Possible Influence of Clinical Stage and Type of

Treatment in the Persistence of Residual Circulating

t(14;18)-Positive Cells in Follicular Lymphoma

Patients

GISELE W. B. COLLEONI*, LUIZ CLAUDIO C. DUARTE, FABIO R. KERBAUY, MARIA APARECIDA E. NOGUTI,ROBERTA SPETIC FELIX, JOSE SALVADOR R. DE OLIVEIRA, MARIA STELLA FIGUEIREDO and

ANTONIO CORREA ALVES

Sao Paulo Hospital, Brazil

(Received 1 June 2003)

Many patients with follicular lymphoma (FL) achieve response after treatment but completeremission (CR) rates are very low. Thus the majority of them will relapse, mainly those in advancedstage disease, due to the persistence of residual disease. Therefore, this study had the following aims:to determine the presence of bcl-2/IgH rearrangement in peripheral blood of early and advanced stageFL patients after treatment and to correlate it with their clinical situation at the same moment. Weobtained 100 consecutive peripheral blood samples from 30 FL cases and conducted molecular studiesusing two separate semi-nested PCRs for MBR and mcr rearrangements. These semi-nested PCRs forbcl-2/IgH rearrangement were able to detect one positive cell among 10,000 normal cells. Clinical andmolecular evolution of patients diagnosed as early stage disease suggested that molecular responsecould be obtained even with conventional chemotherapy or radiotherapy. In this group of patients,64% achieved molecular response in some point during follow-up. However, only 23% of patientsdiagnosed as advanced stage disease reached molecular response when treated with chemotherapy(with or without radiotherapy). Due to the low number of subjects assessed in this study, we onlyfound a tendency to significance when clinical stage at the diagnosis was associated to molecularresponse (P= 0.095). We observed 100% of concordance between clinical remission and molecularresponse in patients after bone marrow transplantation or in those cases treated with monoclonalantibody anti-CD20. This retrospective study, performed in a restricted number of patients, suggeststhat molecular response can be obtained in FL patients diagnosed at early stage disease, even withconventional chemotherapy and radiotherapy. In advanced stage disease, concordance betweenclinical remission and molecular response was observed in the majority of patients after bone marrowtransplantation or in those cases treated with monoclonal antibody anti-CD20. The prognosticsignificance of this data should be confirmed with extended follow-up and in a larger number ofpatients.

Keywords: Non-Hodgkin’s lymphoma; Follicular lymphoma; bcl-2/IgH rearrangement; Prognosis

INTRODUCTION

Follicular lymphomas (FL) are the most common type of

indolent NHL in adults and represent approximately 1/3

of NHL within this age group, with an incidence of

20,000 new cases diagnosed every year in the USA. The

median age at diagnosis is 42 years [1]. Most patients

show an advanced stage disease at diagnosis and are

considered incurable with currently available treatments.

This is because complete remission rates are very low even

though the initial response rates are greater than 90%

[1,2]. FL has a clinical course characterized by remissions

and relapses with a life expectance varying from 7 to 10

years. Death is generally due to refractory disease or to

transformation to aggressive lymphoma [1,2]. Around

85% of FL and 1/3 of the non-Hodgkin’s diffuse large B-

cell lymphomas show the t(14;18) (q32;q21) translocation.

This translocation is the result of the juxtaposition of the

*Corresponding author. Sao Paulo Hospital, Rua Botucatu, 740, 38. andar, Hematologia, CEP 04023-900, Sao Paulo, SP, Brazil.E-mail: gcolleoni@hemato.epm.br

Leukemia & Lymphoma, March 2004 Vol. 45 (3), pp. 539–545

ISSN 1042-8194 print/ISSN 1029-2403 online # 2004 Taylor & Francis LtdDOI: 10.1080/1042819031000159303

