in PM32) MATa ura? hisl-258 hisl-?0 trp2 (gene replacement in PM33) MATa ura? horn3 hisl-258 hisl-672 arg6 trp2 leu2 (gene replacement in PM31) MATa hisl-216 trp2 MATa ura? hisl-672

LZ21-13C)

in LZ21-13C)

in PM21)

PM21)

in PM26)

HASTINGS (1984) HASTINGS 1984 HASTINGS lab collection HASTINGS lab collection HASTINGS lab collection HASTINGS 1984 HASTINGS 1984 HASTINGS 1984 HASTINGS lab collection HASTINGS lab collection This study HASTINGS lab collection HASTINGS lab collection SAVAGE 1979 SAVAGE 1979 This study This study HASTINGS lab collection HASTINGS lab collection This study This study HASTINGS lab collection HASTINGS lab collection HASTINGS 1984 HASTINGS 1984 This study This study HASTINGS lab collection HASTINGS lab collection HASTINGS lab collection HASTINGS lab collection This study

This study

This study

This study

This study This study This study This study This study This study

This study This study This study This study This study This study This study

"In addition to the markers listed, the following markers, which are not relevant to the work reported here, are present in the following strains and their derivatives: adel-1 in HP077-1D, HP077-2B, HP067-3A, HP067-4B, HP007 series, and HP119 series; adel-1 ade6 in HP109 series, LZ21 series, and LZl0 series.

Mismatch Repair in Recombination

TABLE 2

S. cereuisiae diploid strains and genotypes

409

Diploid strainb Haploid parents Relevant genotype"

PMlOl

PM102

PM103

PM104

PM105

PMlO6

PM107

PM108

PM109

PMllO

PM112

PMll5

PM116

PM117

PM118

PMll9

PM 120

PM121

PM122

PM123

PM124

PMl29

PM 130

PM131

PM132

PM133

PMl34

PM135

LZ21-1B LZ24-8A

HPOl7-8A LZ21-1B

LZ21-1B HP067-3A LZ21-1B LZ 10-2A LZ21-1B

HPOl9-1A LZ21-1B

HP077-1D LZ21-1B

HP119-8B LZ21-1B

HP007-9A LZ21-2A

PM23 LZ21-2A

PM24 LZ21-24

PM27 LZ21-IC

PM25 LZ21-1c

PM27 LZ21-1c

PM28 LZ21-IC

PM29 LZ21-1c

PM27 HPlO9-IC

PM1-13 HPlO9-1C PM33D PM53B

HP109-8D HPlO9-IC

PM23 PM2-3B

HP109-8D HP109-3B

PM24 HP109-3B

PM25 LZ21-2A

PM25 LZ24-4B

PM25 HPOl7-3D

PM25 HP0674B

PM25 LZ10-8B

PM25

Mata horn3 hisl-49 arg6 trp2 leu2 Mata HOM3 hid-1S ARG6 TRP2 LEU2

M a h horn3 hid-49 arg6 trp2 leu2

Mata hom3 hid-49 arg6 hp2 leu2

Mata URA3 horn3 hid-49 arp5 tM2 leu2

~

Ma& HOM3 hisl-19 ARM TRP2 LEU2

Mata HOM3 hid-42 ARM TRPZ LEU2

Mata ura3 HOM3 hid-30 ARG6 TRP2 LEU2 Mata horn3 hisl-49 arg6 trp2 leu2

Mata HOM3 hisl-51 ARG6 TRPZ LEU2 Mata URA3 horn3 h id-49 ard tnb2 leu2

Mata ura3 HOM3 his140 ARG6 TRP2 LEU2 M a h horn3 hid-49 are6 tM2 leu2

Mata HOM3 hisl-7 ARG6 TRP2 LEU2 Mata horn3 hid-49 argd trp2 leu2

Mata HOM3 hid-315 A R M trp2 LEU2 M a h ura3 HOM3 hid-49 ARG6 TRPZ leu2

Mata ura3 horn3 hid-260 arg6 trp2 leu2 Mata ura3 HOM3 hid-49 ARG6 TRP2 leu2

Mata ura3 horn3 hid-511 ard trp2 F 2 Mata ura3 HOM3 hisl-49 AR& T R P Z leu2

Mata ura3 horn3 hisl-662 a r d tnb2 leu2 M a h ura3 HOM3 HISl ARG6OTRk2 h 2 Mata ura3 horn3 hisl-216 arg6 trp2 leu2

Mata ura3 HOM3 HISl ARG6 TRP2 leu2 M a h ura3 horn3 hid-662 aq-6 trp2 z 2

Mata ura3 HOM3 HISl AR& T h . 2 leu2 Mata ura3 horn3 hisl-672 are6 tr62 leu2

M a h ura3 HOM3 HISl ARG; T&2 leu2 Mata ura3 horn3 hid-876 arg6 trp2 g 2

Mata ura3 HOM3 HISl ARM TRP2 leu2 Mata ura3 horn3 hisl-662 arp5 trpZ leu2 - , Mata horn3 hid-1 ARG6

