process strategies for enhancing recombinant streptokinase production in lactococcus lactis cultures...

Accepted Manuscript

Title: Process strategies for enhancing recombinantstreptokinase production in Lactococcus lactis cultures usingP170 expression system

Author: Sujoy Bera Karthikeyan Thillai Kalpana SriramanGuhan Jayaraman

PII: S1369-703X(14)00201-0DOI: http://dx.doi.org/doi:10.1016/j.bej.2014.07.009Reference: BEJ 5993

To appear in: Biochemical Engineering Journal

Received date: 4-12-2013Revised date: 2-7-2014Accepted date: 12-7-2014

Please cite this article as: S. Bera, K. Thillai, K. Sriraman, G. Jayaraman, Processstrategies for enhancing recombinant streptokinase production in Lactococcus lactiscultures using P170 expression system, Biochemical Engineering Journal (2014),http://dx.doi.org/10.1016/j.bej.2014.07.009

This is a PDF file of an unedited manuscript that has been accepted for publication.As a service to our customers we are providing this early version of the manuscript.The manuscript will undergo copyediting, typesetting, and review of the resulting proofbefore it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers thatapply to the journal pertain.

http://dx.doi.org/doi:10.1016/j.bej.2014.07.009

http://dx.doi.org/10.1016/j.bej.2014.07.009

of 38

Accep

ted

Man

uscr

ipt

0

Title: Process strategies for enhancing recombinant streptokinase production in Lactococcus

lactis cultures using P170 expression system

Authors: Sujoy Bera1,2*, Karthikeyan Thillai2*, Kalpana Sriraman2,3 and Guhan Jayaraman2

*Karthikeyan Thillai and Sujoy Bera contributed equally.

Affiliation of authors:

1Leibniz Institute for Neurobiology, Brenneckestr. 6, Magdeburg-39118, Germany2Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences Building, Indian

Institute of Technology Madras, Chennai 600036, India3Stem Cell Biology Department, National Institute for Research in Reproductive Health,

Jehangir Merwanji Street, Parel, Mumbai-400012, India

Corresponding author contacts

Guhan Jayaraman

Professor

Department of Biotechnology

Indian Institute of Technology – Madras

Chennai, India 600 036

Tel:+91-44-2257 4108

Fax: +91-44-2257 4102

Email-ID: [email protected]

of 38

Accep

ted

Man

uscr

ipt

1

Abstract

The production of recombinant proteins in Lactococcus lactis is often limited by several process

and biological constraints. Recombinant gene expression in the P170 system of L. lactis is

triggered at a pH below 6.5 by lactic acid accumulation. This work has used static flask, batch

bioreactor and chemostat studies to independently investigate various factors affecting

production of recombinant streptokinase. These factors are induction strength, complex-nutrient

supplementation, specific growth rate and the cellular response to acid-stress termed as Acid

Tolerance Response (ATR). In the P170 system, induction strength is is mainly a function of

lactate concentration . Recombinant protein production is enhanced by increasing induction

strength and complex-nutrient supplementation. However, acid-induced cellular stress-response

has a deleterious effect on recombinant protein productivity. It is seen that suppression of ATR

has the most predominant effect on enhancing recombinant protein productivity. The insights

obtained from batch studies were used to investigate fed-batch processes, both during complete

development of ATR and during suppression of ATR. During complete ATR-development, a 25-

fold enhancement of volumetric productivity was achieved in fed-batch culture, due to a

synergistic combination of increased glucose-feed rates and addition of complex-nutrients to the

feed. A combination of these factors and ATR-suppression gave rise to nearly 60-fold increase in

volumetric productivity in fed-batch culture over batch processes.

Keywords: Lactococcus lactis, P170 expression system, Recombinant streptokinase production,

Acid Tolerance Response, Fed-batch processes

of 38

Accep

ted

Man

uscr

ipt

2

1. Introduction

Recent research has exhibited an increased interest in the use of Lactococcus lactis as a host

organism for recombinant protein production [1-4]. L. lactis MG1363 is a well-characterized

Gram-positive bacterial strain, for which the complete genome sequence is available [5-7],

genetic tools are well-developed [8-12], and abundant literature is available on its fermentation

and metabolic characteristics [13,14]. Furthermore, the GRAS status of L. lactis confers certain

advantages over commonly-used recombinant bacteria such as E. coli, which have endotoxins

associated with recombinant protein production and purification [15]. Various genetic and

process strategies have been employed for the efficient production of recombinant proteins in L.

lactis cultures [16-22].

The P170 expression system, which responds to lowered pH as well as lactate accumulation, is a

derivative of a native L. lactis promoter, identified during screening for environmentally-

regulated promoters [9,12,21,23]. The promoter is regulated by pH and growth phase i.e. the

activity is strongly up-regulated at pH below 6.5 during the transition to stationary phase,

without the need for addition of an exogenous inducer [12,21]. It has also been shown that lactate

addition at pH above 6.5 can induce recombinant protein production [2,12]. Thus, the P170

expression system has advantages over the more commonly used nisin-inducible expression

system (NICE), in terms of reduction in inducer and downstream processing costs. Glenting et al.

[24] have used a P170 promoter to express a allergen protein (Arah2) in L. lactis flask culture

and observed high yield of secreted, full-length and immunologically-active allergen. The P170

expression system has also been used for production of staphylococcal nuclease in L. lactis and

the process has been reproducibly scaled up from 1-litre to 200-litre cultures [22]. Other than

of 38

Accep

ted

Man

uscr

ipt

3

batch cultures, few studies are available on bioreactor strategies for recombinant protein

production with L. lactis [10,19,21,25]. Production of recombinant green fluorescent protein was

optimized in fed-batch cultures of nisin-inducible Lactococcus lactis IL1403 [20]. Recombinant

protein production can be significantly increased through development of high-cell-densities,

such as in fed-batch and cell-recycle cultures [22, 26].

Lactic acid accumulation is also a strong source of acid-stress in L. lactis cultures [27-29].

Various studies have been conducted to examine the effect of acid-stress on gene expression and

protein production in lactic acid bacteria [17,18, 28-33]. In L. lactis, development of acid-stress

induces synthesis of stress proteins [28,29], decreases specific growth rate and leads to slower

glucose metabolism in the post-acidification phase [34]. The rate of transcription is reduced

during post-acidification phase and a stable pool of mRNA is maintained for subsequent

translational events [34]. Further, transcriptional analysis suggests that the regulation and

induction of ATR differs for chemically-defined and complex M17 media [33, 35]. We have

shown in earlier studies that suppression of acid-stress in L. lactis cultures leads to increased

recombinant protein production [17]. Since a higher level of lactic acid accumulation in fed-

batch cultures further enhances acid stress, it is essential to develop process strategies to combat

this problem in fed-batch cultures.