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

bcl-2 oncogene, which is localized in the q21 region of

chromosome 18, to the 14q32 locus that corresponds to

the immunoglobulin heavy chain (IgH) region. As a

consequence of this translocation, there is an over-

expression of the bcl-2 gene, which codes for the Bcl-2

protein [3,4]. The function of this protein is to block the

apoptosis or programmed cell death, and its over-

expression is considered an important factor related to

multiple drug resistance and absence of response to

chemotherapy [5,6]. The bcl-2/IgH rearrangement can be

detected by Southern blotting, a laborious procedure, or

by PCR (polymerase chain reaction), which is a very

sensitive technique especially for the detection of minimal

residual disease (MRD) [7]. The bcl-2 gene has approxi-

mately 230 kb divided into three exons. In 70% of the

cases, the rearrangement that involves the bcl-2 gene

occurs in a region known as MBR (major breakpoint

region), which is localized in the third exon of the bcl-2

gene. However, in 5 – 10% of the cases, this rearrange-

ment occurs in the minor cluster region mcr, which is

localized around 20 kb from the MBR region. Moreover,

in about 15% of the cases, the t(14;18) (q32;q21)

translocation can not be detected by cytogenetic studies,

Southern blot or by PCR, and these cases are called

germline [8]. Using polymerase chain reaction (PCR),

that can detect one circulating lymphoid cell carrying

t(14;18) translocation among 16 105 to 16 106 normal

cells, it is possible to detect minimal residual disease

(MRD) in bone marrow aspirates or peripheral blood of

FL patients [9] for monitoring their response to

chemotherapy (associated or not to monoclonal antibody

anti-CD20) or allogeneic or autologos stem-cell trans-

plant [1]. Many patients with follicular lymphoma (FL)

achieve response after treatment but complete remission

(CR) rates are very low. Thus the majority of them will

relapse, mainly those in advanced stage disease, due to the

persistence of residual disease [10]. Persistence of residual

disease, detected as t(14;18)- or bcl-2/IgH-positive cells in

peripheral blood, was also described in early stage FL

patients treated with local radiotherapy and in prolonged

clinical remission [11]. One possible explanation is that

FL, even when localized, has to be considered as a

systemic disease [12]. Thus, the clinical significance of the

persistence of residual disease in FL patients diagnosed as

early stage disease has to be better investigated. There-

fore, this study had the following aims: to determine the

presence of bcl-2/IgH rearrangement in peripheral blood

of early and advanced stage FL patients after treatment

and to correlate it with their clinical situation at the same

moment.

PATIENTS AND METHODS

One hundred blood samples were collected from 30 FLs

followed-up at the NHL Outpatient Service of the Sao

Paulo Hospital - UNIFESP/EPM, Brazil, to access

minimal residual disease status after treatment. The

interval between the sample’s harvest varied according

to the disease phase and to the type of treatment

(avoiding cytopenic phases). All patients included in this

analysis were informed about the nature of the study and

signed a consenting form before blood withdrawal,

according to the Research Ethics Committee from the

Sao Paulo Hospital - UNIFESP/EPM. Patients were

treated according to the disease stage and the general

recommendations of NCCN (National Comprehensive

Cancer Network) [13]. Fifty-four percent of patients were

initially treated with CHOP, 28% received CHOP-like

regimen, 2% were treated with chlorambucil-based

chemotherapy, 10% were initially treated with surgery

(with or without radiotherapy) and 6% did not receive

treatment at diagnosis (watch and wait).

Histology and Immunohistochemistry

The diagnosis of FL was established according to the

W.H.O. classification for lymphoproliferative disorders

[14]. Immunohistochemical reactions were conducted in

paraffin-embedded sections using the streptoavidin –

biotin – peroxidase method and the following monoclonal

antibodies: CD 45 (LCA), CD 20 (L 26), CD 45 Ro

(UCHL-1) and Bcl-2 (Dako, Carpinteria, CA, USA).

DNA Extraction From Paraffin-Embedded Tissue

Three to ten 10-mm-thick slices were obtained from

paraffin blocks and were deparaffinized with xylene. The

pellet was resuspended in 495 ml of digestion buffer

(100 mM Tris, pH 8.0; 1 mM EDTA; 1% Tween 20) and

5 ml proteinase K (20 mg/ml) (Gibco BRL, Rockville,

MD, USA), followed by an incubation at 608C for 16 h.

Afterwards, the tube with the tissue was heated at 958Cand stored at 7 208C for further extraction. DNA was

purified with phenol/chloroform, precipitated with 3 M

sodium acetate and ethanol, and resuspended in sterile

water [15].