Mata HOM3 hisl-49 a r d M a h URA3 horn3 hisl-TARG6 Mata ura3 HOM3 hisl-40 arg6 Mata HOM3 hisl-7 are6 Mata horn3 hisl-l ARG6 Mata hom3 hisl-1 ARG6

Mata HOM3 hid-IS arg6 Mata HOM3 hisl-30 a r d Mata horn3 hisl-1 ARG6 Mata URA3 HOM3 hisl-1 ARM TRP2 leu2

Mata ura3 horn3 hisl-511 a@ trp2 leu2 Mata URA3 HOM3 hisl-1 ARG6 TRPZ leu2

Mata ura3 horn3 hid-216 arg6 hp2 F 2 M a h ura3 HOM3 hid-49 ARM TRP2 leu2

Mata ura3 horn3 hisl-216 arg6 trp2 leu2 Mata URA3 HOM3 hisl-1 ARG6 TRPZ LEU2

Mata ura3 horn3 hisl-216 arg6 trp.2 leu2 Mata URA3 HOM3 hid-1 9 ARG6 TRP2 LEU2

Mata ura3 horn3 hisl-216 arg6 trp2 leu2 Mata URA3 HOM3 hisl-42 ARG6 TRP2 LEU2

Mata ura3 horn3 hid-216 arg6 trp2 leu2 Mata ura3 HOM3 hisl-30 ARM TRP2 LEU2

Mata ura3 horn3 hid-216 arp6 h$2 leu2


TABLE 2

Continued


PM136

PM137

PM 138

PM139

PM140

PM141

PM142

PM150

PM151

PM152

PM153

PM154

PM155

PM157

PM170

PM171

PM173

PM175

PM178

PMl79

PM180

PM181

PM182

PM183

PM 184

PM185

PM186

PM187

HPO19-1C Ma& URA3 HOM3 hisl-51 ARG6 TRP2 LEU2 PM25

HPII9-11C PM25

HP007-3B PM25

HP007-2B PM25

PM115-12B PM23

PM115-12D PM24

PM115-12D PM28

HP007-2B PM28

HPOI9-IC PM28

LZ 10-8B PM28

HP119-11C PM28

HP007-3B PM28

HP109-3B PM28

LZ21-2A PM28

PM5-3B PM2-4B PM5-3B PM38B PM3-3D


Mata ura3 horn3 hisl-216 arg6 trp2 leu2 M a n URA3 HOM3 hisl-315 ARG6 TRPZ leu2

Mata ura3 horn3 hisl-216 arg6 trp2 leu2 Mata urn3 HOM3 hisl-40 ARG6 TRP2 LEU2


Ma& ura3 horn3 hisl-260 arc6 trp2 leu2 Mata URA3 HOM3 hisl-216 ARG6 TRP2 LEU2

Mata uru3 horn3 hisl-511 u r d trb2 leu2 Mata URA3 HOM3 hisl-216 AgG6 kRP2 LEU2

Mata ura3 horn3 hisl-672 arg6 t q 2 leu2 Mata ura3 HOM3 hisl-40 ARG6 TRPZ LEU2


Muta ura3 horn3 hisl-672 arg6 trp2 leu2 Mata uru3 HOM3 hisl-30 ARG6 TRP2 LEU2

Ma& ura3 horn3 hisl-672 urg6 trp2 leu2 Mata URA3 HOM3 hisl-7 ARG6 TRP2 LEU2

Ma& ura3 horn3 h i d 6 7 2 arc6 trp2 leu2 Mata URA3 HOM3 hisl-315 LRGh TRP2 leu2

Ma& uru3 horn3 hisl-672 arc6 trb2 leu2 -

Mata URA3 HOM3 hisl-1 ARGu6 T&2 leu2 Muta ura3 horn3 hisl-672 arg6 t q 2 leu2

Mata uru3 HOM3 hisl-49 ARG6 TRP2 leu2 Mata ura3 horn3 hisl-672 arc6 trp2 leu2 .- .