The work reported in this manuscript extends earlier studies in our laboratory on the production

of recombinant streptokinase in L. lactis cultures using the P170 expression system [17, 18].

Streptokinase is widely used as a thrombolytic agent in the treatment of acute myocardial

infarctions and there are many literature reports on production of streptokinase by recombinant

organisms[36-41]. One of the problems commonly encountered during streptokinase production

of 38

Accep

ted

Man

uscr

ipt

4

relates to the proteolysis of streptokinase [40, 42] and this was also observed during recombinant

streptokinase production by L. lactis [17]. It was shown that the surface protease HtrA, which is

up-regulated during development of acid-stress, is responsible for proteolysis of streptokinase

[18, 43, 44]. However, htrA-mutants of L. lactis do not efficiently secrete streptokinase [18]. We

have also shown that suppression the acid tolerance response (ATR) in L. lactis offers another

alternative to using a htrA-mutant of L.lactis [18]. It was shown that ATR-suppression not only

down-regulates htrA-expression and lowers streptokinase degradation but also leads to

substantially higher streptokinase production [17, 18].

This work focuses on developing strategies to enhance recombinant streptokinase production

using the P170-expression system. Initial studies, carried out in static-flasks and batch

bioreactors, investigate factors affecting recombinant protein production such as induction

strength, complex-nutrient supplementation, specific growth rate and the onset of ATR. Based on

these investigations, fed-batch processes were developed to improve recombinant streptokinase

productivity in L. lactis cultures.

2. Materials and methods

2.1 Bacterial strains and Plasmids

E. coli DH5 (Life Technologies, USA) was used as the primary host for construction and

propagation of plasmids. Lactococcus lactis strain MG1363 and plasmid pAMJ399 expression

system was obtained from Bioneer (Denmark). Plasmid pAMJ399 carries the pH-inducible P170

promoter, SP310mut2 signal sequence, erythromycin resistance marker and replicons for

of 38

Accep

ted

Man

uscr

ipt

5

propagation in L. lactis and E. coli. The plasmid pSK99 containing the recombinant

streptokinase gene was used for expression of the protein in L. lactis MG1363 [17].

2.2 Cultivation Medium

Lactococcus lactis was grown and maintained in M17 medium. M17 is a complex medium

containing casein-hydrolysate, 2.5 g/l; peptic digest of animal tissue, 2.5 g/l; peptic digest of

soyabean meal, 5.0 g/l; yeast-extract, 2.5g/l; beef-extract, 5g/l; ascorbic acid, 0.5 g/l; MgSO4,

0.25 g/l; and sodium β-glycerophosphate, 19.0 g/l. Erythromycin (2µg/ml) was added to

maintain selection pressure. The pH was regulated in the M17 medium using sodium β-

glycerophosphate. Glucose was added to the M17 medium at varying initial concentrations, in

order to vary lactic acid accumulation in the medium. In some experiments, the concentration of

the complex nutrients in the M17 media were also varied (Table 1). However, the proportion of

the various complex nutrients in the M17 media was kept the same as in the original M17

medium.

2.3 Static flask cultivation

All static flask cultivations were carried out at 30ºC, using the M17 media. Static flask cultures

were inoculated around mid-exponential phase. Samples were taken at frequent intervals and

analyzed for glucose, lactic acid and cell mass concentrations throughout the growth phase.

Streptokinase concentrations and ATR-development were analyzed in the stationary phase.

2.4 Batch cultures

of 38

Accep

ted

Man

uscr

ipt

6

Batch cultures were carried out in a 2.4-L bioreactor (KLF-2000, Bioengineering AG,

Switzerland). The pH was controlled at 6.5 with 2M sodium β- glycerophosphate or KOH.

Temperature and agitation were maintained at 30ºC and 300 rpm, respectively [45].

2.5 Chemostat cultures

Continuous culture studies were conducted at dilution rates ranging from 0.05 to 0.3 h-1 in a 2.4

L bioreactor, with a 1L working volume. Fresh M17 medium (without sodium β-

glycerophosphate, but keeping the same relative level of nutrients) was added to the bioreactor,

along with the required glucose concentration. Steady state was achieved after the feeding

process was continued till four to five reactor residence-times.

2.6 Fed-batch cultures

Fed-batch cultures were carried out at the same process condition as batch cultures, with an

initial culture volume of 1 L. Glucose was fed at 5 g l-1 h-1 or 10 g l-1 h-1, either alone or along

with M17 nutrients at 2 g l-1 h-1. The fed-batch experiments were operated with a concentrated

feed solution and low volumetric feed rate (~ 40 ml/hr). The same volumetric feed rate was

maintained for all fed batch experiments and the feed composition was kept constant during a

particular fed-batch experiment. To obtain different substrate feed rates for different fed-batch

experiments, only the feed concentrations were changed.

2.7 Analytical Methods

2.7.1 Dry Cell Weight estimation

of 38

Accep

ted

Man

uscr

ipt

7

Culture broth samples were centrifuged, washed with distilled water and dried in an oven at

105°C, until constant dry-cell weight (DCW) was observed. Biomass concentration was

measured in a spectrophotometer (Jasco, Japan) at 600 nm and calibrated with dry-cell weight.

2.7.2 Glucose and Lactate Analysis

To determine the extracellular metabolite concentration, samples were filtered through a 0.22 µm

filter. Glucose and lactate were analyzed based on enzymatic and electrochemical reactions using

a YSI analyzer (7100 model, Yellow Spring Instruments, OH, USA).

2.7.3 ATR Analysis

Cells were centrifuged and re-suspended in fresh G5-M17 medium (without sodium -

glycerophosphate) and the medium was adjusted to pH 4 with acetic acid. The acid-stressed

culture was immediately sampled after re-suspension and plated on G5-M17 plates containing

the appropriate antibiotic. The same procedure was repeated with the acid-stressed culture after

incubating it for 2 hours. The cell numbers in each sample were estimated by the number of

colony-forming units (CFU) on each plate, after incubation for 24 hours at 30ºC. A comparison

of the CFU between the two samples gave a measure of organisms surviving acid-stress and the

percentage of surviving organisms was taken as a measure of ATR.

2.7.4 Streptokinase activity

The culture-supernatant was obtained by centrifugation of culture broth for 10 min at 8000 rpm

and 4°C. Activity of streptokinase from culture-supernatant was quantified by Chromozym PL

Assay [36]. The specific-production of recombinant streptokinase was represented as activity of

of 38

Accep

ted

Man

uscr

ipt

8

streptokinase obtained per gram of cells (IU/g of cells).The specific-production did not account

for the proteolytically-degraded streptokinase, which does not exhibit any enzymatic activity

[46]. It was also assumed that the specific activity of un-degraded streptokinase (i.e. IU/mg-Stk)

remained same in all experiments.

