proliferation effects of 42-khz radiofrequency energy on human foreskin fibroblasts

Articles in Press, J. Med. Biol. Eng. (Jan 30, 2013), doi: 10.5405/jmbe.1334

Proliferation Effects of 42-kHz Radiofrequency Energy on Human Foreskin Fibroblasts 1

(Running Title: RFE on Human Fibroblasts) 2

3

Chun-Yi Chiu1, Po -Hsiang Tsui

2, Chao-Ming Su

1, and Shyh-Liang Lou

1a) 4

5

1 Department of Biomedical Engineering, College of Engineering, 6

Chung Yuan Christian University, Chungli, Taiwan, ROC 7

8

2 Department of Medical Imaging and Radiological Sciences, College of Medicine, 9

Chang Gung University, Taoyuan, Taiwan, ROC 10

11

12

13

14

15

16

17

a) Corresponding author 18

Name: Shyh-Liang Lou Ph. D. 19

Tel: +886-3-265-4517 20

Fax: +886-3-265-2599 21

e-mail: [email protected] 22

23


2

Abstract 24

Radiofrequency (RF), which can penetrate the dermis to induce cell responses, has been 25

frequently used in the field of skin regeneration. The purpose of this study is to determine 26

the potential for skin wound healing using RF treatment. Human fibroblasts were exposed 27

to a 42-kHz RF at various intensities for 30 min. The cell cycle progression, cell viabilities, 28

and c-fos and c-jun gene expressions were evaluated using flow cytometry, an MTT assay, 29

and reverse-transcription polymerase chain reaction (RT-PCR) after individual exposures. 30

The results showed that the DNA synthesis, cell viabilities, and gene expressions were 31

upregulated by a low-level RF, especially at 350 and 450 A/m2 electromagnetic field 32

exposures. Therefore, we conclude that RF may play a predominant role in inducing cell 33

proliferation through cell cycle progression and c-fos and c-jun mRNA activation. 34

Non-thermal RF may be the major cause of generating this type of cell response 35

performance. 36

37

Keywords: Radiofrequency, Fibroblasts, Bio-effects 38

39

40

41

42

43

44

45

46


3

1. Introduction 47

Wound healing is a complex and dynamic process that involves interactions among soluble 48

mediators, blood cells, extracellular matrices (ECM), and parenchymal cells [1]. Inflammation, 49

tissue formation, and tissue remodeling are essential phases during wound healing that overlap 50

each other. To regenerate wound tissue, dermal fibroblasts are activated by cytokines and 51

released from macrophages to support skin healing [1]. After the bleeding and inflammatory 52

phases, fibroblasts migrate to the wound margins, proliferate, and secrete ECM, such as 53

proteoglycans and glycosaminoglycans, to provide a scaffold for directing supportive cells to the 54

injury site and to synthesize more new ECM. However, ischemia, infections, fibroblast inactivity, 55

and wound protease imbalances hinder wound healing. This has been reported in studies on 56

diabetic, burned, and chronic pressure ulcers patients [2,3]. Therefore, developing an effective 57

method for redundancy reduction has become critical. 58

Physical therapy modalities are widely applied to wound healing enhancement, such as 59

electrical, ultrasonic, and low-level laser stimulations [4]. Electrotherapy can stimulate fibroblast 60

growth [5], decrease ulcer size [6], and expedite healing time [7]. Although exogenous electric 61

stimulation assists in the healing process, unstable current density and voltage distributions occur 62

during in vivo applications [8]. Ultrasound, which is a type of mechanical stimulation, has 63

longitudinal waves that are used for diagnosis and therapy. Research has suggested that 64

ultrasound might facilitate chronic wound regeneration in vivo [9], regulate fibroblastic 65

proliferation [10], and induce ECM deposition [11]. The characteristics of being noninvasive and 66

safe from organisms have enabled ultrasound to become one of the most acceptable approaches 67

in clinical applications. However, a medium is necessary for energy propagation, such as water 68

and coupling gels. This approach poses a challenge to avoiding the infection of a medium contact. 69


4

Low-level laser treatment is another promising method for facilitating wound healing [12]. 70

However, the machinery is expensive and the outcomes are controversial. Although these 71

treatments can benefit cell responses, some obstacles must be overcome. Therefore, a novel and 72

effective modality to accelerate wound healing is necessary. 73

Radiofrequency (RF) is one of the most innovative treatments for chronic wound healing and 74

skin regeneration. It has been shown to reduce skin flaccidity, wrinkles, and cutaneous aging 75

[13]. In addition, RF has demonstrated the ability to upregulate human dermal cell proliferation 76