Mata HOM3 hisl-7 arg6 Mata horn3 hisl-30 ARG6 Mata HOM3 hisl-7 u r ~ 6

Mata horn3 hisl-40 ARG6 Mata ura3 HOM3 hisl-40 arpb

PM2-4B HP119-11C

PM24 HP067-4B

Mata URA3 horn3 hisl-30 ARG6 Mata URA3 HOM3 hisl-7 ARG6 TRP2 LEU2


PM24 HPOl7-3D

PM24 HP007-3B

HPY29 HP119-1 IC

PM29 HP007-2B

PM29 HP067-4B

PM29 LZ 1 0-8B

PM29 LZ21-2A

PM29 PM117-8C

PM29 PM115-2D

PM29

Muta ura3 horn3 hisl-511 urg6 t q 2 leu2 Mata URA3 HOM3 hisl-19 ARG6 TRP2 LEU2

Mata ura3 horn3 hisl-511 arg6 tq.2 leu2 Mata URA3 HOM3 hid-315 ARG6 TRP2 - leu2

Mats ura3 horn3 hisl-876 arg6 trp2 leu2 Mata URA3 HOM3 hisl-7 ARG6 TRP2 LEU2

Mata ura3 horn3 hisl-876 arg6 trp2 leu2 Mata ura3 HOM3 hisl-40 ARG6 TRP2 LEU2

Mata ura3 hond hisl-876 arg6 t q 2 leu2 Muta URA3 HOM3 hisl-42 ARG6 TRP2 LEU2

Mata ura3 horn3 hisl-876 arg6 trp2 leu2 Mata ura3 HOM3 hisl-30 ARG6 TRP2 LEU2

Mata ura3 hond his1476 arg6 t q 2 leu2 Muta ura3 HOM3 hisl-49 ARG6 TRP2 leu2

Ma& ura3 horn3 hisl-876 arg6 t q 2 leu2 Mota ura3 HOM3 hisl-672 A R M TRP2 LEU2

Ma& ura3 horn3 hisl-876 arg6 trp2 leu2 Mata URA3 HOM3 hisl-216 ARG6 TRP2 LEU2

Mata ura3 horn3 hisl-876 arc6 trp2 la42


TABLE 2

Continued

41 1


PM 189 HP109-3B PM29

PM27 PM 190 HP077-2B

PM191 HPO19-IC

Mata URA3 NOM3 hisl-l ARG6 TRPZ leu2 Mata ura3 horn3 hisl-876 arg6 trp2 leu2

Mata ura3 HOM3 hisl-40 ARG6 TRPZ LEU2 Ma& ura3 horn3 hid-662 arg6 trp2 leu2

Ma& URA3 NOM3 hisl-51 ARG6 TRP2 LEU2 PM27

PM192 LZlO-8B PM27

Mato ura3 horn3 hisl-662 arg6 trp2 leu2 Mata ura3 HOM3 hisl-30 ARG6 TRP2 LEU2

Ma@ ura? horn3 hisl-662 a r d trp2 leu2 PM193 HP0674B Mata URA3 NOM3 hisl-42 ARG6 TRP2 LEU2

PM27 Mato ura3 horn3 hisl-662 ared t ~ 2 leu2 PM195 HP007-3B Mata URA3 HOM3 hisl-315 &G6'TRP2 leu2

PM27 Mata ura3 horn3 hisl-662 arg6 trp2 leu2 PM200 PM34 Mata ura3 HOM3 hisl-258 hisl-40 ARG6 TRP2 LEU2 -

PM28 Mato ura3 horn3 hisl-672 arg6 trp2 1eu2 PM201 PM35 Mata ura3 HOM3 HIS1-258 hisl-30 ARG6 t q 2 LEU2

PM28 Mato ura3 horn3 hisl-672 arg6 trp2 1eu2 PM300 HP077-2B Mata ura3 HOM3 hisl-40 ARG6 TRP2 LEU2

PM36 Mata ura3 horn3 HIS1-258 his-672 arg6 trp2 leu2 PM301 LZ 10-8B Mata ura3 HOM3 his130 ARG6 TRp2 LEU2

PM36 Mato ura3 horn3 HISl-258 hisl-672 arg6 trp2 leu2

-

a In addition to the markers listed, the following markers, which are not relevant to the work reported here, are present in the following strains and their derivatives: adel-1 in HP077-1D, HP077-2B, HP067-3A, HP067- 4B, HP007 series, and HP119 series; adel-1 ade6 in HP109 series, LZ21 series, and LZlO series.

'All diploid strains were constructed for this study.

YEPD or MC plates. Plates were incubated 2-3 days at 30°, and then replica-plated to MC-his.

Transformation: Transformation was modified from the protocol of HINNEN et al. (1978). Liquid cultures (5 ml) at lo7 cells/ml in YEPD were harvested, washed in water, resu- spended in 0.5 ml volume of 0.1 M Tris-HC1, 0.01 M EDTA, and 0.1 M lithium acetate, pH 7.5. Cell suspensions (50 pl) were added to transforming DNA (0.5-5 pg) plus 5-pg carrier

DNA. PEG solution (40% PEG 4000, 0.1 M lithium acetate in TE) was added and the mixture incubated at 30" for 30 min, then 42" for 15 min followed by washing with water and plat- ing on appropriate plates.