2.7.5 Polyacrylamide Gel Electrophoresis (SDS-PAGE)

Gel electrophoresis was carried out using SDS-Polyacrylamide gels and stained with Coomassie

Brilliant Blue. Stained gels are scanned using a gel-documentation system (Gel DocTM, Biorad)

and analyzed using Quantity One software (Biorad, USA).

2.7.6 Densitometry analysis

The percentage of degradation of streptokinase from SDS-PAGE gels was estimated by

densitometry analysis using Quantity One software (Biorad). The secreted native protein Usp45

was used for normalization [17].

2.7.7 Real-time PCR

Real-time PCR was done to analyze the mRNA levels of streptokinase using Qiagen’s

Quantitect® SYBR Green qPCR kit, according to manufacturer’s instructions (Applied

Biosystems, USA) The kit has a Hotstrat Taq DNA polymerase. All samples were analyzed in

duplicate and the average value is reported. Relative quantification of the mRNA was done using

16S rRNA as endogenous reference gene. The primers used for this study were designed using

Web-based Primer 3 software. The primers for streptokinase are: Forward - 5’

of 38

Accep

ted

Man

uscr

ipt

9

GGTGTCATCGTGATTATCC3’ and Reverse - 5’ GCGAACGTAACTTAGACTTC 3’. The

primers for 16S are: Forward - 5’ GCGAACGTAACTTAGACTTC 3’ and Reverse - 5’

GCGAACGTAACTTAGACTTC 3’. The primers were designed such that the gene can be

cloned in-frame with the Sp310mut2 signal sequence in BglII and PstI sites of pAMJ399. The

PCR amplification was done using Mastercycler (Eppendorf, Germany) and the conditions used

for the amplification were as follows: initial denaturation at 94°C for 3 minutes, followed by 30-

cycle sequence of denaturation (94°C, 30 secs.), annealing (55°C, 30 secs.), and extension (72°C,

60 secs.). The final extension (after 30 cycles) was at 72°C for 7 minutes. The enzyme used was

Deep Vent Polymerase (New England Biolabs, USA) and reaction was set according to

manufacturer’s instructions.

3. Results and Discussion

3.1 Factors affecting recombinant streptokinase production in L. lactis cultures

Batch, chemostat and fed-batch culture experiments were carried out to investigate recombinant

streptokinase production using the P170 expression system in Lactococcus lactis cultures. Batch

experiments were carried out in static flasks as well as un-aerated bioreactors to investigate the

effects of induction strength, complex-nutrient supplementation and suppression of acid-

tolerance response (ATR) on recombinant streptokinase production. Chemostat studies were

undertaken to examine the effect of specific growth rate on recombinant streptokinase

production. The insights obtained from these experiments were used in designing fed-batch

processes for enhanced production of recombinant streptokinase.

3.1.1 Effect of induction strength

of 38

Accep

ted

Man

uscr

ipt

10

The induction strength of the P170 promoter depends on lactate concentration in the culture.

The concentration of lactic acid needed for induction depends on the culture pH value; at low

pH, a lower lactic acid concentration is needed for induction [21]. The strength of auto-induction

due to lactic acid accumulation was studied by varying the initial glucose concentration in the

M17 medium from 5 g/l to 20 g/l in the static flask experiments (SF1–SF4) (Table 1). The

concentration of sodium β-glycerophosphate was increased in order to buffer the medium against

increasing lactic acid concentration, while keeping other M17components at the same level. The

stationary-phase culture pH dropped below 6 in all the static flask cultures, thus triggering

expression of the recombinant protein. Streptokinase production was observed to increase with

increasing lactic acid accumulation (Table 2). It was also observed that streptokinase was

substantially degraded in all the cultures (Table 2, ). Our earlier work has shown by Western blot

analysis that the culture supernatant contains ~ 37 kDa degraded products of streptokinase,

which has lost approximately 10kDa at the C-terminal end [17, 18] (). This region forms a major

part of the domain required for streptokinase to interact with plasminogen and hence the removal

of this region results in loss of activity of streptokinase [46].

Since the level of degradation as well as recombinant protein produced depends on the extent of

ATR [17], the ATR-levels were kept the same in static flask experiments SF1-SF4. In order to

study the effect of pH on induction strength, a bioreactor experiment (BB1) was conducted at pH

6.5, controlled with KOH addition (Table 2). Comparison of the streptokinase production

obtained in BB1 with that obtained in SF2 shows that activity increases with decreasing pH.

Amount of lactic acid needed to induce the promoter depends on the pH value and a lower lactic

acid concentration is needed for induction at lower pH [21]. Therefore, induction strength also

increases with decreasing pH for the same lactate concentration. .

of 38

Accep

ted

Man

uscr

ipt

11

Growth-phase effects were independently investigated by examining the promoter activity at

different growth stages in batch culture. First, the promoter strength was measured at different

growth stages in a batch experiment, by measuring the mRNA levels of streptokinase, relative to

the mid-exponential phase. As seen in Figure 1, the streptokinase mRNA level increases

considerably towards the late-exponential growth phase and stationary phase for the experiment

with complete ATR-development (SF1), thus exhibiting increased promoter activity. This is due

to increasing lactate accumulation, which increased from ~ 1.25 g/l in the exponential phase to ~

3.2 g/l in the late-exponential and up to ~ 4.3 g/l in stationary phases [21]. However, the same

increase in mRNA-level was not observed for an ATR-suppressed culture with the similar lactate

levels (SF7), due to the lowering of induction strength at a higher stationary-phase pH (Table 2).

To differentiate the effect of growth-phase on induction strength from lactate concentration

effects, a separate set of experiments were carried out by addition of a known amount of lactate

at different growth phases of the culture ( Figure 2). In cultures where extra lactate was not

added (Lactate-- culture, Figure 2), the lactate concentrations were 3.6 g/l, 5.5 g/l and 6.6 g/l,

respectively, in the mid-exponential, late-exponential and stationary phases. A higher amount of

streptokinase production was observed in the late-exponential phase in comparison to the mid-

exponential phase, presumably due to higher lactate concentration (induction strength) in the

former. However, in a separate set of experiments, lactate was added to bring the overall lactate

concentration to 10 g/l in each phase of the culture (Lactate++ culture, Figure 2). As seen in the

Figure 2, streptokinase production was highest during the late exponential phase (and ~ 60%

more than the mid-exponential phase), even when lactate concentration was same in each phase.

of 38

Accep

ted

Man

uscr

ipt

12

This also correlates with the sharp increase in mRNA level seen during the transition from mid-

exponential to late-exponential phase (Figure 1). The slight decrease in streptokinase activity

observed in the stationary phase may be attributed to the increase in ATR level (and

correspondingly higher streptokinase degradation) seen during this phase, relative to the late-

exponential phase. This may also be due to lactate accumulation above a certain threshold

resulting in both growth rate and productivity decrease [21].

