prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/syeda_marriam_ba… · viii table of...

i

GENETICS OF LEARNING

DISABILITIES

By

SYEDA MARRIAM BAKHTIAR

School of Biotechnology,

National Institute for Biotechnology and Genetic Engineering

(NIBGE), Faisalabad

&

Quaid-i-Azam University, Islamabad, Pakistan

2014

ii

Genetics of Learning

Disability

A dissertation submitted for partial fulfillment of the degree of

DOCTOR OF PHILOSOPHY

IN

BIOTECHNOLOGY

By

Syeda Marriam Bakhtiar

School of Biotechnology,

National Institute for Biotechnology and Genetic Engineering (NIBGE),

Faisalabad

&

Quaid-i-Azam University, Islamabad, Pakistan

2014

iii

DECLARATION

I hereby declare that the work presented in the following thesis is my own effort,

except where otherwise acknowledged, and that the thesis is my own composition.

No part of this thesis has been previously presented for any other degree.


iv

Dedicated to

TO MY FAMILY

Who offered me unconditional love and support throughout the course of

this thesis. Specially to my Father, who taught me that the best kind of

knowledge to have is that which is learned for its own sake, and to my

Mother, who taught me that even the largest task can be accomplished if it is

done one step at a time. And to all those - who knowingly and

unknowingly- led me to an understanding of some of the more subtle

challenges to our ability to thrive.

v

Use it …… to understand more about disease, prevent genetic diseases

coming into existence and possibly finding a way to cure them

J D Watson

viii

TABLE OF CONTENTS

1

1.1

1.2

1.3

1.4

1.5

1.6

1.7

1.8

2

2.1

2.2

2.3

2.4

2.5

2.6

2.7

3

3.1

3.2

Acknowledgments………………………………………………………………… X

List of tables ………………………………………………………………………… XII

List of figures………………………………………………………………………… XIV

List of abbreviations………………………………………………………………XVII

Abstract……………………………………………………………………………… .XIX

INTRODUCTION

Characteristics of Pakistani Population ……………….………………..

Genetic disorders and analysis techniques ………………………..…..

Learning disability ……………………………………………………….………

Stuttering…………………………………………………………………………….

Microcephaly……………………………………………………………………….

ASPM ………………………………………………………………………………..…

Dyslexia……………………………………………………………………………….

Objectives of the study……………………………………………….………..

MATERIALS AND METHODS

Family Identification and data collection……………………………….

Genomic DNA extraction..............................................................................38

Karyotyping.......................................................................................................39

Linkage Analysis..............................................................................................40

Mutation Analysis…………………………………………………………………

Genome wide screening (SNP6)…………………………………………….

Taqman Copy Number Assay………………………………………………..

RESULTS AND DISCUSSIONS

Family A………………………………………………………..…………………….

Family B………………………………………………………………………………

ix

3.3

3.4

3.5

3.6

4

Family C …………………………………………………………………………… ……..

Family D……………………………………………………………………………………

Family E……………………………………………………………………………………

Family F and Family G………………………………………………………… …….

REFERENCES …………………………………………………………………………

x

ACKNOWLEDGEMENTS

All the praises be to Almighty Allah, who is merciful, gracious, and whose bountiful

blessings enabled me to persuade higher ideals of life and bestowed upon me bodily

potential and mental faculties. All regards and respects to the Holy Prophet Mohammad

PBUH for enabling us to recognize our creator and guiding mankind towards the

straight path of life.

I would like to express my deep and sincere gratitude to my Supervisor, Dr. Shahid

Mahmood Baig, Head of Health Biotechnology Division (HBD) and Group Leader

Human Molecular Genetics Laboratory, National Institute for Biotechnology and

Genetic Engineering (NIBGE) Faislabad. His wide knowledge and logical way of

thinking have been of great value for me. His understanding, encouragement and

personal guidance have provided a good basis for the present thesis.

I owe my most sincere gratitude to Prof. Niels Tommerup, who gave me the opportunity

to work in the Wilhelm Johansen Center (WJC) for Functional Genomics, PANUM

Institute, Copenhagen University, Copenhagen, Denmark, and also for his valuable

advice, discussions and guidance. I am deeply grateful to Prof. Lars Hansen for his

detailed and constructive comments, and for his important support throughout this

work at WJC. I would like to thank Prof. Klaus W Kjaer for his importatnt input and

very useful discussions for this study at WJC.

I am grateful to Dr. Zafar .Mehmood Khalid, Director NIBGE, for providing me the

opportunity to work in the Institute and for supportive cooperation. My sincere thanks

to Dr. Fazli Rabbi Awan, Senior Scientist HBD for his support and cooperation. Special

thanks to Mr. Naveed Altaf Malik , Senior Scientist, HBD, for his friendly moral support.

My warm thanks are due to Professor Dr. Fayyaz Chaudary, Ex-Dean Department of

Biological Sciences, Quaid-i-Azam University (QAU), and Professor Dr. Abdul Hameed,

Dean Department of Biological Sciences, QAU for their kind support and cooperation

throughout this study.

xi

I am deeply indebted to my seniors Dr. Farooq Muhammad, Dr Mahmood Rasool , Dr.

Sadia Nawaz, Dr. Iram Anjum and Aysha Azhar for devoting their precious time to solve

my problems during different stages of research . I am thankful to my colleagues

especially , Shoaib ur Rehman, Ilyas Ahmed and Muhammad Tariq for their friendly

behavior, support and cooperation throughout this study. Cordial thanks to Usman

Raza, Scientific Assistant, and my juniors Lab fellows Tahir, Jamil and Ambrin, for their

help and support.

Special thanks to my friends both in QAU and NIBGE, Hina Naseem, Mehreen Aun,

Sarmad, Fozia, Maryam, Tehmeena, Sadia, Nosheen and Farzana for providing me moral

support. I take this opportunity to thank my fellows and friends in Denmark who made

my stay there memorable and pleasurable

Last but not least I am grateful to my loving family who always prayed for me and

helped during the course of this work. I cannot find any words which can express

thanks to my parents whose prayers carved my way to success. It is a pleasure to thank

those who made this thesis possible especially my siblings Luqman, Arooj and Sahar as

their encouragement and support from the begining to the final level enabled me to

complete this task. Thanks to my husband Amjad Ali who provided me any sort of

support whenever required during this study.

May Allah almighty bless all of them and grant me strength to attain the level of their

expectations from me.


xii

LIST OF TABLES

Table 1 Loci reported for Familial stuttering..........................................14

Table 2 Loci reported for autosomal recessive primary

microcephaly (MCPH)................................................................20

Table 3 Loci reported for Dyslexia............................................................24

Table 4 Standard solutions used in DNA extracti.....................................39

Table 5 Composition of Master mix used for P........................................41

Table 6 Thermal cycling conditions used for PCR..................................41

Table 7 Primers’ sequences of microsatellite markers used

for stuttering and microcephaly..................................................42

Table 8 Sequencing primers for ASPM..................................................46

Table 9 Sequencing primers for SOX3...................................................48

Table 10 Sequencing primers for ARX3 poly A repeats........................48

Table 11 Sequencing primers for GPRASP2............................................48

Table 12 Composition of Master mix used for PCR..............................49

Table 13 Thermal cycling conditions for sequencing amplification…49

Table 14 Composition of Exo-SAP treatment.........................................50

Table 15 Master mix for sequencing PCR................................................50

xiii

Table 16 Thermal cycling conditions used for sequencing....................51

Table 17 Taqman Copy Number Assay reaction mix for

real time PCR.............................................................................53

Table 18 Settings for real time PCR used in Taqman assay..................54

Table 19 Settings for Taqman Copy Number assay................................54

Table 20 Settings for Taqman Copy Number Reference Assay............54

Table 21 Parameters for real time PCR instrument..................................55

Table 22 List of genes present at 18p11.32-p11.31..................................77

Table 23 Candidate Homozygous regions found in Family G

after SNP6 analysis.....................................................................80

Table 24 List of candidate genes present in 2p12 homozygous

region in Family F .....................................................................81

Table 25 Positions of candidate regions reported on

short arm of chromosome 2 for dyslexia ................................82

xiv

LIST OF FIGURES

Figure 1 Anatomy of Human Brain..............................................................9

Figure 2 Interspecies comparison of the predicted

abnormal spindle protein..............................................................22

Figure 3 Pedigree of Family A with autosomal recessive

primary microcephaly...................................................................28

Figure 4 Pedigree of Family B with autosomal recessive


Figure 5 Pedigree of Family C with autosomal recessive


Figure 6 Pedigree of Family D with autosomal recessive


Figure 7 Pedigree of Family E indicating X-linked stuttering .................34

Figure 8 Pedigree of Family F with autosomal recessive dyslexia.........36

Figure 9 Pedigree of Family G with autosomal recessive dyslexia.........37

Figure 10 Representative DNA sequence chromatogram from

Family A. .....................................................................................57


Family B. .....................................................................................58

xv


Family C. ...................................................................................59

Figure 13 Graphical representation of the MCPH5 locus.q31.3

at chromosome 1........................................................................61

Figure 14 Analysis of copy numbers by Taqman probe assay..............62

Figure 15 Analysis of two Taqman probes Hs03084432 and

Hs03084882.................................................................................63

Figure 16 A) Position of deletion on chromosome1. B) position

of deletion with respect to ASPM. C) SNPs and CNVs

indicating the borders of the deletion. D) CNVs at the

left border of the deletion. E) SNPs at the right border

of the deletion. F) primers’ position designed for

breakpoint mapping......................................................................65

Figure 17 Window of UCSC genome browser indicating

two candidate regulatory regions present in the

deleted fragment..........................................................................66

Figure 18 Loop back hypothesis for enhancer element and

binding to ASPM promoter........................................................68

Figure 19 Gene network for lysosomal protein.........................................70

xvi

Figure 20 Position of candidate genes and markers on

X-chromosome...............................................................................71

Figure 21 Pedigree of Family E segregating X-Linked recessive

form of familial stuttering.. ...........................................................72

Figure 22 Graphical representation of results of Affymetrix SNP6 .......71

Figure 23 Graphical representation of results of Affymetrix SNP6

analyzed by Chromosome analysis suit indicating

homozygous regions on chromosome 18 ...................................75

Figure 24 Window of UCSC genome browser indicating

candidate region revealed by autozygosity mapping

in Family E....................................................................................77

Figure 25 Karyogram of affected individual from the

family F indicating normal karyotype.........................................79

Figure 26 Karyogram of affected individual from the

family G indicating normal karyotype.........................................79

Figure 27 Graphical representation of results of Affymetrix

SNP6 analyzed by Chromosome analysis suit

indicating homozygous regions on chromosome 2....................81

xvii

LIST OF ABBREVIATIONS

ADHD Attention Deficit Hyperactivity disorder

ASPM Abnormal Spindle like microcephaly associated genes

bp Base pairs

cM Centi Morgan

CNVs Copy Number Variations

CSF Cereberospinal fluid

DNA Deoxyribonucleotide acid

dNTPs Deoxy nucleotide triphosphates

EDTA Ethylene diamine tetra acetate

EST Expressed sequence tag

HC Head circumference

Kb Kilo bases

KDa Kilo Daktons

LD Learning Disability

LOD Logarithm of odds ratio

MCPH Primary Microcephaly

Mg Milligram

MIM Mendelian Inheritance in Man

ml Milliliter

mM Millimolar

mRNA Messenger Ribonucleic Acid

MRI Magnetic Resonance imaging

xviii

ng Nanogram

NJCLD National Joint Committee on Learning Disability

NMR Nuclear Magnetic Resonance

OFC Occipital Frontal Head Circumference

PCR Polymerase Chain Reaction

pH potential of Hydrogen Ion

RNA Ribonuclease acid

RPM Revolution per minutes

SD Standard Deviation

SNP Single Nucleotide Polymorphism

STG Superior Temporal Gyrus

STRs Short Tandem Repeats

SLI Specific language Impairment

STG Superior Temporal Gyrus

UV Ultra Violet

VNTRs Variable Number of Tandem Repeats

°C Degree centigrade

µl Microlitre

µM Micromole

θ Theta (Recombination fraction)

xix

ABSTRACT

Learning disability also referred as learning disorder or learning difficulty, is a

classification characterized mainly by the person’s difficulty in learning and

meeting milestones resulting in diverse etiology and patho-physiology. These

disorders can make it difficult for a person to learn quickly or in the same manner

as someone who is not affected by a learning disability. Usually these disorders

are outcome of defects in brain’s ability to receive and process information.

People with a learning disability have trouble performing specific skills or

completing tasks if left to figure things out by themselves or if taught in

conventional ways. Learning disabilities tends to run in families; therefore

genetics is believed to be one of the culprits. However, the form of learning

disability in parents may appear slightly different in child. A parent who has a

writing disorder may have a child with an expressive language disorder which

indicates that there may not be a direct link, but a general brain dysfunction may

be inherited.

The objective of the present study was to identify and characterize genetic

mutations responsible for various forms of learning disabilities which will enable

many families to get more appropriate diagnostic investigations and the possibility

of understanding the cause of disability in the child. In this study a total of 35

inbred families were identified and sampled from various regions of Pakistan

suffering with range of learning disabilities including microcephaly (20 families),

dyslexia (14 families) and stuttering (1 family). All analyzed families were

consanguineous and of Pakistani origin. For the identification of key genetic

variants in families suffering with learning disability linkage analysis, genome

xx

wide SNP analysis and copy number variation were performed, which lead to the

characterization of two known mutations c.9557C>G and c.3978G>A and one

novel mutation c.6131C>T ASPM gene, mutations in this gene are reported to be

the most common cause of microcephaly in Pakistan.

An enhancer element was also found in one of the families suffering with mild

form of microcephaly. This regulatory region is present 1.2 Mb downstream to

ASPM gene which loops back to allow transcription of gene. This enhancer is

present in region which is deleted in all affected individuals of the family. This

regulatory region is a cis acting element and possesses c.FOS and HeyI elements

which are complementary to ASPM promoter. In a genome wide linkage scan of

an apparently X linked family suffering with speech disorder, a risk locus for

stuttering in Pakistani families at 18p11.32-11.31 is mapped which contains seven

candidate genes but no mutation is found so far. In two families with autosomal

recessive dyslexia four candidate loci for dyslexia at 2p, 1p, 2q and 4q were also

found by Affymetrix SNP 6.

The present data extends our knowledge and understanding of the genetic and

molecular spectrum of learning disabilities. There are many disorders associated

with congenital defects to learn cognitive behaviors and it is necessary to setup a

correct diagnosis to avoid unnecessary and ineffective treatment options.

Knowledge of specific risk factors may improve our ability to design proper

strategies to cope with the impact of disease.

Chapter 1 INTRODUCTION

Genetics of Learning Disabilities 1

1 INTRODUCTION

1.1 CHARACTERISTICS OF PAKISTANI POPULATION

Despite the technological progress in mapping and sequencing of human genome and remarkable

advances in the application of molecular methods in medicine, molecular genetics research in the

field of child development and psychopathy is comparatively new in part. Although family

studies have provided considerable evidence that genetic influence play an important role in the

development of child behavior and cognition. The ignorance could be because of difficulties in

defining childhood disorders and scarcity of genetically informative families.

Pakistan, a unique country in the world with population size of 180 million with almost 70% of it

living in villages holding small area of land and engaged in small scale agriculture farming and

livestock business, just 30% population living in cities are engaged in services department and

small business to earn their living. Literacy rate is about 40% which is far low as compared to

many other developing countries (Bittles, 2001). Pakistani population is characterized by large

family size and high rate of inbreeding because of a strong tradition of marrying within the same

caste or tribe and consanguineous marriages are part of culture and tradition. In addition to high

frequency of consanguinity the lack of public health measures directed at the prevention of

congenital and genetic disorders, inadequate perinatal and prenatal health care, particularly in

low income groups pose a major risk factor for developing various diseases. Services for the

prevention and control of genetic disorders are restricted by certain cultural, legal and religious

limitations, for example, the cultural fear of families with genetic diseases to be stigmatized

within their community similarly, the social restrictions on selective termination of pregnancy of

an affected fetus (Alwan et al., 1997). As a consequence, large inbred families suffering from a

variety of diseases can be found commonly in Pakistan. Recessively inherited disorders are not

rare and account for a substantial proportion of physical and mental handicap.



1.2 GENETIC DISORDERS AND ANALYSIS TECHNIQUES

To better adapt the environment, nature allows new combinations of the genome by mixing the

hereditary material during every meiotic recombination. The term mutation usually implies

change in the nucleotide sequence of single gene, altering their coding information. Mutation is

one of the three vital processes; the others being recombination and random chromosome

assortment at fertilization, which lead to the molecular individuality of a person. These changes

in the sequence of DNA could benefit the organism, but sometimes also cause disease. Any

disease which could be caused by the changes in genome is referred as genetic disorder. Genetic

disorder could be monogenic (single gene disorder) or complex (involving multiple genes and

nongenetic factors). Mode of inheritance of genetic disorders could be autosomal or X-linked,

and phenotypically it could be recessive or dominant. There are many different approaches

which could be used to study whether genetic factors play a role in the susceptibility of a given

disease. Linkage analysis and association studies are two common methods which are exploited.

Both of these approaches utilize known genetic markers and polymorphisms which correlate

with genetic loci constituting the heritable component of the trait of interest.

On average, the DNA sequence from two randomly chosen individuals differs only in 0.1%. If

the variation occurs in a human population with frequency of ˃0.01 it is called as DNA

polymorphisms. Single nucleotide polymorphism (SNPs) is the most common form of genetic

variations present in the human genome. SNPs are important for the constitution of phenotypic

variation or genetic diversity in the human species but to a certain extent influence susceptibility

to disease (Przeworski et al., 2000). Repetitive sequences including short tandem repeats (STRs)

or variable number of tandem repeats (VNTRs), constitute another form of genetic variation.

They can range from di-nucleotide repeats to duplications which are several Kb in size.

Microsatellites or short tandem repeats (STR) are short sequences made up of 2-4 nucleotides

which repeat continuously for different lengths and the number of repeats is often highly

polymorphic. Majority of the microsatellites are in noncoding regions, and up to 80 different

alleles may exist at a single microsatellite locus (Sebat et al., 2004). Copy number variations

(CNVs) result in gain or loss of a certain DNA segment, this DNA segment could be a gene or a

regulatory element, ranging from 1 Kb to 3 Mb in size (Iafrat et al., 2004).



1.3 LEARNING DISABILITY

Learning disability is a descriptive concept, not a disorder. A long held (and totally valid) view

has been that the conditions leading to severe and profound learning disability have identifiable

pathologies, including genetic disorders. Learning disability (sometimes called as learning

disorder or learning difficulty) is a classification including several disorders in which a person

has difficulty learning in a typical manner, usually caused by defects in brain’s ability to receive

and process information. The phrase learning disability became prominent in the 1980s. It is

broad in scope, covering general conditions such as Down syndrome, microcephaly (MCPH) as

well as more specific cognitive or neurological conditions such as dyslexia and attention deficit

disorder. In emphasizing the difficulty experienced rather than any perceived ‘deficiency’ it is

considered less discriminatory and more positive than other terms such as mentally handicapped,

and is now the standard accepted term in official context.

According to American National Joint Committee on Learning Disability [NJCLD (1980)], the

term learning disability is defined as “A heterogeneous group of disorders manifested by

significant difficulties in the acquisition and use of listening, speaking, reading, writing,

reasoning or mathematical abilities. These disorders are intrinsic to the individual and presumed

to be due to Central Nervous System (CNS) dysfunction. Even though a learning disability may

occur concomitantly with other handicapping conditions (e.g. sensory impairment, mental

retardation, social and emotional disturbance) or environmental influences (e.g. cultural

differences, insufficient/inappropriate instruction and psychogenic factors etc), it is not the direct

result of those conditions or influences.”

Mild to moderate learning disability has been seen as largely socio-cultural and multi-

factorial/polygenic in origin. Secondly, familial disorders associated with learning disability

often do not show simple Mendelian inheritance. Partial penetrance, parent-of-origin effects and

anticipation occur, and in some cases can occur together (Walter, 2000). Learning disabilities fall

into two categories: verbal learning disability results in difficulty with words, both spoken and

written while non verbal learning disability causes difficulty in processing what is been seen.



1.3.1 LEARNING AND COGNITION IN HUMAN BRAIN

The human brain weighs only about 1400g, yet it contains more than 100 billion neurons. In

addition, each neuron may have from 1000 to 10,000 synaptic connections with other nerve cells.

There may be as many as 100 trillion synapses in the brain. Performance of even a simple task

involves multiple areas of brain, although each function is localized to a specific brain area, but

since many units are involved, widely distributed brain areas take part in mental tasks. Therefore,

brain process, stores, and retrieves information in different ways to suit different needs. For

example in learning of language, the role of two cerebral hemispheres differs anatomically,

chemically and functionally. In 90 percent of the population, the left hemisphere is superior at

producing language and in performing other tasks that require rapid changes overtime. But if a

damage occurs to the dominant hemisphere, some language functions can be acquired by the

opposite hemisphere, the younger the patient, the greater the transfer function (Widmaier et al.,

2004).

To date, little is known regarding the neural bases of cognition in normally developing children.