[14,15] and activate expressions of genes and enzymes [16-19]. Moreover, RF generates a 77

non-ionizing electromagnetic field considered a biosafety modality, and has been used in both 78

medicine and communication depending on the radio spectrum. For example, the spectrum 79

between 3 and 30 GHz is within the microwave band; a range of 30 to 300 MHz of RF is used 80

for FM radio broadcasts and land mobile stations (emergency and military). Furthermore, the 81

characteristics of non-contact and non-invasion during RF treatment are beneficial to human pain 82

tolerance [20-22]. Thus, RF may play a therapeutic role in inducing cell responses and 83

influencing physiological alterations. 84

The bio-effects of RF are inconclusive [17,24-27]. Particular studies have shown that RF 85

might regulate the behavior of human skin fibroblasts, by enhancing DNA synthesis, inducing 86

intracellular mitogenic second messenger formation [17], increasing the expression of comet tail 87

factors, and accelerating centromere-negative micronuclei with time dependence [26]. In 88

addition, a continuous RF wave at 864 MHz significantly upregulates the growth of V79 cells 89

with 0.08 W/kg SAR and 72 h exposure [3]. However, other researchers have argued that RF can 90

induce either harmful effects or have no effect on mammal cells [23,25,27]. In 2009, Sannino et 91

al. proved that the alkaline comet and cytokinesis-block micronucleus assay of human dermal 92


5

fibroblasts have no changes after 900-MHz RF treatment for 1 h [25]. In 2011, Bourthoumieu et 93

al. reported that human amniotic cells exposed to a 900-MHz RF for 24 h at SAR of 0.25, 1, 2, 94

and 4 W/kg had no significant differences in the aneuploidy rate of chromosomes 11 and 17 [23]. 95

However, a previous study indicated that RF can induce harmful effects on mammal cells [27]. 96

This lack of consensus on the effects of RF on cell responses is probably due to the various RF 97

modes of frequency, intensity, and exposure duration. 98

To distinguish these variances, an RF at a low frequency of 42 kHz was selected in this study 99

to determine the RF energy effects. Because of the lower frequency mode with the longer 100

wavelength, the energy can maintain the magnitude in avoiding attenuation, which compares to 101

the high-frequency mode when the energy is transmitted to a deeper site. A low-frequency RF is 102

more flexible for future applications. In addition, the biosafety and bio-effects of RF have drawn 103

considerable attention recently, and are considered crucial. These biological responses have the 104

potential to influence certain physiological phenomena, such as wound healing. To determine the 105

efficiency of RF, we hypothesize that RF can influence wound healing by regulating cell 106

proliferation. Therefore, this study investigated the bio-effects of RF on human skin fibroblastic 107

proliferation, which is a leading factor in regulating wound healing. 108

This article is organized as follows. We introduce the experimental materials and methods, 109

present the results, and discuss the cell responses of RF exposure. Finally, we present our 110

conclusion on the significant findings and contributions of this study. 111

112

113

114

115


6

2. Materials and Methods 116

2.1 Cells and cell culture 117

Human foreskin fibroblasts, the Hs68 cell line, were obtained from the Bioresearch 118

Collection and Research Center at the Food Industry Research and Development Institute (FIRDI) 119

(Hsinchu, Taiwan). The cells were cultured in a medium composed of Dulbeccos modified 120

Eagles medium (DMEM) (GIBCO, New York, USA), 4 mM of L-glutamine (GIBCO, New 121

York, USA), 1.5 g/L of sodium bicarbonate (GIBCO, New York, USA), and 10% (v/v) fetal 122

bovine serum (FBS) (Biological Industries, Israel) in an incubator at 37 C with 5% CO2 (v/v). 123

Fibroblasts, grown in culture dishes (Corning, New York, USA), were digested with 0.05% (v/v) 124

trypsin-EDTA (GIBCO, New York, USA) for 5 min. The cells were resuspended in a fresh 125

medium, after which they were centrifuged at 1000 rpm for 5 min. All experiments were 126

performed by conducting 2 passages of the cell line after being unfrozen. 127

128

2.2 RF exposure system and procedure 129

The RF induction system consists of an RF generator (GA-15A, Kanwei Machine and Tool 130

Agent Company, Taiwan) connected to a concentric square coil and a temperature control device, 131

as shown in Fig. 1. The output intensity is adjustable in relation to the electric current. In this 132

study, 150, 250, 350, and 450 A/m2 were applied to cell exposures of 30 min each. The 133

temperature differences between the environment and the culture medium were monitored and 134

maintained at 37.0 0.5 oC using a gas-circulating controller, as shown in Fig. 2. After achieving 135

80% confluence, Hs68 was trypsinized, counted, and resuspended in a medium composed of 136

DMEM supplemented with 10% FBS and 1% antibiotics. Aliquots containing 2104 cells/cm

2 137

were seeded in a well of a 24-well culture plate, averaged, and cultured in an incubator 138


7

maintained at 37 C in a humidified atmosphere with 5% CO2. After 24 h, the cells were exposed 139

to 42 k RF with different energies for 30 min in a 37 oC environment. 140

141

2.3 Cell responses detection 142

2.3.1 Cell cycle distribution 143

To characterize the cell cycle progression affected by RF, the DNA was stained with 144

propidium iodide (PI) (Invitrogen, California, USA). The Hs68 was fixed using 75% ethanol for 145

30 min and then incubated with a staining solution containing 0.1% Triton X-100 (Sigma, 146

Missouri, USA), 10 g/mL of RNase A (Invitrogen, California, USA), and 50 g/mL of PI for 147

