population structure and intergeneric hybridization … the following supplement accompanies the...

1

The following supplement accompanies the article

Population structure and intergeneric hybridization in harbour porpoises Phocoena phocoena in British Columbia, Canada

Carla A. Crossman1,2,*, Lance G. Barrett-Lennard1,2, Eric B. Taylor1

1Department of Zoology, Biodiversity Research Centre and Beaty Biodiversity Museum, University of British Columbia, #2370-6270 University Blvd., Vancouver, British Columbia V6B 1Z4, Canada

2Cetacean Research Program, Vancouver Aquarium, PO Box 3232, Vancouver, British Columbia V6B 3X8, Canada

*Corresponding author: [email protected]

Endangered Species Research 26: 1–12 (2014)

Supplement. Additional sample information and test statistics Table S1. Phocoena phocoena, Phocoenoides dalli and hybrids. Case numbers and additional organizations associated with each sample. Samples that were identified as hybrids are identified by an asterisk. Organizations—AH: Anna Hall; AHC: Animal Health Centre; CPSMMSN: Central Puget Sound Marine Mammal Stranding Network; CR: Cetus Research and Conservation Society; CRC: Cascadia Research Collective; DFO: Department of Fisheries and Oceans (also includes BC Marine Mammal Response Network); FOS: Fisheries and Oceans Service (now DFO); LBL: Lance Barrett-Lennard; SIRS: Strawberry Isle Research Society; SJ: San Juan County Marine Mammal Stranding Network; SWDP: Stranded Whale and Dolphin Program; WDFW: Washington Department of Fish and Wildlife. Additional information on individual samples can be obtained through one of the related organizations Species DFO AHC LBL Other Case Number Other Org.

Dall's Porpoise AHC 00-3075


Dall's Porpoise AHC 04-1780 04-SJ004


Dall's Porpoise DFO 1075 AHC 03-2768 LBL 03-14 AH 03OBDM06

Dall's Porpoise DFO 2362 AHC 06-0706

Dall's Porpoise DFO 2374 AHC 06-0916

Dall's Porpoise DFO 4078


Dall's Porpoise DFO 4287 AHC 02-2110 LBL 02-18

Dall's Porpoise DFO 4631 LBL 02-19

*Dall's Porpoise DFO 4838 AHC 09-01909


Dall's Porpoise LBL 00-06 Ron Lewis 98-403 From AHC

Dall's Porpoise LBL 00-07 Ron Lewis 98-405 From AHC

Dall's Porpoise LBL 00-08 Ron Lewis 98-405, 97-05

From AHC

2

Species DFO AHC LBL Other Case Number Other Org.