3.1.2 Effect of Complex-nutrient supplementation

To study the effect of the complex-nutrients on streptokinase expression, the concentrations of

all the components in the M17 medium (except glucose and β-glycerophosphate) were varied in

shake flask cultures SF1, SF5, and SF6 (Table 2). Initial glucose concentration was kept the

same (5 g/l) in order to keep similar induction strength (stationary-phase pH and lactic acid

accumulation), while sodium β-glycerophosphate concentration was kept same (19 g/l) in order

keep similar ATR levels. The specific-production of recombinant streptokinase increased by 4 -

6 fold due to the enrichment of complex-nutrients in the medium (Table 2).

3.1.3 Effect of ATR Suppression

Literature reports have shown that the intracellular pH is a major factor in ATR-development

[47]. Secondly, mutants of phosphate uptake system have revealed that low intracellular

phosphate concentrations have been found to trigger ATR [27]. In L. lactis, the intracellular

phosphate concentration depends on activity of phosphate uptake system and external phosphate

concentration [48]. It has been observed that intracellular pH and phosphate concentrations can

be increased by increasing the level of the buffering agent (sodium β -glycerophosphate) in the

medium [49]. This technique has been found to be a simple and effective way of suppressing the

of 38

Accep

ted

Man

uscr

ipt

13

onset of ATR [17]. Earlier studies in our laboratory have shown that suppression of ATR (by

addition of sodium β-glycerophosphate) correlates strongly with enhanced production of the

recombinant streptokinase in L. lactis cultures [17, 18]. In order to compare the effect of ATR

suppression at similar induction strengths, a batch bioreactor experiment (BB2) was carried out,

wherein the pH was controlled by the addition of the sodium β-glycerophosphate buffer (Table

2). This resulted in suppression of ATR, unlike experiment BB1 where pH-control by KOH

addition resulted in complete development of ATR (Table 2). In an independent set of

experiments, Sriraman has shown that, in KOH-based pH-controlled cultures, the intracellular

pH decreases sharply in the late-exponential / early-stationary phases, correlating with complete

(~ 100%) ATR development in this phase [49]. Comparison of the two bioreactor experiments

(with comparable induction strengths and medium composition) demonstrates that ATR

suppression resulted in ~ 4-fold increase in the specific production of streptokinase. It can also

be observed that the culture with complete ATR-development exhibits a much higher level of

streptokinase degradation than the ATR-suppressed culture ( Figure 3, Table 2).

3.1.4 Effect of specific growth rate

A series of chemostat studies were performed to examine the effect of specific growth rate

(dilution rate) on specific-production of recombinant streptokinase. The dilution rate was

increased from 0.05 to 0.3 h-1 in two independent set of experiments, one with high level of

ATR-development and another with ATR-suppression. As observed earlier in the batch

experiments, the chemostat experiments with ATR-suppression showed much higher specific-

production of recombinant streptokinase than the experiments with high ATR-development. It

was also observed that the ATR-level decreases marginally with decreasing specific growth rate

of 38

Accep

ted

Man

uscr

ipt

14

and this may account for the higher recombinant streptokinase production at these conditions.

Despite the decrease in the specific-production of streptokinase with increasing specific growth

rate, the volumetric productivity increases with increasing dilution rates due to the increase in

biomass productivity. The volumetric productivity obtained at higher dilution rates in chemostat

experiments is better than the productivity obtained in corresponding batch bioreactor

experiments. For the experiments conducted with ATR-suppression, the best volumetric

productivity achieved in batch processes was ~ 20000 IU l-1 hr-1, while it was ~ 44000 IU l-1 hr-1

in chemostat at a dilution rate of 0.3 hr-1 (Table 3).

3.2 Fed-batch process studies

Recombinant protein productivity is often limited in batch processes, due to low biomass

production, substrate limitations and lack of control on the parameters affecting recombinant

protein expression. To overcome limitations of batch and continuous processes, fed-batch

processes were investigated for enhancing recombinant streptokinase production. The initial

medium composition used in all these processes was G10M17-II (Table 1). The fed-batch

processes were operated with constant volumetric feed rate, allowing the development of a quasi-

steady-state operation. The low specific growth rate obtained in the fed-batch processes permits a

higher specific productivity, as seen from chemostat studies (Table 3). We also sought to

independently investigate the effects of induction strength, complex-nutrient supplementation

and ATR-suppression on the productivity of the fed-batch processes. In order to normalize the

basis for comparison of productivity, the time period for each calculation was taken from the

beginning of the logarithmic growth phase till two hours after the onset of the stationary phase,

at which point no increase was observed in the activity values of the recombinant streptokinase.

of 38

Accep

ted

Man

uscr

ipt

15

Initial studies were carried out at a culture pH of 6.5, controlled using KOH addition, which

allowed for complete ATR-development (FB1 – FB4, Table 4). The main objective of these fed-

batch experiments was to assess the effect of increasing induction strength (lactic acid

accumulation) and complex-nutrient supplementation on recombinant streptokinase production.

These fed-batch experiments (FB1-FB4) were repeated with ATR-suppression (FB5 - FB8,

Table 4), to assess the effect of this parameter, in addition to the other parameters. In these

experiments, the culture pH was controlled at 6.5 by addition of sodium -glycerophosphate.

3.2.1 Effect of glucose feed- rates and lactic acid accumulation

The effect of the induction strength (lactic acid accumulation) and glucose feed-rates were

assessed by constant-rate feeding of glucose alone at 5 gl-1h-1 and 10 gl-1h-1. The glucose feeding

was started at a cell density around 1 g/l and was continued for 6 hours. Surprisingly, the

specific-production of streptokinase was quite low at a glucose feed rate of 5gl-1h-1 (FB1) even

though a substantial amount of lactic acid (~ 15 g/l) was accumulated. However, when the feed

rate was increased to 10 gl-1h-1 (FB2), around 3.6-fold increase was observed in specific-

production and volumetric productivity of streptokinase (Table 4). As observed in static flask

studies (Table 2) this increase could be due to higher lactic acid accumulation (induction

strength). However, the scale of increase is higher than accounted by induction strength. The

increased production of recombinant streptokinase could also be influenced by the rates of

glucose consumption.