10 min. Subsequently, the diploid and haploid of the stained cells were analyzed using a BD 148

FACS Calibur instrument (Becton Dickinson, California, USA) equipped with CellQuest 149

software. A minimum of 10 000 cells were counted in each sample. 150

151

2.3.2 Cell proliferation 152

For cell viability analysis, the fibroblasts were cultured in a 24-well plate at a concentration 153

of 20000 cells/cm2 with DMEM supplemented with 10% FBS. At 0, 24, 36, and 48 h after RF 154

exposure, the cells were co-cultured with 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium 155

bromide (MTT) (5 mg/mL) (Sigma, Missouri, USA) for 3 h at various intensities. The succinate 156

dehydrogenase in the mitochondria of the cells was reduced from a yellow MTT solution to an 157

insoluble and purple formazan, specifically in highly activated cells. Finally, the insoluble 158

formazan was dissolved by dimethyl sulfoxide (DMSO) (Sigma, Missouri, USA) and measured 159

using a spectrophotometer at a wavelength of 570 nm. 160

161


8

2.3.3 Gene expression 162

For gene expression analysis, total RNA was extracted using a TRIzol reagent (Invitrogen, 163

California, USA) according to manufacturer instructions. The RNA of 2.5 g was applied in 164

reverse transcription (RT) using a SuperScriptIII RT kit (Invitrogen, California, USA). The PCR 165

amplifications were reacted with Tag polymerase, cDNAs, primers, and other salts for 35 cycles. 166

The primers are c-fos (forward): CCTCACCTTTCGGAGTCCC, and reverse: 167

CTCCTTCAGCAGGTTGGCAATCT, c-jun (forward): GACTGCAAAGATGGAAACGACC, 168

and reverse: GTAGTGGTGATGTGCCCATTGC, Glyceraldehyde 3-phosphate dehydrogenase 169

(GAPDH) (forward): CAGCAATGCATCCTGCACC, and reverse: 170

TGGACTGTGGTCATGAGCCC. 171

172

2.4 Statistics 173

The results represent the averages taken from 3 separate experiments. Data analysis and 174

statistical tests were performed using a t test. 175

176

177

178

179

180

181

182

183

184


9

3. Results 185

3.1 Cell cycle progression after RF exposure 186

To determine the effects of RF treatment on cell cycle progression, Hs68 was cultured in 187

24-well plates with a serum-free medium, which prevented the interference of growth factors and 188

other nutrition during RF exposure. The cells were then exposed to RF for 30 min at multiple 189

outputs. After 24 h, the cells were collected, fixed, and stained by PI, and then detected by using 190

flow cytometry at a wavelength of 530 nm. The results are shown in Fig. 3. The S portions in the 191

RF-treated groups were significantly higher than those in the sham stimulation, reaching 2.8-, 192

2.7-, 3.5-, and 3-fold at 150, 250, 350, and 450 A/m2, respectively. This evidence indicates that 193

the capability of DNA replication might be activated by RF exposure. 194

195

3.2 Cell proliferation after RF exposure 196

The enhancement progression of the cell cycle is observed in several physiological 197

phenomena, such as cell proliferation, tissue formation, malignant transformation, inflammation, 198

and wound healing [28]. Although a portion of the DNA synthesis phase was increased by RF 199

stimulation, the cell fate of entering the mitosis stage or arresting in this stage remains unknown. 200

To determine these effects on cells that were induced from cell cycle progression alteration, cell 201

viabilities were investigated using an MTT assay. The results show that the cell viabilities of the 202

RF exposure groups, particularly those exposed to 450 A/m2, were upregulated significantly 203

within 24 h, as shown in Fig. 4. They reached 1.35-fold and gradually decreased in the next 24 h. 204

In the 250 and 350 A/m2 RF exposure groups, the cell viabilities were 1.2- and 1.3-fold after 36 205

h. Consequently, RF at low frequencies induced DNA synthesis and, subsequently, cell viability 206

increased. In addition, the cell responses appeared to be correlated at the RF intensities. 207


10

3.3 The c-fos and c-jun gene expressions 208

Certain RF-sensitive regulators might be activated by RF exposure to result in the 209

enhancement of DNA synthesis and cell proliferation. It has been speculated that the RF signals 210

were transmitted to intracellular sites to generate these cell responses. Thus, immediate early 211

gene families of transcription factors c-fos and c-jun were selected to determine the relevant 212

bio-effects of RF. The results show that the c-fos expressions in the RF exposure groups were 213

significantly activated by 3.5-fold at 150 and 250 A/m2, and by 6-fold at 350 and 450 A/m

2, as 214

shown in Figs. 5(a) and 5(b). The c-jun was significantly activated by RF at 350 and 450 A/m2 215

groups, by 3- and 2-fold, respectively. These results suggest that the upregulation of c-fos and 216

c-jun gene expressions may correlate with cell cycle progression and cell proliferation. 217

