pseudomonas aeruginosa possesses two putative type i ... · pseudomonas aeruginosa possesses two...

Pseudomonas aeruginosa Possesses Two Putative Type I SignalPeptidases, LepB and PA1303, Each with Distinct Roles in Physiologyand Virulence

Richard D. Waite,a Ruth S. Rose,b Minnie Rangarajan,a Joseph Aduse-Opoku,a Ahmed Hashim,a and Michael A. Curtisa

Centre for Immunology and Infectious Disease (CIID), Blizard Institute, Barts, and The London School of Medicine and Dentistry, Queen Mary University of London,London, United Kingdom,a and School of Biological and Chemical Sciences, Queen Mary University of London, London, United Kingdomb

Type I signal peptidases (SPases) cleave signal peptides from proteins during translocation across biological membranes andhence play a vital role in cellular physiology. SPase activity is also of fundamental importance to the pathogenesis of infection formany bacteria, including Pseudomonas aeruginosa, which utilizes a variety of secreted virulence factors, such as proteases andtoxins. P. aeruginosa possesses two noncontiguous SPase homologues, LepB (PA0768) and PA1303, which share 43% amino acididentity. Reverse transcription (RT)-PCR showed that both proteases were expressed, while a FRET-based assay using a peptidebased on the signal sequence cleavage region of the secreted LasB elastase showed that recombinant LepB and PA1303 enzymeswere both active. LepB is positioned within a genetic locus that resembles the locus containing the extensively characterizedSPase of E. coli and is of similar size and topology. It was also shown to be essential for viability and to have high sequence iden-tity with SPases from other pseudomonads (>78%). In contrast, PA1303, which is small for a Gram-negative SPase (20 kDa), wasfound to be dispensable. Mutation of PA1303 resulted in an altered protein secretion profile and increased N-butanoyl homoser-ine lactone production and influenced several quorum-sensing-controlled phenotypic traits, including swarming motility andthe production of rhamnolipid and elastinolytic activity. The data indicate different cellular roles for these P. aeruginosa SPaseparalogues; the role of PA1303 is integrated with the quorum-sensing cascade and includes the suppression of virulence factorsecretion and virulence-associated phenotypes, while LepB is the primary SPase.

Type I signal peptidases (SPases) are cytoplasmic membrane-bound enzymes that cleave amino-terminal signal peptides

from proteins translocated by the general secretory pathway (Sec)of bacteria (reviewed in references 12, 43, 44, 67, and 69). SPasesare unique serine proteases that use a catalytic Ser-Lys dyad mech-anism. The signal peptides they remove have three conserved do-mains: a positively charged amino-terminal domain, a central hy-drophobic domain, and a carboxy-terminal hydrophilic domainthat contains the SPase cleavage site (44). Small neutral residuesare found at the �1 and �3 positions relative to the cleavage site,with Ala being the most common amino acid at these positions(41). Substrates of the Sec-independent twin arginine transloca-tion (TAT) pathway also possess similar signal peptides, althoughthey contain a highly conserved twin arginine motif upstream ofthe hydrophobic region, while the type II signal peptides of lipo-proteins are cleaved by a different protease (signal peptidase II)immediately upstream of a Cys residue that is part of the N-ter-minal lipoprotein box motif (9, 71).

In Gram-negative bacteria, SPase-mediated cleavage of signalpeptides releases proteins into the periplasm, from where theymay be transported across or into the outer membrane (19). Agood illustration of the immense importance of SPases to bacterialcellular physiology was provided by Lewenza and colleagues (36),who performed an in silico analysis to identify protein export sig-nals within the genome of Pseudomonas aeruginosa strain PAO1.This predicted that 801 P. aeruginosa proteins (14.4% of the ge-nome) contain a cleavable type 1 signal peptide (36) and thereforeshowed that a significant proportion of the proteome of this op-portunistic pathogen is targeted to the cell envelope and extracel-lular milieu. These proteins include components of the generalsecretory pathway (Sec), iron uptake proteins, outer membrane

proteins and porins, flagellar structural proteins, catalase (KatB),cell wall biosynthesis enzymes, components of ABC transporters,and regulatory proteins (36). In addition, many important P.aeruginosa virulence factors possess a type 1 signal peptide, includ-ing elastases (LasA and LasB), exotoxin A, �-lactamase (AmpC),and proteins involved in the biosynthesis of alginate (AlgD, AlgE,AlgG, AlgL, and AlgF) (24, 29, 36), and thus reveal a direct role forP. aeruginosa SPase activity, not only in cellular housekeeping, butalso in pathogenesis.

Multiple SPases are frequently observed in Gram-positive bac-teria. The most extreme case is Bacillus cereus which containsseven paralogous SPases, while Bacillus anthracis, Bacillus subtilis,and Streptomyces lividans have six, five, and four chromosomallylocated SPases, respectively (69). Other notable examples areStaphylococcus aureus and Listeria monocytogenes, which possesstwo and three contiguous SPases, respectively (7, 10). However, inthe case of S. aureus, SPase activity is performed by only one of theparalogues (SpsB), while the other (SpsA) does not possess theserine-lysine catalytic dyad and is thus devoid of catalytic activity(10). Conversely, L. monocytogenes is a good example of a patho-gen that possesses SPases with different functions, as two of thethree proteases (SipX and SipZ) have been shown to have different

Received 11 December 2011 Accepted 7 June 2012

Published ahead of print 22 June 2012

Address correspondence to Richard D. Waite, [email protected].

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.06678-11

September 2012 Volume 194 Number 17 Journal of Bacteriology p. 4521–4536 jb.asm.org 4521

on April 20, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://dx.doi.org/10.1128/JB.06678-11

http://jb.asm.org

http://jb.asm.org/

roles in pathogenesis, with SipZ being the major SPase of the or-ganism (7).

In contrast, Gram-negative bacteria usually possess only a sin-gle SPase. This has been observed for Escherichia coli, whose SPase(LepB) has been extensively characterized, and documented formany organisms, including Haemophilus influenzae, Legionellapneumophila, Pseudomonas fluorescens, Rhodobacter sphaeroides,Salmonella enterica serovar Typhimurium, and Yersinia pestis (34,69). However, the possession of multiple SPases is not exclusivelya trait of Gram-positive organisms; two SPases have been demon-strated in Synechocystis sp. (80), and the Gram-negative soil bac-terium Bradyrhizobium japonicum is known to have at least twofunctional SPases (SipS and SipF), with a further SPase that has yetto be studied (1, 38, 39). In addition, the list of Gram-negativeorganisms with multiple SPases is likely to increase as more se-quenced genomes are explored for proteins with this importantfunction.

There is urgent clinical need for new therapies against P.aeruginosa, which has a remarkable capacity to infect compro-mised individuals—it is the principal cause of chronic respiratoryinfection in cystic fibrosis (CF) patients and is a common nosoco-mial pathogen, with burn victims, intensive care unit patients, andthose with indwelling devices (catheters or ventilators) particu-larly at risk from infection. In addition, its natural resistance tomany frontline antibiotics is compounded by its genetic capacityto express a wide repertoire of resistance mechanisms and acqui-sition of additional resistance genes and beneficial mutations (33).The need for a functional SPase for viability has been demon-strated in other organisms, such as E. coli, S. aureus, and Strepto-coccus pneumoniae (10, 13, 79), and several inhibitors, includingarylomycin and lipoglycopeptide natural products and �-lactamanalogs (penem inhibitors), have been shown to have activityagainst SPases (3, 5, 31, 34, 37, 43, 51). In this study, we performeda molecular characterization of the two SPase homologues presentwithin the P. aeruginosa genome, LepB and PA1303, in order todetermine their physiological roles and their suitability as drugtargets. LepB was found to possess all the characteristics of a con-ventional Gram-negative SPase, to be essential for viability, and todisplay intra- and interspecies conservation. In contrast, althoughPA1303 is conserved among P. aeruginosa strains, its mutationshows that it is dispensable in vitro and reveals a potential functionin the suppression of virulence factor secretion through involve-ment in the quorum-sensing (QS) cascade.

MATERIALS AND METHODSBacterial strains, culture conditions, and DNA techniques. The bacte-rial strains and plasmids used in this study are listed in Table 1. Bacterialstrains were grown at 37°C in Luria-Bertani (LB) broth or on LB agar(Invitrogen) or Pseudomonas isolation agar (PIA) (Difco), as indicated.Antibiotics were used at the following concentrations; ampicillin, 100�g/ml for E. coli; carbenicillin, 100 �g/ml for P. aeruginosa; gentamicin,10 �g/ml for E. coli and 200 �g/ml for P. aeruginosa; tetracycline, 15 �g/mlfor E. coli and 60 or 100 �g/ml for P. aeruginosa. Standard techniques forDNA manipulations were used (53).

Fractionation of P. aeruginosa cells and Western blotting. Briefly,PAO1 harboring pHERD26T (PAO1 pHERD26T) or pHERD26T-PA1303-HAtag (PAO1 pHERD26T-PA1303-HAtag) was grown over-night at 37°C in LB broth with and without 1% arabinose, and bacterialcells were pelleted by centrifugation (17,000 � g; 3 min). For the total celllysate analysis, pellets were resuspended in 250 �l SDS (0.2%), and 10-�laliquots were mixed with 10 �l Nu-PAGE sample buffer (Life Technolo-

gies), boiled for 5 min (99°C), resolved on a Nu-PAGE 4 to 12% Bis-Trisgel (Life Technologies), and transferred to polyvinylidene difluoride(PVDF) membranes. PA1303 was detected using monoclonal anti-hem-agglutinin (HA) antibodies (Covance) diluted 1:1,000 in TBST (50 mMTris/HCl, pH 8, 138 mM NaCl, 2.7 mM KCl, 0.1% [vol/vol] Tween 20)and anti-mouse immunoglobulin G peroxidase antibody (Sigma) diluted1:5,000 in TBST. Blots were developed using the Lumiglo chemilumines-cence detection system (Cell Signaling).