Detection of bcl-2/IgH Rearrangement Using DNA

Obtained from Paraffin- Embedded Tissue (one step

PCR)

DNA samples obtained from paraffin- embedded tissue

were tested only for the presence of the MBR

rearrangement, using the PCR technique proposed by

Johnson [16]. Positive controls for the MBR rearrange-

ment were: (1) Su-DHL-4 cell-line (Invivoscribe, Carls-

bad, CA, USA) and a DNA sample obtained from a

lymph node of a MBR-positive case (confirmed by

automated sequencing). Since we detected a high degree

of degradation of the DNA obtained from paraffin-

embedded tissue, we were not able to access the

presence of the mcr rearrangement using these DNA

samples (the expected PCR product should have

between 600 – 700 bp). PCR reactions were conducted

in duplicate in a Perkin Elmer 9700 thermocycler

540 G.W.B. COLLEONI et al.

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

(Perkin Elmer, Norwalk, CT, USA) with: 1 mg of DNA

for each 50 ml reaction, 16 Taq polymerase buffer,

2 mM MgCl2, 200 mM dNTPs, 20 pmol of each primer

(internal MBR and external JH) (Table I), 2.5U Taq

polymerase (Invitrogen, Carlsbad, CA, USA), with an

initial denaturation at 948C/5 min and 40 cycles of:

denaturation at 948C/45 s, annealing at 588C/45 s,

extension at 728C/30 s, with final extension at 728Cfor 5 min. Due to the degradation of the DNA

obtained from paraffin-embedded tissue, in 12 (40%)

cases bands between 50 and 200 bp were not observed

for the bcl-2/IgH PCR reactions using the internal

MBR/external JH primers. Therefore, in an attempt to

optimize the detection of the MBR rearrangement,

without re-amplifying the amplicon, a new reaction was

conducted using the Eppendorf Master Mix 2.5X

(Eppendorf, Westbury, NY, USA). For each 50 mLPCR reaction, there was 1 mg DNA, 1.25U Taq DNA

polymerase, 50 mM KCl, 30 mM Tris-HCl (pH 8.3),

1.5 mM MgCl2, 200 mM dNTPs and 20 pmol of each

primer (internal MBR and external JH) (Table I). To

increase the chance of amplifying the fragment using

these degraded DNA samples, denaturation, annealing

and extension times were increased as follows: initial

denaturation at 948C/5 min, followed by 40 cycles of

denaturation step at 948C/1 min and 30 s, annealing at

588C/ 1 min and 30 s, extension at 728C/1 min, and

final extension at 728C for 5 min.

DNA Extraction From Peripheral Blood Samples

Proteinase K digestion of the leukocyte pellet, DNA

purification and precipitation were conducted according

to the protocol described by Lee et al [15].

Detection of bcl-2/IgH Rearrangement in Peripheral

Blood Samples (semi-nested PCR)

Peripheral blood samples were assessed for the presence

of MBR and mcr rearrangements through two different

semi-nested PCR reactions [16]. Each reaction had a

sense primer for each type of the rearrangement (MBR

or mcr) and the same anti-sense consensus primer for the

JH region of the immunoglobulin heavy-chain gene

(IgH). Positive controls for the MBR and mcr

rearrangements were produced by Invivoscribe (Carls-

bad, CA, USA). PCR reactions were conducted in

duplicate in a Perkin Elmer 9700 thermocycler. The first

PCR reaction had: 1 mg of DNA for each 50 ml of

reaction, 16 buffer of Taq polymerase, 2 mM MgS04,

200 mM dNTPs, 20 pmol of each primer (external

MBR/ external JH or external mcr/ external JH) (Table

II), 1.5U Platinum Taq polymerase High Fidelity

(Invitrogen, Carlsbad, CA, USA), with initial denatura-

tion at 948C/5 min and 30 cycles with: denaturation at

948C/45 s, annealing at 648C/45 s, extension at 728C/30 s, followed by a final extension at 728C for 5 min.

