presentation on claim drafting: biotech and pharma

© Vinita Radhakrishnan 2010

Claim Drafting: Biotech and Pharma

Vinita Radhakrishnan


Basics

Claims???

Part of claim?


Chemical and pharmaceutical claim drafting


Types of claims

Product claims Process claims


Product related claims

i) New Chemical entity including a molecule or a compound

ii) Combination ii) Compositions


New Chemical Entity Claims

A chemical molecule developed in the early discovery stage which later translates into a drug product is generally referred to as a new chemical entity. Actual molecular structure of the

NCE in the claim


Actual Structure example A compound having the formula

Scope of protection rendered by the claim stated in the illustration is limited to the compound bearing the molecular structure.


‘Markush’ type Claim

include a chemical entity along with the various variants of the same

close ended claims


Markush claim

A compound having the formula

Wherein X is selected from a group consisting of Cl, Br, F and I.


Fingerprint claim When the exact structure is not known but the

characteristics of the structure is sufficient to distinguish the compound from existing prior art.

e.g.:

What is claimed is

A chemical entity characterized by molecular weight of 280, having a pH of 6.5, which has a melting point of 123 degree Celsius and a boiling point of 180 degree Celsius.


Product by process claim

When the product cannot be clearly defined and is best defined by the process of preparing the same


Example

Polyjuice potion: A potion that transforms one person to another

person he desires to look and sound like

What is claimed is a potion prepared by: Mixing 12 lacewing flies that have been stewed for 21 days , 1 ounce of crude Antimony, 4 leeches that have been "unsucculated“, 1 pinch of powdered horn of a Bicorn that has been "lunar extracted" and extract of Extract of The-Transfigured-Being-To-Be floowed by 21 days of brewing in a oak barrel


Omnibus Claims

Reference is made to the specification

Usually not allowed in most jurisdiction

It’s a play safe claiming strategy


Example

A compound for treating Hemophilia, wherein the compound is substantially as discussed in the specification.


Chemical Composition or Combination Claims

Novel Combination product patents including two or more already known chemical compounds.

These compounds may be available in the public domain. But so long as the combination is novel, they can be patented.

A composition claim usually shall include several components both essential and non essential for the invention.


Example 1

What is claimed isA shampoo composition comprising a. 25 % of Alkyl ether sulphate; b. 10% of Dimethicone; c. 2% of imidazole and d. 63% water.


Example 2What is claimed is1. A shampoo composition comprising

20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of atleast one anti fungal agent and water.

2. The shampoo composition as claimed in claim 1, wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.

3. The shampoo composition in claim 1 wherein said anti fungal agent is imidazole.


Example 3

A shampoo composition comprising 20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of atleast one anti fungal agent and Water

wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.


Process related claims

A process claim enumerates the step wise process for manufacturing the compound or formulation

Steps to be enumerated in the logical order.


Example

A process for preparing a modified phosphocalcic compound comprising

a) adding a gem-biphosphonic acid or an alkali metal or alkaline-earth metal salt thereof to a suspension of a precursor phosphocalcic compound in ultrapure water;

b) stirring the reaction medium at room temperature and

c) recovering the formed compound there from by centrifugation


Exercise 1 Biphenyl Propionic acid


Sample for Exercise 1A compound wherein the compound is

What is claimed is a compound wherein ring P is an aromatic ring optionally having substituent(s), ring Q is an aromatic ring optionally further having substituent(s) besides —Y—COOH, and X and Y are each independently a spacer, or a salt thereof or a prodrug thereof.


Biotechnology Claims


Type of claims

Product related claims Process related claims


Product related claims

Gene sequence Amino Acid sequence A method of expressing the

sequence, Vector and host used for expression of the gene

An antibody against the protein / sequence and a kit made from the antibody / sequence


Gene sequences/Amino Acid sequences: e.g.1

What is claimed is An isolated nucleic acid comprising

a nucleic acid sequenceATGGGCCTAACGTGAGGGAATTCGAAAT

T



What is claimed is An isolated nucleic acid molecule

comprising a nucleic acid Sequence of SEQ ID no. 1.


Gene sequences/Amino Acid sequences: e.g. 3

A nucleic acid molecule comprising a nucleic acid sequence that hybridizes to SEQ ID no.1 under stringent conditions.