Dall's Porpoise LBL 00-09 Ron Lewis 98-405, 97-10

From AHC

*Dall's Porpoise LBL 00-10 Ron Lewis 98-421 From AHC


Dall's Porpoise LBL 00-12 Ron Lewis 98-442, SWDP 97-11

From AHC

Dall's Porpoise DFO 3763 LBL 00-13 Ron Lewis 98-1468 From AHC



Dall's Porpoise AHC 02-00609 LBL 02-19



Dall's Porpoise AHC 03-02770 LBL 03-17 030WCPPF10



Dall's Porpoise DFO 3056 AHC 07-3966 LBL 07-04 FOS 3056

Dall's Porpoise DFO 2910 AHC 07-2879 LBL 07-10 CR



*Dall's Porpoise DFO 3083 AHC 09-2920 LBL 09-10 FOS 3083

Dall's Porpoise LBL 96-01 G. Ellis

Dall's Porpoise LBL 98-17A

Dall's Porpoise LBL 99-02 SIRS 99-07

*Dall's Porpoise PW 0619-1(97) P. Willis

*Dall's Porpoise SWDP 95-17 P. Willis

Dall's Porpoise SWDP 97-05 P. Willis





Harbour Porpoise AHC 00-3866



Harbour Porpoise AHC 02-3171 LBL 02-28

Harbour Porpoise AHC 03-2356 2002SJ-006



Harbour Porpoise AHC 05-03901 A-Ppunk-03-04, 1-29045B

Harbour Porpoise AHC 06-02388 060412-JST-PHPH

*Harbour Porpoise AHC 06-03282

Harbour Porpoise AHC 06-1962 06PpVicF-04

Harbour Porpoise AHC 06-3276 CRC-733


Harbour Porpoise AHC 07-2921 06Pp21NovW1-06 Vancouver

3


Aquarium


Harbour Porpoise AHC 09-01252 09-0SJ001

Harbour Porpoise DFO 5026 AHC 09-02921




Harbour Porpoise AHC 10-0515 09Pp01SepWI-02 CPSMMSN

Harbour Porpoise AHC 10-0516 09Pp02SeptWH-10 CPSMMSN



Harbour Porpoise AHC 10-4951 DFO 5733

Harbour Porpoise AHC 10-4952 DFO 5737


*Harbour Porpoise AHC 10-514 09Pp07AugSK-01


*Harbour Porpoise DFO 6507 AHC 11-1945









Harbour Porpoise AHC 11-2487 11Pp01JanWI-01











Harbour Porpoise Birch Bay 2006 B. Hanson

Harbour Porpoise CRC-711

Harbour Porpoise DFO 1071 AHC 03-00171 LBL 03-20



*Harbour Porpoise DFO 2227 AHC 05-01619


AH 05PpVICM20

Harbour Porpoise DFO 2250 AHC 05-02076 AH 05PpSSF23

4









Harbour Porpoise DFO 3406 AHC 08-03815 AH 08PpEsqM06


Harbour Porpoise DFO 3519 AHC 02-02112 LBL 02-16 AH 02PpM02

Harbour Porpoise DFO 3539 SWDP 93-46, HP93-15 SWDP

Harbour Porpoise DFO 3599A?