The second PCR reaction contained: 5 ml of the first

PCR product for each 50 ml reaction, 16 Taq

polymerase buffer, 1 mM MgCl2 for MBR/JH and

0.5 mM MgCl2 for mcr/JH, 200 mM dNTPs, 20 pmol

of each primer (internal MBR/ external JH or mc7/

external JH) (Table I), 2.5U Taq polymerase (Invitro-

gen, Carlsbad, CA, USA), with denaturation at 948C/5 min followed by 20 cycles of denaturation at 948C/45 s, annealing at 668C/45 s, extension at 728C/30 s, and

a final extension at 728C for 5 min.

Visualization of the PCR Products and Cloning of JH

Band

PCR products were visualized under UV light on a 2%

agarose gel, stained with ethidium bromide. MBR

rearrangement produced bands between 50 – 200 bp and

mcr rearrangement was detected as 600 – 700 bp bands

(Figs 1 and 2) [16]. A 550 bp band, also called JH band,

was visualized in all PCR reactions using DNA obtained

from peripheral blood samples. Cloning of the purified

550 bp fragment (not shown here) confirmed that this

important internal control corresponds to phosphoglice-

rate kinase (PGK) 1 pseudo-gene 2 localized at the short

arm of chromosome 19 (19p 13.3) (GenBank access

AC010422.7) [17].

PCR Sensitivity

The sensitivity of this non-radioactive semi-nested PCR

was established using MBR and mcr control samples

(Invivoscribe, Carlsbad, CA, USA) diluted in sterile

water and in human placenta DNA (1 mg DNA; 100 ng

or 1:10; 10 ng or 1:100; 1 ng or 1:1000; 0.1 ng or 1:10,000;

0.01 ng or 1:100,000 and 0.001 ng or 1:1,000,000) and the

above PCR conditions (Figs 1 and 2).

Statistical Analysis

In this study, the response to the primary treatment was

classified according to the International Workshop

proposed by Cheson et al [18]: complete response (CR),

unconfirmed complete response (CRu), partial response

(PR), stable disease (SD) or progressive disease (PD).

Molecular response was defined as the disapearence of

circulating t(14;18)-positive cells at any moment during or

after treatment, for a patient whose bcl-2 gene rearrange-

TABLE I PCR primers for the detection of the bcl-2/IgH rearrange-

ment [16, 24]

Primers

External MBR (sense): 5’ CAGCCTTGAAACATTGATGG 3’

External mcr (sense): 5’ GACTCCTTTACGTGCTGGTACC 3’

External JH (anti-sense): 5’ ACCTGAGGAGACGGTGACC 3’

Internal MBR (sense): 5’ AGTTGCTTTACGTGGCCTGT 3’

mc7 (sense): 5’ TCAGTCTCTGGGGAGGAGTG-

GAAAGGAA 3’

541RESIDUAL T(14;18)-POSITIVE CELLS IN FL

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

ment at diagnosis was known. Associations between the

assessed variables and the response to the treatment were

tested with Pearson Chi-square Test (w2) or with Fisher’s

exact test. The level of significance for all statistical tests

was 5%. The analysis was conducted with the SPSS 8.0

software.

RESULTS

Twelve patients (40%) were diagnosed as early stage and

18 (60%) as advanced stage disease. Molecular analyses

identified 24 (80%) patients with MBR and 5 (17%) with

mcr rearrangement. In one case (3%) it was not identified,

despite numerous attempts to detect the type of

TABLE II PCR for bcl-2/IgH rearrangement in paraffin-embedded tissue and peripheral blood samples

MBR rearrangement in

bcl-2/IgH rearrangement in peripheral blood samples

Type of bcl-2/IgH

N Patient paraffin-embedded tissue MBR mcr rearrangement

1. 1 7 + NP MBR

2. 2 7 + NP MBR

3. 3 7 7 + Mcr

4. 4 7 + NP MBR

5. 5 + 7 7 MBR*

6. 6 + + NP MBR

7. 7 7 7 + Mcr

8. 8 + + NP MBR

9. 10 + 7 7 MBR*

10. 14 + + NP MBR

11. 18 + + NP MBR

12. 19 + 7 7 MBR*

13. 22 + 7 7 MBR*

14. 27 + + NP MBR

15. 28 + 7 7 MBR

16. 30 + + NP MBR

17. 31 7 7 + Mcr

18. 32 7 + NP MBR

19. 34 + + NP MBR

20. 35 + + NP MBR

21. 36 + + NP MBR

22. 40 + + NP MBR

23. 41 + + NP MBR

24. 42 + + NP MBR

25. 43 7 + NP MBR

26. 44 + + NP MBR

27. 45 7 7 7 Unknown*

28. 46 7 + 7 MBR

29. 47 7 7 + Mcr

30. 48 7 7 + Mcr

NP=not performed; *=amplification of MBR band was obtained with Eppendorf Master Mix.