218

219

220

221

222

223

224

225

226

227

228

229

230


11

4. Discussion 231

RF is an innovative method used in wound healing. Several auxiliary treatments have 232

recently been developed to regenerate wounds. Whirlpool, subatmospheric pressure, pulsed 233

lavage, and hyperbaric oxygen therapy have potential in becoming mainstay therapies, despite 234

limitations such as cost, complications, and diversity of effects [29]. In addition, ultrasound (US), 235

electrical stimulation (ES), and RF have been proven to have positive effects on wound healing. 236

However, additional advanced experiments in vitro and in vivo are required to determine the 237

efficiencies of US, ES, and RF in additional applications. We selected a low-frequency RF 238

because of non-contact, noninvasiveness, and a lack of side effects. There was also little 239

evidence of determining RF bio-effects. Therefore, we created an apparatus and designed a 240

procedure for efficiently exploring RF stimulation in vitro to investigate cell responses. 241

Furthermore, RF is expected to be used in chronic wound healing applications. 242

The results show that the progression of DNA synthesis was induced after RF exposure. An 243

entire cell cycle consists of 4 Phases, including Gap1 (G1), DNA synthesis (S), Gap2 (G2), and 244

Mitosis (M), which are regulated by the coordinated activation of cyclins and cyclin-dependent 245

kinases (CDK) [30]. For example, cyclin C, cyclin D1, and cyclin E are the checkpoint proteins 246

that determine the transition from the G1 to the S phase; cyclin A and cyclin B1 regulate mitotic 247

G2/M transition and mitosis [31]. Certain growth factors and physical stimuli can regulate the 248

quiescent cell reentrance into cell cycle progression. In addition, RF exposure-enhanced cell 249

cycle progression was demonstrated in this study. Therefore, RF could be the main cause in the 250

regulation of DNA synthesis. Certain studies have shown results that are consistent with those of 251

this study. Cao et al. [32] reported that a 27-MHz RF at 25 W/kg altered the cell cycle 252

progression of Chinese hamster ovary cells, which is consistent with our results. However, 253


12

neither single (837-MHz) nor combined (837- and 1950-MHz) RF modes altered both the cell 254

cycle distributions and the cell cycle regulatory proteins at SAR of 4 W/kg for 1 h of exposure 255

[33]. The cell cycle-related genes of HL-60 cells were downregulated when the cells were 256

exposed to a 2.45-GHz RF in a 2-h treatment [34]. However, the various RF parameters, such as 257

frequency and duration of stimulation, may lead to such inconsistent results. Therefore, the RF 258

frequency band in the low range appears to have great potential in accelerating cell cycle 259

progression. 260

The cell proliferation results show that RF may play a vital role in cell proliferation 261

enhancement. Numerous causes could induce increases in cell numbers. First, the 262

electromagnetic fields may directly affect the gene expressions related to cell proliferation in the 263

nucleus and, consequently, increase cell growth. Second, certain potential RF-sensitive receptors 264

distributed in the cell membrane are activated by electromagnetic field exposure. Cytoskeletons, 265

such as proteoglycan and F-actin, translate the signals to induce cell responses. Third, 266

electromagnetic fields can stimulate particular soluble-growth factor secretions in the culture 267

medium. These growth factors can possibly benefit cell proliferation. Finally, the final possibility 268

is that RF may cause perturbation of the culture medium, which could accelerate the exchange 269

and metabolism of ions and nutrition. However, additional experiments are required to 270

demonstrate the mechanisms of these potential pathways occurring either individually or in 271

relation to one another. 272

Other studies have shown that RF exposure upregulates cell proliferation, and these findings 273

are consistent with those of our study [35-37]. With exposure to a 72-GHz microwave in 274

continuous-wave (CW) mode, Candida albicans resulted in a 25% increase in cell growth rate 275

[36]. An increasing concentration in bacterial cultures, which were exposed to a 2.45-GHz CW 276


13

and a 3.10-GHz pulsed microwave radiation, also occurred [37]. Therefore, non-ionizing 277

exposure enhanced cell proliferation, which is consistent with this study. However, certain 278

studies have also reported that RF played a different role in cell proliferation [33,38,39]. The 279

proliferation of human lens epithelial cells (hLEC) remained unchanged with 1.8 GHz of RF 280

exposure [38]. However, V79 proliferation, which was exposed to a 935-MHz RF, was 281

downregulated [39]. Various characteristics in the RF and target cells might be the cause of these 282

conflicting results. 283

To determine how RF influences cell proliferation initially, c-fos and c-jun genes were 284

considered potential mediators and selected to determine the outcome of RF exposure. The 285

results show that RF enhanced c-fos and c-jun gene expressions. The c-fos, c-jun, and c-myc are 286

the family of the immediate early proto-oncogenes, which are mediated by mechanical signals 287

and may initiate cell growth [40,41]. The results show that both the immediate early gene 288

expressions and cell proliferation were stimulated by low-level RF. In addition, cell growth (24 h 289

after RF exposure) appeared to occur directly after gene expression (2 h after RF exposure). This 290

shows that cell proliferation is a downstream consequence of gene expression. However, the RF 291

mechanisms regulating cell proliferation through immediate early gene pathways are unclear. 292