The HISl gem Inspection of the polarity gradient of conversion in HISl (FOGEL and HURST 1967; SAVAGE 1979) and the sequences of the hisl mutations used as markers (SAVAGE et al. 1989) reveals that this gene's polarity gradient runs oppo-

TABLE 3

HISl alleles used

Allele TYPe Position Sequence Reference

hisl-49 High PMS A163-200 A 163-200 KORCH and SNOW (1973) hisl-l Normal 208 A to T KORCH and SNOW (1973) hisl-216 High PMS 216 C to G This work

hisl-260 Normal 260 +4 This work hisl-IS Normal 364 A to T KORCH and SNOW (1973)

hisl-42 Normal 499 G to T KORCH and SNOW (1973)

hisl-30 Normal 652 G to A KORCH and SNOW (1973) hisl-51 Normal 653 G to A KORCH and SNOW (1973) hisl-662 Normal 662 C to T hisl-672 High PMS 672 G to c hisl-40 Normal 683 G to A KORCH and SNOW (1973) hisl-7 Normal 798 G to T KORCH and SNOW (1973) hisl -8 76 High PMS 876 + 28 palindrome hisl-315 Normal 887 G to A KORCH and SNOW (1973)

HIS1-258" Putative high PMS 258 C to G This work

h i ~ l - 1 9 Normal 432 A to G KORCH and SNOW (1973)

hid-51 1 Normal 511 +4 This work

This work This work

This work

a HISl-258 confers HIS+ phenotype and so is not genetically scoreable for PMS.


.- L (TI Q 0,

m 13 v) 100

FIGURE 1.-Hyperrecombination between the high PMS deletion allele, hisl- 49, and a close normal allele. The allele recombined with hisl-49 is indicated on

B L

C

hid-49 indicated in parentheses. (A) Mi- Ca

tance (in basepairs) of that allele from .s g the abscissa of each graph with the dis-

E 2

.- 5s with a minimum of 200 prototrophs being a 2 scored for each cross. In both mitotic and Z G O , , ,",- meiotic recombination, hyperrecombina-

nJ 0, nJ ~7 co 0 tion is seen between the high PMS allele - 3 S % % % E 2 7 his149 and the nearby normal allele hisl- ~ r n 0 , l n l n c o c n c o C D

w c b Q a - Q $ Q Q - - ~ ~ ~

r- - r\l r- .? 1, located eight nucleotides away. Hyper- - - - - - - ,? ? & ? .E recombination is not seen with more dis- .fn y .y .y .y .? c: .y - -Ecc:ccc: .?A=.% rant normal alleles.

E ? 50- combination frequencies. Crosses and cal- totic recombination rates. (B) Meiotic re-

as described in MATERIAIS AND METHODS culation of recombination were performed o r

an. 0 25- .u_ b

---nn-nnnnh

site to the direction of transcription, being highest at the 3' end of the gene. A similar pattern has been reported in the HIS3 gene of yeast (MALONE et ul. 1992).

Construction of new alleles in the HZSZ gene: Site directed mutagenesis of the HISl gene was done using the Muta-Gene Phagemid (BIO-RAD) kit and protocol. A 1.5-kb HindIII- EcoRI fragment containing basepairs 144 to 897 (the stop codon) of the HIS1 gene was subcloned into the multi-cloning site of pTZ18 (Muta-Gene kit) from PHIS1 (E. A. SAVAGE, University of Alberta) to create plasmid pHP1. pHPl has single EcoRV, BglII, and SulI sites in HISl that are also unique in the plasmid.

The following oligonucleotide primers were used for oligonucleotide-directed mutagenesis (underlined letters indicate the mutation introduced) : 5'AAATGTGATGTTGGTATA- ACT to create hid-216, 5'CTAACGTGGACGTAGAC to create hisl-258; 5'GGTGTCATGATCGCTCAAAGG to create hisl-662; 5'GCTCAAAG~TTCGT"CA to create hisl-672;

TAATTGTCGT to create the palindromic insertion hisl-876. The sequences of these new alleles were verified by sequencing double-stranded PCR product using the sequencing protocol of MANIATIS, FRITSCH and SAMBROOK (1982) and the Sequenase kit (US. Biochemicals).

Insertions of the URA? gene into HISl were made by ligat- ing a 1.9-kb SulI-SmuI fragment from plasmid YCp50 (ROSE et al. 1987) into pHP1. YCp50 was first digested with SmuI and the SmuI blunt ends were ligated to a SulI sticky ended linker. The DNA was next digested with SulI and the resulting SulI fragment containing the URA3 gene was ligated into the pHPl unique SulI site at position 256 to produce hisl :: URA3- SulI in the plasmid designated pHP2. To create hisl :: U R . 0 EcoRV a SulI linker was inserted into the unique EcoRV site at position 858 in the hisl gene in pHP1, then a SulI fragment derived from pHP2 was ligated in. The structures of these new alleles were confirmed by restriction mapping.