AHC 02-02115 LBL 02-12 AH 02PhF08

Harbour Porpoise DFO 3599B AHC 02-02115 LBL 02-33 AH 02PpF08

Harbour Porpoise DFO 3639 SWDP 94-08, HP94-01A

SWDP



Harbour Porpoise DFO 3819 SWDP 93-06, HP93-02 R. Baird


Harbour Porpoise DFO 3897 AHC 190 LBL 98-08 HP98-02B


Harbour Porpoise DFO 3916A AHC 01-03740 M0697

Harbour Porpoise DFO 3916B AHC 01-03740 M0697


Harbour Porpoise DFO 3964 AHC 01-03742 M753-2


SWDP

Harbour Porpoise DFO 3993 AHC 01-04520 AH 01JdFM20


*Harbour Porpoise DFO 4024 SWDP 93-52, HP93-13 SWDP


Harbour Porpoise DFO 4065 AHC 98-00445 SWDP 94-43, HP94-12 SWDP



Harbour Porpoise DFO 4126 AHC 03-02766 LBL 03-18 379, AH 01HSPP002




Harbour Porpoise DFO 4273 SWDP 92-50, HP92-01A, Pp92-1

DFO By-catch


R. Baird





5












Harbour Porpoise DFO 4819

Harbour Porpoise DFO 5206 AHC 09-03814 RR 09-0254



Harbour Porpoise DFO 5649 AHC 10-01948 LBL 10-12 AH 16PpRRF10, RR 10-0084


Harbour Porpoise DFO 5656 AHC 10-01952 LBL 10-16 AH 20PpVicF10




Harbour Porpoise DFO 6292 AHC 02-01779 SJ057

Harbour Porpoise DFO 6443 SWDP94-?, HP94-10, 172

SWDP

Harbour Porpoise DFO 6445 B. Hanson

Harbour Porpoise JackVA Vancouver Aquarium

Harbour Porpoise LBL 00-02 SIRS SIRS

Harbour Porpoise LBL 00-16 Ron Lewis 98-406 T. Guenther

Harbour Porpoise LBL 00-17 Ron Lewis 98-406, SWDP 97-08

T. Guenther


Harbour Porpoise DFO 4656 LBL 00-19 Ron Lewis 98-409, SWDP 94-06

From AHC


Harbour Porpoise LBL 00-21 Ron Lewis 98-411 From AHC







*Harbour Porpoise LBL 00-28 Ron Lewis 98-432 T. Guenther


Harbour Porpoise LBL 00-31 Ron Lewis 98-443, SWDP 97-13

From AHC

6


Harbour Porpoise DFO 4565 LBL 00-33 Ron Lewis 98-417 SWDP 95-27

From AHC

Harbour Porpoise LBL 02-09 SIRS



Harbour Porpoise AHC 03-02767 LBL 03-15 VICPPM05

Harbour Porpoise AHC 05-01611 LBL 05-30 05PpVicU03

Harbour Porpoise DFO 3080 AHC 07-4080 LBL 07-07 FOS 3080

Harbour Porpoise DFO 2926 AHC 07-3212 LBL 07-08 FOS 2926 Vancouver Aquarium








Harbour Porpoise DFO 3184 AHC 10-1852 LBL 10-06 John Ford




Harbour Porpoise DFO 5648 AHC 10-1947 LBL 10-11 15PpRRM10

Harbour Porpoise DFO 5650 AHC 10-1949 LBL 10-13 17PpMetM10



Harbour Porpoise DFO 5655 AHC 10-1953 LBL 10-17 21PpSKF10






*Harbour Porpoise DFO 5731 AHC 10-3824 LBL 10-23





Harbour Porpoise LBL 95-01 J. Ford

Harbour Porpoise LBL 98-08 G. Ellis

Harbour Porpoise LBL 98-09 Nitnat Fishery

Harbour Porpoise LBL 98-10



Harbour Porpoise LBL 98-14 Nitnat Fishery

Harbour Porpoise LBL 98-15 Area 12-1 test fishery

7



Harbour Porpoise LBL 98-17B Ron Lewis #97/003539

Harbour Porpoise LBL 98-19 SIRS

Harbour Porpoise SWDP 95-10 P. Willis

*Harbour Porpoise SWDP 95-13 P. Willis




Hybrid PW 51698 P. Willis

*Hybrid PW 52597 P. Willis




Hybrid PW 98-01 P. Willis

*Hybrid PW 98-03 P. Willis

Hybrid PW 98-04 P. Willis

*Hybrid PW 98-05 P. Willis

*Hybrid AHC 08-120 LBL 07-11 WDFW 1207-04

*Porpoise LBL 00-39 Ron Lewis 98-444, SWDP 97-16

T. Guenther

Porpoise AHC 02-02114 LBL 02-11 AH 02PpM06

Porpoise AHC 02-02113 LBL 02-15 AH 02PpF05

Porpoise DFO 3027(8)

AHC 07-3624 LBL 07-09 Vancouver Aquarium

Table S2. Phocoena phocoena. Sequences of forward and reverse primers from Chen & Yang (2008). Locus Np403 did not amplify and was removed from further analyses

Locus Primer Sequence (5’-3’) Np403F GGCACAGGCAGGTTGGAC Np403R GGTGTTTACGCAGGGGAG Np404F GGTCAGAACAAGAACACAG Np404R CTCCTCCTAATACAGAAATAC Np407F TATCCCATCAGCATTCCT Np407R CCAGAGAAACAGAACCAG Np409F TGGGAGAGGTATAAGTGGCT Np409R TGGATGGGTGGAAGTAGTT Np417F GGTCCCACAACTACAGAACT Np417R GGTCCTCCAGAGAAACAG Np426F GCAAGGATAAAGAGAATAGAG Np426R CTAAGCCTGGAGTGTTCAT Np427F CAGGACAGTTGTGACCAT Np427R GCTGAGGCAAAGAGAGTA Np428F CCAGAGAATCAGAACCAATAG Np428R CCAGAATCACACGAGCCT Np430F TTCAATGAGAGAGAGCAAG Np430R AGAAGCATAGTGTAGTGGTG

8

Table S3. Phocoena phocoena. Locations of 44 mtDNA haplotypes resolved by sequencing 500 base pairs of D-loop from 125 harbour porpoises. The localities ‘inside’, ‘outside’, and ‘northern’ water are shown in Fig. 1 in the main article

JX475317

JX475410

JX475415

9

Table S4. Phocoena phocoena. Coordinate data used in Geneland analysis. Coordinates are for the most accurate stranding locations available

10

Table S5. Phocoena phocoena, P. dalli. Results of 10 independent runs testing the number of putative populations (K) according to STRUCTURE, using both posterior probability (mean LnP[K]) and the Evanno et al. (2005) method (Delta K) of all samples—harbour, Dall’s, and hybrid porpoises (N = 262)

K Posterior Probability (mean LnP[K])

Delta K

1 -5482.49 2 -4604.19 284.32 3 -4558.51 3.22 4 -4533.20 2.62 5 -4578.69 1.48 6 -4539.70 0.34 7 -4524.55 0.98 8 -4572.09 0.62 9 -4563.74 0.21

10 -4575.98

Table S6. Phocoena phocoena. Nucleotide and haplotypic diversity (mean ± SD) of harbour porpoise using a 99% threshold for pure species Nucleotide Diversity Haplotypic Diversity Sample Size (n)