For the subcellular localization study, the separation of PAO1pHERD26T-PA1303-HAtag cells grown overnight at 37°C in LB brothcontaining 1% arabinose into a soluble fraction (cytoplasm andperiplasm) and separation of a total membrane fraction into inner andouter membrane fractions using Sarkosyl solubilization were performedas previously described (26). Six micrograms of each fraction was resolvedon a Nu-PAGE 4 to 12% Bis-Tris gel (Life Technologies) and stained withBrilliant Blue G colloidal concentrate (Sigma). After confirmation that differ-ential fractionation had been achieved, protein was transferred to PVDFmembranes. The membranes were probed with rabbit polyclonal anti-XcpYand mouse monoclonal anti-RpoA (Neoclone) and anti-HA antibodies.Anti-mouse immunoglobulin G peroxidase antibody (Sigma) and anti-rab-bit immunoglobulin G peroxidase antibody (DakoCytomation) were addedto probed membranes as appropriate, and blots were developed as describedabove. The antibody against XcpY was a kind gift from Romé Voulhoux(CNRS, Aix Marseille University). The detection of RpoA and XcpY served asa marker for the detection of cytoplasmic and inner membrane fractions,respectively. Detection of OprF in the outer membrane fraction was achievedthrough liquid chromatography-tandem mass spectrometry (LC MS-MS)(Centre of Excellence for Mass Spectrometry, King’s College London).

RT-PCR. Expression of lepB was targeted using primers LepB RT-For(5= GCGCGGCGATGTCATGGTGTT 3=) and LepB RT-Rev (5= GCGGCTGTCGTTGGAGTTGTCG 3=), while PA1303 was targeted using PA1303RT-For (5= CGCGCACGGCTCCTCGG 3=) and PA1303 RT-Rev (5= CACCGGGCGCTCATTGACGTA 3=). Reverse transcription (RT) was car-ried out on 250 ng total RNA using a Verso 1-Step RT-PCR Reddy mix kit(ThermoScientific). The following parameters were used: 55°C (30 min)for first-strand cDNA synthesis, followed by inactivation of the enzymeand 30 cycles of 94°C (30 s), 63°C (30 s [LepB]) or 61°C (30 s [PA1303]),and 72°C (1 min). A final extension step was applied at 72°C (5 min). Thetotal RNA used was isolated from P. aeruginosa strain PAO1 planktoniccultures grown to logarithmic and stationary phases in full-strength LBusing methodology described previously (74).

Cloning of LepB (truncated) and PA1303 (full length) for proteinexpression. Using P. aeruginosa strain PAO1 chromosomal DNA as atemplate and primers LepB-hydro-del LepB-hydro-del (5= GGAATTCCATATGCGTTCCTTCCTGGTCGAGCC 3=) and LepB-end-BamH1 (5=CGGGATCCTCAGTGAATCACGCCGACC 3=), the lepB gene was PCRamplified to generate a DNA fragment lacking the identified N-terminaltransmembrane regions to facilitate protein purification. These primerswere designed to incorporate NdeI and BamHI restriction sites into theamplified template in order to permit cloning into the corresponding sitesof expression vector pET28 (Novagen) to generate plasmid pET28-�lepB.This put the truncated lepB gene under the control of a T7 promoter andintroduced a polyhistidine tag upstream of the gene to facilitate proteinpurification. Similarly, the full-length PA1303 DNA sequence was ampli-fied using primers PA1303-up-Nde1 (5= GGAATTCCATATGGGCCTGCTCGCCGCGAT 3=) and PA1303-end-BamH1 (5= CGGGATCCTCAGCGCACCGAACCGATGCGC 3=), and the resultant PCR productwas cloned into pET-28 to generate pET28-PA1303 using the same pro-cedure. The presence of the correct cloned sequence was verified throughDNA sequencing.

Protein production and purification. PA1303 and LepB wereoverproduced using the pET system (Novagen) (60). Briefly, E. coliRosetta(DE3)pLysS transformants containing pET28-PA1303 orpET28-�lepB were grown overnight at 18°C and induced with 1 mMIPTG (isopropyl-�-D-thiogalactopyranoside) to express PA1303 and a

Waite et al.

4522 jb.asm.org Journal of Bacteriology


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

truncated LepB protein, respectively. Cells from a 1-liter culture wereharvested by centrifugation (3,315 � g) and resuspended in 30 mlbuffer (20 mM Tris, pH 8.0, 500 mM NaCl, 10 mM imidazole, 1%Triton), and 25 U benzonase (Novagen) was added. The cells werelysed by two passages through an Emulsiflex high-pressure microflu-idizer (Avestin) at 22,000 kPa, and cell debris was removed by centrif-ugation at 35,000 � g for 20 min. The soluble fraction was then incu-bated with 0.5 ml of Ni-NTA Sepharose (Sigma) for 1 h at 4°C on arotator, the contents was poured into a column, and unbound materialwas removed under gravity. The Sepharose was then washed in 30 mlbuffer (20 mM Tris, pH 8.0, 500 mM NaCl, 10 mM imidazole), and theprotein was eluted in the following buffer: 20 mM Tris, pH 8.0, 500mM NaCl, 500 mM imidazole. The purity of the protein was deter-mined by SDS-PAGE using 12% gels and Coomassie blue or SimplyBlue (Invitrogen) staining. Recombinant protein was then buffer ex-

changed into 50 mM Tris-HCl, pH 7.5, containing 0.5% Triton X-100using PD-10 desalting columns (Sephadex G-25 M; GE Healthcare).

In vitro activity of purified LepB and PA1303. The recombinantSPases were screened for enzymatic activity using fluorescence resonanceenergy transfer (FRET) technology. The intramolecularly quenched fluo-rescent substrate (Dabcyl)VSPAAFAADL(EDANS) (purchased fromPeptide Protein Research Ltd., United Kingdom) contained a decapeptide(based on the cleavage region of the signal peptide sequence of the P.aeruginosa LasB protein) that links a fluorophore [5-((2-aminoethyl)amino)naphthalene-1-sulfonic acid) (EDANS)] with a quencher [4-((4-(dimethylamino)phenyl)azo)benzoic acid (Dabcyl)]. Cleavage of this de-capeptide results in fluorescence emission. Reactions using a mixturecontaining 0.5, 1.0, and 1.5 �M recombinant LepB protein or 0.5 �Mrecombinant PA1303 protein and 20 �M FRET peptide (final concentra-tion) in assay buffer (50 mM Tris-HCl, pH 7.5) containing 0.25% and/or

TABLE 1 Bacterial strains and plasmids

Strain or plasmid Relevant characteristics and/or genotypea Reference/source

StrainsE. coli

JM109 endA1 recA1 gyrA96 thi-1 hsdR17(rK� mK

�) relA1 supE44 �(lac-proAB)[F= traD36 proAB lacIqZ�M15]

78

S17-1 �pir thi pro hsdR hsdM� recA RP4-2-Tc::Mu-KM::Tn7 �pir 58Rosetta(DE3)pLysS F� ompT hsdSB(rB

� mB�) gal dcm (DE3) pLysSRARE (Camr) Novagen

P. aeruginosaPAO1 Wild-type strain; MPAO1 27�lepB/pUCP26-lepB PAO1 with chromosomal lepB deletion, expressing lepB in trans from

pUCP26; Tcr Gmr

This study

�PA1303 PAO1 containing chromosomal deletion in PA1303; Gmr This study�PA1303 pHERD26T �PA1303 mutant carrying pHERD26T; Gmr Tcr This study�PA1303 pHERD26T-PA1303 �PA1303 mutant carrying pHERD26T-PA1303; Gmr Tcr This studyPAO1 pHERD26T-PA1303-HA PAO1 carrying pHERD26T-PA1303-HA; Tcr This studyPAO1 pHERD26T PAO1 carrying empty vector pHERD26T; Tcr This study

PlasmidspUCP18 Broad-host-range vector; Apr 55pUCP20 pUCP18-derived broad-host-range vector; Apr 76pUCP26 pUCP18-derived broad-host-range vector; Tcr 76pHERD26T pUCP26 Plac replaced with 2.4-kb AdhI-EcoRI fragment of araC-PBAD

cassette and oriT; Tcr

47

pUCGm Source of Gmr cassette; Apr Gmr 54pEX100T Gene replacement vector; Apr sacB� 56pUC18-lepB pUCP18 carrying lepB and flanking regions; Apr This studypUC-lepB::Gmr pUC18-lepB carrying a Gmr cassette within the cloned lepB gene

sequence; Apr Gmr

This study

pEX100T-lepB::Gmr pEX100T carrying lepB containing a Gmr cassette and flanking regions;Apr Gmr sacB�

This study

pEX100T-�lepB::Gmr pEX100T-lepB::Gmr with 700 bp of lepB removed; deletion constructused for lepB chromosomal mutation analysis; Apr Gmr sacB�

This study

pUCP26-lepB pUCP26 carrying lepB and flanking regions; Tcr This studypUCP20-PA1303 pUCP20 carrying PA1303 and flanking regions; Apr This studypUCP20-�PA1303::Gmr pUCP20-PA1303 with 456 bp of PA1303 removed and replaced by a

Gmr cassette; Apr Gmr

This study

pEX100T-�PA1303::Gmr pEX100T-containing construct used to generate a chromosomaldeletion mutation in PA1303; Apr Gmr

This study

pHERD26T-PA1303 pHERD26T carrying PA1303; Tcr This studypHERD26T-PA1303-HA pHERD26T carrying PA1303 C-terminally tagged with HA; Tcr This studypET28 Protein expression vector; Kanr NovagenpET28-�lepB pET28 carrying lepB lacking N-terminal transmembrane regions; Kanr This studypET28-PA1303 pET28 carrying PA1303; Kanr This studypSB1075 AHL reporter plasmid; P. aeruginosa lasRI and luxCDABE from

Photorhabdus luminescens77

pSB536 AHL biosensor; ahyR�:: luxCDABE in pAHP13; Apr 61a Apr, ampicillin resistance; Gmr, gentamicin resistance; Tcr, tetracycline resistance; Kanr, kanamycin resistance; sacB�, levansucrase-encoding gene.