hisl alleles were incorporated into the genome using a two- step gene replacement. First, the HZSI gene was disrupted by ends-out replacement (ROTHSTEIN 1983) using the SulI or EcoRV disruptions described above and selecting on MC-ura plates. The presence of URA3 in the correct location was confirmed by Southern analysis. Replacement of the hisl disruption with the prototrophic allele HISI-258 was done by ends-out replacement selecting on MGhis plates. For the other, auxotrophic hisl alleles, a fragment from each plasmid bearing a new allele was gel-purified and 2-3 pg DNA were

TTCGAAATTGAGTACTGTATGGGCCCATACTCTC-

C - C

used to transform the appropriate his::URA strain. The re- placements eliminate the URA3 gene and were therefore selected on 5-fluoro-orotic acid (5FOA) plates. Isolates from each transformation were verified to contain each introduced mutation by sequencing double-stranded PCR product using the sequencing protocol Of MANIATIS, FRITSCH and SAMBROOK (1982) and the Sequenase kit (U.S. Biochemicals).

To construct hisl double mutants, his1 single mutants were disrupted by one of the URAIinsertion fragments (as described above), that does not overlap the single mutation. The structures of these were verified by restriction analysis of PCR amplified DNA. These double mutants were then trans- formed with linear DNA containing a his1 allele used to re- place the URA3 insertion, and ura3 colonies selected on 5FOA.

The C to G transversion alleles, hisl-216 and hisl-672, and the palindromic insertion allele, hisl-876, were shown by tetrad analysis to be high PMS alleles. The C to G transversion allele HISl-258 confers HIS+ phenotype and so could not be tested genetically for high PMS. However, this allele is shown (below) to confer hyperrecombination with very close normal alleles, a phenotype that only the high PMS alleles manifest, implying that it is a high PMS allele.

Measurement of recombination rates: For each cross, five independent diploids were selected after mating and grown to form colonies of -10' cells. These were picked and grown to saturation in liquid. For mitotic recombination rates, half of the liquid was plated on MC-his and YEPD plates to measure frequencies of HZ9 recombinants and rates were calculated from the medians of the five cultures by the method of LEA and COULSON (1949). For meiotic recombination frequencies, the other half of each of the five liquid cultures was sporulated and the number of H I S ascospore colonies deter- mined as described above. For each cross, at least 200 prototrophs were selected. The recombination frequencies were normalized to the frequencies per base pair.

RESULTS AND DISCUSSION

Hyperrecombination between high PMS alleles and nearby normal alleles: In Figures 1-4 the mitotic rates and meiotic frequencies of recombination per base pair are displayed for four different high PMS alleles crossed with normal alleles at varying distances. The high PMS

Mismatch Repair in Recombination 413

alleles include a deletion, hisl-49 (Figure l), a C to G transversion, hisl-216 (Figure 2), a G to C transversion, hisl-672 (Figure 3), and a palindromic insertion, hisl- 876 (Figure 4). Hyperrecombination can be seen with all high PMS alleles when they are crossed with normal alleles located 8-20 bp away. By contrast, when close normal alleles are crossed, hyperrecombination is not seen for markers 9, 10, 12 or 21 nucleotides apart (Fig- ure 5). Hyperrecombination appears to be a general feature of high PMS alleles crossed with very close normal alleles.

A model for the mechanism of hyperrecombma- tion: Figure 6 illustrates a model for the mechanism of hyperrecombination between high PMS alleles and close normal alleles. In this model, the mechanism of mismatch repair is proposed to be bidirectional under normal circumstances (Figure 6, A-C) . For example, a mismatch created when a normal allele is included in recombinational heteroduplex with wild type (Figure 6A) would be bound by a mismatch recognition protein

.- L m

FIGURE 2.-Hyperrecombina- tion between the high PMS transversion allele, hisl-216, and a close normal allele. Experiments and presentation of data as in Figure 1. (A) Mitotic recombination rates. (B) Meiotic recombination frequencies. In both mitotic and meiotic recombination, hyperrecombination is seen between the high PMS allele hisl-216and the nearby normal allele hzsl-1, located eight

9% $ $ 2 6 g nucleotides away. Hyperrecombi- 7 C e!. e!. % % 52. % e!. nation is not seen with more dis- - . 9 T - - v c 9 m 0) 0, Q Q - 5 "PCy" Q (0 - tant normal alleles. c L L L L L & p - ?

.y .y .y .y .y .y .- - c s c c : E . ? s E . ?

..... ..... ..... ..... ..... ..... ..... .....

..... ..... ..... ..... ..... ..... ..... .... ..... .....

..... ..... ..... .... . . . . . . . . . . . . . . . . . . . . . . . . .

" h "

- 7 - m o w g f ! " e ! . $ l c u

.y .y .y .y '?

0 -

-"h Y ? ? ? ?