FIGURE 1 Sensitivity of semi-nested PCR using MBR positivecontrol. Lane 1=1:1, lane 2=1:10, lane 3=1:102, lane 4=1:103, lane5=1:104 , lane 6=1:105, lane 7=1:106, lane 8=100 bp marker. Apositive PCR is shown up to 0.1ng dilution (lane 5).

FIGURE 2 Sensitivity of semi-nested PCR using mcr positive control.Lane 1=1:1, lane 2=1:10, lane 3=1:102, lane 4=1:103, lane5=1:104 , lane 6=1:105, lane 7=1:106, lane 8=100 bp marker. Apositive PCR is shown up to 0.1ng dilution (lane 5).

542 G.W.B. COLLEONI et al.

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

rearrangement (Table II). Semi-nested PCR reactions for

MBR and mcr were positive up to 1:10,000 dilution (Figs

1 and 2). Thus, these semi-nested PCRs for bcl-2/IgH

rearrangement were able to detect one positive cell among

10,000 normal cells. Nineteen percent of samples of

known MBR or mcr patients have PCR negative results

(with positive JH band) in the presence of active disease.

Figs 3 – 6 show the time where samples where collected,

e.g., at diagnosis, during re-staging, at relapse or disease

progression, or during follow-up. Time zero represents

the dates of diagnoses. During follow-up, 4 (13%)

patients were treated with bone marrow transplantation

(3 allogeneic and one autologous) and 2 (7%) patients

were treated with rituximab. The analysis of Figs 3 and 4,

that show clinical and molecular evolution of patients

diagnosed as early stage (I or II) disease, suggests that

molecular response can be obtained even with conven-

tional chemotherapy or radiotherapy. In this group of 11

FIGURE 4 Clinical and molecular analyses of early stage (I/II) cases: samples taken 4 60 months after diagnosis of FL (initial treatment is notshown). Dots represent time when blood samples were collected (see Figure 3 for key to symbols).

FIGURE 3 Clinical and molecular analyses of early stage (I/II) cases: samples taken 0 – 60 months after diagnosis of FL. Dots represent time whenblood samples were collected.

FIGURE 5 Clinical and molecular analyses of late stage (III/IV) cases, samples taken 0 – 60 months after diagnosis of FL. Dots represent time whenblood samples were collected (see Figure 3 for key to symbols).

543RESIDUAL T(14;18)-POSITIVE CELLS IN FL

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

patients, 7 (64%) achieved molecular response in some

point during follow-up. Patient 48 (Fig. 4), despite of

being diagnosed as early stage disease, showed many

relapses as disseminate disease and used rituximab after

the last chemotherapy schedule (when we performed the

molecular studies) and was excluded from this analysis.

Patients 2 and 41 (Fig. 4) had a negative PCR only in the

last collected sample, many months after the last

treatment approach. However, when Figs 5 and 6 were

analyzed, we concluded that only 8/18 (44%) of patients

diagnosed as advanced stage disease reached molecular

response. If we exclude the 5 patients submitted to

transplant (Patients 6, 28, 36, 47) or who received

rituximab (Patient 8) from this analysis, we will have 3/

13 or 23% of molecular response in advanced stage

patients treated with chemotherapy (with or without

radiotherapy). Also, in this study, we found 100% of

molecular response in 6 cases treated through either bone

marrow transplantation or rituximab.

DISCUSSION

In this study, the sensitivity of the semi-nested PCR for

MBR ormcr rearrangement was 16 104, e.g., it detected a

single t(14;18)-positive cell among 10,000 normal cells.