P. aeruginosa Type I Signal Peptidases

September 2012 Volume 194 Number 17 jb.asm.org 4523


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

0.5% Triton X-100 were carried out at 37°C. Fluorescence intensity read-ings were taken over a period of 30 to 60 min using a Fluostar Optimamicroplate reader (BMG Laboratories). The fluorescence emission signalwas measured at 520 nm over time, following excitation at 405 nm.

MALDI-TOF MS analysis of FRET peptide substrate cleavage by re-combinant PA1303 protein. Recombinant PA1303 protein in 50 mMTris-HCl, pH 7.5, containing 0.5% Triton X-100 was dialyzed against 50mM Tris-HCl, pH 8.0, at 4°C, with four changes of buffer. Reaction mix-tures containing 0.5 �M recombinant PA1303 protein and 20 �M FRETpeptide were carried out at 37°C. Control reactions with mixtures con-taining no recombinant PA1303 protein were set up in parallel. After 6and 15 h of incubation, the reaction mixtures were lyophilized and resus-pended in 40 �l in distilled water. Matrix-assisted laser desorption ion-ization–time of flight mass spectrometry (MALDI-TOF MS) was per-formed with a Bruker Microflex MALDI-TOF mass spectrometer fittedwith a nitrogen laser operating at 337 nm using pulsed extraction in neg-ative linear mode. Peptides were analyzed using 9H-pyrido(3,4)indole(Norharmane; Sigma) in methanol-water (2:1 by volume) at a concentra-tion of 10 mg/ml, used as a matrix. A total of 0.5 �l of peptide/reactionproducts in water, together with 0.5 �l of matrix solution, was applied tothe MALDI plate and allowed to dry in air. The instrument was calibratedusing the peptides des-ArgI bradykinin (904.0 Da), angiotensin I (1,296.5Da), and neurotensin (1,672.3 Da), and average masses were usedthroughout.

Mutagenesis analysis of lepB. The P. aeruginosa PAO1 lepB gene andflanking regions was amplified by PCR using primers S26F (5= GGTCCAGCGAATTACTCAC 3=) and S26R (5= CGACATGCACTTCCTCAG 3=)and cloned into pUC18 to give plasmid pUC18-lepB. This plasmid was cutwith AccIII at nucleotide position 750 of lepB, the sticky ends were pol-ished with Klenow, and a gentamicin cassette was inserted to generateplasmid pUC-lepB::Gmr. This construct was then excised and insertedinto pEX100T to give pEX100T-lepB::Gmr. pEX100T-�lepB::Gmr wasthen generated by removing 698 bp of lepB with NarI and KpnI.

Allelic replacement in strain PAO1 was then attempted using standardmethodology (56). However, although plasmid pEX100T�lepB::Gmr wasfound to successfully integrate into the PAO1 genome to form a merodip-loid strain, excision of the plasmid to yield an inactivated LepB was foundnot to occur. Chromosomal lepB deletion mutants could be obtained,however, if lepB was provided in trans using plasmid pUCP26-lepB duringthe mutagenesis procedure. pUCP26-lepB was constructed using primerslepBup-str_for (5=-GCCCTCGCCCTGATCGTCCAC-3=) and lepB-down_rev (5=-CCCTGCGGCGGCGTTCG-3=). Briefly, electrocompe-tent stocks (16) of merodiploid colonies were made, which were thentransformed with pUCP26-lepB (Tcr), and the mutagenesis protocol wasresumed. Using this procedure, colonies containing a chromosomal lepBdeletion and harboring lepB in trans were generated. These colonies hadthe appropriate phenotype; colonies grew on LB agar containing genta-micin (200 �g/ml), sucrose (5%), and tetracycline (60 �g/ml), but not onLB agar containing carbenicillin (100 �g/ml). The production of a chro-mosomal lepB deletion mutation was confirmed using PCR primers lepBseq for (5=-CCAGGAAATGCGCGAACCGATCT-3=) and lepB seq rev(5=-GCCCGGCGTAGCTGCGATGG-3=), which are located outside theregions cloned into pUC18 and pUCP26.

Generation of a PA1303 chromosomal deletion mutant. The PA1303gene and flanking regions was amplified by PCR using primers PA1303 up-stream (5=-CGCCAACCTGCTGCTGCTCAAGA-3=) and PA1303 down-stream (5=-CCCGCATCGACTTCACCGTGGA-3=) and cloned intopUCP20 to give plasmid pUCP20-PA1303. Plasmid pUCP20-PA1303 wascut with the restriction endonucleases SnaBI and NcoI, removing 456 bpof PA1303 DNA. The resultant sticky ends were then polished with Kle-now, and a gentamicin cassette was inserted to generate plasmid pUCP20-�PA1303::Gmr. The PA1303 gentamicin-resistant construct was then ex-cised using the restriction endonucleases EcoRI and SphI and insertedinto pEX100T to give pEX100T-�PA1303::Gmr. This plasmid was thenintroduced into donor strain E. coli S17 by electroporation for conjugal

transfer into PAO1, which was performed as described previously (56). Inthe transformants obtained by this procedure the insertional mutationwas confirmed to be in the right location through PCR, using primersflanking the chromosomal region cloned into pUCP20 (PA1303 up-stream2, 5= CCTGCTGGTGGTCGCCGGCTAC 3=; PA1303 down-stream2, 5= CGGCTGGCAGGGCGAGTTCG 3=). PCR with primers S26Fand S26R was used to show that no insertion had occurred in the lepB geneof these transformants.

Construction of plasmids pHERD26T-PA1303 and pHERD26T-PA1303-HA. In order to place PA1303 under the control of a PBAD arabi-nose-inducible promoter, the gene was cloned into the shuttle vectorpHERD26T (47). This was achieved using the following primers: PA1303-up-EcoRI (5= AGAATTCCATGGGCCTGCTCGCCGC 3=) and PA1303-end-HindIII (5= CAAGCTTTCAGCGCACCGAACCGATGCGC 3=),which through PCR introduced terminal restriction sites that were usedfor ligation into linearized vector. The generated plasmid, pHERD26T-PA1303, was then sequenced using primers that flank the cloning site(pHERD-SF, 5= ATCGCAACTCTCTACTGTTTCT 3=, and pHERD-SR,5= TGCAAGGCGATTAAG TTGGGT 3=) to confirm that no mutationhad arisen in the cloned PA1303 sequence. pHERD26T-PA1303 was thenintroduced into the PA1303 mutant by electroporation.

A similar strategy was used to generate plasmid pHERD26T-PA1303-HA, using primers PA1303-up-NcoI (5= CGCCATGGGCCTGCTCGCCGCGA 3=) and PA1303-HA-ctag1 (5= GCAAGCTTTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCGCACCGAACCGATGCGCCGGGT 3=).This replaced the Wild-type (WT) PA1303 sequence with an HA tag(amino acid sequence, YPYDVPDYA) incorporated at the C terminusunder the control of the arabinose-inducible promoter. pHERD26T-PA1303-HA was sequenced using primers pHERD-SF and pHERD-SRand introduced into PAO1 by electroporation.

Planktonic-growth analysis. Overnight LB cultures (2.4 � 109 to2.5 � 109 CFU/ml) were diluted 100-fold into LB broth, and planktonicgrowth at 37°C was monitored at 30-min intervals using a Fluostar Op-tima microplate reader (BMG Laboratories).

TEM. P. aeruginosa overnight cultures were fixed in 0.5% glutaralde-hyde in 0.1 M sodium cacodylate buffer (pH 7.4) for 1 h at 4°C. Sampleswere prepared for transmission electron microscopy (TEM), as previouslydescribed (59), and visualized with a Jeol JEM-1200 EX11 transmissionelectron microscope at 80 kV.

Two-dimensional (2D) electrophoresis, in-gel digestion, andMALDI-TOF MS analysis of excised spots. Supernatants from 500-mlovernight cultures of P. aeruginosa strain PAO1 and its isogenic PA1303mutant were obtained through centrifugation, and a cocktail of proteaseinhibitors (Roche, Germany) were added. Supernatant (250 ml) was dia-lyzed against 4 liters of deionized water at 4°C for 2 days with four changesof water. The lysate was then freeze-dried and solubilized in 5 ml buffer(15 mM Tris-HCl, pH 7.5, containing 1% Triton X-100 and a cocktail ofprotease inhibitors), proteins were precipitated with 5 volumes of ice-cold10% trichloroacetic acid in acetone containing 0.2% dithiothreitol, andthe pellet was washed twice with the same volume of ice-cold acetone. Theprecipitated protein pellets were then solubilized in 1.0 ml of solubiliza-tion buffer (7 M urea, 2 M thiourea, 4% CHAPS {3-[(3-cholamidopro-pyl)-dimethylammonio]-1-propanesulfonate}, 50 mM dithiothreitol,0.002% bromophenol blue, 2% immobilized pH gradient [IPG] buffer,pH 3 to 10 [GE Healthcare, Bucks, United Kingdom]) at room tempera-ture for 1 h with occasional mixing. After centrifugation of this suspension(100,000 � g), the clear supernatant was stored in 100-�l aliquots at�80°C.

Isoelectric focusing with immobilized pH gradients (IPG strips) in theIPGphor Isoelectric Focusing System (GE Healthcare) was carried outaccording to the manufacturer’s instructions using 13-cm IPG strips inthe pH range 3 to 11 (nonlinear) loaded with 250 �g protein per strip. TheIPG strips were incubated in 10 ml of equilibration buffer (23) with gentleshaking for 15 min to denature the proteins and reduce disulfide bridges,followed by alkylation of cysteine residues (23). SDS-PAGE was per-

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

formed in an SE600 standard vertical system without the use of a stackinggel. The gels were stained with colloidal Coomassie brilliant blue as pre-viously described (40).