"

- C c c s

A

E E

or proteins similar to the Escherichia coli MutS protein (large circle, Figure 6A), which binds base mismatches as a part of the repair reaction (MODRICH 1991). MutS homologues (encoded by MSH genes) are known in yeast (REENAN and KOLODNER 1992; NEW et al. 1993; A L A N 1 et al. 1994; ROSS-MACDONALD and ROEDER 1994). It has been shown that MSH2 interacts with the products of yeast genes MLHl and PMSl which are homologs of the E. coli mutLgene (PROLLA et al. 1994a,b). The interaction of a MutS-like protein with other mismatch repair proteins (small dark circles, Figure 6A) would be necessary for excision of one DNA strand, bidirec- tionally from the mismatch (Figure 6B), leading to repair (Figure 6C). Hyperrecombination of a high PMS allele with a very close normal allele could occur because of steric blockage of the repair tract in one direction from the normal allele (Figure 6, D-F). The unre- pairable mismatch formed in heteroduplex of a high PMS marker with wild type could be bound by a MutS- like protein or another DNA binding protein (Figure

ii 2 150 n m B

h

0 cu w a h 2 E

FIGURE 3.-Hyperrecombination between the high PMS transversion allele, hisl-672, and close normal alleles. Experiments and presentation of data as in Figure 1. (A) Mitotic recombination rates. (B) Meiotic recombination frequencies. In both mitotic and meiotic recombination, hyperrecombination is seen between the high PMS allele hzsl-672 and nearby normal alleles hisl-40, at 11 bp away, hkl-51, at 19 bp away, and hisl-30, at 20 bp away, but is not seen with more distant normal alleles.

E


h

d (u (u

0 v

3 .Y r-

E

Q e,

6 D), but then not repaired. This binding could block addition of other mismatch repair proteins (small dark circles) to that side of the repair complex nucleating from the normal allele (Figure 6D), so that repair of the close normal allele could proceed only unidirectionally, in the direction away from the high PMS allele (Figure 6E) most of the time. This would cause the high PMS allele not to be corepaired with the normal allele (Figure 6, E and F). The strand of DNA that was repaired unidirectionally would thus contain recombinant information (Figure 6F, top strand: + +), which would replicate to form a recombinant duplex. The MutSlike protein(s) bound at the high PMS allele is proposed to block formation of the correct repair complex on its side of the normal allele not progression of an already formed repair complex coming at it from a distance. This would explain why high PMS alleles located far from a normal allele are usually corepaired with the normal allele (FOGEL et al. 1981; HASTINGS

1984; S C H ~ and KOHLI 1993) and why the hyperrecom-

50-

A 40-

30 -

20-

10-

h

b b m v s l-

I E

FIGURE 4.-Hyperrecombination between the palindromic high PMS allele, hid-876, and a close normal allele. Ex- periments and presentation of data as in Figure 1. (A) Mitotic recombination rates. (B) Meiotic recombination frequencies. In both mitotic and meiotic recombination, hyperrecombination is seen between the high PMS allele hid- 876 and nearby normal allele hid-315, at 11 bp away, but is not seen with more distant normal alleles.

bination reported by MOORE et al. (1988), SCHAR and KOHLI (1993) and in this paper, only occurs when the high PMS and normal alleles are very close.

It is possible that if a high PMS allele is placed very close to a normal allele, the high PMS allele would block corepair of a second, distant high PMS allele with the normal allele (Figure 7A). This blocking of corepair should occur when the close allele is between the normal allele and the distant PMS allele (Figure 7A), but not when the close PMS allele is on the opposite side of the normal allele (Figure 7B). To test this possibility, crosses were performed in which the putative high PMS allele HIS1-258 is in the distant position (Figure 7) and hisl-672 is in the close position (Figure 7) on the same chromosome. This strain was crossed with a strain carrying the normal allele hisl-40, which is located to the right of both PMS alleles (Figure 7A), 11 bp from hisl- 672. The HISI-258 hisl-672 double mutant strain was also crossed with a strain carrying the normal allele hisl- 30, which is located in between the two high PMS alleles

FIGURE 5.-Recombination rates between close and distant normal alleles. Ex- periments and presentation of data as in Figure 1. (A) Mitotic recombination rates. (B) Meiotic recombination frequencies. In both mitotic and meiotic recombination, hyperrecombination is not seen when normal alleles are recombined, even when they are very close (9, 10, 12 or 21 bp).


A D

415

lbidirectional unidirectional mismatch reDair 1

1 F 1 C

+ + + + PMS +

FK;URF 6.-A model for the mechanism of hyperrecombination between high PMS alleles and close normal alleles. Repairable mismatches created in heteroduplex of a normal allele with wild type are symbolized as opposing angles; poorly repairable mismatches created in heteroduplex of a high PMS allele with wild type are indicated by opposing hemi-circles. A MutSlike mismatch recognition and binding protein is rep resented by large circles that are either inactive for mismatch repair (lightly shaded), due to binding an poorly correctable mismatch, or are active for mismatch repair (darkly shaded), when bound to a correctable mismatch. Small dark circles represent another mismatch repair protein or proteins that must bind to activated MutS homologue for repair to occur. These other proteins are proposed to bind on either side of the activated MutS homologue (A) unless sterically hindered by a nearby high PMS allele bound by inactivated MutS homc- logue (D). Model described in text.