In order to address the neural circuits underlying cognitive development, a means of assessing, in

vivo, the developmental physiological course of the behavior is needed. In the case of

Microcepahly, ASPM, CDK5RAP2, CENPJ, STIL and WDR62 are expressed in fetal brain

during neurogenesis (Kumar et al., 2009, Bond et al., 2002). ASPM, CDK5RAP2 and CENPJ all

have roles in centrosome or mictotubule formation and can affect neurogenic mitosis by

influencing the spindle pole and astral microtubule network (Fong et al., 2008).the function of

microcephaly genes are consistent with the developmental mechanisms proposed to have

facilitated brain expansion. The phenotypes exhibited by individuals with microcephaly show

that these loci affect cortical surface area, not thickness, consistent with a role in regulating the

size of the neural progenitor pool (Desir et al., 2008). Developmental dyslexia is a most

common learning disorder and evidence suggest that early brain development is altered in

dyslexic readers. Genetic studies implicate genes associated with neuronal migration and axonal

guidance (Galaburda et al., 2006), and electro physiological data suggest that a deficit in the

perception of speech sounds is present in infants who became dyslexic readers (Molfese 2000).

Functional neuroimaging studies of dyslexic readers have reported atypical activation in 3



cortical regions: the temporoparietal area, the inferior frontal gyrus ad the fusiform gyrus (Simos

et al., 2002). Specific Language Impairment (SLI) involves abnormal development of brain

structure that constitutes the procedural memory system. This system is composed of a network

of interconnected structures rooted in frontal/basal ganglia circuits; sub serves the learning and

execution of motor and cognitive skills (Ullman and Pierpont, 2005).

1.3.2 GENERAL STRUCTURE OF THE BRAIN

The brain is protected by the scalp with its hairs, skin, fat and, other tissues, and by the cranium.

Brain floats shockproof in cerebrospinal fluid and is encased by three layers of protective

membranes called cranial meninges. It directly covers and is attached to the surface of the brain

and dips down into the fissures between the raised ridges of the brain. Within the brain there is a

series of connected cavities called ventricles. A network of blood vessels called a choroid plexus

is formed in several places where the ependyma contacts the pia mater. Each cranial ventricle is

filled with cerebrospinal fluid (CSF) and is lined by cuboidal epithelial cells (Gerard and

Nicholas, 1987). CSF is a clear, colorless liquid that is similar to blood plasma. It conveys excess

components and unwanted substances away from the extra cellular fluid and into the venous

portion of the blood circulatory system.

The brain is technically called the encephalon. It has four major divisions; brainstem,

cerebellum, cerebrum and diencephalon (Figure 1).

1.3.2.1 Brainstem

Brain stem is the stalk of brain, and it relays messages between the spinal cord and the

cerebellum. Its three segments are the midbrain, pons and medulla oblongata. Deep within the

brain stem is a slender network of neurons and fibers called reticular formation. The medulla

oblongata is connected to the pons by longitudinal bundles of nerve fibers. Just superior to the

medulla oblongata is the pons, so named because it forms a connecting bridge between medulla

oblongata and mid brain, the uppermost portion of brain stem (Wildmaier et al., 2004).

1.3.2.2 Cerebellum

The cerebral cortex is corrugated, with long, parallel ridges called folia cerebelli, which are more

regular than the gyri of the cerebral cortex. The cerebellum integrates the contractions of skeletal



muscles in relation to each other as they participate in a movement or series of movements

(Elaine et al., 2007). The main role of cerebellum is to regulate balance, timing and precision of

body movements and positions. It processes input from sensory receptors in the head, body, and

limbs. Through connections with the cerebral cortex, vestibular system, and reticular formation,

the cerebellum refines balance and coordinates muscular movements. The much larger lateral

lobe or hemispheres of the cerebellum help smooth out muscle movement.

1.3.2.3 Cerebrum

The largest and most complex structure of the nervous system is the cerebrum. It consists of two

cerebral hemispheres. Each hemisphere is composed of a cortex, white matter, and basal ganglia.

Each of the first four lobes of cerebrum contains special functional areas, including speech,

hearing, vision, movement and the appreciation of general sensations. The cerebellum has a

surface covering of gray matter called the cerebral cortex. The cortex is thin convoluted covering

containing over 50 billion neurons and 250 billion glial cells (estimated to be 70 % of the brain

cells), the raised ridges of the cortex are called convolutions or gyri, which are separated by slit

like grooves called sulci. Extremely deep cerebral grooves or depressions are called fissures

(Keith and Arthur, 1999). The cerebral hemispheres are separated by the longitudinal fissure, and

the cerebrum is separated from the cerebellum by the transverse cerebral fissure. Beneath the

cortex lies a thick layer of white matter. The thalamus is functionally integrated with the cerebral

cortex in the highest sensory and motor functions of the nervous system.

Each cerebral hemisphere is subdivided into six lobes; the frontal, parietal, temporal, occipital,

and limbic lobes, and the insula. The frontal lobe is involved with two basic cerebral functions,

the motor control of voluntary movements, including those associated with speech and the

control of emotional expressions and moral and ethical behavior. The parietal lobe is concerned

with the evaluation of the general senses. It integrates the general information that is necessary to

create an awareness of the body and its relation to its external environment. The temporal lobe is

the lobe located closest to the ears. It has critical functional roles in hearing, equilibrium, and to a

certain degree, emotion and memory. Occipital lobe, although it is relatively small, it is

important because it contains the visual cortex. It is made up of several areas organized for

vision and its associated forms of expression. Limbic lobe is the ring of cortex, located on the

medial surface of each cerebral hemisphere and surrounding the central core of the cerebrum.



The limbic system is a ring of structures encircling the brainstem. It is defined in functional

terms as an assemblage of cerebral, diencephalic, and midbrain structures that are actively

involved in memory and emotions and the visceral and behavioral responses associated with

them (Solms, 2002).

1.3.2.4 Diencephalon

The diencephalon is the deep part of the brain, connecting the midbrain with the cerebral

hemispheres. It houses the third ventricle and is composed of the thalamus, hypothalamus,

epithalamus, and ventral thalamus. The pituitary gland is connected to the hypothalamus (Donna

et al., 1995).

1.3.3 DEVELOPMENT OF BRAIN

The central nervous system appears at the beginning of the third week as slipper-shaped plate of

thickened ectoderm, the neural plate, in the middorsal region in front of the primitive pit. Its

lateral edges soon elevate to form the neural folds. With further development, the neural folds

elevate more, approach each other in the midline, and finally fuse, forming the neural tube.

Fusion begins in the cervical region and proceeds in cephalic and caudal directions (Kenneth,

2004). At the cranial and caudal ends of the embryo, fusion is delayed, and the cranial and caudal

neuropores temporarily form open connections between lumen of the neural tube and the

amniotic cavity. Closure of the cranial neuropore proceeds cranially from the initial closure site

in the cervical region, and forms a site in the forebrain that forms later (Gerard and Nicholas,

1987). This later site proceeds cranially to close the rostralmost region of the neural tube and

caudally to meet advancing closure from the cervical site. Final closure of the cranial neuropore

occurs at the 18 to 20 somite stage (25th

day); closure of the caudal neuropore occurs

approximately 2 days later.

The cephalic end of the neural tube shows three dilations, the primary brain vesicles: forebrain

(prosencephalon), midbrain (mesencephalon), and hindbrain (rhombencephalon).

Simultaneously, it forms two flexures: the cervical flexure at the junction of the hindbrain and

the spinal cord, and the cephalic flexure in the midbrain region. When the embryo is 5 weeks old,

the prosencephalon consists of two parts: the telencephalon, formed by a midportion and two

lateral outpocketings, the primitive cerebral hemispheres, and the diencephalon, characterized by



outgrowth of the optic vesicles (Adel and Ronald, 2005). A deep furrow, the rhombencephalic

isthmus, separates the mesencephalon from the rhombencephalon.

The rhombencephalon also consists of two parts: the metencephalon, which later forms pons and

cerebellum, and the myelencephalon. The boundary between these two portions is marked by the

pontine flexure. The lumen of the spinal cord, the central canal, is continuous with that of the

brain vesicles. The cavity of the rhombencephalon is the fourth ventricle, that of the

diencephalon is the third ventricle, and those of the cerebral hemispheres are the lateral

ventricles. The lumen of the mesencephalon connects the third and fourth ventricles. This lumen

becomes very narrow and is then known as the aqueduct of sylvius. The lateral ventricles

communicate with the third ventricle through the interventricular foramina of monro (Sadler et

al., 2000).



Figure 1: Anatomy of Human brain: Adapted from Widmaier et al., (2004).



1.4 STUTTERING

Language is truly a unique human gift and a complex process that enables communication and

social functioning. Most children acquire language naturally in the sequence of listening,

speaking, reading and writing. Failure in any of these processes may lead to lifelong socio-

economic and mental health consequences (Gayan et al., 1999). Among many causes of

language disability, dyslexia is the most common one. It is referred as a difficulty in learning to

read and spell despite adequate education, intelligence and socio-cultural opportunities and

without any sensory deficits (Shaywitz et al., 1998). Dyslexia is the most common subtype of

learning disabilities with a prevalence ranging from 5-10 per cent. The central difficulty in

dyslexia is the phonological awareness deficit (Roongpraiwan et al., 2002).

Specific language impairment (SLI) is diagnosed when a child is significantly delayed in speech

and language development despite having normal hearing, normal intelligence and no known

neurological problems. Research involving molecular genetics and /or pedigree analysis depends

crucially on having good measures for the phenotype under investigation. An imprecise

diagnosis of the phenotype can result in a genetically heterogeneous sample which will in turn

significantly impact on the research (SLI Consortium, 2004). Unfortunately, the SLI phenotype

by its very nature is heterogeneous. The disorder is diagnosed on the basis of (i) a low score on a

subset of language tests from a battery assessing receptive, expressive and phonological skills

and (ii) no other impairment that could potentially explain poor performance (Bishop, 2001).

The familial stuttering project is a part of a larger project to study Pakistani families with mild to

moderate learning disability. This project includes dyslexia as the most common learning

disability and neuro-developmental disorder, Attention Deficit Hyperactivity Disorder (ADHD),

which can be found in approximately 20% of the cases with dyslexia plus other childhood

developmental disorders showing clinical co-morbidity. The focus on developmental and

neurological disorders sharing clinical co-morbidity is relatively new, although family studies

have provided considerable evidence that genetic elements play an important role in the

development of child behavior and cognition, and the stuttering is just one phenotype in this

clinical very broad group of developmental disorder.



Developmental stuttering is a communication disorder that begins in early childhood and is

characterized by involuntary disruptions in the fluency of verbal expression. The most typical

core behaviors are repetitions of sounds or syllables and articulatory fixation, resulting in blocks

or prolongations of sounds (Suresh et al., 2006). The overt symptomology of the disorder is

characterized by excessive repetitions of sounds, syllables, and monosyllabic words, as well as

sound prolongations and complete blockage of the vocal tract. Any of these characteristics may

be accompanied by physical tension or movements, especially in the head and neck areas

(Conture and Kelly, 1991).

Stuttering, also known as stammering is a common speech disorder that has been recognized

since antiquity and affects all populations and language groups (Bloodstein et al., 2008). Familial

aggregation of stuttering has been extensively documented, with an increased incidence of

almost 15% in first degree relatives of probands; as compared with a 5% life time risk in general

population (Ambrose et al., 1993). The underlying causes are unknown, but twin studies,

adoption studies (Felsenfeld et al., 1997), and family studies (McFarlane et al., 1991) strongly

support genetic contribution in the etiology of stuttering. Stuttering is typically found in young

children and affects at least 15 % of those in age range of 4 to 6 six years, and the stuttering

resolves later leading to a population prevalence of 1 to 2 % (OMIM 184450).

The onset of stuttering usually occurs in childhood, between the ages of 3 and 6 years, with

reported rates of natural, unassisted recovery of almost 75% (Yairi and Ambrose, 1999). An

investigation into the relationship between persistence and recovery in stuttering, with the use of

pedigree and segregation analysis, suggested that the two phenomena are not genetically

independent disorders, though the persistence of stuttering may require the transmission of

additional genetic factors (Raza et al., 2012).

The superior temporal gyrus (STG) encompasses the primary auditory cortex and is believed to

be a major anatomical substrate for speech, language and communication (Rajarethinam et al.,

2000). The STG connects to the limbic system (hippocampus and amygdala), the thalamus and

neocortical association areas in the prefrontal cortex, all of which have been implicated in

schizophrenia (Hajeck et al., 1997). A variety of brain imaging tools have documented structural

(MRI or DTI), chemical (MRSI), functional (rCBF, PET, fMRI), and temporal (EEG, ERP, MSI)

differences dyslexics and good readers are often associated with phonological processing (Eckert



et al., 2003). The left and right inferior frontal gyrus (IFG) may participate in an executive

function panel for coordinating phonological and orthographic processing, respectively; in

children deactivation of right IFG was associated with improvements in phonological decoding.

The left IGF and its connections to cerebellum may function as the phonological loop in working

memory (Richard et al., 2006).

Stuttering is one of many complex disorders showing striking sex differences in severity and /or

prevalence. There is a significant sex bias in the incidence of stuttering, with a male to female

ratio of 2:1 during childhood increasing to 4:1 to 5:1 in adulthood. The increased polarity with

age of affected males versus female suggests that recovery from stuttering is considerably more

frequent in girls than in boys (Yairi and Ambrose, 2005).

1.4.1 LOCI REPORTED FOR STUTTERING

Genetic-linkage studies have provided evidence of linkage with numerous loci (Shugart et al.,

2004) but the studies are complicated by the high rate of spontaneous recovery in this disorder,

especially among females (Yairi et al., 1999) and by the likelihood of non-genetic and

heterogeneous causes. These factors make it probable that unaffected persons can carry

mutations associated with stuttering (i.e. may have non-penetrate mutations) and that affected

persons may not carry such mutations (i.e. may represent pheno-copies). Table 1 summarizes

various loci reported to be linked with familial stuttering.

1.4.1.1 Loci for X-Linked Stuttering

Two loci are so far reported for X-linked stuttering associated with other genetic abnormalities.

The locus Xp22.13 (MIM:309510) is associated with a syndrome of mild to moderate mental

retardation and episodic dystonic movements of hands referred as Partington Disease. In the

original Australian family reported by Partington et al. (1988), and in the unrelated Belgian

family reported by Frints et al. (2002) and Stromme et al. (2002), an expanded alanine repeat in

the ARX gene. The polyA expansion was due to the 24-bp duplication. The other locus Xq26.3

(MIM 313430) where stuttering is coupled with X-Linked mental retardation and isolated growth

hormone deficiency reported by Hamel et al. (1996), while Laumonnier et al. (2002) identified a

33 bp duplication (711-743 dup) in the SOX3 gene.



1.4.1.2 Autosomal Loci for Stuttering

Four loci are described for the stuttering phenotype, 18p11.3-p11.2 (STUT1, MIM 184450),

12q24.1 (STUT2, MIM 609261), 3q13.2-q13.33 (STUT 3, MIM 614655) and 16q12.1-q23.1

(STUT4, MIM 614668) and putative disease genes at the STUT2 locus and two other loci have

been reported (Kang et al., 2010). The disease displays very high genetic heterogeneity and is

associated both with autosomal recessive, autosomal dominant as well as with a sex-modified

autosomal dominant inheritance (McFarlane et al., 1991).

STUT 1

Familial persistent stuttering STUT1 located 18p11.3-p11.2 (MIM 184450) has been suggested

as susceptibility loci by Shugart et al. (2004). They performed a genome wide linkage survey

and used non-parametric analysis methods to identify genomic regions of interest. According to

them, major hindrance in genetic studies of stuttering include highly distorted sex ratio, an ability

to ascribe a mode of inheritance, the high frequency of the trait in ‘normal’ young children, and

greatly variable expression within families.

STUT 2

Familial persistent stuttering STUT2 located at 12q24.1 (MIM 609261) was refined to a 10 Mb

region between D12S101 and D12S1597 by Kang et al. (2010), in a large consanguineous

Pakistani family with stuttering. They identified E1200K variant in GNPTAB gene and also

found three variants each in GNPTG and NAGPA genes, present on locus 16p13.3, and

concluded that variations in genes governing lysosomal metabolism may be susceptibility factors

for non syndromic stuttering.

STUT 3

Familial persistant stuttering STUT 3 locus (MIM 614655) was identified genome wide linkage

analysis followed by fine mapping in a consanguineous Pakistani family with stuttering Raza et

al., (2010) found linkage to a region on chromosome 3q13.2-q13.33. Sequencing of DRD3 gene

was done but no mutation or variation was identified.



STUT 4

Familial Persistant stuttering locus STUT 4 (MIM 614668) in region 16q12.1-q23.1 was located

by genome wide linkage analysis followed by fine mapping in Pakistani kindred with stuttering

(Raza et al., 2012)

Table 1: Loci reported for Familial Stuttering

Chromosome Position Gene Reference

Chr:X Xp22.13 ARX Partington et al., 1988

Chr:X Xq26.3 SOX3 Laumonnier et al., 2002

Chr:18 18p11.3-p11.2 No gene identified yet Shugart et al., 2004

Chr:3 3q13.2-q13.33 No gene identified yet Raza et al., 2010

Chr:12 12q24.1 GNPTAB Kang et al., 2010

Chr:16 16q12.1-q23.1 No gene identified yet Raza et al., 2012

1.5 MICROCEPHALY

Microcephaly is defined as small cranium with significantly reduced occipito-frontal head

circumference (OFC) of more than two standard deviations (SD) below the mean for age, sex,

and ethnicity (severe Microcephaly OFC < -3 SD). Autosomal recessive primary Microcephaly

(MCPH) is a condition where fetal brain growth is significantly reduced (as is head size

throughout the life), brain architecture is normal, and there is no apparent abnormalities in other

body systems (Woods et al., 2005). The incidence of Microcephaly at birth, as evaluated in birth

defect register world-wide, varies from 1.3 to 150 per 100,000 live births, depending on the

population and the applied SD threshold to define Microcephaly (source: International

Clearinghouse for Birth Defects Surveillance and Research, 2006 report;

http://www.icbdsr.org/). Primary, non syndromic Microcephaly has an incidence of 1:30,000 to

1:250,000 live-births.



Microcephaly can be acquired (caused by environmental factors like congenital infection with

toxoplasma, maternal alcohol overconsumption during pregnancy etc.) or hereditary in origin

and can become apparent congenitally (primary Microcephaly) or postnatal (secondary

Microcephaly). Microcephalia vera (true Microcephaly) is a loosely defined, historical term

referring to children with isolated, non syndromal congenital Microcephaly. This term was

coined without consideration of etiology or neuropathology, and is still applied, however, in a

narrower sense, to designate patients with non-syndromal autosomal recessive Microcephaly

without lisssencephaly or pachygyria. The initial definition of autosomal recessive primary

Microcephaly (MCPH) has proved useful to both clinicians and researchers as it is easy to

identify an individual with a small but structurally normal brain, a mild to moderate mental

retardation but otherwise normal in appearance, health and neurological functioning (Cox et al.,

2006).

1.5.1 CLINICAL FEATURES AND PHENOTYPE OF MCPH

The term “microcephaly” refers to clinical findings: a head circumference (HC) significantly less

than expected for an individual’s age and sex. HC is used as surrogate measurement of brain

size; however, it is only imperfectly correlated with brain volume. Other methods have been used

(e.g., NMR), but HC remains the common, simple method for evaluating gross brain size,

although it needs to be accurately measured and charted relative to age and sex. An HC of three

standard deviations below the mean (-3SD) is usually the cut-off for defining microcephaly

(Baraiser, 1990). However, it is becoming clear that the true phenotype spectrum of patients with

MCPH gene mutations is wider than indicated by previous publications which for the most part

provide no detailed phenotype information. In individual patients, the OFC is still in the normal

range (around -2 SD) at birth followed by a development of a Microcephaly within the first year

of life (Passemard et al., 2009). MCPH may already be evident by the 24th

week of gestation

through ultra sound and /or MRI analysis (Tunca, 2006). It has been demonstrated recently that

neurological features can indeed occur in patients with MCPH due to ASPM gene mutations.

These include speech delays, hyperactivity and attention deficit, aggressiveness, focal or

generalized seizures, delay of developmental milestones and pyramidal signs (Passemard et al.,

2009). Imaging studies reveal typically brains of ‘normal architecture’ but of reduced size. The

latter is particularly evident in the cerebral cortex, which shows a simplified cerebral cortex



structure, and there is also a slightly reduced white matter volume. Individual patients with

MCPH provide evidence of periventricular neuronal heterotopias suggesting neuronal migration

defects (Woods et al., 2005).

As phenotype , the term “true microcephaly” used for the sloping forehead as defining feature;

however, as it is not seen in all cases of Microcephaly so a new diagnostic label “Autosomal

recessive primary microcephaly” shortened to MCPH was been used (MIM#251200). The initial

defining clinical features of MCPH in the studies by Jackson et al. (2002) and Roberts et al.

(2002) were:

1. Congenital microcephaly at least 4SD below age and sex means.

2. Mental retardation but no other neurological findings, such as spasticity, seizures, or

progressive cognitive decline.