Protein spots were excised, destained, and digested with sequencing-grade trypsin (13 �g/ml) overnight. Peptide extracts were desalted andconcentrated using Zip-Tip C18 resin. Peptide mass fingerprinting wasperformed using MALDI-TOF MS and/or quadrupole time of flight tan-dem mass spectrometry (Q-TOF MS-MS), and peptides were identifiedusing the complete translated open reading frames (ORFs) for sequencedP. aeruginosa strain PAO1 (MRC Clinical Sciences Centre, Imperial Col-lege Faculty of Medicine, London, United Kingdom).

Phenotypic assays. Two methods were used to assess elastase produc-tion; the qualitative elastin-nutrient agar method and the quantitativeelastin Congo red (ECR) assay (Sigma) (52, 64). Elastin-nutrient agarplates were prepared as previously described and contained an insoluble-elastin (Sigma; elastin from bovine neck ligament)-containing agar over-lay and a nutrient agar base. Zones of elastin clearing were observed afterovernight incubation at 37°C and storage at 4°C for 24 h. For the ECRassay, 100-�l aliquots of sterile supernatant from triplicate P. aeruginosacultures grown for 15 h in LB broth or LB broth containing 1% arabinosewere added to 2 ml of ECR buffer (0.1 M Tris, pH 7.0) containing 20 mg ofECR and incubated with shaking at 37°C for 18 h. Insoluble ECR wasremoved by centrifugation, and the absorption of the supernatant wasmeasured at an optical density at 495 nm (OD495) against a buffer blank.

Swarming motility plates contained constituents that have been de-scribed previously (49). Overnight LB broth cultures (2 �l) were inocu-lated onto the agar surface, and the plates were incubated at both 30 and37°C for 15 h. Swimming motility was detected using medium containing0.3% Bacto agar, 1% tryptone, 1% NaCl, and 0.2% glucose (22). Bacterialcells from agar plates were stab inoculated into the center of the swimmingagar, and motility was observed after incubation at 30°C and 37°C for 15 h.Twitching motility was observed using LB agar (Invitrogen) containing2,3,5-triphenyltetrazolium chloride (Sigma). Wild-type and mutantstrains were stab inoculated into the agar and incubated at 37°C for 24 h,and bright-red twitching zones were observed after a further 2 to 3 days ofincubation at room temperature.

Rhamnolipid production was observed using biosurfactant detectionagar plates, which contained constituents that have been described previ-ously (8). Forty microliters of overnight LB broth cultures were inocu-lated onto the agar surface, and the plates were incubated at 37°C for 24 h,followed by a further 24 h at room temperature. Rhamnolipid productionwas observed through the precipitation of cetyltrimethylammonium bro-mide (CTAB) and the formation of a white-outlined halo that surroundedthe colonies that had grown (57).

AHL detection. N-Acylhomoserine lactones (AHLs) were detected us-ing E. coli harboring the following reporter plasmids: pSB1075 [for N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL)] and pSB536(for N-butanoyl homoserine lactone [C4-HSL]) using methodology sim-ilar to that previously described (15). Briefly, sterile supernatant fromtriplicate P. aeruginosa cultures grown to exponential (4.5 h; OD600 0.7)and stationary (8 to 8.5 h; OD600 1.05 to 1) phases was obtained bymembrane filtration. The supernatant was diluted 1:10 in LB broth, and100 �l was added to a microtiter plate containing 100 �l 1:1,000-diluted E.coli harboring pSB1075. The same procedure was also followed for reac-tion mixtures containing E. coli harboring pSB536. The plates were incu-bated at 30°C, and luminescence was determined hourly and turbidity wasdetermined after 4 and 6 h for reaction mixtures containing pSB536 andpSB1075, respectively, using a Fluostar Optima microplate reader (BMGLaboratories).

RESULTSP. aeruginosa has two signal peptidase homologues. The se-quenced genome of P. aeruginosa strain PAO1 contains two puta-tive SPases, PA0768 (annotated as LepB) and PA1303, which have41% and 32% amino acid sequence identity, respectively, with the

prototype bacterial SPase—E. coli LepB. The literature to datesuggests that the presence of multiple SPases is uncommon forGram-negative bacteria, and multiple SPases are often contiguousin Gram-positive bacteria; however, the P. aeruginosa paraloguesare located in different regions of the PAO1 genome (LepB, nu-cleotides 837328 to 838182; PA1303, nucleotides 1414147 to1414686). The locus in which P. aeruginosa lepB is present has anarrangement similar to that of the equivalent locus in E. coli. Theonly difference from the lepA-lepB-rnc-era-recO-pdxJ gene se-quence present in E. coli is that immediately downstream of lepB inP. aeruginosa is a gene encoding a protein of unknown function(PA0769). However, the genes immediately up- and downstreamof PA1303 appear to be a novel combination of genes flanking aGram-negative SPase; PA1302 and PA1304 are annotated as aprobable heme utilization protein precursor and a probable oligo-peptidase, respectively (http://www.Pseudomonas.com).

Although both LepB and PA1303 contain the SPase catalyticSer/Lys dyad (LepB, S90 and K145; PA1303, S40 and K83), theprotein LepB is much larger (LepB, 284 amino acids, predictedmolecular weight, 32,103; PA1303, 179 amino acids, predictedmolecular weight, 20,067) and is similar in size to the LepB proteinof E. coli (323 amino acids; molecular weight, 35,988), whileSPases of approximately 20 kDa are more commonly found inGram-positive organisms. An alignment of the amino acid se-quences of LepB and PA1303 shows that the two proteins have43.2% identity (58.9% similarity) (Fig. 1).

The topologies of both LepB and PA1303 were predicted usingtwo methods: Hidden Markov Model for TOpology Prediction(HMMTOP) software (65, 66) and the dense alignment surface(DAS) (transmembrane server) method (11). As expected for aGram-negative SPase, two transmembrane helices (amino acids[aa] 7 to 28 and aa 57 to 76, HMMTOP; aa 5 to 28 and aa 65 to 81,DAS) were identified for LepB using both prediction methods.However, only the DAS prediction method identified a singleshort transmembrane region for PA1303 (aa 6 to 14).

As the identification of an N-terminal transmembrane regionfor PA1303 was inconclusive using bioinformatics topology pre-diction methods, a subcellular location analysis was performed.For this study, PA1303 was introduced in trans into strain PAO1on plasmid pHERD26T-PA1303-HA. Plasmid pHERD26T-PA1303-HA carries the PA1303 gene with an HA tag (amino acidsequence, YPYDVPDYA) incorporated at the C terminus (to fa-cilitate detection by Western analysis) under the control of a PBAD

arabinose-inducible promoter. Total cell lysates obtained fromPAO1 pHERD26T-PA1303-HA and PAO1 pHERD26T (negativecontrol for background and cross-reactivity) grown overnight inLB broth with and without 1% arabinose were analyzed by West-ern blotting with anti-HA antibodies. This analysis showed thatthe anti-HA antibodies have no cross-reactivity with proteinsfrom PAO1 containing the empty vector (pHERD26T) and thatPA1303 (predicted molecular weight, 20,067) could be detectedonly in total cell lysates derived from PAO1 pHERD26T-PA1303-HA grown in LB broth containing 1% arabinose (datanot shown). Similar results were obtained using LB broth contain-ing 0.5% arabinose.

To investigate the subcellular localization of PA1303, PAO1pHERD26T-PA1303-HA cells grown overnight in LB broth con-taining 1% arabinose were separated into a soluble (cytoplasm/periplasm) fraction and membrane (inner and outer) fractions.When resolved by one-dimensional (1D) SDS-PAGE, different




http://jb.asm.org/

Dow

nloaded from

http://www.Pseudomonas.com

http://jb.asm.org

http://jb.asm.org/

protein profiles were obtained for each fraction, as expected (Fig.2A). A Western analysis using these fractions and anti-HA anti-bodies showed PA1303 to be located in the inner membrane (Fig.2B), which is a feature consistent with an SPase. Antibodies spe-

cific for XcpY (inner membrane) and RpoA (cytoplasmic) wereused as fractionation markers (Fig. 2B), while liquid chromatog-raphy (LC) MS-MS analysis of a band shown by 1D SDS-PAGE tobe prominent only in the outer membrane fraction identified

FIG 1 Alignment of PAO1 lepB and PA1303 amino acid sequences. The sequences were aligned using CLUSTAL X (1.83). Conserved boxes A to E (shaded) wereidentified using sequence alignments and the following consensus motifs, in which uppercase underlined letters denote absolutely conserved, uppercase lettersdenote conserved, and X denotes not conserved (box B, IPSGSMXPTLX; box C, RGDIVVFXXP; box D, YIKRXXGXPGDXV; and box E, VPXGXYFXMGDNRDNSXDSR) (12, 34). Box A is labeled as previously identified (34). The first transmembrane helix identified for LepB using two prediction methods (aa 7 to 28,HMMTOP; aa 5 to 28, DAS) and the single short transmembrane region identified for PA1303 (aa 6 to 14, DAS) are underlined. The catalytic serine and lysineresidues are boxed. Identical residues are also indicated (asterisks), as are conserved residues (colons).

FIG 2 Subcellular localization of PA1303 in P. aeruginosa. Total cell (TC), soluble (S), inner membrane (IM), and outer membrane (OM) fractions from PAO1harboring pHERD26T-PA1303-HA (PAO1 pHERD26T-PA1303-HA) grown overnight in LB broth containing 1% arabinose were used. (A) Fractions resolvedon a Nu-PAGE 4 to 12% Bis-Tris gel (Life Technologies) and stained with Brilliant Blue G colloidal concentrate (Sigma). LC MS-MS analysis of a band onlyprominent in the outer membrane fraction (indicated by the arrow) identified OprF (14 unique peptides were detected, giving 47% coverage of OprF), an OMfraction marker. (B) Localization of PA1303 through immunoblotting of fractions with antibody specific for HA (detection of PA1303), XcpY (inner membranemarker), and RpoA (cytoplasmic marker).