Perhaps, if the PCR reaction had a higher number of

cycles, the level of sensitivity could have been raised to

1:105 or 106 as documented in other studies [9,19]. The

obvious disadvantage of increasing the sensitivity of this

analysis is the identification of non-malignant t(14;18)-

positive cells in subjects considered in complete remission,

and who are not going to relapse. Nineteen percent of

samples of known MBR or mcr patients have PCR

negative results (with positive JH band) in the presence of

active disease. Maybe it reflects either false-negative or

bcl-2/IgH amount under the detection of the test. Analysis

of Figs 3 and 4, showing clinical and molecular follow-up

of the patients assessed at the initial stage, suggested that

molecular remission could be reached even with the use of

conventional chemotherapy and radiotherapy. The oppo-

site could be seen in Figs 5 and 6, which showed patients

followed-up who were diagnosed at advanced stage

disease. Due to the low number of subjects assessed in

this study, we only found a tendency to significance when

clinical stage at the diagnosis was associated to molecular

response (P= 0.095). After the initial treatment, a latent

period can occur between the achievement of CR and

molecular response, which could be correlated with the

elimination of the residual disease by the patient’s immune

system, especially by natural-killer cells. In this study, we

found 100% of molecular response in six advanced stage

cases treated through either bone marrow transplantation

or rituximab. Probably, the main application of MDR

analysis in FL patients is in the follow-up of patients

submitted to autologous or allogeneic stem-cell transplan-

tation and in those who received monoclonal antibody

anti-CD20. Currently, these therapies are well-known for

their potential of eradication of MDR. In the near future,

non-myeloablative allogeneic transplants will probably

represent one of the best therapeutic options for patients

with FL [20], and the presence of residual disease may

represent an important instrument in managing the graft-

vs.-lymphoma effect. In this study, Patients 2, 14, 41 and

42 who showed clinical remission after more than 60

months of follow-up of FL, had negative results for the

PCR reactions only at the last collected sample. A possible

explanation for these results would be the fluctuation of

the tumor content with levels lower than the sensitivity of

the method, thus requiring a serial observation for a final

conclusion on the patients’ condition. Another hypothesis

would be the presence of a non-malignant sub-clone

detected in several blood samples during the observation

of the residual disease, without any clinical meaning [11].

Finally, a third possibility could be a false-negative result

(despite of the identification of the positive internal JH

control). Therefore, the meaning of the presence of bcl-2/

IgH rearrangement in normal tissue is uncertain, but it

could suggest that the translocation is an early event, in

which cumulative oncogenic alterations are necessary for

the FL to be expressed as a clinical entity [21]. Lee et al [22]

suggested that the evaluation of the residual disease after

the treatment could identify groups of patients at risk for

FL relapse. The persistency of a large tumor mass between

12 and 23 months seemed to be predictive of low FFS. On

the other hand, the late tumor content (between 36 and 48

months of treatment) did not show an impact on FFS over

5 years. Therefore, based upon the literature, we can not

affirm that the detection of circulating t(14;18)-cells

through PCR correlates with an imminent relapse of the

FIGURE 6 Clinical and molecular analyses of late stage (III/IV) cases: samples taken 4 60 months after diagnosis of FL (initial treatment is notshown). Dots represent time when blood samples were collected (see Figure 3 for key to symbols).

544 G.W.B. COLLEONI et al.

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.

disease. One way of differentiating the persistence of

positive cells without potential tumor growth from a

relapse is the sequential follow-up of the patients, as

conducted in this study. The other possibility is the

quantitative analysis of the tumor content through real-

time PCR. However, it is still necessary to determine the

amount of the tumor cells that truly predicts the risk of

relapse. Mandigers et al [23] did not find differences in

FFS between patients that had a large number (above the

median of the group) or a small number (below the

median of the group) of circulating t(14;18)-positive cell at

diagnosis of FL, which was determined through real time

PCR. Also, the authors questioned the use of a

quantitative monitoring in patients treated with first line

methods, which are known to be non-curative. This study

is retrospective, performed in a restricted number of

patients, monitored at non-predefined time points in the

course of FL and treated with different approaches. It

suggests that molecular response can be obtained in FL

patients diagnosed at early stage disease even with

conventional chemotherapy and radiotherapy. In

advanced stage disease, concordance between clinical

remission and molecular response was observed in the

majority of patients after bone marrow transplantation or

in those cases treated with monoclonal antibody anti-

CD20. The prognostic significance of this data should be

confirmed with extended follow-up and in a larger number

of patients.