Three sampling groups Northern Waters 0.0100±0.0073 1.000±0.1768 4 Outer Waters 0.0095±0.014783 0.7949±0.0056 13 Inner Waters 0.0110±0.0059 0.8996±0.0233 101

All samples Single Population 0.0105±0.0056 0.8892±0.0227 138

Two sampling groups Outside/North 0.0093±0.0054 0.8382±0.0867 17 Inside Waters 0.0110±0.0059 0.8996±0.0233 101

Table S7. Phocoena phocoena. Results from analysis of molecular variance apportioning variation in mtDNA D-loop sequences among and within a priori populations of harbour porpoise using a 99% threshold for pure species

% variation among populations

% variation within populations

ΦST p

Three sampling groups

-3.65 103.65 -0.0365 0.89±0.012

Two sampling groups

-1.91 101.91 -0.0191 0.845±0.012

11

Table S8. Phocoena phocoena. Variation in microsatellite loci of harbour porpoise using a 99% threshold for pure species

Table S9. Phocoena phocoena. Results from analysis of molecular variance apportioning variation in allele frequencies among and within a priori populations of harbour porpoise assayed at 8 microsatellite DNA loci using a 99% threshold for pure species

% variation among populations

% variation within populations

FST P

Two sampling groups 0.25 99.75 0.00247 0.25±0.015

Table S10. Phocoena phocoena. Pairwise FST (lower diagonal) between 2 a priori populations based on variation in allele frequencies among and within a priori populations of harbour porpoise assayed at 8 microsatellite DNA loci using a 99% threshold for pure species. The probabilities that the reported FST values are significantly different from 0 are indicated in the upper diagonal

Inside Outside/North

Inside - 0.35±0.016 Outside/North 0.00078 -

Table S11. Phocoena phocoena. Posterior probability of 10 runs of Geneland each converging on a single population of harbour porpoises using a 99% threshold for pure species

Number of Clusters Posterior Probability

Run1 1 -4587.705 Run2 1 -4582.982 Run3 1 -4595.395 Run4 1 -4591.118 Run5 1 -4565.540 Run6 1 -4578.210 Run7 1 -4526.933 Run8 1 -4608.563 Run9 1 -4574.873 Run10 1 -4608.977

Locus Number of Alleles

Expected Heterozygosity (He)

Observed Heterozygosity (Ho)

Range in Allele Size (bp)

Np404 6 0.584 0.614 134-158 Np407 1 0.000 0.000 186 Np409 3 0.481 0.487 221-229 Np417 12 0.799 0.741 128-176 Np426 6 0.346 0.392 98-116 Np427 7 0.686 0.666 150-276 Np428 8 0.786 0.750 110-142 Np430 3 0.085 0.094 144-168

12

2 4 6 8 10

–3600

–3400

–3200

–3000

–2800

K

Mea

n L

nP(K

)

Fig. S1. Phocoena phocoena. Posterior probability of population membership according to STRUCTURE for 1 to 10 putative populations (K) of harbour porpoise sampled within southern British Columbia. Each value is the mean of 20 STRUCTURE simulations of variation across 8 microsatellite DNA loci (error bars are standard deviations)

Fig. S2. Phocoena phocoena. Estimated population assignment from Geneland. Different colours are used to represent distinct populations, and the presence of a single colour (yellow) suggests a single population based on variation in allele frequencies of harbour porpoise assayed at 8 microsatellite DNA loci across various areas using the sampling locations (black dots). An approximate map of the coastline of British Columbia is overlaid for reference. Because the program is not provided with species range boundaries, it is unable to assess whether harbour porpoises inhabit the land and therefore assigns land area to a population as well

13

2 4 6 8 10

–3100

–3000

–2900

–2800

–2700

–2600

K

Mea

n L

nP(K

)

Fig. S3. Phocoena phocoena. Posterior probability of population membership according to STRUCTURE for 1 to 10 putative populations (K) of harbour porpoise sampled within southern British Columbia with a 99% threshold. Each value is the mean of 20 STRUCTURE simulations of variation across 8 microsatellite DNA loci (error bars are standard deviations)

LITERATURE CITED Chen L, Yang G (2008) Development of tetranucleotide microsatellite loci for the finless porpoise

(Neophocaena phocaenoides). Conserv Genet 9: 1033–1035 Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software

STRUCTURE: a simulation study. Mol Ecol 14: 2611–2620

population structure and intergeneric hybridization … the following supplement accompanies the...

Documents