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

OprF (37 kDa; 14 unique peptides; 47% coverage), which is acommon marker for this fraction (Fig. 2A).

SPases possess five regions of significant sequence homologyreferred to as boxes A to E. Box A is a transmembrane region, andboxes B to E (box B and D contain the catalytic serine and lysineresidues, respectively) all lie near the signal peptidase active siteand are part of the catalytic SPase protein fold (12, 43). Both LepBand PA1303 possess all the boxes of the catalytic region (boxes B toE), while the presence of box A is clear only for LepB (Fig. 1),which, similar to other Gram-negative SPases, corresponds to thesecond transmembrane helix identified by HMMTOP.

In order to determine whether both lepB and PA1303 are ex-pressed, an RT-PCR analysis was performed. LepB and PA1303transcripts were detected in RNA extracted from P. aeruginosaPAO1 cells grown to both logarithmic and stationary phases inplanktonic culture (Fig. 3).

Intra- and interspecies comparisons of LepB and PA1303.When the amino acid sequences of strain PAO1 LepB and PA1303were compared with their orthologues in the six sequenced ge-nomes at http://www.Pseudomonas.com for which these loci arecomplete (PA14, 2192, PA7, PACS2, LESB58, and 39016), at least98.9% and 96% sequence identity was found for LepB andPA1303, respectively, showing that both proteins are highly con-served among different sequenced P. aeruginosa isolates.

A BLASTP search of the sequenced members of the familyPseudomonadaceae (P. fluorescens SBW25, Pf0-1 and Pf-5; Pseu-domonas putida W619, F1, GB-1, and KT2440; Pseudomonas fulva12-X; Pseudomonas syringae pv. syringae B728a; P. syringae pv.phaseolicola 1448A; Pseudomonas stutzeri A1501; Pseudomonasentomophila L48; P. syringae pv. tomato strain DC3000; Pseu-domonas brassicacearum subsp. brassicacearum NFM421; andPseudomonas mendocina ymp and NK-01 [http://www.Pseudomonas.com]) using the P. aeruginosa PAO1 LepB aminoacid sequence also revealed orthologues with high sequence sim-ilarity (�78.17% sequence identity; E values � 2.0E�120) (Table2) harbored within similar genetic loci (i.e., with the lepA-lepB-rnc-era-recO-pdxJ arrangement of genes).

In contrast to the LepB analysis, a BLASTP search using thePA1303 amino acid sequence revealed much lower sequence iden-tities (38.16 to 48.89%; E values, 6.0E�23 to 4.0E�41) (Table 2)with SPases from these related organisms. Therefore, these datashow that P. aeruginosa LepB has more evolutionary conservation

in this family. Interestingly, this analysis also revealed that only P.mendocina NK-01 and P. fluorescens SBW25 possess an additionalSPase, annotated as MDS_1606 (33% identity to LepB, E value4.0E�19; 49% identity to PA1303, E value 4.0E�41) andPFLU0154 (33% identity to LepB, E value 2.0E�14; 38% identityto PA1303, E value 6.0E�23), respectively (Table 2).

Overproduction and purification of LepB and PA1303. Full-length PA1303 and truncated LepB (�2-76, LepB lacking N-ter-minal transmembrane regions) proteins were overexpressed in E.coli Rosetta(DE3)pLysS using the pET system, and purificationwas facilitated through His tags present at the N termini of bothproteins. Both LepB and PA1303 were induced by IPTG and wereobserved with apparent molecular masses of 26 and 22 kDa, re-spectively, on Coomassie-stained SDS-PAGE (Fig. 4A and B).

In vitro activity of purified LepB and PA1303. The recombi-nant LepB protein generated under native conditions (Fig. 4A andB) was screened for enzymatic activity using FRET technology, anapproach that has previously been successfully used to assess the invitro activity of SPases of Staphylococcus epidermidis and S. aureus(4, 48). For this assay, an internally quenched fluorescent peptidesubstrate based on the signal peptide sequence cleavage region ofthe P. aeruginosa elastase (LasB) preproenzyme was used. Thesignal peptide of elastase (LasB) was chosen, as it is a well-charac-terized secreted virulence factor of P. aeruginosa that has a signalpeptide cleavage site that has been experimentally identified as the

TABLE 2 Amino acid sequence identity of orthologues of LepB andPA1303 found within the genomes of sequenced members of the familyPseudomonadaceae

Pseudomonas species

LepB PA1303

%a E value %a E value

P. fluorescensSBW25 82.69b 6.00E�140 38.17b 5.00E�27

33.0c 2.0E�14 38.16c 6.00E�23Pf0-1 83.39 3.00E�136 40.54 4.00E�28Pf-5 82.33 6.00E�134 40.54 4.00E�28

P. putidaW619 81.34 2.00E�136 40.54 3.00E�29F1 82.04 6.00E�136 41.08 9.00E�29GB-1 81.69 6.00E�136 40 1.00E�28KT2440 81.69 1.00E�135 41.08 8.00E�29

P. fulva 12-X 82.04 4.00E�139 37.36 3.00E�28P. syringae pv. syringae B728a 81.63 2.00E�138 41.21 1.00E�27P. syringae pv. phaseolicola

1448A81.27 8.00E�138 40.66 1.00E�27

P. stutzeri A1501 81.69 2.00E�137 41.21 2.00E�28P. entomophila L48 81.69 6.00E�137 39.46 5.00E�28P. syringae pv. tomato

DC300080.57 8.00E�137 40.66 5.00E�28

P. brassicacearum subsp.brassicacearum NFM421

83.75 9.00E�137 41.08 2.00E�28

P. mendocinaymp 79.23 2.00E�126 39.01 4.00E�28NK-01 78.17b 2.00E�120 38.92b 5.00E�28

32.51c 4.0E�19 48.89c 4.00E�41a Percent amino acid sequence identity obtained using a BLASTP search(http://www.Pseudomonas.com).b Orthologue 1.c Orthologue 2.

FIG 3 Gene expression analysis by RT-PCR. Lanes 1 to 4, PA1303-specificprimers used; lanes 5 to 8, lepB-specific primers used. �, reverse transcriptaseadded; �, no reverse transcriptase control included to exclude possible con-tamination of the RNA sample by chromosomal DNA. Shown are planktonic-culture RNA samples; L, logarithmic phase; S, stationary phase.




http://jb.asm.org/

Dow

nloaded from




http://jb.asm.org

http://jb.asm.org/

peptide bond between the alanine residues at positions 23 and 24relative to the N-terminal methionine (29). Thus, the peptide sub-strate (Dabcyl)VSPAAFAADL(EDANS) was designed to span 10amino acids of the LasB signal peptide cleavage region, with ala-nine residues 7 and 8 corresponding to positions 23 and 24 of thepreproenzyme. Dose-dependent cleavage of this peptide by re-combinant P. aeruginosa LepB enzyme (0.5, 1.0, and 1.5 �M) inbuffer containing 0.25% Triton X-100 was observed through theemission of fluorescence, which confirmed the enzymatic activityof this recombinant protein (Fig. 5A). As the yield of recombinantPA1303 protein was low during purification (Fig. 4B), the maxi-mum concentration of the enzyme that could be used in the FRET

assay was 0.5 �M. Recombinant PA1303 was also found to beactive in the assay, and using buffer containing 0.5% TritonX-100, fluorescence emitted through cleavage of the FRET peptidewith 0.5 �M PA1303 was found to be higher than that obtainedusing the highest concentration of LepB recombinant protein (1.5�M) (Fig. 5B).

MALDI-TOF MS analysis of FRET peptide substrate cleavageby recombinant PA1303 protein. FRET peptide was treated withrecombinant PA1303 enzyme, and the hydrolysis products wereanalyzed by MALDI-TOF MS in order to determine the site ofcleavage. The FRET peptide gave a signal at m/z 1,462 (Fig. 6A),which is consistent with the predicted molar weight. An identicalmass spectrometry profile was obtained for FRET peptide dilutedin distilled water (data not shown). After 6 h of incubation at 37°Cwith recombinant enzyme PA1303, the peak at m/z 1,462 and twoadditional signals at m/z 557 and m/z 913 were observed (Fig. 6B).The last two signals are consistent with SPase activity, whichwould cleave the FRET peptide between Ala residues 7 and 8 andthus would yield products of approximately m/z 566 and m/z 913.During the MALDI-TOF MS of the FRET peptide, we observed anadditional signal at m/z 1,329 (Fig. 6A), which differs from the m/zof the FRET peptide (m/z 1,462) by 133 m/z mass units. During theanalysis of products of the enzyme reaction, we observed a peak atm/z 780 (Fig. 6B and C), which differs from the peak at m/z 913 by133 mass units. We believe the peak at m/z 1,329 is a contaminant/shortened FRET peptide produced during synthesis that is never-theless cleaved by the recombinant PA1303 enzyme to yield twopeaks at m/z 557 and m/z 780. After overnight incubation (15 h) at37°C, no signals of FRET peptide at m/z 1,462 were observed (in-dicating complete digestion), whereas the signals at m/z 557 andm/z 913 were present (Fig. 6C).

LepB is essential for viability. In order to determine the phe-notypic effect of a deletion mutation in lepB, a lepB gene replace-ment plasmid (pEX100T�lepB) was constructed. This plasmidcontains PAO1 lepB and flanking regions with 698 bp of the855-bp lepB gene removed (amino acids 18 to 252 are deleted) andreplaced by a gentamicin cassette. This deletion removes the fivesignal peptidase conserved regions (boxes A to E), which includethe catalytic dyad. Attempts to obtain a lepB deletion mutant using

FIG 4 Purification of P. aeruginosa LepB (A) and PA1303 (B) under nativeconditions. Lane 1, lysed cells; lane 2, cell debris removed by centrifugation;lane 3, soluble fraction after centrifugation; lane 4, removal of unbound ma-terial—flowthrough; lane 5, wash fraction; lanes 6 to 9, eluted purified recom-binant protein.