Additional experiments are necessary to confirm the connections among these cell responses. 293

Gene expression alterations after RF exposure have been reported since the global system for 294

communication (GSM) became widespread. In 2002, the gene expression of cell cycle regulators, 295

mitogen-activated protein kinase 3, ERK activator kinase 3, and transforming growth 296

factor-TGF were activated by a 902.4-MHz RF on human skin fibroblasts [17]. Similarly, 297

an increase in c-jun transcript levels of PC12 cells caused by a 836.55-MHz RF exposure has 298

been observed [16]. The upregulation of inflammation gene expressions have also been 299


14

confirmed to be induced by a 27.12-MHz RF for 30-min exposures [42]. This shows that RF has 300

the potency to enhance the expression of specific genes. However, numerous studies using 301

various RF fields and cell types have discovered diverse effects on gene expression [43-46]. For 302

example, FOS expression was not significantly changed when C3H 10T1/2 cells were exposed to 303

RF fields of 847.74-836.55 MHz [45], the c-fos and c-jun mRNAs expressions were not affected 304

by 900-MHz electromagnetic field exposures [44], and no significant gene alterations were 305

observed in normal human glial cell lines using 2.45-GHz RF fields [43]. The RF effects from 306

different studies are inconclusive, and additional studies are required to distinguish the 307

bio-effects in clinical applications. 308

The enhancement of cell cycle progression, increases in cell proliferation, and induction of 309

c-fos and c-jun gene expression were expected to be affected by the thermal and non-thermal 310

effects of RF. Because the temperature differences of culture media among the sham and 311

exposure groups were less than 0.5 oC (Fig. 2), the non-thermal effect appears to be the main 312

cause of inducing an Hs68 biological response. Electromagnetic fields consist of electrical and 313

magnetic fields, which may induce different bio-effects. Alternative electrical fields of high 314

frequencies raise water temperature because of the friction of rapidly rotating dipolar molecules 315

in water. However, the temperature did not change during the 42-kHz RF exposure in this study. 316

Previous studies have shown that the electrical field did not alter cell concentration at 27 MHz 317

[37]. They have also shown that electrical fields with lower frequencies do not affect cell 318

viability. Therefore, it appears that magnetic fields may be the primary causes of cell response 319

induction. 320

An RF at 42 kHz demonstrated its effectiveness in enhancing DNA synthesis, cell 321

proliferation, and gene expression; additional experiments are necessary to prove the correlation 322


15

among cell cycle progression, cell number up-regulation, gene expressions, and the magnetic 323

field mechanisms that induce cell responses. Presently, the potential bio-effects of the 324

surrounding cells of skin tissue, such as the keratinocytes, blood cells, and lymphocytes, which 325

result from RF exposure, were unclear in this study. However, certain studies have shown that 326

RF has no alteration of lymphocyte proliferation [26,47], no apoptosis in peripheral blood 327

mononuclear [48], and no protein expression in MCF-7 [49]. Although these pieces of evidence 328

show that the RF did not play a role in cell fate alteration, the variety of bio-effects still depends 329

on different RF exposure systems. Therefore, the bio-effects of surrounding cells must be 330

investigated in future studies to avoid abnormal responses and maintain physiological 331

homeostasis. In addition, the criteria of RF treatments are crucial for future in vitro and in vivo 332

applications. 333

5. Conclusion 334

We confirmed the cell response of Hs68 exposed to a 42-kHz RF at various intensities. The 335

results show that the portions of the DNA synthesis phases of the cell cycle, cell number, and 336

c-fos and c-jun gene expressions increased significantly when the cells were exposed to RF for 337

30 min. We showed that RF might induce c-fos and c-jun gene expressions, resulting in cell 338

cycle progression and an increase in cell numbers. Additional studies are required to quantify the 339

interactions between cell responses and RF exposure animal models to determine whether these 340

effects may play an essential role in regulating wound healing. 341

342

Acknowledgments 343

The authors acknowledge the financial support of this work was from the National Science 344

Council of Taiwan under grants NSC 95-2221-E-033-009. 345


16

References 346

[1] A. J. Singer and R. A. F. Clark, Cutaneous wound healing, N. Engl. J. Med., 341: 738-746, 347

1999. 348

[2] W. J. Jeffcoate, P. Price, and K. G. Harding, Wound healing and treatments for people with 349

diabetic foot ulcers, Diabetes-Metab. Res. Rev., 20: S78-S89, 2004. 350

[3] M. A. Loots, E. N. Lamme, J. Zeegelaar, J. R. Mekkes, J. D. Bos and E. Middelkoop, 351

Differences in cellular infiltrate and extracellular matrix of chronic diabetic and venous ulcers 352

versus acute wounds, J. Invest. Dermatol., 111: 850-857, 1998. 353

[4] P. P. Gogia, Physical therapy modalities for wound management, Ostomy Wound Manag., 354