3. Normal height and weight, appearance, and results on chromosome analysis and brain

scan.

NMR and CAT scans of the brain show that MCPH causes a central nervous system of reduced

size, with the greatest effect on the cerebral cortex (Bond et al., 2003). The timing of the

reduction in growth has been elucidated by ultra sound of affected pregnancies. Normal head

measurements are found up to 20 week of gestation, whereas a decreased HC is seen by 32 wk.

after birth, HC lies between -4 and -12 SD (Tolmie et al., 1987). Subsequent to MCPH gene

discovery, genotype/phenotype studies showed that the original MCPH diagnostic criteria

required revision. The original definition excluded seizures, height reduction, and abnormal

cytogenetic findings, these features have now been reported in some cases of MCPH, and the

diagnosis of MCPH is no longer excluded by their presence. Therefore MCPH was redefined as:

1. Congenital microcephaly, with HC at least 4SD below age and sex means.

2. Mental retardation but no other neurological findings, such as spasticity, or progressive

cognitive decline. Fits are unusual but do not exclude the diagnosis.

3. For the majority of people with MCPH, normal height, weight, appearance, chromosome

analysis, and brain scan are reported. For people with MCPH1 mutations, a reduction in

height may be found, but the HC will always be significantly more reduced than height;

on NMR scan, some MCPH1 patients show evidence of periventricular neuronal



heteropias suggestive of neuronal migration defects; and cytogenetic analysis may

indicate an increased proportion of prophase like cells (Woods et al., 2002).

1.5.2 MCPH GENES AND PATHOMECHANISMS

MCPH can be caused by recessive mutations in up to seven genes (Table 2) encoding

microcephalin (MIM#251200) MCPH1 (Jackson et al., 2002), Cyclin Dependent Kinase 5

regulatory associated protein 2 CDK5RAP2 (MIM#604804) MCPH3 (Bond et al., 2005),

abnormal spindle like, Microcephaly associated ASPM (MIM#608716) MCPH5 (Pattison et al.,

2000), Centromeric Protein J CENPJ (MIM#608393) MCPH6 (Leal et al., 2003), SCL/TAL1-

interrupting locus STIL (MIM#612703) MCPH7 (Kumar et al., 2009) as well as linkage to two

loci with newly discovered genes 19q13.1-13.2 (Roberts et al., 1999) WDR62(MIM#604317)

MCPH2 (Nicholas et al. 2010) and 15q15-q21 (Jamieson et al., 1999). MCPH4 (MIM#604321)

CEP152 (Guernsey et al. 2010) Further genetic heterogeneity likely exists as about 20-30 % of

families with MCPH do not show linkage to any of the currently known loci (Kaindl et al.,

2009).

Unexpectedly most of the known MCPH genes, CDK5RAP2, ASPM and CENPJ (better known

as CPAP), encode centrosomal proteins, highlighting the importance of the centrosome in

neurogenesis (Zhong et al., 2006). All the MCPH proteins identified are ubiquitously expressed

and have a centrosomal association for at least part of the cell cycle; suggesting knowledge of a

centrosomal association might provide guidance in the selection of candidate genes. Despite this,

a common mechanism explaining the role of the MCPH genes in neurogenesis has yet to emerge.

All four known MCPH proteins are also present in the midbody (the microtubular structure

linking daughter cells at the final stage of cytokinesis) and have apparently diverse roles:

microcephalin in DNA repair and chromosome condensation, CDK5RAP2 and CENPJ in

centriole/centrosome replication, and ASPM in modulating the plan of cytokinesis in neural

precursors (Graser et al., 2007).

1.5.2.1 MCPH1 (8p23)

The MCPH1/ Microcephalin gene is a 14 exon gene that encodes an 835 amino acid protein on

chromosome 8p23. It was identified by positional cloning within an ancestral haplotype shared



by two consanguineous Pakistani families (Jackson et al., 2002). Mutations in MCPH1 gene are

an infrequent cause of MCPH; however, some studies have defined a broader phenotype for the

MCPH1 gene than that described for other MCPH genes. For example, premature chromosome

condensation (PCC) syndrome has been shown to be allelic to MCPH1 primary microcephaly.

The defining features of this disorder are: significant Microcephaly, short stature and an unusual

cytological cellular phenotype of excess prophase like cells in conjunction with recurrent poor

banding quality (Neitzel et al., 2002).

The human phenotype due to MCPH1 mutations may be caused by defective cell cycle

checkpoint control and DNA repair. Cell cycle checkpoints are regulatory pathways that govern

the order and timing of cell cycle transitions to ensure completion of one cellular event prior to

commencement of another one. These checkpoints control mechanisms are linked to those of

DNA damage repair as, in response to DNA damage, the cell cycle needs to be delayed until the

damage is repaired to restore the integrity of the organism or; if repair is not possible, arrested

with subsequent induction of cell death (Bork et al., 1997).

1.5.2.2 MCPH2 (19q13.1-q13.2)

This region was first reported by Roberts et al. (1999) as a candidate region for MCPH. The

minimum critical region containing the MCPH2 locus was defined by the polymorphic markers

D19S416 and D19S420, spanning a region of approximately 7.6 cM. Recently, Nicholas et al.

(2010) reported WDR62 mutations associated with spindle pole.

1.5.2.2 MCPH3 (9q33.3)

The MCPH3 locus harbours the 34-exon gene cyclin dependent kinase 5 regulatory associated

protein 2 [CDK5RAP2 (Bond et al., 2005)]. It has been recently reported that CDK5RAP2 is

required for spindle checkpoint regulation, as loss of function leads to chromosome mis-

regulation and reduced expression of the spindle checkpoint proteins BUBR1 (budding

uninhibited by benzimidazoles 1 homolog beta) and MAD2 (mitotic arrest-deficient 2) via

interaction with their promoters and transcription regulation in Hela cells. Chromosomes

segregation is initiated by activation of the spindle checkpoint target APC (anaphase promoting

complex), which functions as an E3 ligase when bound to its activator CDC20 and drives cells



from metaphase into anaphase by inducing degradation of securin and mitotic cyclins (Zhang et

al., 2009).

1.5.2.3 MCPH4 15q15-q21

A novel locus was reported at 15q15-q21 in a consanguineous Moroccan family by Jamieson et

al. (1999). While recently, Guernsey et al. (2010) reported homozygous and compound

heterozygous mutations in CEP152 gene in three unrelated patients from Eastern Canada.

1.5.2.3 MCPH5 1q31

Homozygous mutations of the MCPH5 gene, also known as abnormal spindle-like

Microcephaly-associated gene (ASPM), are the most common cause of the MCPH phenotype.

ASPM plays a role in mitotic spindle function including orientation of cleavage plane. The

spindle apparatus dictates the plane of cell cleavage, which is critical in the choice between

symmetric or asymmetric division. Spindle positioning is controlled by an evolutionary

conserved pathway. ASPM localizes to the centrosome in the interphase and to mitotic spindle

poles, from prophase through telophase, in murine embryonic neuroepithelial (NE) cells and

primary stem cells as well as progenitor cells of the mammalian brain. ASPM maintains

symmetrical cell divisions and is down regulated with the switch from proliferative to

neurogenic divisions (Fish et al., 2006).

1.5.2.4 MCPH6 13q12.2

The human centromeric protein J gene encodes CRNPJ, also referred to as centrosomal P4.1-

associated protein (CPAP), LAG-3-associated protein (LAP) or LYST-interacting protein 1

(LIP1). CENPJ plays a role on centrosome and spindle function. The protein shows centrosomal

localization throughout the cell cycle in a microtubule-independent way and is associated to the

y-tubulin complex. It has been suggested that CENPJ regulated microtubule dynamics at the

centrosome, and such a precise regulation of microtubule assembly and disassembly at

kinetochore and centrosomes is thought to be important for the maintenance of the spindle

structure and chromosome segregation during mitosis (Hung et al., 2004).



1.5.2.5 MCPH7 1p32

The human SCL/TAL1-interrupting locus gene encodes STIL, also referred to as SCL-

interrupting locus (SIL). STIL is an immediate early gene that encodes a cytosolic protein of 150

KDa whose function is not fully understood and which lacks homology to any known protein

families or motifs. Two isoforms have been reported (Karkera et al., 2002). STIL is expressed

throughout the cytosol with increased expression in the perinuclear region that probably plays a

role in mitotic entry (cell cycle progression in the perinuclear region that likely plays a role in

mitotic entry in cell cycle progression during G2-M), apoptosis control and centrosome function.

In HeLa and HEK293T cells, endogenous STIL was detected at the poles of the mitotic spindle

in the metaphase (where the microtubules coalesce adjacent to the centrosome), while cells in the

anaphase did not show this localization and interphase cells expressed almost no STIL

(Campaner et al., 2005).

Table 2: Loci reported for Autosomal Recessive Primary Microcephaly (MCPH)

Locus Position Gene Reference

MCPH1 8p23 Microcephalin Jackson et al., 2002

MCPH2 19q13.1-q13.2 WDR62 Nicholas et al., 2010

MCPH3 9q33.3 CDK5RAP2 Bond et al., 2005

MCPH4 15q15-q21 CEP152 Guernsey et al., 2010

MCPH5 1q31 ASPM Bond et al., 2002

MCPH6 13q12.2 CENPJ Hung et al., 2004

MCPH7 1p32 STIL Campaner et al., 2005



1.6 ASPM

In the evolutionary lineage leading to Homo sapiens, one of the most notable trends is the

dramatic enlargement of the brain, specially the cereberal cortex, and the site of higher cognitive

functions (Finlay and Darlington, 1995). Anatomy, physiology and behavior have been major

focus of efforts to study evolution of brain. By contrast, genetic basis of brain evolution remain

poorly explored. Because the genes implicated in MCPH; including ASPM, are specifically

involved in determining cerebral cortex size, it is tempting to speculate that these genes may also

play a role in the evolutionary enlargement of the human cerebral cortex (Evans et al., 2004).

Consistent with the function of human ASPM in controlling brain size, the mouse ASPM gene is

expressed prominently at the site of cerebral cortical neurogenesis (Bond et al., 2002), and the

Drosophila homolog, ASPM, encodes microtubule-binding protein required for proper mitotic

spindle organization during neuroblast proliferation (Do Carmo et al., 2001).

ASPM is found to be widely expressed in fetal and adult human tissues with lower levels in adult

tissues. ASPM is up-regulated in human ovarian and uterine cancer tissues. ASPM gene contains

28 exons and spans 62 kb of genome sequence on chromosome 1 region 1q31. The predicted

full-length protein contains 3477 aminoacids and has a calculated molecular mass of 410 kD.

ASPM contains two conserved regions termed ASPM N-Proximal (ASNP) repeats, and more

than half of the protein consists of 81 C-Terminal calmodulin-binding IQ motifs of variable

length. Western blot analysis identified several predicted alternatively spiced ASPM variants

with fewer IQ motifs. Immunostaining of cultured human cells revealed that ASPM was

localized in the spindle poles during mitosis (Kouprina et al., 2005). Interspecies comparisons of

the predicted abnormal spindle proteins (Fig. 2) indicate that they are notably conserved overall,

but show a consistent correlation of greater protein size with larger brain size. Both the putative

amino terminal microtubule binding region of asp and a putative calponin homology domain are

conserved in Aspm and ASPM (Saunders et al., 1997).



Figure 2: Interspecies comparison of the predicted abnormal spindle proteins: Genomic

structure of ASPM; phylogenetic comparison of the primary structure of asp, Aspm and ASPM;

a, Genomic structure of ASPM, containing 10434 bp and 28 exons. The four premature stop

codons that cause protein truncations in individuals with MCPH are marked with asterisks. The

primary mouse-human difference is marked by a gray box. Dotted lines mark the exons

comprising each domain of the ASPM protein. b, the predicted sizes and domains of abnormal

spindle proteins in Homo sapiens, Mus musculus, D.melanogaster and C.elegans (m.musculus

and C. elegans protein sequences are predictions). The putative microtubule-binding domains

(gray box), calponin-homology domain (hatched box), multiple IQ calmodulin-binding domains

(filled bars) and terminal region (diagonal striped box) are shown for each. Adapted from Bond

et al. (2002).

1.7 DYSLEXIA

Affecting more than 5% of the school age children, dyslexia is the most common learning

disorder. Developmental dyslexia is a specific disorder in learning to read and spell in spite of

adequate educational resources, normal intelligence, no obvious sensory deficits and adequate

socio-cultural opportunity. The impairment in dyslexia appears to be in phonological processing,

which interferes with the function of the linguistic system at the higher level, such as semantics

(Shaywitz, 1998). Functional brain imaging studies have shown that dyslexic subjects have a

common neuro-anatomical basis (Paulesu et al., 2001). Dyslexia is a multi-factorial, or complex

phenotype, the genetic basis of which has been established in a number of twin and family based



studies (Fisher and De Fries 2002). In addition to its complex etiology, dyslexia displays a wide

spectrum of phenotypes, which could also reflect incomplete penetrance, and / or the effect of

influencing environmental factors.

Specific reading problems in dyslexia include difficulties in single word decoding, processing

new words, and making distinction between similarities and differences, also dyslexics’ shows

reversal and transposition of words and letters (Artigas-Pallares, 2009). They also have

difficulties in map reading, confusion with left and right and fail to become right or left handed.

There is no single test for dyslexics. Diagnosis involves an evaluation of medical, cognitive,

sensory processing, educational and psychological factors. It is usual to undergo vision, hearing

and neurological examinations to see whether another disorder may be causing or contributing to

poor reading ability.

Although the presence of strong genetic influences on reading related disabilities is evident, but

the mode of inheritance of dyslexia remains unclear. Autosomal dominant, autosomal recessive

and polygenic models, as well as genetic heterogeneity have been suggested (Ging-Yuek et al.,

2004). As reading is a complex task, this disability could arise from deficiencies in one or more

cognitive processes. Due to this complex nature, identification of dyslexia genes is difficult task

and it is most likely to be influenced by the interaction of many genetic and environmental

factors (Fisher, 1999).

The risk of dyslexia is more in relatives of dyslexics compared to the general population.

Familial clustering in dyslexia was recognized a few years after the first description of the

disorder by Hinshelwood in 1895. A child with an affected parent has a risk of 40-60% of

developing dyslexia. The risk is increased when other family members are also affected (Zeiger

et al., 2005).

Several phenotypes have been found in dyslexics but the etiological link between these related

phenotypes and genotypes is yet to be established. Thus isolation and analysis of the genetic

variants will initiate a new phase of research which will provide a more fundamental

understanding of the nature of dyslexia, eventually leading to an early diagnosis, risk estimation,

better methods of treatment and prevention (Pushpa and Ramachandra, 2006).



1.7.1 LOCI REPORTED FOR DYSLEXIA

Linkage and association studies have investigated dyslexia both as a categorical trait and as a

composite condition, with several independent components analyzed contributing to the disorder.

To date, nine (DYX1-DYX9) chromosomal regions have been confirmed (Table 3). Four

candidate genes for the susceptibility of developing dyslexia have been suggested.

Table 3: Loci reported for Dyslexia

Locus Position Gene Reference

DYX1 15q21 DYX1C1 Smith et al.,1983

DYX2 6p22.2 DCDC2, KIAA0319 Meng et al., 2005, Francks et al., 2004

DYX3 2p16-p15 - Petryshen et al., 2002

DYX4 6q11.2-q12 - Petryshen et al., 2001

DYX5 3p12-q13 ROBO1 Nopola-Hemmi et al., 2001

DYX6 18p11.2 - Fisher et al., 2002

DYX7 11p15.4 DRD4 Hsiung et al., 2004

DYX8 1p36-p34 - Rabin et al., 1993

DYX9 Xq27.3 - De Kovel et al., 2004



1.8 OBJECTIVES OF THE STUDY

A screening program for genetic carriers is a systematic attempt to identify and counsel as many

people at genetic risk in a population as possible specially people with the family history. An

Islamic ruling (‘Fatwa’) in 1990 allows termination of pregnancy in the first 120 days after

conception if the fetus is diagnosed beyond doubt to be affected with a severe malformation that

is not amenable to treatment (Consang.net) and the Law in Pakistan allows it.

When a gene for a recessive disorder is present in a family, the diagnosis of the disease in a child

serves as a marker of the extended family that is at increased genetic risk. In communities where

a high level of consanguinity exists and large families are common. Family oriented screening

offers an alternative to population screening for identifying current and future couples at risk of

producing affected children. This approach is particularly suitable to populations with a high

level of consanguinity and clustering of rare genetic diseases in certain communities or families.

It produces a high yield of information on carriers and couples at risk, family members

understand this condition because if they already have experience of having an affected child in

the family. Usually one gene variant is present in a given family or tribe, simplifying and

reducing the cost of DNA based diagnosis (Ahmed et al., 2002; Baig et al., 2008). This strategy

is being successfully used in the case of hemoglobanopatheis in this country.

Therefore, this study is designed with the following objectives:

1. To determine the phenotypic and genetic variability in Learning Disabilities among

Pakistani families.

2. To identify the loci/genes involved in Learning Disabilities in Pakistani population.

3. To identify the mutations in families affected with learning disability.

4. Elucidation of genetic mechanism of disease.

Chapter 2 MATERIAL AND METHODS


2 MATERIALS AND METHODS

2.1 FAMILY IDENTIFICATION AND DATA COLLECTION

Approval for the study was obtained from Institutional Research Ethics Committee of National

Institute for Biotechnology and Genetic Engineering (NIBGE), School of Biotechnology, Quaid-

i-Azam University, Islamabad, Pakistan. In this study, a total of 20 consanguineous families

diagnosed with autosomal recessive primary Microcephaly (MCPH) and 15 consanguineous

families with provisional diagnosis of Dyslexia or Autism spectral disorders were ascertained

from different regions of Pakistan. Families selected for this study were ascertained with the help

of physicians, clinical laboratories, and hospitals, institutions for special children, school

teachers and resource persons who collaborate with Human Molecular Genetics Laboratory

(HGML) NIBGE in order to identify consanguineous families with inherited disorders. Informed

consent was taken from all the families under study after explaining the purpose and expected

benefits of this research project. Families were visited at their residence and relevant clinical

information was carefully collected to exclude involvement of any environmental factors.

Clinical history was recorded for both affected and unaffected individuals, standardized

questionnaire was filled and proper diagnosis was carried out with the help of the clinician,

neurologist, radiologist, psychiatrist, psychologist or speech therapist etc. collaborating in this

study.

After having informed consent from all members taking part in the study, pedigrees were drawn

during field sampling trips with information collected from elders of family, relatives and family

friends. An extensive pedigree was constructed for each family for genetic inference by standard

method (Bennett et al., 1995). Pedigree information was collected from the family members and

constructed by interviewing multiple family members. Pedigrees were drawn by using Cyrillic

software, version 2.1.3 (Cherwell Scientific Publishing Ltd, Oxford, UK). Photographs of all the

affected members were taken for record and for further molecular analysis blood samples were

taken from the normal and affected family members to extract genomic DNA.

Peripheral venous blood samples were taken from both affected and normal family members,

using 5-10 ml sterile syringes or multiple sampling needles and immediately transferred to 5-10



ml sodium EDTA vacutainers. Blood samples were kept at 4°C till DNA extraction at HGML,

NIBGE.

2.1.1 FAMILY A

Family A originated from Bahawalnagar District of Southern Punjab Pakistan. This pedigree had

three loops originated from same forefather and eight affected individuals born from

consanguineous marriages. A total of 10 individuals were sampled, four of which were affected.

Pedigree show autosomal recessive mode of inheritance. All the affected individuals showed

head circumference (HC) 7-8 SD below age and sex related mean in the population. All the

unaffected siblings and parents of the affected individuals showed normal head circumference.

Affected individuals have mild mental retardation with some aggressive behavior but able to do

self care. Apart from microcephaly and mental retardation associated with it, affected individuals

had no other clinical malformations and symptoms. Figure 3 shows pedigree of the family where

square represents male and circle represents female, solid symbols indicate phenotypically

affected individuals, horizontal line indicates marriage and two horizontal lines indicate

consanguineous marriage. Roman numbers indicate generation while Arabic numerals indicate

sample within a particular generation.

2.1.2 FAMILY B

Family B is small with only two affected individuals whose parents were first degree cousins.

Family was sampled from Bahawalnagar and both affected individuals revealed no other clinical

malformation, symptoms or apparent physical deformity. As both parents of affected children are

normal therefore autosomal recessive mode of inheritance is deduced. Figure 4 shows pedigree

of the family where square represents male and circle represents female, solid symbols indicate

phenotypically affected individuals, horizontal line indicates marriage and two horizontal lines

indicate consanguineous marriage. Roman numbers indicate generation while Arabic numerals

indicate sample within a particular generation.



A

B

Figure 3: Pedigree of Family A with autosomal recessive primary microcephaly. A)

Pedigree of family indicating autosomal recessive mode of inheritance. Solid symbols represent

affected subjects, while the open symbols represent normal individuals. Roman numerals

indicate generation number. B) Pictures of representative affected individuals of the family

showing slopping foreheads.



A

B

Figure 4: Pedigree of Family B with autosomal recessive primary microcephaly. A)



indicating generation number B) Picture of representative affected individual of the family

indicating slopping foreheads.