Gene sequences/Amino Acid sequences:e.g. 4

A nucleic acid molecule comprising1) SEQ ID no.1 OR2) a nucleic acid sequence that

hybridizes to SEQ ID no.1 under stringent conditions



What is claimed is

An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence Met Ala Asp Asp Cys Glu Phe Val Gly Ser Ala Val

Or

An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO 2.


Other claims

Vector: A vector comprising a nucleic acid

molecule as claimed in Claim 1. Host Cell:

A transgenic host cell that contains the vector comprising a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID no.1.


Antibody

Isolated Antibody: An isolated antibody or fragment thereof

comprising the amino acid sequence of the VH and VL domains of SEQ ID no. 2.

Antibody Kit: A kit comprising the antibody or fragment

thereof of claim 3.Or A kit for producing a protein, at least

comprising the nucleotide sequence of claim 1, or a gene expression vector at least comprising the nucleotide sequence of Claim 1.


Process related claims

Method of expression claims Biotechnological process

claims


Method of expression claims

A method of expressing a target protein or polypeptide comprising the steps of: a. transfecting a host cell with the expression vector of claim 2; b. culturing the host cell transfected with the expression vector under conditions that permit expression of the target protein or polypeptide; and c. isolating the target protein or polypeptide.


Biotechnological process claims

A process for making an insulin precursor or an insulin analog precursor, said method comprising (i) culturing a host cell comprising a polynucleotide sequence encoding an insulin precursor or an insulin analog precursor according to claim 1 under suitable culture conditions for expression of said precursor; and (ii) isolating the expressed precursor.


Diagnostic methods

Product Process


Product

A diagnostic kit used for detecting malaria antibodies in a biological sample comprising of the protein according to claim 3 where the said protein is brought in contact with the biological sample under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label.


Process

A method for in vitro diagnosis of malaria antibodies in a biological sample, comprising

(i) contacting said biological sample with a composition comprising a protein according to claim 3 under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label, and

(ii) detecting the presence of said immune complexes visually or mechanically.


Exercise 2

An isolated nucleic acid encoding a flavonoid methyltransferase molecule bearing the SEQ ID no 1 and its amino acid sequence bearing SEQ ID no 2


Sample Claim Exercise 2

An isolated nucleic acid molecule according to any one of claims 1 to 3 having the nucleotide sequence comprising:

(i) a nucleotide sequence set forth in SEQ ID NO:1; (ii) a nucleotide sequence having at least about 50% similarity after

optimal alignment to SEQ ID NO:1; (iii) a nucleotide sequence capable of hybridizing under low

stringency conditions to SEQ ID NO: 1 or its complementary form;

(iv) a nucleotide sequence capable of encoding the amino acid sequence set forth in SEQ ID NO:2;

(v) a nucleotide sequence capable of encoding an amino acid sequence having at least about 50% similarity after optimal alignment to SEQ ID NO:2;

(vi) a nucleotide sequence capable of hybridizing under low stringency conditions to the nucleotide sequence in (iv) or (v) or its complementary form; wherein said nucleotide sequence encodes a FMT molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homolog thereof.


Exercise 3

Herbal Preparation The medicinal preparation

comprises of: 1. Melon Extract (40%) 2. Aloe vera Extract (10%) 3. Saffron (5%) 4. Papaya extract (20%) 5. Water


Sample claims

1. A personal care composition comprising of 20-60% of melon extract 0-10% of moisturizing agent 3-7% of anti oxidative agent 10-30% of cleansing agent A suitable solvent

2. The personal care composition claimed in claim 1 where the cleansing agent is selected from a group consisting of papaya extract, cucumber extract and strawberry extract.

3. The personal care composition claimed in claim 1 and 2 where the cleansing agent is papaya extract.


Sample claims

The personal care composition claimed in claim 1, where the composition is administered as a serum.

The personal care composition claimed in claim 1, where the composition is used for treatment of vitiligo.

presentation on claim drafting: biotech and pharma

Documents

claim vinita radhakrishnan

molecular vinita radhakrishnan

chemical composition

basics claims

formed compound

pharmaceutical claim

shampoo composition

chemical compounds