(Figure 7B), and 20 bp left of hisl-672. The HISI-258 allele does not confer histidine auxotrophy, so recombinants between both other pairs of his alleles can be selected as histidine prototrophs. The HISI-258 allele destroys a SalI site at position 258, and thus was scored by restriction of DNA amplified by PCR from HIS' recombinants selected after mating and selection of meiotic recombinant spores (MATERIALS AND METHODS, random spore analysis). Two out of 24 HIS' spore colonies show corepair of HISI-258 with hisl-40, whereas 16 out of 27 HIS' spore colonies showed corepair of HISI-258 with hisl-30.

FURTHER DISCUSSION

The results presented here confirm and extend results presented previously (MOORE et al. 1988; NAG et al. 1989; DETLOFF and PETES 1992; SCHAR and KOHLI 1993) indicating that hyperrecombination occurs when high PMS alleles are located between eight and 26 nucleotides away from normal alleles with which they are crossed. We have suggested a model for such hyperrecombination: that mismatch repair tracts started at the normal allele, which would usually be bidirectional, are made to be unidirectional because their extension to- wards the side close to the high PMS allele is blocked by binding of protein(s) at the poorly repaired mismatch there (Figure 6).

distant PMS ~ r m a l a l l e l e allele blocked

allele close PMS allele

HIS 1-258 hisl-672 hiSl-40

c"&- co-repair of distant PMS allele

dlslanl normal PMS allele allele

HIS 1-258 hisl-30 his1672 close PMS allele

FIGURE 7.-A prediction of the model. Symbols as in Figure 6. Described in text.

Using data from Schizosaccharomyce.~ !)ombe, SCHAR and KOHLI (1993) proposed that both long and short patch mismatch repair systems exist in yeast. They suggest that the hyperrecombination effect seen between two close markers is due to termination of long patch repair tracts before a C/C mismatch and to short patch repair at the C/C. Though more than one type of repair system may exist in yeast, such a short patch repair system should show its hyperrecombination effect irrespective of distance (reviewed by RADMAN 1988). Thus, this view does not explain a conspicuous feature of our data. Neither the model suggested here (Figure 6) nor the model of SCHAR and KOHLI (1993) explains the observation that a high PMS allele and a nearby normal allele (26 bp apart) show co-PMS in a two point cross (DET- I.OFF and PETEs 1992). Co-PMS was not investigated in either this study or that of SCHAR and KOHLI (1993). Thus it will be informative to see whether such co-PMS will be a generally applicable observation as is the hyperrecombination described here and by others.

This work was supported by grana from National Sciences and Euginering Research Council (Canada) to P,j.H. and Alberta Cancer Roard to S.M.R. and P.J.H. The manuscript was written by S.M.R. with support from the Alberta Heritage Foundation for Medical Research.

LITERATURE CITED

Alnh'l, E., R. A. G. REENAN and R. K o l . o l m l x , 1994 Interaction between mismatch repair and recombination in Snrrharomyws rmmisine. Genetics 137: 19-39,

RISIloIB, D. K.J. AN1)ERSON and R. D. Kol.ol)NF.R, 1989 Specificity of mismatch repair following transformation of Snrrhnromyres rmp- ois inp with heteroduplex plasmid DNA. Proc. Natl. Acad. Sci.

DFI'IXWF, P., and T. D. PETES, 1992 Measurements of excision repair tracts formed during meiotic recombination in the yeast Sarrhnro- myrm rmmisinp. Mol. Cell. Riol. 1 2 1805-1814.

FOC:EI., S., and D. D. HLIRST, 1967 Meiotic gene conversion in yeast tetrads and the theory of recombination. Genetics 57: 455-481.

USA 86: 3713-3717.

41 6 P. Manivasakam, S. M. Rosenberg and P. J. Hastings

FOGEL, S., R. K. MORTIMER and K. LUSNAK, 1981 Mechanisms of meiotic gene conversion, or “wanderings on a foreign strand,” pp. 289-339 in The Molecular Biology of the Yeast Saccharomyces, Life Cycle and Inheritance, edited by J. N. STRATHERN, E. W. JONES and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Ny.

HASTINGS, P. J., 1984 Measurement of restoration and conversion: its meaning for the mismatch repair hypothesis of conversion. Cold Spring Harbor Symp. Quant. Biol. 49: 23-28.

HINNEN, A., J. B. HICKS and G. R. FINK, 1978 Transformation of yeast. Proc. Natl. Acad. Sci. USA 7 5 1929-1935.

KORCH, C. T., and R. SNOW, 1973 Allelic complementation in the first gene for histidine biosynthesis in Saccharomyces cermisiue. I. Characteristics of mutants and genetic mapping of alleles. Genet- ics 7 4 287-305.