2.1.3 FAMILY C

Family C sampled from Qasoor Central Punjab region has six affected probands in two loops.

Pedigree shows autosomal recessive mode of inheritance as parents are normal. Sample III: 7; 40

years of age (HC 42cm) 5 SD below and sample III: 8; 45 years of age (HC 42 cm) 5 SD below

than the mean for age and sex, both these affected individuals showed no sign of seizers or

epilepsy but unable to speak properly despite normal hearing. All unaffected individuals show

normal head circumference. Affected individuals were able to do self care but unable to

communicate properly. Figure 5 shows pedigree of the family where square represents male and

circle represents female, solid symbols indicate phenotypically affected individuals, horizontal

line indicates marriage and two horizontal lines indicate consanguineous marriage. Roman

numbers indicate generation while Arabic numerals indicate sample within a particular

generation.

Fig. 5: Pedigree of Family C with autosomal recessive primary microcephaly: Pedigree of

family indicating autosomal recessive mode of inheritance. Solid symbols represent affected

subjects, while the open symbols represent normal individuals. Roman numerals indicate

generation number.



2.1.4 FAMILY D

Family MCP 85 originated from Bahawalnagar, South of Punjab. This family had three loops

originated from same forefathers with five affected individuals resulting from consanguineous

marriages. Family chart or pedigree show autosomal recessive mode of inheritance. In branch I

(central), two non-microcephalic individuals suffered from blindness. All affected individuals

show head circumference less than expected age and sex mean in the population. Sample VII:8 7

years of age (HC:34cm) 8 SD below; sample VII:9 5 years of age (33cm) 7SD below; sample

VII:1 16 years of age (43 cm) 5 SD below; sample VII:2 18 years of age (45 cm) 4 SD below,

sample VII:3 22 years of age (46.5cm) 4 SD below and sample VIII:1 7 years of age (41cm) 5

SD below mean for age and sex. All the normal siblings and parents had normal head

circumference. In addition to small head, affected individuals had very mild mental retardation

and were able to do self care. Figure 6 shows pedigree of the family where square represents

male and circle represents female, solid symbols indicate phenotypically affected individuals,

horizontal line indicates marriage and two horizontal lines indicate consanguineous marriage.

Roman numbers indicate generation while Arabic numerals indicate sample within a particular

generation.



A

B

Figure 6: Pedigree of Family D with autosomal recessive primary microcephaly: A)



indicate generation number. B) Photographs of representative affected individuals from the

family indicating sloping foreheads.



2.1.5 FAMILY E

This family was sampled from Bahawalnagar South of Punjab. Family suffered with speech

difficulty and stutter with repetition of words. Affected individuals were offspring of

consanguineous union. They showed no other physical deformity, tics or mental disability.

Parents are normal and all affected are males and pedigree analysis indicates X-linked recessive

mode of inheritance. Their social behavior was normal and they did not show any sign of

aggression or communication disorders. Stuttering frequency increases during excitement.

Parents were normal and show no sign of stuttering. Figure 7 shows pedigree of the family where

square represents male and circle represents female, solid symbols indicate phenotypically






Figure 7: Pedigree of Family E with Stuttering: Pedigree of family indicating X-Linked

inheritance. Solid symbols represent affected subjects, while the open symbols represent normal

individuals. Roman numerals indicate generation number.



2.1.6 FAMILY F

Family F is small with only three affected individuals, sampled from District Rawalpindi, North

of Punjab. Three affected individuals born from consanguineous marriage. Both parents and two

siblings appear to be normal and show no sign of learning disability. Affected children were

physically normal and show no sign of mental disability, able to do self care but slow learners.

They were not aggressive or hyperactive. Had some difficulty in reading and writing despite of

normal eye sight and hearing. They also had some speech problems as they were not able to

communicate properly. Pedigree analysis indicate autosomal recessive mode of inheritance.

Figure 8 shows pedigree of the family where square represents male and circle represents female,

solid symbols indicate phenotypically affected individuals, horizontal line indicates marriage and

two horizontal lines indicate consanguineous marriage. Roman numbers indicate generation

while Arabic numerals indicate sample within a particular generation.



Figure 8: Pedigree of Family F with Dyslexia: Pedigree of family indicating autosomal

recessive mode of inheritance. Solid symbols represent affected subjects, while the open symbols

represent normal individuals. Roman numerals indicate generation number.



2.1.7 FAMILY G

This small family with three affected individuals was sampled from District Rawalpindi. They

were diagnosed with dyslexia by the speech therapist at National Institute of Rehabilitation

Medicine (NIRM), Islamabad. Parents were first degree cousins and show no sign of disease. All

affected children were not able to speak properly; joined Special Children School but unable to

read or write. They were able to do self care and were neither hyperactive nor aggressive.

Pedigree show autosomal recessive mode of inheritance. Figure 9 shows pedigree of the family

where square represents male and circle represents female, solid symbols indicate phenotypically




Figure 9: Pedigree of Family G with Dyslexia. Pedigree of family indicating autosomal

recessive mode of inheritance. Solid symbols represent affected subjects, while the open symbols

represent normal individuals. Roman numerals indicate generation number.



2.2 GENOMIC DNA EXTRACTION

DNA was extracted from whole blood using standard Phenol: Chloroform method (Sambrook et

al., 1989). Composition of solutions is given in Table 4. The protocol employs 0.75 ml of blood

in 1.5 ml micro centrifuge tube, 0.75 ml of Solution A was added, tube gently vortexed and kept

for 10 minutes at room temperature. Then centrifuged at 13000 rpm for 15 minutes and

supernatant was discarded. Pellet was re-suspended in 400 µl of Solution A and tube was again

centrifuged at 13000 rpm for 10 minutes. After discarding supernatant and re-suspension of

pellet in 500 µl of Solution B, 25 µl of 10% SDS and 8µl of proteinase K were added in the tube.

Tube was then left in heating block at 65°C for 3 hours. After incubation 0.5 ml of solution C+D

were added with gentle vortexing and tube was centrifuged at 13000 rpm for 15 minutes to get

rid of proteins. After centrifugation upper aqueous phase was separated carefully, 500 µl of

Solution D was added and after mixing, tube was again centrifuged at 13000 rpm for 15 minutes.

The upper aqueous phase was separated again, 55 µl of 3M Sodium Acetate Solution was added

and DNA precipitated by adding 500 µl of Isopropanol kept at -20°C. Precipitated DNA was

pelleted by centrifuging at 13000 rpm for 10 minutes. Supernatant was discarded and DNA

washed with 400 µl of 70% ethanol stored at -20°C. After centrifugation at 13000 rpm for 10

minutes supernatant was discarded and pellet was vacuum dried to remove residual ethanol.

DNA pellet was re-suspended in TE buffer or double distilled deionized water and stored at 4°C.

Genomic DNA was quantified using NanoDropTM 1000 Spectrophotometer at 260 nm

wavelength. Each DNA sample was diluted to 50 ng/μl final concentration for amplification of

genomic fragment using polymerase chain reaction (PCR). The quality of extracted DNA was

evaluated in 1 % agarose gel electrophoresis using ethidium bromide (0.5 μg/ml).



Table 4: Standard solutions used in DNA extraction

Solution Composition

Solution A 0.32 M Sucrose, 10 mM Tris-HCl, 5 mM MgCl2, 1 % v/v Triton X-100, pH 7.4-

7.6

Solution B 10 mM Tris-HCl, 400 mM NaCl, 2 mM EDTA, pH 7.4-7.6

Solution C Phenol equilibrated with Tris-HCl containing Hydroxyqinoline and

mercaptoethanol (pH 7.6-8.0).

Solution D Chloroform:Isoamyl alcohol (24:1)

2.3 KARYOTYPING

Karyotyping was performed to exclude the presence of chromosomal aberrations. For

karyotyping, samples were collected in lithium heparin vacutainers and shifted to laboratory

immediately. Tubes were allowed to stand for half an hour to allow gravity sedimentation of

blood cells and 0.8 ml of whitish portion was taken later on in 10 ml of RPMI 1640 medium. The

contents were mixed gently, 100 µl of PHA-P solution was added and incubated for 71.5 hours at

37°C. After incubation, 40 µl of pre-warmed (37°C) colcimed was added to the culture and

mixed gently. Mixture was incubated again for 30 minutes.

To harvest lymphocytes, blood culture was removed from incubation and mixed gently. Entire

content was shifted from culture flask to Falcon tube and centrifuged at 500-900 rpm for 10

minutes. Supernatant was removed and 1ml of hypotonic KCl solution was added to the pellet.

After resuspension of pellet, 9 ml of KCl solution was added. Solution was thoroughly mixed,

and incubated at 37°C for 20 minutes. Then few drops of fixative (chilled absolute methanol and

glacial acetic acid in 3:1 ratio) were added. Mixture was then centrifuged for 10 minutes at 500-

900 rpm. After centrifugation supernatant was discarded. For fixing, 10 ml of fixative was added

to the tube and mixed well.



Factory pre-cleaned, frosted slides were taken and few drops of the mixtures were dropped from

18 inches to ensure proper dispersal on slide. Slides were placed overnight at 65°C and stained

with Geimsa.

2.4 LINKAGE ANALYSIS

Linkage analysis can localize a disease causing gene to a region of a chromosome without

knowledge of its function. When the abnormal gene product responsible for a given genetic

disease is not known, one would like to know first the location of the responsible gene within the

genome. The strategy of locating the gene to a single chromosome and then to as specific a

region as possible within the chromosome is referred to as ‘linkage analysis’.

2.4.1 HAPLOTYPING USING 3FP SYSTEM

Amplification of microsatellite repeats was performed for genotyping. UCSC genome browser

(http://genome.ucsc.edu/) was used for localization of microsatellite marker loci and

identification of transcripts in the candidate region. Fluorescent labeled primers were used for

amplification of microsatellite markers by adding an 18-bp extension sequence to the 5' end of

each forward primer to allow amplification by third primer which was FAM labeled at 5' end for

allele detection in ABI 1310 XL genetic analyzer (Applied Biosystems). Table 7 shows the

sequences of the primers used. 1% Agarose gel was used to test the amplification of products

with 100bp ladder. Gel was visualized at, 30V Transilluminator (SynGene).

http://genome.ucsc.edu/\\\)



Table 5: Composition of Master mix used for PCR

Forward primer 2.4 pmol

Reverse primer 6 pmol

FAM labeled primer 10 pmol

dNTP 200 µl of each

Taq DNA polymerase 1.2U

Buffer 1X

Template DNA 50 ng

MgCl2 1.5 mM

Total Volume 12 µl

Table 6: Thermal cycle conditions used for PCR

Step Temperature °C Duration No. of Cycles

Denaturation 95 5 min 1

Denaturation

Touchdown Annealing

Extension

95 30 sec

30 45-60 30 sec

72 30 sec

Denaturation 95 30 sec

8 Annealing 50 30 sec

Extension 72 1 min

Final extension 72 5 min 1



Table 7: Primers’ sequences of microsatellite markers used for stuttering and

microcephaly

Locus Marker Forward primer Reverse primer

MCPH1 D8S1742 Tgaccggcagcaaaattgcccccaccaagacaca ctcaagggatatgaagggca

D8S277 tgaccggcagcaaaattgccaggtgagtttatcaattcctgag tgagaggtctgagtgacatccg

MCPH2 D19S416 tgaccggcagcaaaattgcctgtcccagagagacccta aagagagtgtgccatttgct

D19S425 tgaccggcagcaaaattgccacaggtgtgcataaaag gccatgtgactgtagcaga

D19S224 tgaccggcagcaaaattgaacaccattcctcatcttcc cccaggccctatctga

D19S897 Tgaccggcagcaaaattgaggatttccccaacagc tgcacattacagtgtgagacag

D19S420 Tgaccggcagcaaaattgctggggcaggagcact gcttaccaaacctaaaggatgtc

MCPH3 D9S258 tgaccggcagcaaaattggctagagatgcccttgagtg aggatttatagaaagtccaaaaccc

D9S1823 tgaccggcagcaaaattgactaccattgacattattatgtgc gttggattcatcttggattc

MCPH4 D15S222 Tgaccggcagcaaaattgcctcagcgtcctctcttg ctggtcactgtctgtcctgt

D15S962 Tgaccggcagcaaaattgaattctgctcattgggg ggatattttggaactgcact

MCPH5 D1S1660 tgaccggcagcaaaattgtgctatcctctcaccagtga gtctgaagttcatgggaacg

D1S1723 tgaccggcagcaaaattgaactgtgtccagcagcaact tatgtgcctgttgtgtgcat

MCPH6 D13S742 tgaccggcagcaaaattgtccagcctggtcaacacag tccagacttcccaattcagg

D13S283 tgaccggcagcaaaattgtctcatattcaatattcttactgca gccattccaagcgtgt

MCPH7 D1S2797 tgaccggcagcaaaattgatcacatcacacacaatgactgtgg tgtccattcaaaggattggtctc

D1S2733 tgaccggcagcaaaattgtgcggcgagacagacatc aggaccagcgtgtgcgt

Chr. X DXS6807 tgaccggcagcaaaattggagcaatgatctcatttgc aagtaaacatgtataggaaaaagct

DXS8051 tgaccggcagcaaaattgccagaaatgagcgattattg tttttgaactaagaacctggag

DXS987 tgaccggcagcaaaattggttgagataatgaggccagt ttaaaagcctggttcttctaa

DXS8027 tgaccggcagcaaaattggtgagacgctgtcttgg agctgctgtactaataacatagg

DXS8056 tgaccggcagcaaaattgcctgggaggtggaggt gggcataagtggcttcg

DXS6787 tgaccggcagcaaaattgcaacattttgccaaaattcc agatgacaggttgatgggtg



DXS1068 tgaccggcagcaaaattgcctctaaagcatagggtcca cccatctgagaacacgctg

(Continued….)

Locus Marker Forward primer Reverse primer

DXS1003 tgaccggcagcaaaattgttcacccatagaagccgt Ccattcctcactggcaa

DXS8032 tgaccggcagcaaaattgattttattttgctttgtatttggc Ctcctagaacagtacctgacacg

DXS1194 tgaccggcagcaaaattgacacaacttgaaactgctga Gtatgttgccacagaaacc

DXS7131 tgaccggcagcaaaattgggaatagtaagctctggggc Gtcccctctaaatgatgcaa

DXS1225 tgaccggcagcaaaattgattggcaacacaaaggg Atcctggatggaaggact

DXS1209 tgaccggcagcaaaattgtctatcactatatatatgctatccc Atggagaacagattattggt

DXS8077 tgaccggcagcaaaattgacatttttatgacattaaacacaca Caaaattttccagtgaagtcat

DXS8063 tgaccggcagcaaaattgaaaatcggtgattaggaaaataca Cctccagcagccaaag

DXS1106 tgaccggcagcaaaattgtatgagaactccctaaacaaa Tgatgcaccaaatacca

DXS1001 tgaccggcagcaaaattgtacaagtaaccctcgtgaca Gttatggaatcaatccaagtg

DXS8038 tgaccggcagcaaaattggtggactgtctccgtaacc Ccaagatgtgagcatttttc

DXS1062 tgaccggcagcaaaattggagatgtgtgaccttgagcact Gttgcctgttaagcactttgaatc

DXS8013 tgaccggcagcaaaattgccaacccaactgtctatcaa Gtttggttttccattcctga

DXS984 tgaccggcagcaaaattgtttctgtctgccaagtgttt Tactgngccctactccattc

DXS8073 tgaccggcagcaaaattggaaaatgtctggtgtgctac Atatctcagggctagagtcc

DXS1073 tgaccggcagcaaaattgggctgactccagaggc Ccgagttattacaaagaagca

DXS1062 tgaccggcagcaaaattggagatgtgtgaccttgagcact Gttgcctgttaagcactttgaatc

DXS1192 tgaccggcagcaaaattggttgccaactgctggaacg Tgtggtgcagggaagcc

DXS8013 tgaccggcagcaaaattgccaacccaactgtctatcaa Gtttggttttccattcctga

DXS8106 tgaccggcagcaaaattgcttgcacttgctgtgg Agctgtagagttgaggaatg

DXS8028 tgaccggcagcaaaattgtgatgacactcggactgc Gaaataataatacttgccttgcct

DXS998 tgaccggcagcaaaattgcagcaatttttcaaaggc Agatcattcatataacctcaaaaga

DXS1193 tgaccggcagcaaaattgaattctgactctggggc Ttattttaaggtgagtatggtgtgt

DXS8061 tgaccggcagcaaaattggcttgaagtgtccatgaggtatc Agaagctgatgtgctccctg



2.4.2 PREPARATION OF SAMPLES FOR ABI 3130 XL GENETIC ANALYZER

For size separation of fragments at ABI 3130 XL genetic analyzer, 0.5 -1 µl of fluorescently

labeled PCR product was mixed with 0.5 µl of size standard LIZ-600 (Applied Biosystems) and

10 µl of Hi-Di Formamide in 96 well loading plates. Mixture was denatured and analyzed using

Peak Scanner software v.1.0 (Applied Biosystems).

2.4.3 LOD SCORE CALCULATION

Genetic linkage is statistically measured by logarithm of odds (LOD) score and is derived from

the log 10 ratio between the likelihood that two loci are linked rather than unlinked. For a

Mendelian character, linkage is said to be accepted or significant when LOD score greater than 3

indicating 1000 times greater odds that the loci are linked, and rejected when LOD score less

than -2 indicating 1:100 against linkage. LOD score values between -2 and 3 are said to be

inconclusive (Latherop and Lalouel, 1984). Linkage analysis can be executed as a two-point or

multipoint analysis. In practice, this ratio is calculated for several values of recombination

fraction (q). The frequency of one recombination event in 100 meioses equals a map distance of

one centi Morgan [1 cM 0.01q (Ott, 1991)]. One cM correlates to approximately 1 Mb in

physical distance, but it varies between males and females and depends on chromosomal

location. The estimate for linkage is the sum of LOD scores at given recombination fraction in

single family. The LOD score calculation is dependent on both the penetrance of the disease

phenotype and mode of inheritance.

Two point linkage analyses were carried out using Program LIPED Version for IBM PC/XT

(Ott, 1991). Multipoint linkage analysis was performed using easy LINKAGE (Hoffmann and

Lindner, 2005). MLINK program of FASTLINK computer package was used to calculate two

point LOD score at different values of Ө (Probability of recombination) assuming an autosomal

recessive mode of inheritance for families with autosomal recessive inheritance. Equal male to

female recombination rate, full penetrance and a disease allele frequency of 0.001 was selected.



Equal allele frequencies of the genotyped markers were used in the calculations. Marker order

and their maps distance were based upon Marshfeild genetic map

[http://www.marshfeild.org/genetics/, (Broman et al., 1998)].

2.4.4 HAPLOTYPE ANALYSIS

Closely adjacent alleles can be co-inherited as haplotype, which can be used for evaluating

association between the ancestral mutation and the haplotype upon which it arose. Subsequently,

the haplotype consists of several markers; haplotype analysis can increase power in statistical

calculation (Bostein and Risch, 2003).

2.5 MUTATION ANALYSIS

After establishment of linkage with particular loci, families were subjected to direct sequencing

of candidate genes to identify the pathogenic mutations. Web based software Primer3

(http://frodo.wi.mit.edu/) was used to design oligonucleotide sequencing primers. Primers were

designed to amplify coding exons and exon-intron boundaries. Same primers were used for both

PCR amplification and sequencing. Tables 8-11 show the sequencing primers used for mutation

analysis.



