protein synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. ·...

41
Honors Biology 2006-2007 Protein Synthesis

Upload: others

Post on 31-Aug-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Protein Synthesis

Page 2: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

What do we know? §  Metabolism is controlled by enzymes

  enzymes are proteins

§  DNA contains the genetic information to build proteins.

§  DNA is only in the nucleus. Ribosomes are not.

§  How then can DNA be used to build proteins?

Page 3: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

The “Central Dogma” §  Flow of genetic information in a cell

  How do we move information from DNA to proteins?

transcription translation

replication

protein RNA DNA trait

DNA gets all the glory,

but proteins do all the work!

Page 4: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

RNA Does the Work §  Traits, like eye color, are

determined by proteins that are coded in DNA.

  Our cells, however, need a “secret decoder ring” to express the DNA code……….

  AND, we need to get the instructions on how to make the protein from the nucleus to the ribosomes.

  ENTER: Ribonucleic Acid

(RNA)

Page 5: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Protein Synthesis §  DNA molecules provide the

instructions for making proteins

§  BUT, RNA molecules are what build the proteins based on those instructions.

  The workers for Protein Synthesis (gene expression) are RNA molecules.

Page 6: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Page 7: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

RNA Structure §  RNA structure differs from DNA

structure in 3 ways:

  1. RNA is single stranded   2. RNA is composed of the sugar

Ribose   3. In RNA, a new base Uracil

replaces Thymine

Page 8: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

RNA Nitrogen Bases §  Both RNA and DNA contain four nitrogen bases,

but instead of Thymine, RNA contains Uracil (U)

  Uracil forms a base pair with Adenine, just as Thymine does in DNA.

§  RNA: U - A §  DNA: T - A

Page 9: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

DNA vs. RNA Venn DNA RNA

Page 10: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Types of RNA Molecules §  3 types of RNA molecules help to build

proteins:

1. Messenger RNA (mRNA): “the messenger” §  Runs information from DNA in the

nucleus to ribsosomes.

2. Ribosomal RNA (rRNA): “the reader” §  Part of ribosome and “reads” mRNA

message.

3. Transfer RNA (tRNA): “the transporter” §  Brings amino acids to the ribosome to be

assembled into protein.

Page 11: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

The “Central Dogma”

Step 1: transcription

Step 2: translation

replication

protein RNA DNA trait

DNA gets all the glory,

but proteins do all the work!

Step 3: Folding

Genotype Phenotype

Page 12: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Protein Synthesis §  Step 1: Transcription

  Rewriting DNA into mRNA so that the instructions can leave the nucleus

§  Step 2: Translation   Translating RNA into amino acids

§  Step 3: Protein Folding   Amino acid chain folds up into finished protein

Page 13: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Step 1: Transcription

§  Transcription is the process within the cell nucleus where enzymes make an RNA copy of a DNA gene.   The nucleotide sequence rewritten (transcripted) as

mRNA acts as a genetic message.

  This message is the complete information for the building of a protein.

§  WHY??? DNA cannot leave the nucleus!

DNA RNA

Page 14: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Steps of Transcription §  1. Separation of Strands

  Enzyme DNA helicase opens up the DNA molecule

§  2. Initiation   Enzyme RNA Polymerase joins DNA at the beginning of a gene

§  3. Elongation   An RNA Polymerase “reads” the DNA it adds the complimentary

RNA bases

§  3. Reformation (DNA)   mRNA is complete and DNA winds back up.

§  4. Termination   mRNA is complete and leaves the nucleus to go to the ribosome.

Page 15: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Transcription Example

Using the RNA base-pairing rules, DNA is easily decoded into the mRNA strand.

TACGCACATTTACGTACGCGG!DNA

AUGCGUGUAAAUGCAUGCGCC!mRNA

Page 16: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Step 2: Translation

§  Translation - converting information in mRNA into the language of proteins   Takes place at ribosomes in the cytoplasm.

  The protein language is made up of an “alphabet” of Amino Acids.

§  Because there are 20 different amino acids and mRNA has only 4 bases, biochemists realized that a code was needed to convert the language into a protein.

RNA protein

Page 17: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

The Genetic Code §  The Genetic Code is made up of 64 codons.

  A Codon is a set of 3 nitrogen bases of mRNA that represents a certain amino acid.

§  All organisms use the same genetic code! §  Example: UAC codes for the amino acid tyrosine

in the mRNA of bacteria, birch trees, and bison.

Yeah, me & bacteria go way back.