FIG 5 Detection of in vitro activity of recombinant LepB and PA1303 protein using fluorescence spectroscopy. (A and B) Cleavage of the LasB FRET decapeptide(20 �M) by recombinant enzyme, resulting in fluorescence emission. LepB, 0.5 (diamonds), 1.0 (squares), and 1.5 (triangles) �M; PA1303, 0.5 �M (broken line,diamonds). The buffer conditions used were 50 mM Tris-HCl, pH 7.5, containing 0.25% Triton X-100 (A) and 0.5% Triton X-100 (B). FI, fluorescence intensity.A no-enzyme control was also performed, and the background values were subtracted from test samples. (A) Average background control units subtracted fromeach test replicate at time zero and 15 and 30 min were 1,162, 1,191, and 1,155 FI units, respectively. (B) Average background control units subtracted from eachtest replicate at time zero and 15, 30, and 60 min were 1,336, 1,330, 1,324, and 1,282 FI units, respectively. The error bars show the standard deviations of threereplicates.

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

standard gene replacement methodology were unsuccessful (56).During the gene replacement process, plasmid pEX100T�lepBwas found to successfully integrate into the PAO1 genome to forma merodiploid strain, but excision of this plasmid to yield an in-activated LepB was found not to occur. However, colonies con-taining a chromosomal deletion in lepB were generated if the genewas provided in trans on plasmid pUCP26-lepB by transforma-tion of merodiploid strains during the mutagenesis procedure.The production of a chromosomal lepB deletion mutation wasconfirmed using PCR primers lepBseqfor and lepBseqrev, whichamplified the expected product of 2,106 bp, and the presence ofthe inserted gentamicin cassette was confirmed by digestion withtwo different restriction endonucleases. The presence of an intactcopy of lepB in trans (pUCP26lepB) was confirmed by purifyingplasmid DNA and digesting it with two different restriction endo-nucleases. Therefore, these data suggest that a functional lepB isessential for viability, and this is consistent with previous studiesthat have shown that chromosomal mutations can be made inessential genes of P. aeruginosa when a wild-type copy is providedin trans (17, 75).

PA1303 is not essential for viability in vitro. Unlike lepB, wefound that by using a standard mutagenesis procedure for P.aeruginosa we could generate PA1303 chromosomal deletion mu-tants in the absence of expression in trans. The mutants con-structed had 456 bp of the PAO1 chromosomal PA1303 gene re-moved (this deletes amino acids 2 to 153) and replaced by a

gentamicin resistance cassette. This deletion removes the fourSPase conserved catalytic regions of PA1303 (boxes B to E). Thegeneration of these mutants shows that, unlike LepB, PA1303 isnot essential for viability in vitro. In addition, when growth as aplanktonic culture was evaluated, similar growth rates were ob-served for the PA1303 mutant and the wild-type organism, andwhen stationary-phase cells were evaluated by TEM, no obviouschanges in cell morphology were found to be induced through themutation (data not shown).

Proteomic studies show that a chromosomal deletion muta-tion in PA1303 leads to the increased secretion of extracellularproteins. 2D gel electrophoresis of extracellular proteins preparedfrom wild-type P. aeruginosa strain PAO1 and isogenic PA1303chromosomal deletion mutant stationary-phase cultures was per-formed using Immobiline Dry IPG strips in the pH range 3 to 11(nonlinear) essentially according to the instructions of the manu-facturer (GE Healthcare) (Fig. 7). Ten spots with obviously higherintensity in the PA1303 mutant extracellular fraction were ana-lyzed by peptide mass fingerprinting using MALDI-TOF and/orQ-TOF MS-MS. Significant matches with the complete translatedORFs for the sequenced P. aeruginosa strain PAO1 were obtainedfor 9 out of 10 spots (Table 3). Six spots were identified as extra-cellular proteins: spot M-C, alkaline protease (AprA); spot M-D,aminopeptidase PA2939; spot M-G, LasB elastase PA3724; andspots M-F, M-H, and M-I, identified as the chitin-binding proteinPA0852. All four identified proteins are commonly secreted by P.

FIG 6 MALDI-TOF MS of cleavage of FRET peptide by recombinant PA1303. (A) FRET peptide (20 �M) in 50 mM Tris-HCl, pH 8.0 (assay buffer), incubatedfor 15 h at 37°C. (B and C) FRET peptide (20 �M) was incubated with recombinant 0.5 �M PA1303 in assay buffer for 6 h (B) and 15 h (C) at 37°C. The m/z atwhich major peaks occur are labeled.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

aeruginosa (42), with both AprA and LasB elastases possessingactive roles in pathogenesis, including working in synergy to in-terfere with the host defense (46). In addition, LasB, together withthe LasA protease, degrades elastin, a major structural componentof human lung tissue and blood vessels (18, 68).

Of the three remaining spots, one was shown to contain a cy-toplasmic component and a surface component (spot M-A;GroEL PA4385 and FliC PA1092), while two spots were identifiedas surface components (spot M-E, outer membrane proteinOprD; spot M-J, flagellar capping protein FliD). The presence of

FIG 7 Two-dimensional electrophoresis of extracellular proteins of PAO1 (A) and PA1303 mutant (�PA1303) (B). Samples were prepared as described in thetext. Isoelectric focusing with immobilized pH gradients (IPG strips) in the IPGphor Isoelectric Focusing System (GE Healthcare) was carried out according tothe manufacturer’s instructions using 13-cm IPG strips in the range pH 3 to 11 (nonlinear), followed by SDS-PAGE in 12.5% acrylamide gels and staining withcolloidal Coomassie brilliant blue. Protein spots with obviously greater intensity in the extracellular fraction of the PA1303 mutant (arrows, MA to MJ) were cutout from the gel, digested with trypsin, and subjected to peptide mass fingerprinting by MALDI-TOF MS and Q-TOF MS-MS in certain cases, as described in thetext. The molecular masses of marker proteins are indicated.

TABLE 3 Identification of proteins in spots of greater intensity in PA1303 mutant culture supernatant

Spot ID PA no. Gene Protein identification

No. ofpeptidesmatched % Coverage

MOWSEscoree

Predictedtotal mass(Da)c pIc

Signalsequence

PA1303mutant/WT ratiod

M-A PA4385 groEL GroEL protein (60-kDa chaperonin)a 28 27 792 57,085 4.76 No 4.15PA2939 PA2939 Probable aminopeptidasea 12 22 606 57,511 4.76 YesPA1092 fliC Flagellin type Ba 8 18 552 49,242 5.18 No

M-B No significant hits 23.21M-C PA1249 aprA Alkaline protease (AprA)b 12 51 125 50,432 4.09 No 3.14

PA1249 aprA Alkaline protease (AprA)a 63 39 891 50,432 4.09 NoM-D PA2939 PA2939 Probable aminopeptidaseb 14 41 159 57,511 4.76 Yes 4.59

Probable aminopeptidasea 43 44 1301 57,511 4.76 YesM-E PA0958 oprD Outer membrane porin proteina 10 19 396 48,360 4.75 Yes 6.06M-F PA0852 cbpD Chitin-binding proteina 27 41 573 41,917 6.85 Yes 3.47M-G PA3724 lasB Elastase LasBb 16 55 145 53,687 6.74 Yes 2.39

PA3724 lasB Elastase LasBa 52 50 870 53,687 6.74 YesM-H PA0852 cbpD Chitin-binding proteina 18 20 379 41,917 6.85 Yes 6.23M-I PA0852 cbpD Chitin-binding proteina 13 16 280 41,917 6.85 Yes 6.37M-J PA1094 fliD Flagellar capping protein; FliDb 11 33 80 49,449 7.07 No 1.83

PA1094 fliD Flagellar capping protein; FliDa 66 30 871 49,449 7.07 Noa Identified by Q-TOF MS-MS.b Identified by MALDI-TOF MS.c Values obtained from http://cmr.jcvi.org.d Proteins matched between the PA1303 mutant and the WT organism and the ratio of normalized spot volume calculated using Image Master 2D Elite v3.1 software fromAmersham Pharmacia Biotech. Spots M-A, M-B, M-H, M-I, and M-E were not identified among the proteins derived from the WT organism; therefore, the values quoted are thenormalized volumes of these spots derived from the PA1303 mutant.e Calculated by MS-Fit using peptide mass fingerprint data.

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

surface components, such as OprD and flagellin proteins, withinthe extracellular fraction could be a result of degradation either byelastase or naturally by protein turnover during the bacterialgrowth cycle, as suggested previously (42), while the presence ofGroEL could be a result of cellular lysis of a fraction of the bacterialpopulation. In addition, the identification of flagellar componentscould also be due to shedding of these filaments during cell cul-ture.

Deletion of PA1303 affects multiple phenotypes. Given theproteomic identification of the LasB elastase, one of the majorvirulence factors of P. aeruginosa, as an abundant extracellularprotein of the PA1303 mutant, we next chose to perform a moredetailed analysis of elastase activity produced by the mutant usingelastin nutrient agar plates and the quantitative ECR assay. Both P.aeruginosa elastases (LasA and LasB) contribute to elastolysis onelastin nutrient agar plates, while the LasB elastase cleaves elastinin the ECR assay, and LasA augments this activity (63). In agree-ment with the proteomic data, increased elastinolytic activity wasdetected for the PA1303 mutant using both methods of detection(Fig. 8A and B). We also found that the elastase activity producedby the PA1303 mutant could be reduced when PA1303 was pro-vided in trans on plasmid pHERD26T (Fig. 8A and B). However,

the results in Fig. 8A and B were generated in the absence of arabi-nose and thus show that the basal transcription of PA1303 fromthe PBAD promoter is enough to alter this phenotype of thePA1303 mutant. This phenomenon has been observed in the com-plementation of an efflux pump mutation in Burkholderia pseu-domallei using a similar pHERD vector (pHERD30T) (47). In ad-dition, a further reduction in elastase activity was observed for thecomplemented PA1303 mutant when 1% arabinose was added tothe medium (Fig. 8C).