Table 8: Sequencing primers for ASPM

Exon Forward primer Reverse primer Product size

1 Ccaagagccacccacagtta actcccacgacctctacagc 579

2 Tcccaaagactcctctgcaa aattaagcagatagggtaggagaaa 471

3a Cgtacagagagtggcaagca ggaaatgcagaagagcagaaa 460

3b aattctagttcattattagctccatga caagcttgtgaaaacttggcta 425

3c Ctctggtacaggtggccttc cccaactgttcttcaact 625

3d Gctctgagggagaaaaatgg tcctaaattttctgcagttcagg 419

3e cagcaaaagcaaagaaaaatca gcttcagttgctcggaaaag 386

4 Ttcttccaggctgtta agtgcgtggagtacag 358

5 catttaggctaatgaacagggaat cccaaaatgctttcagctct 434

6 caccacacatacacacaagaagg gagctaacaggttgcgatga 633

7 Tgtcattacgtgcaacacca gctgccaaaaatcccacata 526

8 Gggtggaggaagggagagta tcctgagctttgtctttttgc 508

9 Ggactcaccagacaggcatt tcccatagagatattgggagga 475

10 Cattgatgtaccacttccctga aagttggaaatatgtatgaagtttgc 502

11 Cgctattttccaaagcaacc tacttgccgactatggagca 479

12 Tcacagttactggggcaaaa gattccggcaataagtcgtc 404

13 Tcatttgagggaaagtttgct gtttgcctttggggaaaaa 557

14 Gcaggtattccaccaaggtc tgtgccatgctctcacataa 599

15 Atccaaaagccttgcacaaa cgcaaactggttcagtggta 473

16 Acctccccaacccaaaatac gaccttggtggaatacctgct 461

17 Agccttctgctgaacaccat cgacatgcctggaattatca 535

18a Gcttgaaagcaccgaaatct ttggatggatttctgaattgg 631

18b Aaaatcgaactctgtcttgtctca tgcaaagagcttttagagaatgg 392



18c Gcagctgctcttaaatgcaaa gctgcagccattcaattaca 500

18d Ttcttcctctgattgacctgtg gatgcaagccaggaaaatg 456

(Continued…)

Exon Forward primer Reverse primer Product size

18e Gcagcttgatgttcccttct accttgtccgaaagcagatg 478

18f Ttttgaatcagaagagcagctt gatggtacagggcgtacaaga 439

18g Cacgctgcattttaccttga caaaggcaacataaatgtgcta 580

18h gcagttttcttgagagagaggaa gaagacatattcaacacatgcaca 538

18i Taagggttgcagaggaatgc gcaaagatactgggcaatgaa 581

18j Gcccactgaagcttttggta ccaagcaaatagagctgcaa 633

18k Gcctctaaaagcagcctgaa gacaatggcattctgctgtg 667

18l Tgatagcagctcttttctgctg cagggccaaagttgattatga 488

18m Tggaagataaatggtcacctca tggtcacaagaaaactggaaa 468

19 gaaaatatcaacaaaaccaacca caccactgttctcagaagactca 486

20 ttgactgaaatagatgtgtgtgaaa cttctttcgtgtgcgtgtgt 451

21 Tgacagtcagtgctcttgtcac acccttggcttacaccttca 583

22 ggtgaaaggctaaatgttgtacg tgctttctacactctgagttatgagtt 488

23 Tgagttattctaccggctaatgc aatgcctctgtggaaagctg 453

24 Actctgggccatgttctcac tggtcgataaatgctgtcca 573

25 Tttcatcctaagactcttgcaca cctttctgccattcttgagg 435

26 Gcaaaaagcaggtttgaaca aaagtcctttgcacttgctg 447

27 Accaaacattccattcttattca gcgacagagcaagagagacc 451

28 tgataaaaatgaagaatgtaatgaaca tgaagttctcccacctctttg 400



Table 9: Sequencing primers for SOX3

Forward Primer Reverse Primer

Sox3_1 Agggctccccgaactttt gcttgtgtgggtgtccctac

Sox3_2 gagtcccagggccttttc gcggtcggtacttgtagtcc

Sox3_3 gaacgccttcatggtatggt catgtcgtagcggtgcat

Sox3_4 gcgcctggacacgtacac ggtggcaggtacatgctgat

Sox3_5 tgcagtacagcccaatgatg cccgacagctacagcaaaac

Sox3_6 ctgacccacatctgagcac aaccacgaggaaaacagacg

Sox3_7 cactcctcctcctgagttcc gcttgaaaaccctgaaacaaa

Sox3_8 tttctgccgtgatctgtttg tcaccagtagttaaaaggaaacca

Table 10: Sequencing primers for ARX3 poly A repeats

Exon Frorward Primer Reverse Primer

ARX_ex2_polyA cctccttgggtgacagctc Gctcccctaagagcagcag

Table 11: Sequencing primers for GPRASP2

Exon Forward Primer Reverse Primer

GPRASP2_ex5_1 cagctgtcccacctagcatt ctcttccccagccttctttt

GPRASP2_ex5_2 tgtggttgaggtttagactacgg tctgcctgtgacactgcttc

GPRASP2_ex5_3 agtaggtggcgctcgttcta gtctgatgtttagccctgtgc

GPRASP2_ex5_4 gagtctgggttctggtcagc tcctcaaacctgggttcttg

GPRASP2_ex5_5 taagcagtcctgggttttgc agtgacctcgtcccaggttt

GPRASP2_ex5_6 gagatgaggcctgctttgac Aaggatcccgaattttgtcc

GPRASP2_ex5_7 cgggaaattcgagagcatc Aaggagagaaacccggacat



GPRASP2_ex5_8 gtgaggaaacccttgcacat Ccacctcaggatcattttgg

GPRASP2_ex5_9 gtcttgagccgcttatttctg Gaagggtcacttatgccaattt

GPRASP2_ex5_10 caaactcttgttttgagctgga Tcagggcccacaataatctc

2.5.1 DNA SEQUENCING

Sequencing of the entire candidate regions was performed using POP-7 polymer and an array

length of 36cm in an ABI 3130XL genetic analyzer (Applied Biosystems). Protocol followed for

performing sequencing is as following:

2.5.1.1 PCR Amplification of the region

Polymerase chain reaction (PCR) was performed using a standard protocol in order to amplify

genomic fragments for sequencing. Primers used for sequencing are summarized in Table 8.

Primers were designed in a way that the product size does not exceed 500 bp. Composition of

master mix and thermal cycling conditions used are summarized in Table 12 and 13 respectively.

Table 12: Composition of Master mix used for PCR

Primers 10-20 pmol of each

dNTPs 200 µl of each

Taq DNA polymerase 1U

PCR Buffer 1X

Template DNA 50 ng

MgCl2 1.5 mM

Total Volume 25 µl

Table 13: Thermal cycling conditions of sequence amplification

Step Temperature °C Duration No of Cycles





Touch Down Annealing

Extension

52-66 30 sec 40

72 30 sec

Final extension 72 7 min 1

For highly GC rich regions denaturation was performed at 98ºC and hot start Taq Polymerase

used with Betain and DMSO (Qiagen).

2.5.1.2 Preparation of PCR products for sequencing

PCR products were checked on 1% agarose gel electrophoresis. PCR product was treated with

Exonuclease I and Shrimp alkaline Phosphate in a volume of 5 µl. Volume of PCR product

depends on the intensity of bands visualized on agarose gel. Samples were then incubated

initially at 37°C for 15 minutes and then shifted to 80°C for 20 minutes.

Table 14: Composition of Exo-SAP treatment

PCR product 0.5 – 1 µl

Exo I 0.25 µl

SAP 0.25 µl

Double Distilled Deionised water 5.58 µl

2.5.1.3 Sequencing PCR reaction

BigDye terminator V.1.1 Cycle Sequencing Kit (Applied Biosystems) was used for sequencing

PCR reaction. Sequencing PCR was performed as follows:

2.5.1.4 Sequencing PCR Master Mix

After treatment with Exo-Sap (Table 15) to the amplified product, BigDye amplification was

performed (Table 16).

Table 15: Master mix for sequencing PCR

Exo-Sap treated template 5 µl

Primer (10 pmol) 0.25 µl



Deionized distilled water 2.25 µl

5X sequencing Buffer 1.5 µl

BigDye reaction mix 1.0 µl

Total volume 10 µl

Table 16: Thermal cycling conditions used for sequencing

Step Temperature °C Duration No of cycles



25 Annealing 50-60 10 sec

Extension 60 4 min

2.5.1.5 Purification of sequencing PCR products

To precipitate the purified DNA, 96 well plate containing samples was spin down for 20 sec at

3000 rpm. Lid was removed carefully and 1µl of 3M Sodium Acetate, 1µl of 125 mM EDTA

and 25 µl of 96% ethanol were added in each sample. After leaving at room temperature for 15

minutes, plate was centrifuged at 4000 rpm for 30 minutes. All the supernatant was discarded

and 60 µl of 70% ethanol was added in each sample and again centrifuged at 4000 rpm for 10

minutes. After discarding supernatant, plates were placed upside down on blotting paper and

centrifuged to get rid of excess ethanol at 170 rpm for 1 minute. Pellet was dried at 65°C in oven

for 15 minutes. 10 µl of Formamide was added in each well followed by brief spin to collect the

entire sample at the bottom of tube and analyzed in ABI 3130 XL genetic analyzer.

2.5.1.6 Sequencing data analysis

Sequences were analyzed initially by Sequencing Analysis 5.2 (Applied Biosystems). Analyzed

sequences were viewed by using ChromasPro v.1.43 software by aligning them with control

sequences obtained from www.ncbi.nlm.nih.gov. The obtained sequences were analyzed in silico

for mutations.

2.5.1.7 Restriction analysis

http://www.ncbi.nlm.nih.gov/



Restriction analysis was performed using appropriate restriction enzymes selected by using

online web based software NEB cutter V2.0 (http://tools.neb.com/NEBcutter2/index.php). Each

restriction digestion reaction was carried out using appropriate buffer according to

manufacturer’s instructions. Restriction fragments were analyzed by horizontal gel

electrophoresis using 2-3% agarose gel.

2.6 GENOME WIDE SCREENING (SNP6)

Genome wide scan was performed by homozygosity/autozygousity mapping using single

nucleotide polymorphism or SNPs (Lander and Kruglyak, 1995). Homozygosity mapping is

employed in rare recessive diseases as a useful tool due to the fact that recessive disease alleles

appear homozygous in families due to intact genetic segments inherited as a result of

consanguinity. SNPs genotyping was carried out for affected individuals by using the GeneChip

Human Mapping 6.0 array (Affymatrix) with NSPI enzyme according to manufacturer’s protocol

(www.affymatrix.com). Following enzyme digestion with NSPI, genomic DNA (250 ng) was

ligated to adaptors that recognized the cohesive four base pair overhangs. Fragments of different

sizes/length obtained by restriction enzyme digestion were substrates of adapter ligation.

Adapter-ligated DNA fragments ranging in size from 200-1100 bp were amplified by adapter

sequences and recognized by generic primer. Amplification of DNA was followed by

fragmentation, labeling and hybridization to GeneChip Human Mapping 6.0 array (Affymatrix),

scanned by using scanner and analyzed on computer. Array image data was acquired and

analyzed with Affymetrix GeneChip Operating Software (GCOS) 1.4. Median physical distance

measured between the SNPs was 2.5 kb and average distance was 5.8 kb. Average

heterozygosity of SNPs was 0.30. the plateform consists of 906,600 SNPs including Tag SNPs,

SNPs from X and Y Chromososmes, Mitochondrial SNPs, and SNPs in recombination hot spots.

Platform also contains 946,000 copy number probes. AutoSNPa (Carr et al., 2006) software was

used for the homozygosity mapping and sorting of genomic regions with cutoff value 30-90 on

the basis of homozygous region obtained with more homozygosity more cutoff value. SNP allele

calling was done with Affymetrix GeneChip Genotyping Analysis Software (GTYPE) 4.1.

Chromosome analysis suit was used to visualize the results. To get inference related to Copy

http://tools.neb.com/NEBcutter2/index.php



Number first signal intensities were calibrated and genotype calls were computed into birdseed

files, these signals intensities were converted to copy number calls. Genotyping Console

Software from affymetrix was used to analyze LOH and Copy Number variations. Further

analysis of selected regions was carried out by genotyping all family members using

microsatellite markers and PCR amplification.

2.7 TAQMAN COPY NUMBER ASSAY

To perform copy number assay by TAQMAN, DNA was quantified and each sample was diluted

to final concentration of 5 ng/µl with nuclease free water. Along with samples non template

control was also used to show the background fluorescence and for the detection of

contamination. Four replicates of each sample including non template control were used.

Taqman Copy number assay reaction mix used for real time PCR is summarized in Table 17.

The probes used for analysis are:

Hs03084882_cn

Hs03084432_cn

Table 17: Taqman Copy number assay reaction mix for real time PCR

2X taqman Genotyping Master Mix 10.0 µl

Taqman Copy Number assay , 20X working stock 1.0 µl

Taqman Copy Number Reference Assay 20 X 1.0 µl

Nuclease free water 4.0 µl

Total Volume 16.0 µl

Taqman Copy Number assay and the Taqman Copy Number reference assays were completely

thawed and gently vortexed to mix them. Tubes were briefly spun to bring contents to the bottom

of tube. Taqman genotype master mix was swirled to mix thoroughly. Required volumes of

reaction components were combined in microcentrifuge tubes. Tubes were inverted and flicked

to mix the contents thoroughly, then centrifuged briefly.



In each well of the reaction plate, 16 µl of reaction mix was added and 4 µl of genomic DNA

was added per well to make total sample volume to 20 µl. Reaction mix and DNA were mixed

by pippeting up and down several times. Plate was sealed and briefly centrifuged to bring all the

components at the bottom of the wells. Wells were inspected to ensure the uniform reaction

volume.

Settings used to carry out real time PCR are summarized in Table 18, while Table 19 and Table

20 summarise settings for Taqman Copy number assay and Taqman Copy number Reference

assay respectively.

Table 18: Settings for Real Time PCR used in Taqman assay

System 7300/7500/7500 Fast System (SDS Software v1.X)-Absolute

quantitation plate document) Version 1.3.1

Run Standard mode

Reaction Plate 96 well

Ramp speed/model Standard

Table 19: Settings for Taqman Copy Number assay

Detector name FAM

Target name N/A

Reporter FAM

Quencher none

Table 20: Settings for Taqman Copy Number Reference Assay

Detector name VIC



Target name N/A

Reporter VIC

quencher TAMRA

Plate was loaded on Real Time PCR machine and reaction carried out using following

parameters (Table 21):

Table 21: Parameters for Real Time PCR

Stage Temperature °C Time

Hold 95 10 min

1 Cycle 95 15 sec

40 Cycles 60 60 sec

2.7.1 ANALYSIS OF RESULTS

In the Real Time PCR software, results were analyzed with manual Ct threshold-0.2, autobase

line –on. Copy number analysis was performed using Copy Caller Software (Applied

Biosystems). The system compares the test sample with reference and calculates the possible

copies of the segment. Graphical Interface represents the possible copies of the segment in form

of bars

Chapter 3 RESULTS AND DISCUSSION


3 RESULTS AND DISCUSSION

For the families diagnosed with a mild mental retardation and microcephaly, in which all

affected individuals were able to do self care but had learning deficiency of speech and other

cognitive behaviors, possible linkage to known MCPH loci was performed using highly

polymorphic microsatellite markers (Table 7). As mutations in ASPM gene are reported to be the

most frequent cause of microcephaly in Pakistan (Gul et al., 2006); therefore, these families were

tested for homozygosity in all affected individuals with microsatellite repeat markers flanking

ASPM. Markers include D1S2757, D1S2816, D1S1660, D1S2622, D1S373, D1S1723 and

D1S2655. Out of 20 families with MCPH, six families were linked to ASPM. This observation is

a deviation from what is expected from families affected with microcephaly in Pakistani

population, where 60 to 70 % of the families are usually reported, reason for this deviation could

be small family size and in sufficient number of samples collected from each family for analysis.

Results observed in these families are reported in publication (Hussain et al., 2013). In case of

Family D linkage to ASPM locus was not carried out because of a single sample (sample V:1).

This phenotypically unaffected individual (mother of affected persons in left loop (Figure 6)

appeared to be homozygous at ASPM locus excluding the locus as candidate in this family.

Remaining families were genotyped with markers from all seven MCPH loci and none of them

show linkage to any of those. Bi-directional sequencing was performed using fluorescent dye

chain termination technique on an ABI prism 3130 XL sequencer. Sequences were analyzed by

using chromasPro software version (ChromasPro 1.34) and were compared to reference

sequences (http://www.ncbi.nlm.nih.gov/ and http://genome.ucsc.edu/).

3.1 FAMILY A

Pedigree of the family suggested autosomal recessive mode of inheritance so homozygosity

mapping using STR markers was used to find linkage region. As initiation clinical investigation

indicated microcephaly so the family was tested with markers selected for reported MCPH loci

(Table 7). This large Family with seven affected individuals showed linkage to ASPM gene at

MCPH 5 locus with LOD score of 3. All 28 exons of the gene including exon intron boundaries

were sequenced bi-directionally (Sequences of the primers given in Table 8). Analysis of

sequences (Figure 10) revealed a novel mutation in ASPM gene at position c.6131C>T in exon



18, which cause change in protein sequence p.Q2051X resulting in truncated protein with 2051

amino acids. Variation was confirmed in all affected individuals by using FatI restriction

enzyme. This mutation is a novel mutation and results in an early stop codon resulting in non

functional ASPM protein and ultimately resulting in abnormal neurogenic mitosis. The protein

change p.Gln2051* is located in IQ motif of ASPM protein, this motif serves as binding site for

different EF-hand proteins including the essential and regulatory myosin light chains, calmodulin

and CaM like proteins (www.ebi.ac.uk/interpro). Truncation at this site makes ASPM protein

incabable of interacting with cytoskeleton proteins and proper cleavage plane for cell division is

not ensured resulting in asymmetrical cell division.

Figure 10: Representative DNA sequence chromatogram from exon 18 of ASPM gene in

homozygous affected individual from Family A. Highlighted nucleotide shows site of nonsense

mutation c.6131C>T.

3.2 FAMILY B

Family B is small with only two affected individuals having normal parents so the autosomal

recessive mode of inheritance was deduced. This small family with just two affected individuals

showed linkage to ASPM gene in MCPH5 region. Therefore, all 28 exons of the gene and intron-

exon exon boundaries were sequenced (Table 8). On analysis of sequences, a nucleotide variant

c.9557C>G was found in exon 23 (Figure 11). This variation causes a nonsense mutation

p.S3186X resulting in a truncated protein with 3186 amino acids. Mutation was found to be

homozygous in both affected individuals. This mutation is recurrent mutation in Southern Punjab

and has already been reported (Bond et al., 2002; Muhammed et al., 2009). This mutation also

http://www.ebi.ac.uk/interpro



results in truncated ASPM protein by an early stop codon in IQ motif of protein. As discussed in

case of family A, truncation at this motif results in inability of ASPM to interact with

cytoskeleton proteins and make spindle fibers during neurogenesis resulting in asymmetrical cell

division. So far this mutation is reported from five different families from various regions of

Pakistan.


homozygous affected individual from Family B. Highlighted nucleotide shows site of nonsense

mutation c.9557C>G

3.3 FAMILY C

Family C has six affected individuals in two loops but samples from only one loop were

available. As both parents of the family were dead so homozygosity mapping with the STS

markers was skipped and affected individuals were directly sequenced. Two other families with

just one affected individuals were also sequenced directly for ASPM, resulting in total six

affected individuals from three different families. In exon 17 of gene ASPM at locus MCPH5,

c.3978G>A was found (Figure 12). This variation results in nonsense mutation p.T1326X

causing protein truncation just after 1326 amino acids. This truncated mutation is also found in

IQ motif of the ASPM protein and also results in asymmetrical cell division at the time of

neurogenesis. These families were sampled from Southern Punjab but this recurrent mutation has

already been reported (Muhammed et al., 2009; Gul et al., 2006; Gul et al., 2007; Bond et al.,

2002; Kouser et al., 2010). So far thirty two different families are reported from Pakistan

carrying this mutation and all these families were sampled from same geographical region and



the same mutation is also reported in two Indian families which suggests a founder mutation with

a common ancestral origin in Pakistan. Interestingly another mutation c.3979C>T is also been

reported (Hussain et al., 2013) indicative of a mutational hotspot in exon 17.


homozygous affected individual from Family C. Highlighted nucleotide shows site of nonsense

mutation c.3978G>A

3.4 FAMILY D

This family was sampled from South Punjab and has three loops. As all individuals show

microcephaly so linkage analysis was performed using markers for all seven MCPH loci (Table

7). The family appeared to be linked with ASPM gene at chromosome 1 MCPH5 locus, but

mother in left loop (Sample V:1) who was phenotyppicaly unaffected found genetically

homozygous at this locus, therefore family was considered to be excluding this loci. As deviation

of only one individual could not be significant therefore, in order to avoid any chance of error,

ASPM gene was sequenced in selected individuals but no mutation was found.

To have a broader picture, only selected samples from family were subjected to genome wide

scan by Affymetrix SNP6. Selected samples included V:1 as she is the phenotypically unaffected

female who has homozygosisty at ASPM locus, her affected son VII:1 was also selected.

Another loop comprising unaffected father VI:7 and his unaffected wife VI:6 and their twi

affected children VII:9, VII:8 and unaffected children VII:10, VII:7. Genome wide search was

carried out by homozygosity mapping also known as autozygosity mapping (Lander and Bostein,

1987). Homozygosity mapping takes advantage of families that are genetically homozygous for



recessive disease alleles by virtue of consanguinity. Genome wide search was carried out using

single nucleotide polymorphisms (SNPs) which provide to date the most powerful tool for

association and linkage studies. The SNP array 6.0 is the most powerful solution with 1.8 million

genetic markers (906,600 SNPs and 946,000 CNVs). The array contains a total of 946,000 non

polymorphic copy number probes. These probes, 744,000 originally selected for their spacing

and 202,000 selected based on known copy number changes reported in the Toronto Database of

Genomic Variants (DGV), enable to detect denovo copy number changes and perform

association studies by genotyping both SNP and known copy number polymorphism (CNP) loci

(McCrroll et al., 2008). The median inter-marker distance over all, combining 108 million SNPs

and copy number markers CNVs is less than 700 bases.