3.2.2 Effect of complex-nutrient supplementation

of 38

Accep

ted

Man

uscr

ipt

16

A significant increase in specific-production of streptokinase was observed when glucose feed

was supplemented with the other complex-nutrients of the M17 medium (Table 4). The

supplementation of M17 complex-nutrients at 2 gl-1h-1 in addition to 5 gl-1h-1 of glucose feed

(FB3) resulted in ~ 2.5-fold enhancement of specific-production and volumetric productivity, in

comparison to FB1. When the complex-nutrients were supplemented at a rate of 2 gl-1h-1 to the

increased glucose feed rate (10 gl-1h-1) in FB4, it resulted in around 4.4 fold increase in specific-

production and around 7-fold increase in volumetric productivity, in comparison to FB2. It was

observed in all the experiments that the lactic acid accumulation depended only on the amount of

glucose fed and was not affected by the supplementation of the complex nutrients (Table 4). The

fraction of streptokinase degraded (~ 72 - 75%) as well as the level of ATR development (~

100%) was comparably similar in all these experiments. The enhancement in specific-production

due to complex-nutrient supplementation reiterates the batch experimental data (Table 2).

3.2.3 Effect of ATR-suppression

The effect of ATR suppression on recombinant streptokinase production in fed-batch processes

was studied in experiments FB5 - FB8 (Table 4). The pH was controlled at 6.5 by the addition of

the buffering agent, sodium β-glycerophosphate, and this resulted in suppression of ATR-level to

~ 3 - 4% and lowered streptokinase degradation to ~ 50 - 55% in all the experiments. Other

factors such as glucose feed-rate and complex-nutrient supplementation were kept the same as

described in fed-batch processes FB1-FB4 (Table 4). As seen earlier in the batch experiments,

ATR-suppression resulted in significant enhancement of specific-production of streptokinase.

While feeding 5 gl-1h-1 of glucose, ATR-suppression in FB5 resulted in nearly 20-fold increase in

specific-production and ~ 10-fold increase in volumetric productivity, compared to FB1. The

of 38

Accep

ted

Man

uscr

ipt

17

corresponding experiments at 10 gl-1h-1glucose-feeding (FB6, FB2) resulted in nearly 8-fold

increase in specific-production and ~ 5-fold increase in volumetric productivity, when ATR was

suppressed. The increase in the volumetric productivity of streptokinase was lower in

comparison to specific-production, due to the inhibition of cell growth during the ATR-

suppression experiments. The cell density achieved during ATR-suppressed cultures were only

about 60% of that achieved during ATR-developed fed-batch cultures (Table 4). Since, all the

fed-batch experiments were carried out over the same time period (~ 11 hours) and the same

feeding time (~ 6 hours), the average specific growth rate was lower in the ATR-suppressed

cultures.Combining complex-nutrient supplementation with ATR-suppression (FB7, FB8)

resulted in further enhancement of specific-production and volumetric productivity (Table 4). A

comparison of FB3 and FB7 (Table 4) shows that ATR-suppression resulted in nearly 12-fold

increase in specific-production and ~ 7-fold increase in volumetric productivity of streptokinase.

At a higher glucose feed (FB4, FB8), ATR-suppression resulted in nearly 3.6-fold increase in

specific-production and ~ 2.5-fold increase in volumetric productivity. Altogether, around 60-

fold increase in specific-production and volumetric productivity was observed due the

combination of enhanced glucose feed rates, complex-nutrient supplementation and ATR

suppression during the fed-batch processes.

4. Conclusions

This work has investigated the various factors affecting recombinant streptokinase production in

L. lactis cultures, using the P170 expression system. The strength of induction plays a critical

role in recombinant protein expression and in case of chemical inducers it is usually a function of

inducer concentration. In this work we have shown that the induction strength of the P170

of 38

Accep

ted

Man

uscr

ipt

18

system is mainly influenced by lactate concentration in the culture, with the required lactate

depending on the culture pH. Lower culture pH required lower amounts of lactate for induction.

. The main disadvantage of such a system is that it is difficult to build up a high cell density in

fed-batch processes without accumulating lactate. However, this limitation can be overcome in a

perfusion reactor or cell-recycle reactor [21]. The effect of complex-nutrient supplementation is

easy to understand since an increased supply of amino acids would lead to increased protein

synthesis. Productivity enhancement due to suppression of ATR is a more complex phenomenon,

due to involvement of multiple factors. In general, if the host cell machinery does not have to be

geared up for combating acid-stress, such as increased synthesis of stress-proteins and

maintenance of intracellular pH homeostasis, it can lead to more resources and energy being

available for recombinant protein synthesis.

It was observed that enhanced glucose feed-rates led to an increase in recombinant protein

productivity, again presumably due to higher energy availability. A combination of higher

glucose feed-rate and complex-nutrient supplementation in the feed resulted in a synergistic

effect of 25-fold increase in volumetric productivity. Suppression of ATR had an additional

effect in increasing recombinant protein productivity, although the impact of this factor was less

in fed-batch processes having a combined feed (glucose + complex nutrients) at higher glucose

feed rates. The highest specific-production and volumetric productivity obtained in this work

compares well with that obtained for the same protein with a secretory expression system in

recombinant E. coli cultures [50]. Further engineering of the L. lactis cellular machinery and

process optimization studies with these strains could make it a worthwhile host organism for

recombinant protein production.

of 38

Accep

ted

Man

uscr

ipt

19

5. References

[1] E. Garcia-Fruitos, Lactic acid bacteria: a promising alternative for recombinant protein

production, Microb. Cell. Fact. 11 (2012) doi:10.1186/1475-2859-11-157.

[2] L. Bredmose, S.M. Madsen, A. Vrang, P. Ravn, M.G. Johnsen, J. Glenting, J. Arnau, H.

Israelsen, Development of a heterologous gene expression system for use in Lactococcus

lactis, In : O.W. Merten, D. Mattanovich, C. Lang, G. Larsson , P. Neubauer, D. Porro, P.

Postma, J.T.D. Mattos, J.A. Cole (ed) Recombinant protein production with prokaryotic

and eukaryotic cells. A comparative view on host physiology, Kluwer Academic Press,

Dordrecht, Netherlands, 2001, pp. 269-275.

[3] S. Nouaille, L.A. Ribeiro, A. Miyoshi, D. Pontes, Y.L. Loir , S.C. Oliveira, P. Langella,

V. Azevedo, Heterologus protein production and delivery systems for Lactococcus

lactis, Genet. Mol. Res. 2 (2003) 102-111.

[4] E. Morello, L.G. Bermudez-Humaran, D. Llull, V. Sole, N. Miraglio, P. Langella, I.

Poquet, Lactococcus lactis, an efficient cell factory for recombinant protein production

and secretion, J. Mol. Microbio. Biotechnol. 14 (2008) 48-58.