42: 46-48, 50-52, 54, 1996. 355

[5] G. J. Bourguignon and L. Y. W. Bourguignon, Electric stimulation of protein and DNA 356

synthesis in human fibroblasts, Faseb J., 1: 398-402, 1987. 357

[6] P. E. Houghton, C. B. Kincaid, M. Lovell, K. E. Campbell, D. H. Keast, M. G. Woodbury 358

and K. A. Harris, Effect of electrical stimulation on chronic leg ulcer size and appearance, 359

Phys. Ther., 83: 17-28, 2003. 360

[7] L. C. Kloth and J. A. Feedar, Acceleration of wound healing with high voltage, monophasic, 361

pulsed current, Phys. Ther., 68: 503-508, 1988. 362

[8] L. C. Kloth, Electrical stimulation for wound healing: a review of evidence from in vitro 363

studies, animal experiments, and clinical trials, Int. J. Low. Extrem. Wounds, 4: 23-44, 2005. 364

[9] S. J. Kavros, D. A. Liedl, A. J. Boon, J. L Miller, J. A. Hobbs and K. L. Andrews, Expedited 365

wound healing with noncontact, low-frequency ultrasound therapy in chronic wounds: a 366

retrospective analysis, Adv. Skin Wound Care, 21: 416-423, 2008. 367


17

[10] S. Zhou, A. Schmelz, T. Seufferlein, Y. Li, J. Zhao and M. G. Bachem, Molecular 368

mechanisms of low intensity pulsed ultrasound in human skin fibroblasts, J. Biol. Chem., 279: 369

54463-54469, 2004. 370

[11] A. Ramirez, J. A. Schwane, C. McFarland and B. Starcher, The effect of ultrasound on 371

collagen synthesis and fibroblasts proliferation in vitro, Med. Sci. Sports Exerc., 29: 326-332, 372

1997. 373

[12] X. Gao and D. Xing, Molecular mechanisms of cell proliferation induced by low power 374

laser irradiation, J. Biomed. Sci., 16: 4-20, 2009. 375

[13] N. S. Sadick, Update on non-ablative light therapy for rejuvenation: a review, Lasers Surg. 376

Med., 32: 120-128, 2003. 377

[14] L. C. Kloth and A. A. Pilla, Electromagnetic stimulation for wound healing, in J. M. 378

McCulloch and L. C. Kloth (Ed.), Would Healing: Evidence Based Management, Philadelphia: F. 379

A. Davis Company, 271-311, 2002. 380

[15] L. C. Kloth, J. E. Berman, C. H. Sutton, D. C. Jeutter, A. A. Pilla and M. E. Epner, Effect 381

of pulsed radio frequency stimulation on wound healing: a double-blind pilot clinical study, in: 382

F. Bersani (Ed.), Electricity and Magnetism in Biology and Medicine, New York: Plenum, 383

875-878, 1999. 384

[16] O. I. Ivaschuk, R. A. Jones, T. Ishida-Jones, W. Haggren, W. R. Adey and J. L. Phillips, 385

Exposure of nerve growth factor-treated PC12 rat pheochromocytoma cells to a modulated 386

radiofrequency field at 836.55 MHz: effects on c-jun and c-fos expression, Bioelectromagnetics, 387

18: 223-229, 1997. 388

[17] S. Pacini, M. Ruggiero, I. Sardi, S. Aterini, F. Gulisano and M. Gulisano, Exposure to 389

global system for mobile communication (GSM) cellular phone radiofrequency alters gene 390


18

expression, proliferation, and morphology of human skin fibroblasts, Oncol. Res., 13: 19-24, 391

2002. 392

[18] R. Paulraj and J. Behari, Radio frequency radiation effects on protein kinase C activity in 393

rats' brain, Mutat. Res.-Fundam. Mol. Mech. Mutagen., 545: 127-130, 2004. 394

[19] R. Paulraj, J. Behari and A. R. Rao, Effect of amplitude modulated RF radiation on 395

calcium ion efflux and ODC activity in chronically exposed rat brain, Indian J. Biochem. 396

Biophys., 36: 337-340, 1999. 397

[20] S. D. Shapiro, Y. Eros, Y. Abrahami and A. Leviav, Evaluation of safety and efficacy of 398

the TriPollar technology for treatment of wrinkles, Lasers Surg. Med., 44: 453-458, 2012. 399

[21] B. S. Bloom, J. Emer and D. J. Goldberg, Assessment of safety and efficacy of a bipolar 400

fractionated radiofrequency device in the treatment of photodamaged skin, J. Cosmet. Laser 401

Ther., 14: 208-211, 2012. 402

[22] N. Krueger, H. Levy and N. S. Sadick, Safety and efficacy of a new device combining 403

radiofrequency and low-frequency pulsed electromagnetic fields for the treatment of facial 404

rhytides, J. Drugs Dermatol., 11: 1306-1309, 2012. 405

[23] S. Bourthoumieu, F. Terro, P. Leveque, A. Collin, V. Joubert and C. Yardin, Aneuploidy 406

studies in human cells exposed in vitro to GSM-900 MHz radiofrequency radiation using FISH, 407

Int. J. Radiat. Biol., 87: 400-408, 2011. 408

[24] I. Pavicic and I. Trosic, Impact of 864 MHz or 935 MHz radiofrequency microwave 409

radiation on the basic growth parameters of V79 cell line, Acta Biol. Hung., 59: 67-76, 2008. 410