Results were analyzed by using Genotyping Console software (Applied Biosystems) and then

viewed by Chromosome Analysis Suit (Applied Biosystems). As pedigree of family indicates

autosomal recessive mode of inheritance, therefore family was analyzed to find a homozygous

region but not a single candidate region was found by homozygosity mapping. SNP6 analysis

revealed presence of homozygosity around ASPM gene in affected individuals including VII:1,

VII:9 and VII:8, in case of Sample V:1, phenotypically un affected female with affected son,

had a small homozygous region around ASPM and this confirmed the results of microsatellite

marker. By evaluating deletion and insertion using CNV calls of SNP6.o array A deletion of

44,589 bp was found at chromosome 1 between 194,096,943-194,141,531, 1,178,350 bp

downstream to ASPM gene in a gene desert segregating with the disease in family. LOD score of

5.5 was calculated for this deletion. Figure 13 represents the Homozygosity and deletion present

in this family.



Figure 13: Graphical representation of the MCPH5 locus.q31.3 at chromosome 1. Purple

horizontal bars indicate homozygous regions; green bars indicate deletion in heterozygous

condition while yellow bars indicate deletion in homozygous form. Roman Integers represents

the generation and Arabic numerals represent the sample number within a particular generation.

This high LOD score of 5.5 makes this deletion a powerful candidate as cause of disease.

Therefore, to cross check the deletion and presence of deletion in other family members Taqman

Copy Number Assay was performed. In order to perform Taqman assay nine samples wer

selected from the family representeing all three loops. Samples included affected VII:1 and his

un affected mother V:1 from first loop, an affected girl VIII:1 was slected from second loop, and

to represent loop three normal parents VI:6, VI:7, two affected siblings VII:8, VII:9, and two

unaffected siblings VII:7, VII:10 were sleceted. Copy number variations are important

polymorphisms that can influence the expression of genes within and close to the rearranged

region. This allows transcription levels to be higher or lower than those that can be achieved by

control of transcription of a single copy. Recently, CNVs have been associated with genetic

diseases such as cancer, immune disease and neurological disorders. Taqman copy number

assays are designed to detect and measure copy number variation in the human genome using

real time PCR and un- quenching of fluorescent probes for the target sequence (Mayo et al.,



2010). Two probes Hs03084882_cn and Hs03084432_cn, present within the deleted region but

near the borders were selected. Real time PCR was used to analyze the Copy number. Results

were analyzed and viewed on software Copy Caller V.1.0 (Applied Biosystems). All affected

individuals ( VII:1, VII:9, VII:8 and VIII:1) show zero copy number around these probes,

confirming the deletion of the segment from the samples while parents (V:1, VI:6, VI:7) and

normal sibling (VII:10) showed copy number one while normal sibling (VI:7) show copy

number two (Figure 14). All these observation completely endorsed SNP6 results completely.

Figure 14: Analysis of copy numbers by Taqman probe assay Hs03084432. Sample 1-3 show

affected individuals which carry deletion in homozygous form, sample 4-6, 8 show carriers of

deletion in heterozygous form, sample 7 contains both copies of probe means no deletion.



Figure 15: Analysis of two Taqman probes Hs03084432 in blue and Hs03084882 in cyan

color. Samples 1, 2, 3, and 11 are affected individuals and show zero copy number of probes.

Samples 4, 5, 6 and 10 show 1 copy number, while all the other samples from control population

show copy number more than 1.

To analyze frequency of deletion in general population, this deletion was screened using

Chromosome analysis suit for SNP6 data of almost 50 samples from Pakistani and Danish

population as well. None of the samples indicated presence of the deletion. Taqman Copy

Number assay was also performed for some of the random unaffected non microcephallic

individuals from Southern Punjab to exclude the polymorphism. These samples included Ctr:1,

Ctr:2, Ctr:3, Ctr:4, Ctr:5, Ctr:6, Ctr:7, and Ctr:8. To check samples from family in same

experimental conditions all available affected samples ( VII:1, VI:2, VI:3, VII:9 and VII:8) as

well as all available unaffected samples ( VI:6, VI:7, V:1, VII:10, VII:7, VI:6) were analysed.

The results confirm presence of deletion only in the family and no other sample was found from



control population to have this deletion mutation (Figure 15). After confirmation of deletion as a

candidate cause of disease, break points of the deletion were mapped. As SNP 6 analysis exploits

SNPs as well as Copy number polymorphisms. So one end of the deletion was reported between

two Copy number probes CN_461130 and CN_461131 at point 194, 096,943 and the other end

was reported between two SNPs SNP-A-2036204 and SNP-A-8374585 at position 194,141,531.

Figure 16 depicts the position of deletion on chromosome 1. Forward primers for mapping the

deletion was designed on one side between CN-461130 and CN-461131 while on other side

reverse primers were designed between SNP-A-2036204 and SNP-A-8374585. Different sets of

primers were used to check amplification of the region (Figure 16). Amplification was expected

in samples with deletion as without deletion product is too long to be amplified even with long

PCR.



Figure 16: A) Position of deletion on chromosome1. B) position of deletion with respect to

ASPM. C) SNPs and CNVs indicating the borders of the deletion. D) CNVs at the left

border of the deletion. E) SNPs at the right border of the deletion. F) primers’ position

designed for breakpoint mapping.



Genome wide scan (GWS) routinely implicates variations within gene desert and other types of

non-coding DNA in the etiology of disease (Liu et al., 2011). While the presence of non-

annotated transcripts or non-coding RNAs may explain some of the non-coding disease

associations. These observations also have been interpreted as evidence that many of the

associated non coding regions harbor variants that alter the activity of long-range cis regulatory

elements controlling gene expression. Enhancers are such type of long-range elements,

functioning over up to mega base long genomic distances to regulate the temporal and tissue

specific expression patterns of their target genes (Nobrega et al., 2003). The deleted region was

searched in UCSC genome browser to look for the presence of conserved regions and to find any

regulatory region (Figure 17). Two candidate regions were found as possible regulatory regions.

Figure 17: Window of UCSC genome browser indicating two candidate regulatory regions

present in the deleted fragment.



Gene regulation involves a complex interplay between the proximal promoter and distal genomic

elements (such as enhancers) which work in concert to drive precise spatio-temporal gene

expression. The experimental localization and characterization of gene regulatory elements is a

very complex and resource-intensive process. Such cis-acting regulatory elements can be located

upstream or downstream or within introns of the transcription unit (Howard and davison, 2004).

Locating the components of the developmental regulatory code in the human genome is a central

pre-occupation of genomics, and the first barrier to identifying human-specific regulatory

changes relevant to human evolution. Cis-acting regulatory DNA elements, such as promoters,

enhancers and insulators play an essential role in establishing precise

temporal and tissue-specific

gene expression patterns. They are frequently conserved among species and may be located as

far as 1.5 Mb in either direction. Several studies have identified such elements as essential

regulators of developmental gene expression, that have the potential to switch genes off and on

in particular types of cells/tissues during certain developmental time points. Given the

importance of gene regulation in development, it is expected that a large number of

developmental defects are caused by mutations affecting such regulatory elements (Dathe et al.,

2009).

Zinc finger protein CCCTC-binding factors (CTCF) play a critical role in transcription regulation

in vertebrates. CTCF is identified to be the vertebrate insulator protein (Bell et al., 1999) and so

far it remains as the only major protein implicated in establishment of insulators in vertebrates

including those involved in regulation of gene imprinting and mono-allelic gene expression

(Felsenfeld et al., 2004). There has been a great interest in identifying where potential insulators

are located in the eukaryotic genome, because knowledge of these elements can help understand

how cis-regulatory elements coordinate expression of the target genes. Kim et al. (2007) have

located the sites of CTCF binding in the human genome using chromatin immune-precipitation

followed by detection with genome-tiling microarrays. The region between ASPM and the

suspected regulatory region was scanned for the insulator elements and no CTCF or insulator

element was found in this region.



I assume that as the mutations of the gene ASPM in homozygous form, in most cases frame shift

or nonsense mutation resulting in null alleles (no functional protein product) lead to

microcephaly. If the enhancer element is embedded in the deleted region 1.2 Mb downstream for

ASPM then no transcription of the ASPM takes place without the enhancer elements. So if

deletion is present in heterozygous form means one copy of the enhancer element is present, it is

sufficient to promote the transcription of ASPM to get normal phenotype. In case both copies of

enhancer are deleted then the result is a complete lack of transcriptional activity of ASPM or just

a minor activity. Therefore, the hypothesis in this case is looping back structure for the enhancer

element 1.2 Mb downstream to ASPM, and without this loping back there would be no

transcription (Figure 18). The enhancer element present in this deleted region is a cis-acting

element and c.FOS and Hey1 are possible elements as they are found both in ASPM promoter

and deleted region.

Figure 18: Loop back hypothesis for enhancer element and binding to ASPM promoter. Cis

acting enhancer element present in the deleted region containing cFOS and Hey1, also present in

ASPM promoter region loops back and bind with ASPM promoter to start transcription.



3.5 FAMILY E

This family affected with stuttering was sampled from Bahawalnagar, Southern Punjab. Pedigree

analysis show 8 affected male individuals. Three affected siblings have three affected maternal

uncles indicating a well defined X-linked recessive mode of inheritance. Therefore, X

chromosome was scanned to find the causative sequence variant in the family. There are two

genes reported to be associated with X-linked stuttering SOX3 and ARX.

SOX3 belongs to a gene family related to SRY, the testis determining gene. Bylund et al. (2003)

found that SOX1, SOX2 and SOX3 were co-expressed in self-renewing progenitor cells and

acted to inhibit neuronal differentiation. On the basis of sequence homology, SOX3 is closely

related to SOX1 and SOX2, and the products of all 3 genes belong to the SOXB1 subfamily and

are expressed throughout the developing central nervous system (Collingnon et al., 1996).

Sequence variations in SOX3 results in stuttering associated with hypopituitarism (Solomon et

al., 2004). Three exons and exon-intron boundaries of SOX-3 as a candidate gene were

sequenced (Table 9), but no sequence variant was found to be a cause of stuttering in this family.

Other candidate gene ARX (aristaless-related homeobox gene) was found to be associated with

Partington disease (Frints et al., 2002). Expansion in Alanine repeats due to the duplication of 24

bp results in mild to severe mental retardation (Partington et al., 2004). So primers were

designed to sequence poly adenine repeats (Table 10), no duplication was found in the family.

As both candidate genes present on X-chromosome show no sequence variant segregating with

disease in the family; therefore, third candidate gene GPRASP was selected from gene network

and found closely related to function with already reported genes causing stuttering in Pakistani

population (GNPTAB,) on chromosome 12 and (GNPTG, NAGPA) on chromosome 16 (Kang et

al., 2010). Gene regulatory network is a collection of DNA segments in the cell which interact

with each other and with other substances in the cell, thereby governing the rates at which genes

are transcribed into mRNA. GNPTAB, GNPTG and NAGPA are reported to encode enzymes

that generate the mannose-6-phosphate signal, which directs a diverse group of hydrolases to the

lysosome. Deficits in this system are associated with the mucolipidoses, rare lysosomal storage

disorders that are most commonly associated with bone, connective tissue and neurological

symptoms. Using KEGG (http://www.kegg.jp/ ), an online available tool to study gene networks,



GPRASP2 located on X-Chromosome was found to be present on regulatory network of

GNPTAB (Figure 19).

Figure 19: Gene network for lysosomal protein, red circle is candidate gene on X-

Chromosome GPRASP2 found related to already reported gene GNPTAB involved in stuttering.

Nodes in the network denote genes.

Sequencing of exons and exon-intron boundaries of GPRASP2 generated no sequence variant

responsible for the disease. Therefore, after exclusion of three candidate genes, equally spaced

markers were also designed to map whole X-chromosome especially dense around candidate

genes to find if any of the regulatory regions involved. Chromosome mapping is the assignment

of genes to specific locations on a chromosome, using STS markers linkage maps are constructed

which does not show the physical distances between genes but rather their relative positions, as

determined how often two genes loci are inherited together. Table 7 summarizes STS markers

chosen for mapping X-Chromosome. Haplotypes were constructed and analyzed to find any

candidate loci. Figure 20 depicts position of markers and genes on Chromosome X.



Figure 20: Position of candidate genes and markers on X-chromosome.



Figure 21: Pedigree of Family E segregating X-Linked recessive form of familial stuttering.

Microsatellite markers on chromosome X used for mapping and linkage analysis are indicated to

left. The disease associated haplotype is shown beneath each symbol.



Haplotype is a combination of alleles at different loci on the chromosome that are transmitted

together. A haplotype may be one locus, several loci or an entire chromosome depending on the

number of recombination events that have occurred. Haplotype is often referred to an individual

collection of short tandem repeats (STR) allele mutations within a genetic segment. To perform

haplotyping for the family understudy selected samples including un affected grandparents (V:4,

V:3), un affected parents (VI:1, VI:2) affected maternal uncle (VI:3) and affected brothers

(VII:1, VII:2 and VII:3) were selected. A set of 20 microsatellite markers for X-chromosme

(Table 7) were used. After haplotyping no candidate region was found to be involved in

stuttering and segregating with disease in this family (Figure 21). As male are hemizygous for X-

chromosome, no significant achievement was made using this methodology, a large haplotype

block was observed. Therefore, to do fine mapping and also to find indels in X-chromosome

SNP6 analysis was performed for the whole family. SNPs were chosen as marker of choice due

to their abundance in the genome, their bi-allelic nature, and because they are stably inherited

from generation to generation (Brookes, 1999). Affymetrix SNP6 array was performed and

results were analyzed using Chromosome Analysis Suit software. Homozygosity mapping

revealed absence of any candidate region on the chromosome therefore the results were analyzed

to see any deletion or insertion in chromosome X. Neither any deletion nor insertion segregating

with the disease in the family was found indicating absence of any susceptibility locus on

Chromosome X (Figure 22).



Figure 22: Graphical representation of results of Affymetrix SNP6 analyzed by

Chromosome analysis suit indicating homozygous regions and indels on X-chromosome. Results

indicate absence of any candidate region or indel on the chromosome segregating with disease.

A trait which appears only in male could be X-linked, refers to traits carried on X-chromosome,

or the trait could be sex-limited. Sex limited trait or sex influenced trait refers to special cases in

which sex hormones or other physiological differences between male and female alter the

expressivity and penetrance of a gene. The incidence of stuttering has always been reported to be

higher in males than in females. Many reasons are under consideration for this unequal sex ratio;

however, environmental factors are considered most important (Kidd et al., 1978). Since no

candidate region or gene was found on X-chromosome; therefore, considering stuttering as sex

limited trait in this family, SNP6 data was analyzed for other chromosomes. A sole homozygous

region of 1,041,131 bp was found on chromosome 18 at position, 2,865,432 to 3,906,562

between SNP_A-8393251 and SNP_A-8503775 by autozygosity mapping (Figure 23).



Figure 23: Graphical representation of results of Affymetrix SNP6 analyzed by

Chromosome analysis suit indicating homozygous regions on chromosome 18. Results indicate

homozygous region of 1,041,131 bp at position 18p11.3.

This homologous region residing on locus 18p11.32 – 18p11.31 overlaps with familial persistent

stuttering STUT 1 locus 18p11.3 – 18p11.2 and also with Dyslexia DYX-6 locus 18p11.2.

Linkage studies have implicated the 18p11.2 region in susceptibility to bipolar disorders and

schizophrenia with a parent-of-origin effect (Corradi et al., 2005).

UCSC genome browser (Figure 24) indicated the presence of seven candidate genes in the

homozygous region of 1,041,131 bp (Table 22). EMILIN2 encodes for an elastic fiber interacting

protein that confers elasticity to the extracellular matrix. Gene product is deposited extracellular

as a fine network; it is broadly expressed in connective tissues, has cell adhesion promoting

functions and particularly abundant in blood vessels, skin, heart, lung, kidney, and cornea

suggesting its fundamental role in process of elastogenesis in association with other extracellular

matrix constituents (Bressan et al., 1983; Colombatti et al., 1988).



LIPN2 belongs to a family of nuclear proteins and there is no systemic characterization of this

gene. Three closely related members of the Lipin family; Lipin-1, Lipin-2, and Lipin-3 have

been identified in both mouse and human. Lipin-1 (LIPIN1) was originally characterized as a

candidate gene for mouse lipodystrophy and played an important role in lipid metabolism

(Peterfy et al., 2001).

MYOM1 is a structural constituent of the cytoskeleton thought to integrate the thin and thick

filaments while conferring elasticity to the M-band of the sarcomere in striated muscle (Trinick,

1991). It is member of immunoglobin super family, and binds extracellular matrix proteins

(Diamond et al., 1991), also plays an important role in the assembly and stabilization of

myofibrils (Speel et al., 1998).

MRCL2 and MRCL3 are myosin regulatory subunits which share nearly 100% identity at the

protein level and greater than 94% identity at the nucleotide level. Di-phosphorylation of the

myosin regulatory light chain subunit is thought to play a role in regulation of filament assembly

and reorganization of muscle cells (Iwasaki et al., 2001).

TGIF is a DNA binding homeo-domain protein that belongs to the three amino acid loop

extension homeobox family (Wotton et al., 1999). It is a transcription repressor with multiple

actions, including a role in retinoid-responsive transcription (Bertolino et al., 1995).

DLGAP1 is a member of the PSD95 domain containing family of molecules that are collectively

known as ‘Chapsyns’ for their function as a channel associated proteins. Chapsyns are generally

known to have one to three conserved domains: a binding domain found in the amino or carboxyl

regions, a sulfhydryl group, and a guanylate kinase domain in the carboxyl region (Kim et al.,

1997).

All these genes show diverse functions and on the basis of function none of them could be

chosen as candidate gene, therefore, sequencing of all the genes was tried and no mutation was

detected in coding regions of these genes. These genes are either involve in muscular movement,

extracellular and intracellular cytoskeleton components and ion channels involved in cell

signaling. All these genes could have possible impact on the phenotype as this complex

phenotype involves both muscular movements and neural coordination.



Figure 24: Window of UCSC genome browser indicating candidate region revealed by

autozygosity mapping in Family E. Figure indicated presence of seven genes in the region.

Table 22: List of genes present at 18p11.32-p11.31

Gene Location Function Reference

EMILN2 2,837,028-2,904,090 Elastin Microfibril Interfacer 2;

highly expressed in fetal heart and

adult lung

Doliana et al., 2001

LPIN2 2,906,992-3,001,945 Mutations result in lipodystrophy:loss

of body fat, fatty liver. Similar to

KIAA0249

Reue et al., 2000

MYOM1 3,056,805-3,210,106 Myomesin 1; interconnects the major

structure of sarcomeres

Vinkemeier et al.,

1993

MRCL 3,237,528-3,246,234 Myosin regulatory light chain,

involved with actin cytoskeleton

Sitek et al., 2005

MYL12B 3,252,611-3,268,282 Myosin Light Chain; regulate activity

of non muscle Myosin

Iwasaki et al., 2001

TGIF1 3,402,072-3,448,406 Homodomain protein that act as

transcriptional repressors and co

repressors in retinoid and

transforming growth factor

Shen and Walsh,

2005

DLGAP1 3,488,837-3,835,296 Ion cluster protein associated with

NMDA receptors and concentrated in

synaptic junctions

Kim et al., 1997



3.6 FAMILY F and G

Developmental dyslexia is a distinct learning disability with unexpected difficulty in learning to

read despite adequate intelligence, education, environment and normal senses. The impairment in

dyslexia appears to be in phonological processing, which interferes with the function of the

linguistic system at the higher level, such as semantics (Shaywitz, 1998). Dyslexia is a multi

factorial, or complex phenotype, in addition to which dyslexia displays a wide spectrum of

phenotypes, which could also reflect incomplete penetrance, and/or the effects of environmental

factors.

Out of 14 families which were sampled at the start, only two families gave some interpretable

results. The rest of families were not linked to any of the known loci, neither gave any region of

homozygosity upon SNP analysis, the reason for this could be misdiagnosis, small sample size,

in complete peneterance or phenocopies. the present families are among few small families in

which dyslexia is inherited as autosomal recessive trait. The dyslexia was mild and two males

and one female were affected in each family. A single affected female excludes the possibility of

X-linked inheritance. As inheritance of dyslexia is complex and also the effects of sex

differences in penetrance, heterogeneity, absence of a definitive diagnostic test and age

compensation all complicate an exact mode of inheritance. Therefore, it was planned to go for

genome wide scan directly but cytogenetic analysis was performed to exclude any possibility of

gross deletions or insertion, chromosomal translocations and other chromosomal aberrations.

Cytogenetic analysis refers to analysis of metaphase chromosomes which are Giemsa stained.

Karyotyping is performed to examine chromosomes in an individual as it allows to count the

number of chromosomes and to look for structural changes in chromosome. The karyogram of

Family F (Figure 25) and Family G (Figure 26) showed no chromosomal aberration.



Figure 25: Karyogram of affected individual from the family F indicating normal karyotype.

Figure 26: Karyogram of affected individual from the family G indicating normal karyotype.