[5] D.M. Linares, J. Kok, B. Poolman, Genome Sequences of Lactococcus lactis MG1363

(Revised) and NZ9000 and Comparative Physiological Studies, J. Bacteriol. 192 (2010)

5806–5812.

[6] U. Wegmann, M. O'Connell-Motherway, A. Zomer, G. Buist, C. Shearman, C. Canchaya,

M. Ventura, A. Goesmann , M.J. Gasson, O.P. Kuipers, D. Van Sinderen, J. Kok, The

complete genome sequence of the lactic acid bacterial paradigm Lactococcus lactis

subsp. cremoris MG1363, J. Bacteriol. 189 (2007) 3256-3270.

of 38

Accep

ted

Man

uscr

ipt

20

[7] A. Bolotin, P Wincker, S Mauger, O Jaillon, K Malarme, J. Weissenbach, S.D. Ehrlich,

A. Sorokin, The complete genome sequence of the lactic acid bacterium Lactococcus

lactis ssp. lactis IL1403.Gen. Res. 11 (2001) 731-753.

[8] P. Le Bourgeois, M. Lautier, L.V. Berghe, M. Gasson, P. Ritzenthaler, Physical and

genetic map of the chromosome of Lactococcus lactis subsp. cremoris MG1363

chromosome: Comparison with that of Lactococcus lactis subsp. lactis IL1403 reveals a

large genome inversion, J. Bacteriol. 177 (1995) 2840–2850.

[9] H. Israelsen, S.M. Madsen, A. Vrang, E.B. Hansen, E. Johansen, Cloning and partial

characterization of regulated promoters from Lactococcus lactis Tn917-lacZ integrants

with the new promoter probe vector pAK80, Appl. Environ. Microbiol. 61 (1995) 2540-

2547.

[10] I. Mireau, M. Kleerebezem, 10 years of the nisin-controlled gene expression system

(NICE) in Lactococcus lactis, Appl. Microbiol. Biotechnol. 68 (2005) 705-717.

[11] D. Liull, I. Poquet, New Expression system tightly controlled by zinc availability in

Lactococcus lactis, Appl. Environ. Microbiol. 70 (2004) 5398-5406.

[12] S.M. Madsen, J. Arnau, A. Vrang, M. Givskov, H. Israelsen, Molecular characterization

of the pH-inducible and growth phase-dependent promoter P170 of Lactococcus lactis,

Mol. Microbiol. 32 (1999) 75-87.

[13] K.A. Azizan, S.N. Baharum, N.M. Noor, Metabolic Profiling of Lactococcus lactis under

different culture conditions, Molecules 17 (2012) 8022-8036.

[14] A.R. Neves, W.A. Pool, J. Kok , O.P. Kuipers, H. Santos, Overview on sugar metabolism

and its control in Lactococcus lactis – The input from in vivo NMR, FEMS Microbiology

Reviews 29 (2005) 531–554.

of 38

Accep

ted

Man

uscr

ipt

21

[15] S. Liu, R. Tobias, S.McClure, G. Styba, O. Shi, G. Jackowski, Removal of endotoxin

from recombinant protein preparations, Clin. Biochem. 30 (1997) 455-463.

[16] Y.L. Loir ,V. Azevedo, S.C. Oliveira, D.A. Freitas, A. Miyoshi, L.G. Bermúdez-

Humaran, S .Nouaille ,L.A. Ribeiro, S. Leclercq, J.E. Gabriel, V.D. Guimaraes, M.N.

Oliveir, C. Charlier, M. Gautier, P. Langella, Protein secretion in Lactococcus lactis : an

efficient way to increase the overall heterologous protein production, Microb. Cell. Fact.

4 (2005) doi:10.1186/1475-2859-4-2

[17] K. Sriraman, G. Jayaraman, Enhancement of recombinant streptokinase production in

Lactococcus lactis by suppression of acid tolerance response, Appl. Microbiol.

Biotechnol. 72 (2006) 1202–1209.

[18] K. Sriraman, G. Jayaraman, HtrA is essential for efficient secretion of recombinant

proteins in Lactococcus lactis, Appl. Environ. Microbiol. 74 (2008) 7442- 7446.

[19] I. Mierau, K. Oleiman, J. Mond, E.J. Smid, Optimization of the Lactococcus lactis nisin-

controlled gene expression system NICE for industrial applications, Microb. Cell. Fact. 4

(2005) doi: 10.1186/1475-2859-4-16

[20] G.M. Oddone, C.Q. Lan, H. Rawsthorne, D.A. Mills, D.E. Block, Optimization of fed-

batch production of the model recombinant protein GFP in Lactococcus lactis, Biotech.

Bioeng.. 96 (2007) 1127-1138.

[21] C.M. Jorgensen, A. Vrang, S.M. Madsen, Recombinant protein expression in

Lactococcus lactis using the P170 expression system, FEMS Microbiol. Lett. 351 (2014)

170-178.

[22] S.M. Madsen, A. Vrang, L.H. Pedersen, S.A. MacDonald, J.U. Rype, A. Garde, A

regulatory acceptable alternative to E. coli: high yield recombinant protein production

of 38

Accep

ted

Man

uscr

ipt

22

using the Lactococcus lactis P170 expression system combined with "Reverse electro

enhanced dialysis" (REED) for lactate control, Microb. Cell. Fact. 5 (2006)

doi:10.1186/1475-2859-5-S1-P80

[23] S.M. Madsen, T. Hindre, J. Le Pennec, H. Israelsen, A. Dufour, Two acid-inducible

promoters from Lactococcus lactis require the cis-acting ACiD box and the transcription

regulator RcfB. Mol. Microbial. 56 (2005) 735-746

[24] J. Glenting, L.K. Poulsen, K. Kato, S.M. Madsen, H. Frokiaer, C. Wendt, H.W. Sorensen,

Production of Recombinant Peanut Allergen Arah 2 using Lactococcus lactis, Microb.

Cell. Fact. 6 (2007) doi:10.1186/1475-2859-6-28.

[25] N. Tremillon, N. Issaly, J. Mozo, T. Duvignau, H. Ginisty, E. Devic, I. Poquet,

Production and purification of staphylococcal nuclease in Lactococcus lactis using a new

expression secretion system and a pH-regulated mini-reactor, Microb. Cell. Fact. 9

(2010) doi:10.1186/1475-2859-9-37

[26] T. Suzuki, A dense culture system for microorganisms using a stirred ceramic membrane

reactor incorporating asymmetric porous ceramic filters, J. Ferment. Bioengg. 82 (1996)

264-271

[27] F. Rallu, A. Gruss, S.D. Ehrlich, E. Maguin , Acid- and multistress-resistant mutants of

Lactococcus lactis: identification of intracellular stress signals, Mol. Microbiol. 35

(2000) 517-528.