Acknowledgements

G.W.B. Colleoni., L.C.C. Duarte and F.R. Kerbauy were

partially supported by CNPq (Conselho Nacional de

Desenvolvimento Cientıfico e Tecnologico), Brazil. This

work was supported by grants from FAPESP (Fundacao

de Apoio a Pesquisa do Estado de Sao Paulo), Brazil.

References

[1] Peterson, B.A. (1999) ‘‘Current treatment of follicular low-gradelymphomas’’, Seminars in Oncology, 26, 2 – 11.

[2] Simon, R., Durrleman, S., Hoppe, R.T., Bonadonna, G., Bloom-field, C.D., Rudders, R.A. et al. (1988) ‘‘The non-Hodgkin‘sLymphoma Pathologic Classification Project. Long-term follow-upof 1153 patients with non-Hodgkin’s lymphoma’’, Annals of InternalMedicine, 109, 939 – 945.

[3] Tsujimoto, Y., Finger, L.R., Yunis, J., Nowell, P.C. and Croce,C.M. (1984) ‘‘Cloning of the Chromosome breakpoint of neoplasticB cell with the t(14;18) chromosome translocation’’, Science, 226,1097 – 1099.

[4] Tsujimoto, Y., Cossman, J., Jaffe, E. and Croce, C.M. (1985)‘‘Involvement of the bcl-2 gene in human follicular lymphoma’’,Science, 228, 1440 – 1443.

[5] Vaux, D.L., Cory, S. and Adams, J.M. (1988) ‘‘Bcl-2 gene promoteshaematopoietic cell survival and cooperateswith c-myc to immorta-lize pre-B cells’’, Nature, 335, 440 – 442.

[6] Oltvai, Z.N., Milliman, C.L. and Korsmeyer, S.J. (1993) ‘‘Bcl-2heterodimerizes in vivo with a conserved homolog, Bax, thataccelerates programmed cell death’’, Cell, 74, 609 – 619.

[7] Horsman, D.E., Gascoyne, R.D., Coupland, R.W., Coldman, A.J.and Adomat, S.A. (1995) ‘‘Comparison of cytogenetic analysis,Southern analysis and polymerase chain reaction for the detectionof t(14;18) in follicular lymphoma’’, American Journal of ClinicalPathology, 103, 472 – 478.

[8] Arber, D.A. (2000) ‘‘Molecular diagnostic approach to non-Hodgkin’s lymphoma’’, Journal of Molecular Diagnostics, 2, 178 –190.

[9] Gribben, J.G., Neuberg, D., Freedman, A.S., Gimmi, C.D., Pesek,K.W., Barber, M., et al. (1993) ‘‘Detection by polymerase chainreaction of residual cells with the bcl-2 translocation is associatedwith increased risk of the relapse after autologous bone marrowtransplantation for B-cell lymphoma’’, Blood, 81, 3449 – 3457.

[10] Lopez-Guilhermo, A., Cabanillas, F., McLaughlin, P., Smith, T.,Hagemeister, F., Rodriguez, M.A., et al. (1998) ‘‘The clinicalsignificance of molecular response in indolent follicular lympho-mas’’, Blood, 91, 2955 – 2960.

[11] Finke, J., Slanina, J., Lange, W. and Dolken, G. (1993) ‘‘Persistenceof circulating t(14;18)-positive cells in long-term remission afterradiation therapy for localized-stage follicular lymphoma’’, JournalClinical Oncology, 11, 1668 – 1673.

[12] Lambretchs, A.C., Hupkes, P.E., Dorssers, L.C.J. and van’t Veer,M.B. (1993) ‘‘Translocation (14;18)-positive cells are present in thecirculation of the majority of patients with localized (stage I and II)follicular non-Hodgkin’s lymphoma’’, Blood, 82, 2510 – 2516.