In case of family G, genome wide scan using Affymetrix SNP6 revealed no insertion or deletion

segregating with disease. The homozygosity mapping revealed three candidate homozygous

regions (Table 23) for dyslexia. On chromosome 1, between SNP_A-8700768 and SNP_A-

8351538 at position 83,661,163 to 105,378,977 a homozygous region of 21,961,815 bp contains

more than 1000 genes and coding sequences. The second homozygous region of 1,038,076 bp

was found between SNP_A-8462392 and SNP_A-8606876 at position 121,709,335 to

122,747,410 at chromosome 2. This region comprises five genes and 10 coding sequences. The

third homozygous region present on chromosome 4 spans 804,033 bp at position 98,712,229 to

99,516,261 between SNP_A-8304054 and SNP_A-8583337. This region comprises two coding

sequences. Genome wide homozygosity mapping did not identified any region with highly

significant statistical support for harboring dyslexia or autism susceptibility loci.

Table 23: Candidate Homozygous regions found in Family G after SNP6 analysis

Locus Position Size

1p21.1-p31.1 83,661,163 – 105,378,977 21,961,815 bp

2q14.2-q14.3 121,709.335 – 122,747,410 1,038,076 bp

4q22.3-q23 98,712,229 – 99,516,261 804,033 bp

Affymetrix SNP6 assay for the family F neither indicated a deletion nor an insertion segregating

with the disease. Homozygosity mapping of the family show a homozygous region of 1,144,107

bp found at chromosome 2 between SNP_A-8596121 and SNP_A-1862419 at position

79,428,624 to 80,542,730 (Fig 27). The region has two genes; CTNNA2 and LRRTM1 (Table

24).



Figure 27: Graphical representation of results of Affymetrix SNP6 analysed by Chromosome

analysis suit indicating homozygous regions on chromosome 2 in Family F. Results indicate

homozygous region of 1,144,107 bp at position 2q14.

Table 24: List of candidate genes present in 2p12 homozygous region in Family F

Gene Location Function Reference

CTNNA2 79,593,634-80,729,416 Catenin, Alpha-2; Cadherin-

Associated protein Mutations

cause abnormally motile

dendritic spine heads in

mouse

Claverie et al., 1993

LRRTM1 80,382,514-80,384,998 Leucine-rich repeat

transmembrane protein 1:

show parent of origin

association with human

handedness and

schizophrenia. An important

candidate for

neurodevelopment disorders

and human cognitive and

behavioral evolution.

Lauren et al., 2003



The loci linked to dyslexia was found corresponding DYX3 the previously defined region (Table

25) of 5,493,396 bp region on short arm of Chromosome 2. This locus was first reported by

Fagerheim et al. (1999) for autosomal dominant dyslexia in Norwegian family. They reported

the candidate gene to be present between marker D2S2352 and D2S1337 at chromosomal

position 53,729,382 to 59,222,777. Petryshen et al. (2002) provided further evidence for the

DYX3 dyslexia locus. They reported this candidate region of 3,428,093 bp between marker

D2S2352 and D2S378 at position 53,729,382 to 57,157,474. No candidate gene was found in

both reports. Kaminen et al. (2003) performed a genome wide scan of 38 patients from Finland

and found a region of 200,327bp at 2p11 corresponding to this locus at position 75,095,638 to

75,295,964. They reported maximum LOD score at marker D2S286. They excluded TACR1 as a

candidate in the region. Peyrard-Janvid et al. (2004) mapped the locus to 11,955,428 bp region at

2p12-2p11.2 between markers D2S2116 and D2S2181 at position 76,502,585 to 88,458,012.

This region included CTNNA2 among the candidate genes.

Table 25: Positions of candidate regions reported on short arm of chromosome 2 for

dyslexia

Reference Location STS markers with

maximum LOD

score

Position Size

Fagerheim et al., 1999 2p16.1-p16-2 D2S2352-D2S1337 53,729,382-59,222,777 5,493,396 bp

Petryshen et al., 2002 2p16.1-p16-2 D2S2352 - D2S378 53,729,382-57,157,474 3,428,093 bp

Kaminen et al., 2003 2p13.1 D2S286 75,095,638-75,295,964 200,327 bp

Peyrard-Janvid et al., 2004 2p12-2p11.2 D2S2116-D2S2181 76,502,585-88,458,012 11,955,428 bp

Anthoni et al., 2007 2p12 D2S286 75,715,742-75,794,122 78,381 bp

Sample 7 of family F was indicated unaffected in the pedigree and apparently unaffected but the

SNP6 array indicated homozygous region. As dyslexia is a complex disorder in which

environment plays an important role in addition to unavailability of a proper diagnostic test, sex

differences in penetrance and also age compensation. Anthoni et al. (2007), reported MRPL19

and C2ORF3 genes as possible candidates present in the region and found maximum LOD score

between SNP rs1859708 and rs3755477. They sequenced MRPL19, C2ORF3, CTNNA2 and



LRRTM1 genes but found no mutation responsible for disease in all of these genes. The LOD

score was maximum for MRPL19 and C2ORF3. The candidate region found in family F is

3,247,898 bp from the linkage peak reported by Anthoni et al. (2007). It is suggested that this

difference may be caused by dissimilar sample sets, diagnostic criteria, or results may in fact

reflect the presence of one and the same locus. Alternatively, it is possible that there are indeed

two different but closely located genes for dyslexia.

The present data extends our knowledge and understanding of the genetic spectrum of Learning

disabilities. There are many disorders associated with congenital defects to learn cognitive

behaviors and it is necessary to setup a correct diagnosis to avoid unnecessary and ineffective

treatment options. All analyzed families were consanguineous and were of Pakistani origin.

Presence of novel and recurrent mutations as well as identification of enhancer element for

ASPM will help to design improved strategies of genetic counseling for Pakistani families with

MCPH keeping in view the strong tradition of cousin marriages in this population. The results

found for stuttering and dyslexia families suggest that the close proximity of several linkage

signals to regions previously identified in other learning disorders raises the possibility that many

learning disability phenotypes may share at least some susceptibility loci in common, while there

may be other genes that are unique to each disorder. It is challenging to identify the genetic

variations present in the candidate regions narrowed down by homozygosity mapping, but the

identification and characterization of genes implicated in susceptibility to the specific learning

disability could have a profound impact on our understanding of the primary etiology of the

disorder. A better understanding of specific risk factors may improve our ability to design proper

strategies to cope with the impacts of disorder. New sequencing techniques along with functional

and bioinformatic analyses can facilitate identification of specific sequence variants causing the

disability. Ultimately, genetic counseling, carrier screening and prenatal diagnosis can be

provided in order to control the severe learning disabilities.

Chapter 4 REFERENCES


4. REFERENCES

Adel KA, Ronald AB 2005, Functional Neuroanatomy: text and atlas, 2nd Edition Mc Graw

Hill, New York

Ahmed S, Saleem M, Modell B, Petrou M. Screening extended families for genetic hemoglobin

disorders in Pakistan. N Engl J Med 2002; 347: 1162-8

Alwan A, Modell B. Community control of genetic and congenital disorders. Alexandria:

Eastern Mediterranean Regional Office, World Health Organization, 1997; (EMRO

Technical Publication 24)

Ambrose N, Cox NJ, Yairi E. The genetic basis of persistent and recovered stuttering. J Speech

Lang Hear Res 1997; 40: 567-580

Ambrose N, Yairi E, Cox NJ. Genetic aspects of early childhood stuttering. J Speech Hear Res

1993; 36: 701-706

Anthoni H, Zucchelli M, Matsson H, Muller-Myhsok B, Fransson I, Schumacher J, Massinen S,

Onkamo P, Warnke A, Griesemann H, Hoffmann P, Nopola-Hemmi J, Lyytinen H,

Schulte-Korne G, Kere J, Nothen MM, Peyrard-Janvid Myriam. A locus on 2p12

containing the co-regulated MRPL19 and C2ORF3 genes is associated to dyslexia. Hum

Mol Genet 2007; 16(6): 667-677

Artigas-Pallares J. Dyslexia: a disease, a disorder or something else?. Rev Neurol 2009; 27(48

supplemetary): S1097-103

Baig SM, Din MA, Hassan H, Azhar A, Baig JM, Aslam M, Anjum I, Farooq M, Hussain MS,

Rasool M, Nawaz S, Qureshi JA, Zaman T. Prevention of beta-thalassemia in a large

Pakistani family through cascade testing. Community Genet 2008;11(1):68-70

Baraiser M 1990. Microcephaly: The Genetics of Neurological Disorders. Volume. 18, 2nd

edition. Oxford Medical Publications, Oxford, pp 26-33

Bell AC, West AG, Felsenfeld G. The protein CTCF is required for the enhancer blocking

activity of vertebrate insulators. Cell 1999; 98: 387-398.



Bennett RL, Stelnhaus KA, Uhrich SB, O’Sullivan CK, Resta RG, Lochner-Doyle D, Markel

DS, Vincent V, Hamanishi J. Recommendations for standardized human pedigree

nomenclature. Am J Hum Genet 1995; 56: 745-52

Bertolino E, Reimund B, Wildt-Perinic D, Clerc RG. A novel homeobox protein which

recognizes a TGT core and functionally interferes with a retinoid-responsive motif. J Biol

Chem 1995; 270: 31178-88

Bishop DVM. Genetic and environmental risk for specific language impairment in children.

Philos Trans R Soc Lond B Biol Sci 2001; 356: 369-380

Bittles A. Consanguinity and relevance to clinical genetics. Clin Genet 2001; 60: 89-98

Bloodstein O, Ratner NB 2008. A handbook on stuttering. 6th ed. Clifton Park, New

York

Bond J, Roberts E, Mochida GH, Hampshire DJ, Scott S, Askham JM, Springell K, Mahadevan

M, Crow YJ, Markham AF, Walsh CA, Woods CG. ASPM is a major determinant of

cerebral cortex size. Nat Genet 2002; 32: 316-320

Bond J, Scott S, Hampshire DJ, Springell K, Corry P, Abramowicz MJ, Mochida GH,

Hennekam RC, Maher ER, Fryns JP, Alswaid A, Jafri H, Rashid Y, Mubaidin A, Walsh

CA, Roberts E, Woods CG. Protein-truncating mutations in ASPM cause variable

reduction in brain size. Am J Hum Genet. 2003 Nov;73(5):1170-7

Bond J, Roberts E, Springell K, Lizarraga SB, Scott S, Higgins J. A centrosomal mechanism

involving CDK5RAP2 and CENPJ controls brain size. Nat Genet 2005; 37(4): 724-7

Bork P, Hofmann K, Bucher P, Neuwald AF, Altschul SF. Koonin EV. A super family of

conserved domains in DNA damage responsive cell cycle checkpoints proteins.

Faseb J 1997; 11(1): 68-76

Bostein D, Rich N. Discovering genotype underlying human phenotypes: past successes for

Mendelian disease, future approaches for complex disease. Nat Genet 2003; 33: Suppl,

228-37.

Brookes AJ. The essence of SNPs. Gene 1999; 234: 177-186.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL. Comprehensive human genetic

maps, individuals and sex specific variation in recombination. Am J Hum Genet 1998;

63: 861-9.



Bressan GM, Castellani I, Colombatti A, Volpin D. Isolation and characterization of an

115,000-dalton matrix associated glycoprotein from chick aorta. J Biol Chem 1983;

258:13262-7

Bylund M, Anderson E, Novitch BG, Muhr J. Vertebrate neurogenesis is counteracted by Sox1-

3 activity. Nature Neursci 2003; 6: 1162-1168.

Carr DE, Murphy JF, Eubanks MD (2006). Heredity 96: 29–38

Campaner S, Kaldis P, Izraeli S, Kirsch IR. SIL phosphorylation in a Pin 1 binding domain

affects the duration of the spindle checkpoints. Mol Cell Biol 2005; 25(15): 6660-6672

Claverie JM, Hardelin JP, Legouis R, Levilliers J, Bougueleret L, Mattei MG, Petit C.

Characterization and chromosomal assignment of a human cDNA encoding a protein

related to the murine 102-kDa cadherin-associated protein (alpha catenin). Genomics

1993; 15: 13-20

Collington J, Sockanathan S, Hacker A, Cohen-Tannoudji M, Norris D, Rastan S, Stevanovic

M, Goodfellow PN, Lovell-badge R. A comparison of the properties of Sox-3 with SRY

and 2 related genes: Sox1 and Sox2. Development 1996; 122: 509-520

Colombatti A, Bonaldo P, Volpin D, Bressan GM. The elastin associated glycoprotein gp115.

Synthesis and secretion by chick cells in culture. J Biol Chem 1988; 263(33):17534-40

Consang.net. Background summary (updated 24 May 2005).

www.consang.net/summary.html (accessed 22 Aug 2006)

Conture EG, Kelly EM, Young stutterer’s nonspeech behaviors during stuttering. J Speech Hear

Res 1991; 34: 1041-1056

Corradi JP, Ravyn V, Robbins AK, Hagan KW, Peters MF, Bostwick R, Buono RJ, Berrettini

WH, Furlong ST. Alternative transcripts and evidence of imprinting of GNAL on

18p11.2. Mol Psychiatry 2005; 10: 1017-1025

Cox J, Jackson AP, Bond J, Woods CG. What primary microcephaly can tell us about brain

growth. Trends Mol Med 2006; 12(8):358-366



Dathe K, Kjaer KW, Brehm A, Meinecke P, Nürnberg P, Neto JC, Brunoni D, Tommerup N,

Ott CE, Klopocki E, Seemann P, Mundlos S. Duplications involving a conserved

regulatory element downstream of BMP2 are associated with brachydactyly type A2. Am

J Hum Genet. 2009 Apr;84(4):483-92

Diamond MS, Staunton DE, Marlin SD, Springer TA. Binding of the integrin Mac-1

(CD11b/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and its

regulation by glycosylation. Cell 1991; 65: 961-71

Doliana R, Bot S, Mungiguerra G, Canton A, Cilli SP, Colombatti A. Isolation and

characterization of EMILIN-2, a new component of EMILINs family and a member of

the EMI domain containing superfamily. J Biol. Chem 2001; 276: 12003-12011

Donna Van Wynsberghe, Charles R. Noback, Robert C 1995. Human Anatomy and Physiology,

3rd ed. McGraw-Hill New York. pp 384-425

Do Carmo AM, Tavares A, Glover DM. Polo kinase and Asp are needed to promote the mitotic

organizing activity of centrosomes. Nat Cell Biol 2001; 3:421-424

De Kovel CGF, Hol FA, HEister JGAM, Willemen JJHT, Sandkuijl LA, Franke B, Padberg

GW. Genomewide scan identifies susceptibility locus for dyslexia on Xq27 in an

extended Dutch family. J Med Genet 2004; 41:652-657

Desir J, Cassart M, David P, Van Bogaert P, Abramowicz M. Primary microcephaly with

ASPM mutation shows simplified cortical gyration with antero-posterior gradientpre- and

post-natally. Am J Med Genet A 2008; 146A:1439-1443.

Eckert MA, Leonard CM, Richards TL, Aylward EH, Thomson J, Berninger VW. Anatomical

correlates of dyslexia: frontal and cerebellar findings. Brain 2003; 126(2): 482-494

Elaine N. Merieb, Katja Hoehn, 2007 , Human Anatomy & Physiology. Pearson Benjamen

Cumming, San Francisco, CA 94111., pp434-456

Evans PD, Anderson JR, Vallender EJ, Gilbert SL, Malcom CM, Dorus S, Lahn BT: Adaptive

evolution of ASPM, a major determinant of cerebral cortical size in humans. Hum Mol

Genet 2004, 13(5):489-494



Fagerheim T, Raeymaekers P, Tonnessen FE, Pedersen M, Tranebjaerg L, Lubs HA. A new

gene (DYX3) for dyslexia is located on chromosome 2. Med Genet 1999; 36: 664-669

Felsenfeld G, Burgess-Beusse B, Farrell C, Gaszner M, Ghirlando R, Huang S, Jin C, Litt M,

Magdinier F, Mutskov V et al: Chromatin boundaries and chromatin domains. Cold

Spring Harb Symp Quant Biol 2004, 69:245-250

Felsenfeld S, Plomin R. Epidemiological and offspring analyses of developmental speech

disorders using data from the Colorado Adoption Project. J Speech Lang Hear Res. 1997;

40:778–791

Finlay BL, Darlington RB. Linked regularities in the development and evolution of mammalian

brains. Science 1995; 268: 1578-1584

Fish JL, Kososdo Y, Enard W, Paabo S, Huttner WB. ASPM specifically maintains symmetric

proliferative divisions of neuroepithelial cells. Proc Natl Acad Sci USA 2006; 5

:103(27):10438-10443

Fisher SE. A quantitative-trait locus on chromosome 6p influences different aspects of

developmental dyslexia. Am J Hum Genet 1999;64:146-156

Fisher SE, DeFries JC. Developmental dyslexia: genetic dissection of a complex cognitive trait.

Nat Rev Neurosci 2002; 3:767-780

Fisher SE, Francks C, Marlow AJ, MacPhie IL, Newbury DF, Cardon LR, Ishikawa-Brush Y,

Richardson AJ, Talcott JB, Gayan J, Olson RK, Pennington BF, Smith SD, DeFries JC,

Stein JF, Monaco AP. Independent genome-wide scans identify a chromosome 18

quantitative-trait locus influencing dyslexia. Nat Genet 2002; 30:86-91

Francks C, MacPhaie IL, Monaco AP. The genetic basis of dyslexia. Lancet Neurol 2002;

1:483-490

Francks C, Paracchini S, Smith SD, Richardson AJ, Scerri TS, Cardon LR, Marlow AJ,

MacPhie IL, Walter J, Pennington BF, Fisher SE, Olson RK, DeFries JC, Stein JF,

Monaco AP. A 77-kilobase region of chromosome 6p22.2 is associated with dyslexia in

families from the United Kingdom and from the United States. Am J Hum Genet 2004;

75:1046-1058

Frints SGM, Borghgraef M, Froyen G, Marynen P, Fryns JP. Clinical study and haplotype

analysis in two brothers with partington syndrome. Am J Med Genet 2002; 112: 361-368



Galaburda AM, LoTurco J, Ramus F, Fitch RH, Rosen GD. From genes to behaviour

in developmental dyslexdia.Nat Neurosci 2006;9:1213-1217

Gayan J. Quantitative trait locus for specific language and reading defects on chromosome 6p.

Am J Hum Genet 1999; 64: 157-164

Gerard JT, Nicholas PA 1987. Principles of Anatomy and Physiology. 5th edition Harper and

Row Publishers. Washington pp 306-312

Ging-Yuek RH, Bonnie JK, Tracey LP, Shao L, Field LL. A Dyslexia susceptibility locus

(DYX7) linked to dopamine D4 receptor (DRD4) region on chromosome 11p15.5. Am J

Med Genet 2004; 125B:12-119

Graser S, Stierhof YD, Nigg EA. Cep68 and Ccp 215 (Cdk5rap2) are required for centrosome

cohesion. J Cell Sci 2007; 120:4321-31

Guernsey DL, Jiang H, Hussin J, Arnold M, Bouyakdan K, Perry S, Babineau-Sturk T, Beis J,

Dumas N, Evans SC, Ferguson M, Matsuoka M. Mutations in centrosomal proteins

CEP152 in primary microcephaly families linked to MCPH4. Am J Hum Genet 2010;

87:40-51

Gul A, Hassan MJ, Hussain S, Raza SI, Chishti MS, Ahmad W. A novel deletion mutation in

CENPJ gene in a Pakistani family with autosomal recessive primary microcephaly. J

Hum Genet. 2006a;51:760–4

Gul A, Tariq M, Khan MN, Hassan MJ, Ali G, Ahmad W. Novel protein-truncating mutations

in the ASPM gene in families with autosomal recessive primary microcephaly. J

Neurogenet. 2007;21:153–63

Hajeck M, Huonker R, Boehle C, Volz HP, Nowak H, Sauer H: Abnormalities of auditory

evoked magnetic feilds and structural changes in the left hemisphere of male

schizophrenics- a magnetoencephalographic-magnetic resonance imaging study. Bio

Pshych 1997; 42: 609-616

Hamel BCJ, Smits APT. Otten BJ, Van den Helm B, Ropers HH, Mariman ECM. Familial X-

linked mental retardation and isolated growth hormone deficiency: clinical and molecular

findings. Am J Med Genet 1996; 64:35-41



Hasiung GYR, Kaplan BJ, Petryshen TL, Lu S, Field LL. A dyslexia susceptibility locus7

(DYX7) linked to dopamine receptor D4 (DRD4) region on chromosome 11p15.5. Am J

Med Genet B Neuropsychiatr Genet. 2004; 15;125(1):112-9

Hoffmann K, Lindner TH. easyLINKAGE-Plus--automated linkage analyses using large-scale

SNP data. Bioinformatics. 2005 ;21(17):3565-7

Howard ML, Davison EH. Cis regulatory control circuits in development. Dev Biol 2004;

271:109-118

Hung LY, Chen HL, Chang CW, Li BR, Tang TK. Identification of a novel microtubule-

destabalizing motif in CPAP that binds to tubulin heterodimers and inhibits microtubule

assembly. Mol Biol Cell 2004; 15(6): 2697-2706

Hussain MS, Bakhtiar SM, Farooq M, Anjum I, Janzen E, Toliat MR, Eiberg H, Kjaer KW,

Tommerup N, Noegel AA, Nurnberg P, Baig SM, Hansen L. Genetic heterogeneighty in

Pakistanimicrocephaly families.Clin Genet. 2013;83:446-451

Iafrat AJ, Feuk L, Rivera MN, Listewink ML, Donahoe PK, Qi Y, Schere SW, Lee C. Detection

of large scale variation in the human genome. Nat Genet 2004; 36: 949-51

Iwasaki T, Murata-Hori M, Ishitobi S, Hosoya H. Diphosphorylated MRLC is required for

organization of stress fibres in interphase cells and the contractile ring in dividing cells.