LEA, D. E., and C. A. COULSON, 1949 The distribution of numbers of mutants in bacterial populations. J. Genet. 4 9 264-285.

LIGHTEN, M., C. GOYAN, N. P. SCHULTES, D. TRECO, J. W. SZOSTAK et al., 1990 Detection of heteroduplex DNA molecules among the products of Saccharomyces cermisiue meiosis. Proc. Natl. Acad. Sci.

MALONE, R. E., S. BULLARD, S. LUNDQUIST, S. KIM and T. TARKOWSKI, 1992 A meiotic gene conversion gradient opposite to the direction of transcription. Nature 359: 154-155.

MANIATIS, T., E. F. FRITSH and J. SAMBROOK, 1982 Molecular Cloning, A Labwatoty Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Ny.

MODRICH, P., 1991 Mechanisms and biological effects of mismatch repair. Annu. Rev. Genet. 25: 229-253.

MOORE, C. W., D. M. HAMPSEY, J. F. ERNEST and F. SHERMAN, 1988 Differential mismatch repair can explain the disproportionalities between physical distances and recombination frequencies of cycl mutations in yeast. Genetics 119 21-34.

MUSTER-NASSAL, C., and R. D. KOLODNER, 1986 Mismatch correction catalyzed by cell-free extracts of Saccharomyces cermiszae. Proc. Natl. Acad. Sci. USA 83 7618-7622.

NAG, D. K., M. A. WHITE and T. D. PETES, 1989 Palindromic sequences in heteroduplex DNA inhibit mismatch repair in yeast. Nature 340 318-320.

NEW, L., K. LIU and G. F. GROUSE, 1993 The yeast gene MSH3 defines a new class of eukaryotic MutS homologs. Mol. Gen. Genet. 188: 399-404.

PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombina- tion in yeast. pp. 407-521 in The Molecular and Cellular Biology of

USA 87: 7653-7657.

the Yeast Saccharomyces, Vol. 1, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Ny.

PROLLA, T., D.-M. CHRISTIE and R. M. LISKAY, 1994a Dual require- ment in yeast mismatch repair for MLHl and PMSl, two homologs of the bacterial mutL gene. Mol. Cell. Biol. 1 4 407-415.

PROLLA, T. A., Q. PANG, E. AIANI, R. D. KOLODNER and R. M. LISKAY, 1994b MLHI, PMSl and MSH2 interaction during the initia- tion of DNA mismatch repair in yeast. Science 265: 1091-1093.

RADMAN, M., 1988 Mismatch repair and genetic recombination, pp, 169-192. in Genetic Recombination, edited by R. KUCHERLAPATI and G. R. SMITH. A m . SOC. Microbiol., Washington, D.C.

REENAN, R. A. G., and R. D. KOLODNER, 1992 Isolation and charac- terization of two Saccharomyces cermisiue genes encoding homologues of the bacterial HexA and MutS mismatch repair proteins. Genetics 132 963-973.

ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN and G. R. FINK, 1987 A Saccharomyces cermisiuegenomic bank based on a centro- merecontaining shuttle vector. Gene 60: 237-243.

ROSMACDONALD, P., and G. S. ROEDER, 1994 Mutation of ameiosis- specific mutShomolog decreases crossing over but not mismatch correction. Cell 79: 1069-1080.

ROTHSTEIN, R. J., 1983 One-step gene disruption in yeast. Methods Enzymol. 101: 202-211.

SAVAGE, E. A,, 1979 A comparative analysis of recombination at the hisl locus among five related diploid strains of Saccharomyces cerevisiae. Ph.D. Thesis, University of Alberta, Edmonton, Alberta, Canada.

SAVAGE, E. A,, P. J. HASTINGS and R. C. VON BORSTEL, 1989 DNA sequence of hisl mutants in Saccharomyca cermisiue by direct sequencing of polymerase chain reaction amplified DNA (Abstr.). Yeast Genetics and Molecular BIOI., Atlanta, 109.

S c W , P., and J. KOHLI, 1993 Marker effects of G to C transversions on intragenic recombination and mismatch repair in Schizosac- charomyces pombe. Genetics 133 825-835.

SHERMAN, F., G. R. FINK and J. B. HICKS, 1982 Methods in Yeast Genet- ics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Ny.

WHITE, J. H., J. F. DI MARTINO, R. W. ANDERSON, IL SUSAN, D. HILBERT et aZ., 1988 A DNA sequence conferring high postmeiotic segregation frequency to heterozygous deletions in Saccharomyces cere uisiue is related to sequences associated with eukaryotic recombination hotspots. Mol. Cell. Biol. 8: 1253-1258.

Communicating editor: P. J. PUKKILA

poorly repaired mismatches in heteroduplex dna are hyper … · 2002. 7. 5. · pm104 pm105 pmlo6...

Documents