[13] NCCN. National Comprehensive Cancer Network. (2001) Thecomplete library of practice guidelines in oncology. Version 2001(www.nccn.org).

[14] Harris, N.L., Jaffe, E.S., Diebold, J., Flandrin, G., Muller-Hermelink, H.K., Vardiman, J., et al. (1999) ‘‘World HealthOrganization of neoplastic diseases of the hematopoietic andlymphoid tissues: Report of the clinical advisory committee meet-ing-Airlie House, Virginia, November 1997’’, Journal of ClinicalOncology, 17, 3835 – 3849.

[15] Lee, T.H., Sakahara, N.S., Fiebig, E.W., Hirschkorn, D.F.,Johnson, D.K. and Busch, M.P. (1998) ‘‘Quantitation of white cellsubpopulations by polymerase chain reaction using frozen whole-blood samples’’, Transfusion, 38, 262 – 270.

[16] Johnson, P.W.M. (1996) Polymerase chain reaction for detection ofthe t(14;18) translocation in lymphomas. In: Methods in MolecularMedicine, Molecular Diagnosis of Cancer, edited by FE Cotter. Pp.63 – 74. Totowa, NJ: Humana Press Inc.

[17] Gartler, S.M., Riley, D.E., Lebo, R.V., Cheung, M.C., Eddy, R.L.and Shows, T.B. (1986) ‘‘Mapping of human autosomal phospho-glycerate kinase sequence to chromosome 19’’, Somatic Cell andMolecular Genetics, 12, 395 – 401.

[18] Cheson, B.D., Horning, S.J., Coiffier, B., Shipp, M.A., Fisher, R.I.,Connors, J.M., et al. (1999) ‘‘Report of an international workshopto standardize response criteria for non-Hodgkins lymphomas’’,Journal of Clinical Oncology, 17, 1244 – 1253.

[19] Lee, M.S., Chang, K.S., Cabanillas, F., Freireich, E.J., Trujillo,J.M. and Stass, S.A. (1987) ‘‘Detection of minimal residual cellscarrying the t(14;18) by DNA sequence amplification’’, Science, 237,175 – 178.

[20] Khouri, I.F., Saliba, R.M., Giralt, S.A., Lee, M.S., Okoroji, G.J.,Hagemeister, F.B., et al. (2001) ‘‘Nonablative allogeneic hemato-poietic transplantation as adoptive immunotherapy for indolentlymphoma: low incidence of toxicity, acute graft-versus-hostdisease, and treatment-related mortality’’, Blood, 98, 3595 – 3599.

[21] Biagi, J.J. and Seymour, J.F. (2002) ‘‘Insights into the molecularpathogenesis of follicular lymphomas arising from analysis ofgeographic variation’,’ Blood, 99, 4265 – 4275.

[22] Lee, W.I., Cabanillas, F., Huh, Y. and Lee, M.S. (2001) ‘‘Predictionof clinical relapse by quantitative real-time polymerase chainreaction (Q-Rt-PCR) of t(14;18) carrying cells in patients withfollicular lymphoma’’, Blood, 98, 525.

[23] Mandigers, C.M.P.W., Meijerink, J.P.P., Mensink, E.J.B.M.,Tonnissen, E.L.R.T., Hebeda, K.M., Borgman, M.J.J.T. andRaemaekers, J.MM., for the Interzol (South-East NetherlandsComprehensive Cancer Centers Cooperative Group). (2001) ‘‘Lackof correlation between numbers of circulating t(14;18)-positive cellsand response to first-line treatment in follicular lymphoma’’, Blood,98, 940 – 944.

[24] Ngan, B-Y., Nourse, J. and Cleary, M.L. (1989) ‘‘Detection ofchromosomal translocation t(14;18) within the minor cluster regionof bcl-2 by polimerase chain reaction and direct genomic sequencingof the enzymatically amplified DNA in follicular lymphomas’’,Blood, 73, 1759 – 1762.

545RESIDUAL T(14;18)-POSITIVE CELLS IN FL

Leu

k L

ymph

oma

Dow

nloa

ded

from

info

rmah

ealth

care

.com

by

Tuf

ts U

nive

rsity

on

10/2

8/14

For

pers

onal

use

onl

y.