Page 18: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

DNA Replication vs. RNA Transcription

Page 19: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

AUGCGUGUAAAUGCAUGCGCC!mRNA

mRNA codes for proteins in triplets

TACGCACATTTACGTACGCGG!DNA

AUGCGUGUAAAUGCAUGCGCC!mRNA

codon

Codons are “read” by the ribosome three bases at a time

Page 20: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

More on Codons §  Codons do not just code for amino acids. Some codons

provide instructions for the assembling of proteins.

  Stop Codon: (UAA), (UAG), and (UGA) are all stop codons indicating that protein production ends.

  Start Codon: (AUG) is a codon that indicates where protein production must start. This codon also codes for an amino acid (Methionine)

Page 21: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

The Code

§  For ALL life!   strongest support for a

common origin for all life

§  Code is redundant   several codons for each

amino acid

§  Start codon   AUG   methionine

§  Stop codons   UGA, UAA, UAG

Page 22: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

How do amino acids get to the ribosome?

§  tRNA transports all the amino acids to the ribosome.   Each tRNA molecule attaches to only one type

of amino acid because of it’s structure.   This is done through base pairing.

§  tRNA carries only the amino acid that it’s Anticodon specifies.

Page 23: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

tRNA Structure §  “clover leaf” structure §  Anticodon - three bases

on tRNA that pair with codon of mRNA   on “clover leaf” end   amino acid on �

opposite end

Page 24: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Page 25: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Ribosomes Structure §  Made up of rRNA §  P site

  holds tRNA carrying growing polypeptide chain

§  A site   holds tRNA carrying next amino acid to be

added to chain

§  E site (exit site)   discharged tRNA �

leaves ribosome �from exit site

Page 26: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Steps of Translation 1. Ribosome reads mRNA

codons   AUG codes start

2. tRNA brings correct amino acids

3. tRNA matches anticodon to codon

4. Amino Acids assembled into polypeptide chain   Peptide bonds!

5. Protein synthesis is terminated by stop codon.

Page 27: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Page 28: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Translation Example

Use the Genetic Code chart and mRNA codons to figure out each amino acid in the sequence.

TACGCACATTTACGTACGCGG!DNA

AUGCGUGUAAAUGCAUGCGCC!mRNA

Met Arg Val Asn Ala Cys Ala!protein

Page 29: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Genetic Code Chart

Page 30: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Step 3: Protein Folding

§  Amino acid chains become active Proteins when they are freed from the ribosome and twist and curl into complex 3-D shapes.

  Each protein chain forms the same shape every

time it is produced.

§  These proteins become enzymes, cells, and tissue structures.

protein trait

Page 31: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

mRNA

From gene to protein

DNA transcription

nucleus cytoplasm

mRNA leaves nucleus through nuclear pores

proteins synthesized by ribosomes using instructions on mRNA

aa

aa

aa

aa

aa

aa

aa

aa

ribosome

protein translation

Page 32: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

The Big Picture

Page 33: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Page 34: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Gene Mutations

Page 35: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Reading Codons §  Codons are “read” by the ribosome three bases

at a time WHYDIDTHEREDBATEATTHEFATRAT!WHYDIDTHEREDBATEATTHEFATRAT!§  But, what happens if there is a change in the

DNA base sequence?

WHYDIDTHEREDCATEATTHEFATRAT!

WHYDIDTHEREDBATATTHEFATRAT!

WHYDIDTHEREDBATEATATHEFATRAT!

Page 36: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Gene Mutations §  A mutation is a permanent change in the DNA sequence of

a gene.   Mutations in a gene's DNA sequence can alter the amino acid

sequence of the protein encoded by the gene.

§  How does this happen?   Error during DNA replication

  Error during transcription

  Exposure to chemical, UV Radiation, carcinogen, etc.

Page 37: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

When do mutations affect the next

generation?

Point Mutations §  Single base change §  3 Outcomes

1.  Silent mutation –  no amino acid change

2.  missense –  Changes the amino acid

3.  nonsense –  changes to a stop codon

Page 38: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Point mutation leads to Sickle cell anemia What does the mutation cause?

Missense!

Page 39: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Frameshift Mutations §  Shifts reading frame

  changes everything “downstream”

§  2 Kinds   Frameshift Insertion

§  adding base(s)

  Frameshift Deletion §  losing base(s)

§  Outcomes:   nonsense or missense

Page 40: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Cystic Fibrosis

Page 41: Protein Synthesisdavidson-biochs.weebly.com/uploads/2/0/9/1/20917122/hb... · 2020. 1. 25. · Protein synthesis is terminated by stop codon. Honors Biology 2006-2007. Honors Biology

Honors Biology 2006-2007

Is there any value in mutations?