We also investigated whether other important virulence-asso-ciated traits and factors were affected by a mutation in PA1303. P.aeruginosa is capable of surface translocation through swimming,swarming, and twitching motility. In the case of swarming motil-ity, bacteria migrate as defined groups (tendrils) on semisolid sur-faces (8). Interestingly, we found that the mutation in PA1303 ledto a hyperswarmer phenotype, with tendrils covering much moreof the semisolid agar surface than the wild-type organism afterincubation at both 30 and 37°C (Fig. 9A and B). Indeed, at 37°C,the PA1303 mutant had covered the whole plate. The hyper-swarmer phenotype was found to be reversed when PA1303 wasexpressed in trans on plasmid pHERD26T-PA1303 (Fig. 9A andB). In contrast to the swarming motility observations, the PA1303

FIG 8 Mutation of PA1303 in PAO1 results in increased elastase activity. PAO1, wild-type organism; �PA1303, PA1303 deletion mutant; �PA1303 pHERD26T,PA1303 deletion mutant containing empty vector pHERD26T; �PA1303 pHERD26T-PA1303, PA1303 deletion mutant containing PA1303 in trans(pHERD26T-PA1303). (A) Elastase activity detected using elastin-nutrient agar. (B) Elastase activity in LB broth detected using ECR. (C) Elastase activity in LBbroth containing 1% arabinose detected using ECR. Standard deviations of triplicate cultures are shown.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

mutant showed swimming and twitching motility phenotypessimilar to that of the wild-type organism under the conditionsused (results not shown).

Swarming motility is known to require propulsion using a po-lar flagellum and also the surfactant rhamnolipid, which reducesfriction between the cell and a semisolid surface for swarmingmotility (30). Therefore, we postulated that increased rhamno-lipid production could be responsible for the observed increase inswarming motility. Indeed, using indicator agar plates in which ahalo is produced when a cationic dye (methylene blue) present inthe medium is precipitated by an anionic surfactant, such asrhamnolipid, we observed that the PA1303 deletion mutant pro-duced a larger halo than the wild-type organism (Fig. 10A). Inaddition, the halo surrounding the complemented PA1303 mu-tant (�PA1303 pHERD26T-PA1303) was found to be smallerthan that produced by the PA1303 mutant with and withoutempty vector (�PA1303 and �PA1303 pHERD26T) (Fig. 10A).Thus, this is also evidence of the increased production of anothervirulence factor, as rhamnolipid is associated with a number ofbiological activities, including inactivation of tracheal cilia ofmammalian cells and solubilization of lung surfactant phospho-lipids, which facilitates their cleavage by phospholipase C (25, 32).It is also involved in the maintenance of biofilm architecture andbiofilm dispersal (6, 14).

Another noticeable difference between the WT and the PA1303mutant was the amount of pigmentation on PIA, which is formu-lated to enhance pyocyanin production. On this agar, the PA1303mutant was found to be less pigmented than the wild-type organ-ism (Fig. 10B). Interestingly, however, the PA1303 mutant ap-peared to be more pigmented on elastin-nutrient (Fig. 8A) andswarming agar (Fig. 9B) at 37°C than the wild-type strain. Thus, itappears that the role of PA1303 in the secretion of pyocyanin isdependent on culture conditions. This is not the first observationof culture condition-dependent activation and repression of pyo-

cyanin production, as a P. aeruginosa vfr mutant has been shownto produce increased and decreased amounts of pyocyanin onPIA and LB agar, respectively, compared to the wild-type organ-ism (2).

Deletion of PA1303 alters the QS cascade. It is well establishedthat many P. aeruginosa virulence factors are regulated in a celldensity-dependent manner by the LasR-LasI and RhlR-RhlI QSsystems, which use AHLs as signaling molecules. As mutation ofPA1303 was shown to influence several quorum-sensing-con-trolled phenotypic traits (elastinolytic activity, pyocyanin andrhamnolipid production, and swarming motility), we used theAHL reporter plasmids pSB1075 and pSB536 to detect the signalssynthesized by the products of the lasI and rhlI genes (3-oxo-C12-HSL and C4-HSL, respectively) to determine whether the changesin these multiple phenotypes were due to an alteration in AHLlevels. These bioassays showed that the levels of 3-oxo-C12-HSLwere similar in exponential and stationary-phase cultures of theWT organism and the PA1303 mutant (Fig. 10C), while the levelof C4-HSL was found to be increased by 3.4- and 1.7-fold in thePA1303 mutant in exponential- and stationary-phase cultures, re-spectively (Fig. 10D). Thus, a mutation in PA1303 was found toaffect the level of production of the signaling molecule (C4-HSL)of the RhlR-RhlI QS system but not the signaling molecule (3-oxo-C12-HSL) of the LasR-LasI system.

DISCUSSION

In this study, we carried out a molecular characterization of thetwo P. aeruginosa SPases (LepB and PA1303). We showed thatrecombinant protein generated for both paralogues was active andexamined their inter- and intraspecies genomic distribution, theirphysical properties and gene expression, and the consequences oftheir mutation.

LepB was shown to have features similar to those of the proto-type SPase, E. coli LepB: a similar genetic locus organization, a

FIG 9 Mutation of PA1303 in PAO1 results in a hyperswarmer phenotype. Shown are swarming motility plates incubated at 30°C (A) and 37°C (B). PAO1,wild-type organism; �PA1303, PA1303 mutant; �PA1303 pHERD26T, PA1303 mutant containing empty vector pHERD26T; �PA1303 pHERD26T-PA1303,PA1303 mutant containing PA1303 in trans (pHERD26T-PA1303).

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

similar topology (two transmembrane helices), the five regions ofsignificant sequence homology (boxes A to E) that contain thecatalytic Ser/Lys dyad associated with SPase activity, and a similarsize. In addition, we found that LepB is essential for viability and ishighly conserved among all pseudomonads. Previously, we gener-ated transcriptomic data sets that profiled global gene expressionof P. aeruginosa as (i) a surface-associated community (biofilm)grown under aerobic conditions and as a free-living (planktonic)culture and (ii) an anaerobic biofilm (72–74). When the values forLepB were observed in these data sets, it was found to be expressedunder all conditions (planktonic culture, logarithmic and station-ary phases; biofilms, developing, mature, and anaerobic), with thehighest expression levels found in actively growing cells (logarith-mic-phase planktonic culture and the developing biofilms sam-pled at 8 h) (data not shown). This information suggests an activerole for the protease in both the planktonic and biofilm modes ofgrowth. Therefore, our genomic, transcriptomic, and phenotypicevidence strongly suggests that LepB is the primary signal pepti-dase of P. aeruginosa.

The role of PA1303, however, is at present less clear. Althoughit possesses the four conserved boxes associated with the catalyticactivity of SPases (boxes B to E) and was detected in the innermembrane fraction in the subcellular localization analysis (Fig.2B), the predicted molecular weight of PA1303 (20,067) is verysmall for an SPase of Gram-negative bacteria and is a size moreassociated with SPases of Gram-positive bacteria (43). PA1303also displays much lower sequence similarity (38 to 49%) than

LepB (�78%) with orthologues found in other pseudomonads(Table 2). Although the RT-PCR analysis in this study showed thatPA1303 is expressed in planktonic culture (logarithmic and sta-tionary phases), expression of PA1303 was barely detectable bymicroarray probes under all conditions in our previously gener-ated transcriptomic biofilm and planktonic data sets (72–74). Apossible explanation for the inconsistency between this study andprevious studies could be that expression of PA1303 was below thethreshold of detection by microarray analysis, due to the fact thatweaker medium was used for the microarray study (1/5-strengthLB medium) than for the RT-PCR analysis (full-strength LB me-dium). Although we know that PA1303 is expressed at least inplanktonic culture, the observation that deletion mutants inPA1303 could be easily obtained shows that it is dispensable andits physiological role is not essential to the viability of P. aeruginosain vitro. However, our studies showed that PA1303 has an impor-tant role in the control of virulence and virulence-associated phe-notypes of this important opportunistic pathogen.

In species with multiple functional SPases, the individual en-zymes are usually not essential for viability, and although they candiffer in their contributions to the process of secretion, this sug-gests that they can at least partly complement each other (21, 69).Overlapping substrate specificities between different SPases havebeen commonly observed in Gram-positive bacteria with multipleSPases, while the efficiency of preprotein processing of individualSPases within an organism is known to vary (20, 21, 62). A goodillustration of a pathogen that has SPases with distinct activities is

FIG 10 Mutation of PA1303 in PAO1 results in increased rhamnolipid production, decreased pigmentation on PIA, and an increase in production of C4-HSL.PAO1, wild-type organism; �PA1303, PA1303 mutant; �PA1303 pHERD26T, PA1303 mutant containing empty vector pHERD26T; �PA1303 pHERD26T-PA1303, PA1303 mutant containing PA1303 in trans (pHERD26T-PA1303). (A) Rhamnolipid production was detected through precipitation of CTAB and haloformation on agar plates using a method described previously (8). (B) Growth and pigmentation after overnight growth (37°C) on PIA. (C and D) Detection ofAHL production in exponential-phase (shaded bars) and stationary-phase (white bars) cultures using reporter plasmids pSB1075 for 3-oxo-C12-HSL (C) andpSB536 for C4-HSL (D). RLU, relative light units (test minus no-supernatant plasmid controls) after 6 h (C) and 4 h (D) of incubation at 30°C. Standarddeviations of triplicate cultures are shown.