[25] A. Sannino, G. Di Costanzo, F. Brescia, M. Sarti, O. Zeni, J. Juutilainen and M. R. Scarfi, 411

Human fibroblasts and 900 MHz radiofrequency radiation: evaluation of DNA damage after 412


19

exposure and co-exposure to 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5h)-furanone (MX), 413

Radiat. Res., 171: 743-751, 2009. 414

[26] C. Schwarz, E. Kratochvil, A. Pilger, N. Kuster, F. Adlkofer and H. W. Rudiger, 415

Radiofrequency electromagnetic fields (UMTS, 1,950 MHz) induce genotoxic effects in vitro in 416

human fibroblasts but not in lymphocytes, Int. Arch. Occup. Environ. Health., 81: 755-767, 417

2008. 418

[27] D. Y. Zhang, Z. P. Xu, H. Chiang, D. Q. Lu and Q. L. Zeng, Effects of GSM 1800 MHz 419

radiofrequency electromagnetic fields on DNA damage in Chinese hamster lung cells, 420

Zhonghua Yu Fang Yi Xue Za Zhi., 40: 149-152, 2006. 421

[28] Cell Signalling Biology: Chap9 Cell cycle and proliferation, 2009. Available: 422

http://www.biochemj.org/csb/ 423

[29] G. II. Broughton, J. E. Janis and C. E. Attinger, Wound healing: an overview, Plast. 424

Reconstr. Surg., 117: 1e-S-32e-S, 2006. 425

[30] T. Samuel, H. O. Weber and J. O. Funk, Linking DNA damage to cell cycle checkpoints, 426

Cell Cycle, 1: 162-168, 2002. 427

[31] A. J. Obaya and J. M. Sedivy, Regulation of cyclin-Cdk activity in mammalian cells, Cell. 428

Mol. Life Sci., 59: 126-142, 2002. 429

[32] G. Cao, L. M. Liu and S. F. Cleary, Cell cycle alterations induced by isothermal 27 MHz 430

radiofrequency radiation, Bioelectrochem and Bioenerg., 37: 131-140, 1995. 431

[33] K. Y. Lee, B. C. Kim, N. K. Han, Y. S. Lee, T. Kim, J. H. Yun, N. Kim, J. K. Pack and J. S. 432

Lee, Effects of Combined radiofrequency radiation exposure on the cell cycle and its regulatory 433

proteins, Bioelectromagnetics., 32: 169-178, 2011. 434


20

[34] S. Lee, D. Johnson, K. Dunbar, H. Dong, X. Ge, Y. C. Kim, C. Wing, N. Jayathilaka, N. 435

Emmanuel, C. Q. Zhou, H. L. Gerber, C. C. Tseng and S. M. Wang, 2.45 GHz radiofrequency 436

fields alter gene expression in cultured human cells, FEBS Lett., 579: 4829-4836, 2005. 437

[35] S. Velizarov, P. Raskmark and S. Kwee, The effects of radiofrequency fields on cell 438

proliferation are non-thermal, Bioelectrochem. Bioenerg., 48: 177-180, 1999. 439

[36] L. Dardanonl, M. V. Torregrossa and L. Zanforlin, Millimeter-wave effects on Candida 440

Albicans cells, Electromagn. Biol. Med., 4: 171-176, 1985. 441

[37] Y. Hamnerius, A. Rasmuson and B. Rasmuson, Biological effects of high-frequency 442

electromagnetic fields on Salmonella typhimurium and Drosophila melanogaster, 443

Bioelectromagnetics, 6: 405-414, 1985. 444

[38] L. Sun, K. Yao, K. Wang, D. Lu, H. Hu, X. Gao, B. Wang, W. Zheng, J. Lou and W. Wu, 445

Effects of 1.8 GHz radiofrequency field on DNA damage and expression of heat shock protein 446

70 in human lens epithelial cells, Mutat. Res., 602: 135-142, 2006. 447

[39] I. Troi and I. Pavii, Disturbance of cell proliferation in response to mobile phone 448

frequency radiation, Arh. Hig. Rada. Toksikol., 60: 109-115, 2009. 449

[40] H. Schunkert, L. Jahn, S. Izumo, C. S. Apstein and B. H. Lorell, Localization and 450

regulation of c-fos and c-jun protooncogene induction by systolic wall stress in normal and 451

hypertrophied rat hearts, Proc. Natl. Acad. Sci. USA, 88: 11480-11484, 1991. 452

[41] I. Komuro, T. Kaida, Y. Shibazaki, M. Kurahayashi, Y. Katoh, E. Hoh, F. Takaku and Y. 453

Yazaki, Stretching cardiac myocytes stimulates proto-oncogene expression, J. Blot. Chem., 454

265: 3595-3598, 1990. 455

[42] J. Moffett, N. J. Kubat, N. E. Griffin, M. C. Ritz and F. R. George, Pulsed radio frequency 456

energy field treatment of cells in culture results in increased expression of genes involved in the 457