[28] A. Hartke, S Bouche, J.C. Giard, A. Benachour, P. Boutibonnes, Y. Auffray, The lactic

acid stress response of Lactococcus lactis subsp. lactis, Curr. Microbiol. 33 (1996) 194-

199.

of 38

Accep

ted

Man

uscr

ipt

23

[29] A. Hartke, S. Bouche, J.M. Laplace , A. Benachour, P. Boutibonnes, Y. Auffray, UV-

inducible proteins and UV-induced cross-protection against acid, ethanol, H2O2 or heat

treatments in Lactococcus lactis subsp. lactis, Arch. Microbiol. 163 (1995) 329–336.

[30] E. O’Sullivan, S. Condon, Relationship between Acid Tolerance, Cytoplasmic pH, and

ATP and H+-ATPase Levels in Chemostat Cultures of Lactococcus lactis, Appl. Environ.

Microbiol. 65 (1999) 2287–2293.

[31] J. Koponen, K. Laakso, K. Koskenniemi, M. Kankainen, K. Savijoki, T.A. Nyman, W.M.

de Vos, S. Tynkkynen, N. Kalkkinen, P. Varmanen, Effect of acid stress on protein

expression and phosphorylation in Lactobacillus rhamnosus GG, J. Proteomics 75 (2012)

1357-1374.

[32] H. Trip, N.L. Mulder, J.S. Lolkema, Improved Acid Stress Survival of Lactococcus lactis

expressing the histidine decarboxylation pathway of Streptococcus thermophilus

CHCC1524, J. Biol. Chem. 287 (2012) 11195–11204.

[33] A. Budin-Verneuil, V. Pichereau, Y. Auffray, D.S. Ehrlich, E. Maguin, Proteomic

characterization of the acid tolerance response in Lactococcus lactis MG1363,

Proteomics 5 (2005) 4794-4807.

[34] S. Even, N.D. Lindley, P. Loubiere, M. Cocaign-Bousquet, Dynamic response of

catabolic pathways to autoacidification in Lactococcus lactis: transcript profiling and

stability in relation to metabolic and energetic constraints, Mol. Microbiol. 45 (2002)

1143-1152.

[35] A. Budin-Verneuil, V. Pichereau, Y. Auffray, D.S. Ehrlich, E. Maguin, Proteome

phenotyping of acid stress-resistant mutants of Lactococcus lactis MG1363, Proteomics 7

(2007) 2038-2046.

of 38

Accep

ted

Man

uscr

ipt

24

[36] S.S.Yazdani, K.J. Mukherjee, Overexpression of streptokinase using a fed-batch strategy,

Biotechnol. Lett. 20 (1998) 923–927.

[37] S.L. Wong, R. Ye, S. Nathoo, Engineering and production of streptokinase in a Bacillus

subtilis expression-secretion system, Appl. Environ. Microbiol. 60 (1994) 517-523.

[38] M.J. Hagenson, K.A. Holden, K.A. Parker, P.J. Wood, J.A. Cruze, M. Fuke, T.R.

Hopkins, D.W. Stroman, Expression of streptokinase in Pichia pastoris yeast, Enz.

Microb. Technol. 11 (1989) 650–656.

[39] J. Pratap, G. Rajamohan, K.L. Dikshit, Characteristics of glycosylated streptokinase

secreted from Pichia pastoris: enhanced resistance of SK to proteolysis by glycosylation,

Appl. Microbiol. Biotechnol. 53 (2000) 469–475.

[40] R. Kumar, J. Singh, Expression and secretion of a prokaryotic protein streptokinase

without glycosylation and degradation in Schizosaccharomyces pombe, Yeast, 21 (2004)

1343–1358.

[41] B. Balagurunathan, N.S. Ramchandra, G. Jayaraman, Enhancement of stability of

recombinant streptokinase by intracellular expression and single step purification by

hydrophobic interaction chromatography, Biochem. Eng. J. 39 (2008) 84-90.

[42] B. Balagurunathan, G. Jayaraman, Cellular response to accumulation of recombinant

proteins in the E. coli inner membrane: Implications for proteolysis and productivity of

the secretory expression system, Biochem. Eng J. 39 (2008) 74-83.

[43] C. Foucoud-Scheunemann, I. Poquet, HtrA is a key factor in the response to specific

stress conditions in Lactococcus lactis, FEMS Microbiol. Lett. 224 (2003) 53-59.

of 38

Accep

ted

Man

uscr

ipt

25

[44] I. Poquet, V. Saint, E. Seznec, N. Simoes, A. Bolotin, A. Gruss, HtrA is the unique

surface housekeeping protease in Lactococcus lactis and is required for natural protein

processing, Mol. Microbiol. 35 (2000) 1042-1051.

[45] M. Nordkvist, N.B.S. Jensen, J. Villadsen, Glucose Metabolism in Lactococcus Lactis

MG1363 under different aeration conditions: Requirement of acetate to sustain growth

under microaerobic Conditions, Appl. Environ. Microbiol. 69 (2003) 3462-3468.

[46] D.M. Kim, S.J. Lee, S.K. Yoon, S.M. Byun, Specificity role of the streptokinase C-

terminal domain in plasminogen activation, Biochem. Biophys. Res. Commun. 290

(2002) 585–588

[47] E. O’Sullivan, S. Condon, Intracellular pH is a major factor in the induction of tolerance

to acid and other stresses in Lactococcus lactis, Appl. Environ. Microbiol. 63 (1997)

4210-4215.

[48] B. Poolman, R.M.J. Nijssen, W.N. Konings, Dependence of Streptococcus lactis

phosphate transport on internal phosphate concentration and internal pH, J. Bacteriol. 169

(1987) 5373-5378.

[49] K. Sriraman, Effect of acid tolerance response on recombinant protein production in

Lactococcus lactis, Ph.D. Thesis, IIT-Madras, Chennai, India, 2008.

[50] S. Ramalingam, P. Gautam, K.J. Mukherjee, G. Jayaraman, Effects of post-induction feed

strategies on secretory production of recombinant streptokinase in Escherichia coli,

Biochem. Eng. J. 33 (2007) 34-41.

of 38

Accep

ted

Man

uscr

ipt

26

Figure captions

Figure 1.Variations of streptokinase mRNA in media with different growth phase and varying

buffering capacity in ATR-developed and ATR-suppressed batch cultures

Cell densities (OD600) equivalent to 0.3 (early-exponential phase), 1 (mid-exponential phase), 2.5

(late exponential phase), 3/3.2 (transition to stationary phase), and 3.6/3.8(stationary phase). The

stationary phase point (maximum cell density reached) was 3.8 for G5-M17 and 3.6 for G5-M17

II. The mRNA levels at 0.3 OD600 was considered as the basal level and was used as the

calibrator sample for relative quantification of mRNA levels. The change in streptokinase

mRNA levels during growth was expressed as fold-change from the basal level.