Cell Struct Func 2001; 26: 677-683

Jackson AP, Eastwood H, Bell SM, Adu J, Toomes C, Carr IM, Roberts E, Hapshire DJ, Crow

YJ, Mighell AJ, Karbani G, Jafri H, Rashid Y, Mueller RF, Markham AF, Woods CG.

Identification of microcephalin, a protein implicated in determining the size of the human

brain. Am J Hum Genet 2002; 71: 136-142

Jamieson CR, Govaerts C, Abramowics MJ. Primary Autosomal recessive Microcephaly:

homozygosity mapping of MCPH4 to chromosome 15. Am J Hum Genet 1999; 65(5):

1465-9

Kaindl AM, Passemard S, Kumar P, Kraemer N, Issa L, Zwirner A, Gerard B, Verloes A, Mani

S, Gressens P. Many roads lead to primary Autosomal recessive Microcephaly. Prog

Neurobiol 2010; 90(3):363-383



Kang C, Riazuddin S, Mundorff J, Krasnewich D, Friedman P, Mullikin JC, Drayna D.

Mutations in the lysosomal enzyme-targeting pathway and persistent stuttering. N Engl J

Med 2010; 362:677-685

Kaminen N, Hannula-Jouppi K, Kestila M, Lahermo P, Muller K, Kaaranen M, Myllyuoma B,

Voutilainen A, Lyytinen H, Nopola-Hemmi J, Kere J. A genome scane for developmental

dyslexia confirms linkage to chromosome 2p11 and suggests a new locus on 7q32. J Med

Genet 2003; 40: 340-345

Karkera JD, IzraeliS, Roessler E. Dutra A, Kirsch I, Muenke M. The genomic structure,

chromosomal localization, and analysis of SIL as a candidate gene for

holoprosencephaly. Cytogenet Genome Res 2002; 97(1-2): 62-7

Keith LM, Arthur FD. 1999. Clinically oriented Anatomy. 4th edition. Lippincott Wlliams and

Wilkins. NewYork pp887-889

Kenneth SS. Anatomy and Physiology. 2004. 3rd edition. Mc Graw Hill. New York pp530-535

Kidd KK, Kidd JR, Records MA, The possible causes of the sex ratio in stuttering and its

implication. J of Flen Disorders 1978; 3(1): 13-23

Kim E, Naisbitt S, Hsueh YP, rao A, Rothschild A, Craig AM, Sheng M. GKAP, a novel

synaptic protein that interacts with the guanylate kinase like domain of the PSD-

95/SAP90 family of channel clustering molecules. J Cell Biol 1997; 136: 669-678 Kim

TH, Abdullaev ZK, Smith AD, Ching KA, Loukinov DI, Greem RD, Zhang MQ,

Lobanenkov VV, Ren B. Analysis of the verteberate insulator protein CTCF binding sites

in the human genome. Cell 2007;128(6): 1231-1245

Kouprina N, Pavlicek A, Collins NK, Nakano M, Noskov VN, Ohzeki JI, Mochida GH,

Risinger JI, Goldsmith P, Gunsior M, Solomon G, Gersch W, Kin JH, Barrett JC, Walsh

CA, Jurka J, Masumoto H, Larionov V. The microcephaly ASPM gene is expressed in

proliferating tissues and encodes for a mitotic spindle protein. Hum Molec Genet 2005;

14: 2155-2165

Kousar, R., Nawaz, H., Khurshid, M., Ali, G., Khan, S.U., Mir, H., Ayub, M., Wali, A., Ali, N.,

Jelani, M., et al. (2010). Mutation analysis of the ASPM gene in 18 Pakistani families

with autosomal recessive primary microcephaly. J. Child Neurol. 25, 715–720



Kumar A, girimaji SC, Duvvari MR, Blanton SH. Mutations in STIL, encoding a pericentriolar

and centrosomal protein, cause primary Microcephaly. Am J Hum Genet 2009; 84(2):

286-290

Lander ES, Botstein D. Homozygosity mapping: a way to map human recessive traits with the

DNA of inbred children. Science 1987;236:1567-70

Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and

reporting linkage results. Nat Genet. 1995 Nov;11(3):241-7

Lathrop GM, Lalouel JM. Easy calculations of LOD scores and genetic risks on small

computers. Am J Hum Genet 1984; 36(2):460-5

Laumonnier F, Ronce N, Hamel BCJ, Thomas P, Lespinasse J, Raynaud M, Paringaux C, van

Bokhoven H, Kalscheuer V, Fryns JP, Chelly J, Moraine C, Briault S. Transcription

factor SOX3 is involved in X-linked mental retardation with growth hormone deficeincy.

Am J Hum Genet 2002; 71:1450-1455

Lauren J, Airaksinen MS, Saarma M, Timmusk T. A novel gene family encoding leucine-rich

repeat transmembrane proteins differentially expressed in nervous system. Genomics

2003; 81:411-421

Lage K, Karlberg EO, Størling ZM, Olason PI, Pedersen AG, Rigina O, Hinsby AM, Tümer Z,

Pociot F, Tommerup N, Moreau Y, Brunak S. A human phenome-interactome network of

protein complexes implicated in genetic disorders. Nat Biotechnol, 2007; 25(3):309-16

Leal GF, Roberts E, Silvia EO, Costa SM, Hampshire DJ, Woods CG. A novel locus for

Autosomal recessive primary Microcephaly (MCPH6) maps to 13q12.2. J Med Genet

2003;40(7):540-2

Liu Y, Blackwood DH, Caesar S, de Geus EJ, Farmer A, Ferreira MA, Ferrier IN, Fraser C,

Gordon-Smith K, Green EK, Grozeva D, Gurling HM, Hamshere ML, Heutink P,

Holmans PA, Hoogendijk WJ, Hottenga JJ, Jones L, Jones IR, Kirov G, Lin D, McGuffin

P, Moskvina V, Nolen WA, Perlis RH, Posthuma D, Scolnick EM, Smit AB, Smit JH,

Smoller JW, St Clair D, van Dyck R, Verhage M, Willemsen G, Young AH, Zandbelt T,

Boomsma DI, Craddock N, O'Donovan MC, Owen MJ, Penninx BW, Purcell S, Sklar P,

Sullivan PF. Meta-analysis of genome-wide association data of bipolar disorder and

major depressive disorder. Mol Psychiatry. 2011;16(1):2-4



Mayo P, Hartshorne T, Li K, McMunn-Gibson C, Spencer K, Schnetz-Boutaud N. CNV

analysis using Taqman copy number assays. Curr.Protoc. Hum. Genet 2010; Chapter

2:Unit2.13

McCarroll SA, Kuruvilla FG, Korn JM, Cawley S, Nemesh J, Wysoker A, Shapero MH, de

Bakker PI, Maller JB, Kirby A, Elliott A L, Parkin M, Hubbell E, Webster T, Mei R,

Veitch J, Collins P J, Handsaker R, Lincoln S, Nizzari M, Blume J,Jones K W, Rava R,

Daly MJ, Gabriel SB, Altshuler D. Integrated detection and population-genetic analysis

of SNPs and copy number variation. Nat Genet 2008; (10):1166-1174

McFarlane WB, Hanson M, Walton W, Mellon CD. Stuttering in five generations of a single

family: a preliminary report including evidence supporting a sex-modified mode of

transmission. J Fluency Disord. 1991; 16:117–123

Meng H, Smith SD, Hager K, Held M, Liu J, Olson RK, Pennington BF, DeFries JC, Gelernter

J, O’Reilly-Pol T, Somlo S, Skudlarski P, Shaywitz SE, Shaywitz BA, Marchione K,

Wang Y, Paramasivam M, LoTurco JJ, Page GP, Gruen JR. DCDC2 is associated with

reading disability and modulates neuronal development in the brain. Proc Nat Acad Sci

2005;102:17053-58

Molfese DL. Predicting dyslexia at 8 years og age using neonatal brain responses.Brain Lang

2000; 72:238-245

Muhammad F, Mahmood Baig S, Hansen L, Sajid Hussain M, Anjum Inayat I, Aslam M, Anver

Qureshi J, Toilat M, Kirst E, Wajid M, Nurnberg P, Eiberg H, Tommerup N, Kjaer KW.

Compound heterozygous ASPM mutations in Pakistani MCPH families. Am J Med

Genet A. 2009;149A:926–30

Neitzel H, Neumann LM, Schindler D, Wirges A, Tönnies H, Trimborn M, Krebsova A, Richter

R, Sperling K Premature chromosome condensation in humans associated with

microcephaly and mental retardation: a novel autosomal recessive condition. Am J Hum

Genet 2002; 70(4):1015-22

Nicholas AK, Khurshid M, Desir J, Carvalho OP, Cox JJ, Thornton G, Kausar R, Ansar M,

Ahmed W, Verloes A, Passemard S, Misson JP, Lindsay S, Gergely F, Dobyns WB,

Roberts E, Abramowics M, Woods CG. WDR62 is associated with the spindle pole and

is mutated in human microcephaly. Nat Genet 2010; 42(11):1010-4

Nobrega MA, Ovcharenko I, Afzal V, Rubin EM. scanning human gene desert for long range

enhancers. Science 2003; 302:413



Nopola-Hemmi J, Myllyluoma B, Haltia T, Taipale M, Ollikainen V, Ahonen T, Voutilainen A,

Kere J, Widen E. A dominant gene for developmental dyslexia on chromosome 3. J Med

Genet 2001; 38:658-664

Ott JS. A comparison of two methodologies for assessing human service needs and an

assessment of the impacts of methodological choices on identified needs. J Health Hum

Resour Adm 1991; 14(2):132-59

Passemard S, Titomanlio L, Elmaleh M, Afenjar A, Alessandri JL, Andria G, Billette de

Vilemeur T, Boespflug-Tanguy O, Burglen L, Del Gundice E, Guimiot F, Hyon C, Isidor

B, Megarbane A, Moog U, Odent S, Hernandez K, Pouvreau N, Scala I, Schaer M,

Gressens P, Gerard B, Verloes A. Expanding the clinical and neuroradiologic phenotype

of primary microcephaly due to ASPM mutations. Neurology 2009; 73(12):962-969

Partington MW, Mulley JC, Sutherland GR, Hockey A, Turner G. X-linked mental retardation

with dystonic movements of the hands. Am J Med Genet 1988; 30:251-262

Partington MW, Turner G, Boyle J, Gecz J. Three new families with X-linked mental

retardation caused by the 428-451 dup (24bp) mutations in ARX. Clin.Genet 2004;

66:39-45

Pattison L, Crow YJ, Deeble VJ, Jackson AP, Jafri H, Rashid Y. A fifth locus for primary

Autosomal recessive Microcephaly maps to chromosome 1q31. Am J Hum Genet 2000;

66(2):724-7

Paulesu E, Demonet JF, Fazio F, McCroy E, Chanoine V, Brunswick N, cappa SF, Cossu G,

Habib M, Frith CD, Frith U. Dyslexia: cultural diversity and biological unity. Science

2001; 291:2165-7

Peterfy M, Phan J, XuP, Reue K. Lipodystrophy in the FLD mouse results from mutation of a

new gene encoding a nuclear protein, lipin. Nat Genet 2001; 27:121-4

Petryshen TL, Kaplan BJ, Hughes ML, Tzenova J, Feild LL. Supportive evidence for the DYX3

dyslexia susceptibility gene in Canadian families. J Med Genet 2002; 39:125-126

Petryshen TL, Kaplan BJ, Liu MF, Schmill de French N, Tobias R, Hughes ML, Field LL.

Evidence for a susceptibility locus on chromosome 6q influencing phonological coding

dyslexia. Am J Med Genet 2001; 105:507-517



Peyrard-Janvid M, Anthoni H, Onkamo P, Lahermo P, Zucchelli M, Kaminen N, Hannula-

Jouppi K, Nopola-Hemmi J, Voutilainen A, Lyytinen K, Kere J. Fine mapping of the

2p11 dyslexia locus and exclusion of TACR1 as a candidate gene. Hum Genet 2004;

114:510-516

Przeworski M, Hudson RR, Di Rienzo A. Adjusting the focus on human variation. Trends

Genet 2000;16:296-302

Pushpa S, Ramachandara NB. Biological basis of dyslexia: A maturing perspective. Curr

Science 2006; 90: 168-175

Rabin M, Wen XL, Hepburn M, Lubs HA. Suggestive linkage of developmental dyslexia to

chromosome 1p34-p36. Lancet 1993; 34:178

Rajarethinam RP, De Quardo JR, Nalepa R, Tandon R: superior temporal gyrus in

schizophrenia: a volumetric magnetic resonance imaging study. Schizophrenia Res 2000;

41:303-312

Raza MH, Riazuddin S, Drayna D. Identification of an autosomal recessive stuttering locus on

chromosome 3q13.2-3q13.33. Hum Genet 2010; 128:461-463

Raza MH, Amjad R, Riazuddin S, Drayna D.Studies in a consanguineous family reveal a novel

locus for stittering on chromosome 16q. Hum genet 2012;131:311-313

Reue K, Xu P, Wang XP, Slavin BG. Adipose tissue deficiency, glucose intolerance, and

increased atherosclerosis result from mutation in the mouse fatty liver dystrophy (fld)

gene. J Lipid Res 2000; 41: 1067-1076

Richards T, Aylward E, Raskind W, Abbott R, Field K, Parson A, Richard A, Nagy W, Eckert

M, Leonard C, Berninger V. Converging evidence for triple word form theory in children

with dyslexia. Develop Neu-psych 2006-b; 30:547-589

Roberts E, Hampshire DJ, Springell K, Pattison L, Crow Y, Jafri H, Corry P, Kabani G,

Mannon J, Rashid Y, Keen J, Bond J, Woods CG. Autosomal recessive primary

microcephaly: an analysis of locus heterogeneity and phenotypic variation. J Med Genet

2002;39:718-721

Roberts E, Jackson AP, Carradice AC, Deeble VJ, Mannan J, Rashid Y. The second locus for

Autosomal recessive primary Microcephaly (MCPH2) maps to chromosome 19q13.1-

13.2. Eur J Hum Genet 1999;7(7):815-20



Roongpraiwan R, Ruangdaraganon N, Visudhiphan P, Santikul K. Prevalence and clinical

characteristics of dyslexia in primary school students. J Med Assoc Thai 2002; 85 Suppl

4:S1097

Sadler TW. 2000. Langman`s medical embryology. Lippincott Williams & Wlkins. pp411

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. 2. ed., 3.

vol., Cold Spring Harbor Laboratory Press, New York

Saunders RD, Avides MC, Howard T, Gonzalez C, Glover DM. The Drosophila gene abnormal

spindle encodes a novel microtubule associated protein that associates with the polar

regions of the mitotic spindle. J Cell Biol 1997; 137:881-890

Sebat J, Lakshmi B, Troge J, Alexander J, Young J, Lundin P, Massa H, Walker M, Chi M,

Navin N, Lucito R, Healy J, Hicks J, Ye K, Reiner A, Gilliam TC, Trask B, Patterson N,

Zetterberg A, Wigler M. Large scale copy number polymorphism in the human genome.

Science 2004; 305:525-8

Shaywitz SE. Dyslexia. N Engl J Med 1998; 338:307-312

Shen J, Walsh CA. Targeted disruption of TGIF, the mouse ortholog of a human

holoprosencephaly gene, does not result in holoprosencephaly in mice. Mol Cell Biol

2005; 25: 3639-3647

Shugart YY, Mundorff J, Kilshaw J, Doheny K, Doan B, Wanyee J, Green ED, Drayna D.

Results of a genome-wide linkage scan for stuttering. Am J Med Genet 2004; 124A:133-

135

Siegel GJ, Agranaoff B, Albers RW, Fisher SK, Uhler MD 1998. Basic Neurochemistry:

Molecular, Cellular and Medical aspects: 6th Edition. Lippincott Williams & Wilkins.

Philadelphia PA

Simos PG, Fletcher JM, Foorman BR, Francis DJ, Castillo EM, Davis RN, Fitzgerald M,

Mathes PG, Denton C, Papanicolaou AC. Brain activation profiles during early stages of

reading acquisition.J Child Neurol 2002;17:159-163.



Sitek B, Luttges J, Marcus K, Kloppel G, Schmeigel W, Meyer HE, Hahn SA, Stuhler K.

Application of fluorescence difference gel electrophoresis saturation labeling for the

analysis of microdissected precursor lesions of pancreatic ductal adenocarcinoma.

Proteomics 2005; 5(10):2665079

SLI Consortium highly significant linkage to the SLI1 locus in an expanded samle of

individuals affected by specific language impairment. Am J Hum Genet 2004; 74:1225-

1238

Smith SD, Kimberling WJ, Pennington B, Lubs HA. Specific reading disability: identification

of an inherited form through linkage analysis. Science 1983; 219:1345-1347

Solms M, Oliver T, Oliver S. 2002. The Inner World: an introduction to the neuroscience of

subjective experience. Press LLC, 307 New York

Solomon NM, Ross SA, Morgan T, Belsky JL, Hol FA, Karnes PS, Hopwood NJ, Myers SE,

Tan AS, Warne GL, Forrest SM, Thomas PQ. Array comaparative genomic hybridization

analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical

region at Xq27 containing SOX3. J Med Genet 2004; 41:669-678

Speel EJ, van der Ven PF, Albrechts JC, Ramaekers FC, Furst DO, Hopman AH. Assignment of

the human gene for the sarcomeric M- band protein myosin (MYOM1) to 18p11.31-

p11.32. Genomics 1998; 54:184-6

Stromme P, Mangelsdorf ME, Shaw MA, Lower KM, Lewis SME, Bruyere H, Lutcherath V,

Gedeon AK, Wallace RH, Scheffer IE, Turner G, Partington M, Frints SGM, Fryns JP,

Suthurland GR, Mulley JC, Gecz J. Mutations in the human ortholog of aristaless cause

X-Linked mental retardation and epilepsy. Nature Genet 2002; 30:441-445

Suresh R, Ambrose N, Roe C, Pluzhnikov A, Wittke-Thompson JK, Maggie CYN, Wu Xiaolin,

Cook EH, Lundstrom C, Garsten M, Ezrati R, Yairi E, Cox NJ. New complexities in the

Genetics of Stuttering: Significant Sex-Specific linkage Signals. Am J Hum Genet 2006;

78:554-563

Tolmie JL, McNay M, Stephenson JBP, Doyle D, Connor JM. Microcephaly: genetic

counseling and antenatal diagnosis after the birth of an affected child. Am J Med Genet

1987; 27:583-594

Trinick J. Elastic filaments and giant proteins in muscle. Curr Opin Cell Biol 1991; 3:112-9



Tunca Y, Vurucu S, Parma J, Akin R, Desir J. Baser I. Prenatal diagnosis of primary

Microcephaly in two consanguineous families by confrontation of morphometry with

DNA data. Prenat Diagn 2006; 26(5):449-53

Ullman MT, Pierpont EI. Specific language impairment is not specific to language: the

procedural deficit hypothesis.Cortex 2005;41:399-433.

Vinkemeier U, Obermann W, Weber K, Furst DO. The globular head domain of titin extends

into the center of the sarcomeric M band: cDNA cloning, epitope mapping and

immunoelectron microscopy of two titin-associated proteins. J Cell Sci 1993; 106:319-

330

Walter J.M. Genetics advances and learning disability. Brit J Psych 2000 ;176, 12-19 Widmaier

EP, Raff H, Strang KT. Vander 2004. Sherman &Luciano’s Human Physiology: the mechanisms of body functions. 9th edition. Mc Graw Hill. NewYork. Pg. 262-264

Woods GC, Bond J, Enard W. Autosomal recessive primary microcephaly (MCPH); a review of

clinical, molecular and evolutionary findings. Am J Hum Genet 2005; 76:717-28

Wotton D, Lo RS, Swaby LA, Massague J. A Smad transcriptional co repressor. Cell 1999;

97:29-39

Yairi E, Ambrose NG. Early childhood stuttering. I. Persistence and recovery rates. J Speech

Lang Hear Res. 1999; 42:1097–1112

Yairi, E. and Ambrose, NG. (2005). Early Childhood Stuttering. Austin: Pro Ed Zhang X, Liu

D, Lv S, Wang H, Zhong X, Liu B. CDK5RAP2 is required for spindle checkpoint

function. Cell cycle 2009; 16: 8

Zhong X, Pfeifer GP, Xu X. Microcephalin encodes a centrosomal protein. Cell Cycle 2006;

14:2155-56

Zeiger A, Konig IR, Deiniel W. Developmental Dyslexia-recurrence risk estimates from a

German Bi-centric study using the single proband sib pair design. J Hum Hered 2005; 59:

136-43

prr.hec.gov.pkprr.hec.gov.pk/jspui/bitstream/123456789/7151/1/syeda_marriam_ba… · viii table of...

Documents