21

inflammation phase of lower extremity diabetic wound healing, J. Diabetes foot Complications, 458

3: 30-39, 2011. 459

[43] T. Sakurai, T. Kiyokawa, E. Narita, Y. Suzuki, M. Taki and J. Miyakoshi, Analysis of gene 460

expression in a human-derived glial cell line exposed to 2.45 GHz continuous radiofrequency 461

electromagnetic fields, J. Radiat. Res., 52: 185-192, 2011. 462

[44] G. D. Vecchio, A. Giuliani, M. Fernandez, P. Mesirca, F. Bersani, R. Pinto, L. Ardoino, G. 463

A. Lovisolo, L. Giardino and L. Calza, Continuous exposure to 900 MHz GSM-modulated 464

EMF alters morphological maturation of neural cells, Neurosci. Lett., 455: 173-177, 2009. 465

[45] T. D. Whitehead, B. H. Brownstein, J. J. Parry, D. Thompson, B. A. Cha, E. G. Moros, B. E. 466

Rogers and J. L. Roti Rotil, Expression of the proto-oncogene Fos after exposure to 467

radiofrequency radiation relevant to wireless communications, Radiat. Res., 164: 420-430, 468

2005. 469

[46] Q. Zeng, G. Chen, Y. Weng, L. Wang, H. Chiang, D. Lu and Z. Xu, Effects of global 470

system for mobile communications 1800 MHz radiofrequency electromagnetic fields on gene 471

and protein expression in MCF-7 cells, Proteomics., 6: 4732-4738, 2006. 472

[47] M. R. Scarf, A. M. Fresegna, P. Villani, R. Pinto, C. Marino, M. Sarti, P. Altavista, A. 473

Sannino and G. A. Lovisolo, Exposure to radiofrequency radiation (900 MHz, GSM signal) 474

does not affect micronucleus frequency and cell proliferation in human peripheral blood 475

lymphocytes: an interlaboratory study, Radiat. Res., 165: 655-663, 2006. 476

[48] M. Capri, E. Scarcella, E. Bianchi, C. Fumelli, P. Mesirca, C. Agostini, D. Remondini, J. 477

Schuderer, N. Kuster, C. Franceschi and F. Bersani, 1800MHz radiofrequency (mobile phones, 478

different Global System for Mobile communication modulations) does not affect apoptosis and 479


22

heat shock protein 70 level in peripheral blood mononuclear cells from young and old donors, 480

Int. J. Radiat. Biol., 80: 389-397, 2004. 481

[49] K. B. Kimi, H. O. Byun, N. K. Han, Y. G. Ko, H. D. Choi, N. Kim, J. K. Pack and J. S. Lee, 482

Two-dimensional electrophoretic analysis of radio frequency radiation-exposed MCF7 breast 483

cancer cells, J. Radiat. Res., 51: 205-213, 2010. 484

485

486

487

488

489

490

491

492

493

494

495

496

497

498

499

500

501

502


23

Figure Legends 503

Figure 1. Apparatus for RF exposure to cells. An electromagnetic field was produced by the coil, 504

through which the current passed. A plate was placed above the coil to be exposed. All of the 505

materials were in a sealed Styrofoam box, and the temperature was maintained at 37 oC during 506

stimulation. 507

508

Figure 2. Average temperature differences in each group during 0, 150, 250, 350, and 450 A/cm2 509

RF exposure for 30 min. 510

511

Figure 3. S Phase portion in cell cycle progression. DNA was stained by PI and detected using 512

flow cytometry. Values are given as the mean of 3 samples standard deviation. Statistically 513

significant values are designated as *, p < 0.05; **, p < 0.005; ***, p < 0.001. 514

515

Figure 4. Cell viability of Hs68 exposed to a 42 kHz-RF at different electromagnetic fields with 516

time dependence. Xsn: the cell number under RF treated at Day n; Xcn: the cell number of 517

control group at Day n; Xs0: the cell number under RF treated at Day 0; Xc0: the cell number of 518

RF control groups at Day 0. Values are given as the mean of 3 samples standard deviation. 519

Statistically significant values are designated as *, p < 0.05; **, p < 0.005; ***, p < 0.001. 520

521

Figure 5. Gene expressions of Hs 68 exposed to RF. RNAs were extracted using a TRIzol 522

reagent, and the c-fos and c-jun expressions were analyzed using RT-PCR. (a) Expressions of 523

c-fos and c-jun genes observed by electrophoresis in 1.5% agarose gel, (b) and (c) quantified 524

expressions related to untreated cells and GAPDH. 525


24

Figures 526

527

528

529

530

531

532

533

534

535

536


25

537

538

539

540

541

542

543

544

545

546

547


26

548

549

550

551

552

553

554

555

556

557

558

559


27

560

561

562

563

564

565

566

567

568

569

570

571


28

572

573

574

575

576

577

578

579

proliferation effects of 42-khz radiofrequency energy on human foreskin fibroblasts

Documents

skin wound healing

wound tissue

wound healing enhancement

cell viabilities

human fibroblasts

wound margins

skin healing

radiofrequency rf