Figure 2. Effect of growth phases on specific production of recombinant streptokinase in ATR-

developed and ATR-suppressed batch cultures

Figure 3.SDS-PAGE analysis of streptokinase from batch bioreactor culture supernatant. Lane 1:

Batch run BB1 with ATR development, pH was controlled with 2M KOH. Lane 2. Protein

Marker Lane 3:Batch run BB2 (with ATR suppression), pH was controlled with sodium β-

glycerophosphate.

of 38

Accep

ted

Man

uscr

ipt

27

Highlights:

1. The P170 promoter was used to express recombinant streptokinase in batch and fed-batch

cultures of Lactococcus lactis.

2. Streptokinase production is affected by induction strength, complex-nutrient

supplementation and acid tolerance response.

3. Induction strength depends on lactate concentration in the culture, with required lactate

depending on culture pH.

4. Recombinant streptokinase production is most enhanced by suppression of acid tolerance

response.

5. A combination of above factors resulted in a 60-fold increase in productivity in fed-batch

cultures over batch cultures.

of 38

Accep

ted

Man

uscr

ipt

28

List of Tables

Table 1 Fermentation Media used in this study

Medium Initial glucose concentration

(g/L)

Total complex-nutrients concentration in M17 medium

(g/L)

Concentration of sodium β-glycero-phosphate in M17 (g/L)

G5M17 5 1X 19

G5M17-3X 5 3X 19

G5M17-5X 5 5X 19

G5M17-II 5 1X 38

G10M17-II 10 1X 38

G15M17-III 15 1X 57

G20M17-III 20 1X 57

1X – Original concentration of complex nutrients in M17 medium, as given in Materials and Methods

3X – Each nutrient concentration is increased to three times the concentration in M17 medium, while maintaining the same relative composition

5X – Each nutrient concentration is increased to five times the concentration in M17 medium, while maintaining the same relative composition

of 38

Accep

ted

Man

uscr

ipt

29

Table 2 Effect of induction strength, complex nutrient supplementation and ATR development on

recombinant streptokinase production in static-flasks and batch bioreactors.

Expt. No.

Medium

Stationary phase lactate

conc.

(±0.2) (g/L)

Stationary phase pH

(± 0.2)

ATR developed

(±2) (%)

Degradationof STK

(±3) (%)

Specific Production of

STK

(IU/g-DCW)

Static - Flask experiments

SF1 G5M17 4.51 5.74 100 76 19875

SF2 G10M17-II 6.6 5.15 94.5 73 34625

SF3 G15M17-III 9.2 5.5 99 75.8 46620

SF4 G20M17-III 10.15 5.2 99 74.6 50926

Effect of complex nutrient supplementation

SF5 G5M17-3X 4.45 5.69 99 71.5 81052

SF6 G5M17-5X 4.28 5.75 99.5 73.2 126638

Effect of ATR suppression

SF7 G5M17-II 4.35 6.43 11 53 58818

Batch Bioreactor Experiments with alkali-controlled pH

BB1 G10M17-II 6.7 6.5 100 73.8 24395

of 38

Accep

ted

Man

uscr

ipt

30

Batch Bioreactor Experiments with sodium β-glycerophosphate controlled pH

BB2 G10M17-II 6.9 6.5 12 55.4 96560

* Data shown are mean values derived from two fermentation runs.

Streptokinase activity was measured during the stationary growth phase in duplicate

Average of the duplicate values are reported

IU – International Units, DCW – Dry Cell Weight

of 38

Accep

ted

Man

uscr

ipt

31

Table 3 Effect of specific growth rate on specific production of recombinant streptokinase in chemostat cultures

Dilution rate

(1/h)

Cell dry weight

(g/L)

Lactate

(±0.2) (g/L)

ATR

developed

(±2) (%)

Specific production of STK

(IU/g-DCW)

Volumetric

Productivity of STK

(IU/L/h)

ATR developed cultures

0.05 2.49 18.9 66.7 37046 4612

0.1 2.24 18.5 75 38455 8637

0.2 2.06 21 88.5 25354 10440

0.3 1.54 12.2 92.3 23576 10884

ATR suppressed cultures

0.05 2.27 19.1 2.5 82010 9300

0.1 2.12 18.01 4.1 78537 16650

0.2 1.92 20.5 6.5 71875 27600

0.3 1.48 13.5 7.2 100000 44400

* Initial medium in all experiments was G10M17-II

of 38

Accep

ted

Man

uscr

ipt

32

Averages of the duplicate values are reported for streptokinase activity

IU - International Units, DCW – Dry Cell Weight

of 38

Accep

ted

Man

uscr

ipt

33

Table 4 Effect of glucose feed-rate, induction strength and medium enrichment on recombinant

streptokinase production in fed batch culture

Expt. No.

Cell dry weight

(g/L)

Glucose feed rate

(g/L/h)

M17 nutrients feed rate

(g/L/h)

Stationary phase lactate conc.

(g/L)

Specific production of STK

(IU/g-DCW)

Volumetric

productivity of STK

(IU/L/h)

ATR developed cultures

FB1 2.24 5 - 15.08 23337 5990

FB2 2.28 10 - 24.25 84998 22100

FB3 2.42 5 2 16.50 58700 13892

FB4 3.81 10 2 23.90 374927 152617

ATR suppressed culturesFB5 1.31 5 - 16.04 457806 59006

FB6 1.50 10 - 26.80 656833 115443

FB7 1.57 5 2 17.23 700338 100382

FB8 1.97 10 2 25.18 1359374 390335

* Initial medium in all experiments was G10M17-II

of 38

Accep

ted

Man

uscr

ipt

34

Averages of the duplicate values are reported for streptokinase activity

IU - International Units, DCW – Dry Cell Weight

of 38

Accep

ted

Man

uscr

ipt

Figure 1

http://ees.elsevier.com/bej/download.aspx?id=296112&guid=8f256844-080d-4f22-9c87-3e59fd66ed42&scheme=1

of 38

Accep

ted

Man

uscr

ipt

Figure 2

http://ees.elsevier.com/bej/download.aspx?id=296113&guid=9a7ccee5-ee5a-4291-9a1e-5f1efc638494&scheme=1

of 38

Accep

ted

Man

uscr

ipt

Figure 3

http://ees.elsevier.com/bej/download.aspx?id=296114&guid=2969db8a-c954-44de-94d8-ad3fb4d28690&scheme=1

process strategies for enhancing recombinant streptokinase production in lactococcus lactis cultures...

Documents