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

L. monocytogenes, which possesses three contiguous SPases (SipX,SipY, and SipZ) (7). Bonnemain et al. found that SipX was notessential for bacterial growth but played a role in virulence; inac-tivation of sipY had no detectable effect, while SipZ was found tobe the dominant SPase, being required for normal growth, effi-cient protein secretion, intracellular survival, and virulence. It islogical to hypothesize that the insertional inactivation of a nones-sential SPase would be detrimental to the secretory capacity of anorganism. This was observed in the L. monocytogenes study, wherea mutant expressing only SipX showed reduced secretion of viru-lence factors (listeriolysin O and phosphatidylcholine phospho-lipase C), and a reduced secretory capacity has been observed in anS. lividans sipY mutant (7, 45). However, it has also been demon-strated that the insertional inactivation of a nonessential SPase canimprove the processing of a preprotein substrate. For example, inB. subtilis, whose multiple SPases have overlapping substrate spec-ificities, the deletion of the SipS or SipU SPase leads to more effi-cient cleavage of the -amylase preprotein substrate (62). There-fore, the observed phenotypic changes found in the PA1303mutant could be the result of decreased or more efficient process-ing of preprotein(s) in the absence of the PA1303 protease.

In this study, we show that both recombinant LepB andPA1303 can process a FRET decapeptide substrate based on thesignal peptide cleavage region of LasB (Fig. 5A and B). This is incontrast to S. aureus, where only one (SpsB) of its two paralogueshas been shown to have SPase activity (10, 28). We also show thatfluorescence generated through cleavage of the FRET peptide with0.5 �M recombinant PA1303 was approximately 4.5- to 7-foldhigher than that obtained with the same concentration of recom-binant LepB. However, although this result suggests that LepB andPA1303 have overlapping substrate specificities, further studiesmust be performed to determine whether this apparently moreefficient processing of the FRET decapeptide is due to the reactionconditions used (50 mM Tris-HCl, pH 7.5, 0.5% Triton X-100)favoring the recombinant PA1303 enzyme or whether the twoenzymes have different preferred substrates.

Four secreted P. aeruginosa proteins (LasB, AprA, aminopep-tidase PA2939, and CbpD) were all in greater abundance in theextracellular fraction of the PA1303 mutant (average ratios of nor-malized spot volume, 2.39, 3.14, 4.37, and 4.85, respectively) (Ta-ble 3), while swarming motility, rhamnolipid production, andelastinolytic activity were also found to be increased. As all fourproteins and rhamnolipid production are regulated through cell-cell signaling and AprA does not harbor a signal sequence and isnot translocated by the general secretory pathway, this suggestedthat an alteration in the QS cascade would also be a consequenceof chromosomal deletion of PA1303 and would be responsible forthe observed altered phenotypes. Using reporter plasmids to de-tect levels of 3-oxo-C12-HSL and C4-HSL in exponential- and sta-tionary-phase cultures, we did indeed observe an increase in thelevel of C4-HSL for the PA1303 mutant, but not in the level of3-oxo-C12-HSL (Fig. 10C and D). Control of QS is known to bemultilayered and hierarchical, with the Las system exerting con-trol over the Rhl system (35). In addition, quinolone signalingmolecules and a plethora of other transcriptional and posttran-scriptional regulators are integrated into the QS circuit (15, 70).Thus, our data suggest that the protein(s) that is targeted for pro-cessing by PA1303 is involved (directly or indirectly) in the con-trol of the RhlI-RhlR system. However, the exact molecular eventsthat lead to the observed phenotypic changes are at present un-

clear. Possible explanations are the enhanced cleavage of signalpeptides of a positive regulator(s) of the RhlI-RhlR system byLepB in the absence of PA1303 or that PA1303 has a specific role inthe cleavage of signal peptides of a negative regulator(s) of thissystem. The identification of substrate proteins that are cleaved byLepB and PA1303 (801 P. aeruginosa proteins are predicted topossess type 1 signal peptides) and the determination of the effi-ciency of these cleavage reactions will be key to understanding thephenotypes generated by a PA1303 mutation. A role for an SPasein QS has only previously been reported for S. aureus, where theSPase SpsB was shown to cleave the N-terminal leader of AgrD,which is the peptide precursor of the autoinducing peptide (AIP)(28).

As LepB appears to be essential for viability of P. aeruginosa, itis an attractive target for a protease inhibitor. The carboxy-termi-nal catalytic domains of Gram-negative SPases are present on theouter surface of the cytoplasmic membrane facing into theperiplasm and therefore would be accessible to any inhibitor thatcould traverse the outer membrane. SPases have been shown to beviable drug targets in other bacteria, with lipoglycopeptides show-ing antibacterial activity against E. coli and S. pneumoniae while S.epidermidis is sensitive to the related arylomycins (5, 31, 51). Un-fortunately, the type I SPase inhibitors identified to date have notshown antibacterial activity against P. aeruginosa. Recently how-ever, P. aeruginosa was rendered susceptible to the antibiotic ac-tivity of arylomycin derivatives through mutation of a resistance-conferring proline residue (P84) in LepB (50). This not onlysupports our observation that P. aeruginosa LepB is essential forviability, but also inspires confidence in the suitability of the pro-tease as a drug target. In addition, it emphasizes the need for newand more potent rationally designed synthetic type I SPase inhib-itors optimized for the highly conserved P. aeruginosa LepB cata-lytic region, which can bind regardless of the resistance-conferringproline residue.

ACKNOWLEDGMENTS

We thank Keith Pell for his technical assistance with the transmissionelectron microscopy. Peptide mass fingerprinting by MALDI-TOF MSand Q-TOF MS-MS was performed by MRC Clinical Sciences Centre(Imperial College Faculty of Medicine, London, United Kingdom). Pep-tide mass fingerprinting by LC MS-MS was performed by Steve Lynham(King’s College London). We thank Lori Burrows (University of Toronto)for pUCP20 and pUCP26, Steve Diggle (University of Nottingham) forplasmids pSB1075 and pSB536, F. Heath Damron and Hongwei Yu (Mar-shall University, WV) for supplying pHERD vectors, and Romé Voulhoux(CNRS-Aix Marseille University) for anti-XcpY antibodies. We also thankOlivier Marches (QMUL) for his help with the Western analysis.

This study was funded by a Barts and the London Trust research ad-ministration board (RAB) nonclinical fellowship.

REFERENCES1. Bairl A, Muller P. 1998. A second gene for type I signal peptidase in

Bradyrhizobium japonicum, sipF, is located near genes involved in RNAprocessing and cell division. Mol. Gen. Genet. 260:346 –356.

2. Beatson SA, Whitchurch CB, Sargent JL, Levesque RC, Mattick JS.2002. Differential regulation of twitching motility and elastase productionby Vfr in Pseudomonas aeruginosa. J. Bacteriol. 184:3605–3613.

3. Black MT, Bruton G. 1998. Inhibitors of bacterial signal peptidases. Curr.Pharm. Des. 4:133–154.

4. Bockstael K, et al. 2009. An easy and fast method for the evaluation ofStaphylococcus epidermidis type I signal peptidase inhibitors. J. Microbiol.Methods 78:231–237.

5. Bockstael K, et al. 2009. Evaluation of the type I signal peptidase as

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

antibacterial target for biofilm-associated infections of Staphylococcus epi-dermidis. Microbiology 155:3719 –3729.

6. Boles BR, Thoendel M, Singh PK. 2005. Rhamnolipids mediate detach-ment of Pseudomonas aeruginosa from biofilms. Mol. Microbiol. 57:1210 –1223.

7. Bonnemain C, et al. 2004. Differential roles of multiple signal peptidasesin the virulence of Listeria monocytogenes. Mol. Microbiol. 51:1251–1266.

8. Caiazza NC, Shanks RM, O’Toole GA. 2005. Rhamnolipids modulateswarming motility patterns of Pseudomonas aeruginosa. J. Bacteriol. 187:7351–7361.

9. Chaddock AM, et al. 1995. A new type of signal peptide: central role of atwin-arginine motif in transfer signals for the delta pH-dependent thyla-koidal protein translocase. EMBO J. 14:2715–2722.

10. Cregg KM, Wilding I, Black MT. 1996. Molecular cloning and expressionof the spsB gene encoding an essential type I signal peptidase from Staph-ylococcus aureus. J. Bacteriol. 178:5712–5718.

11. Cserzo M, Wallin E, Simon I, von Heijne G, Elofsson A. 1997. Predic-tion of transmembrane alpha-helices in prokaryotic membrane proteins:the dense alignment surface method. Protein Eng. 10:673– 676.

12. Dalbey RE, Lively MO, Bron S, van Dijl JM. 1997. The chemistry andenzymology of the type I signal peptidases. Protein Sci. 6:1129 –1138.

13. Date T. 1983. Demonstration by a novel genetic technique that leaderpeptidase is an essential enzyme of Escherichia coli. J. Bacteriol. 154:76 – 83.

14. Davey ME, Caiazza NC, O’Toole GA. 2003. Rhamnolipid surfactantproduction affects biofilm architecture in Pseudomonas aeruginosa PAO1.J. Bacteriol. 185:1027–1036.

15. Diggle SP, et al. 2003. The Pseudomonas aeruginosa quinolone signalmolecule overcomes the cell density-dependency of the quorum sensinghierarchy, regulates rhl-dependent genes at the onset of stationary phaseand can be produced in the absence of LasR. Mol. Microbiol. 50:29 – 43.

16. Diver JM, Bryan LE, Sokol PA. 1990. Transformation of Pseudomonasaeruginosa by electroporation. Anal. Biochem. 189:75–79.

17. Finelli A, Gallant CV, Jarvi K, Burrows LL. 2003. Use of in-biofilmexpression technology to identify genes involved in Pseudomonas aerugi-nosa biofilm development. J. Bacteriol. 185:2700 –2710.

18. Galloway DR. 1991. Pseudomonas aeruginosa elastase and elastolysis re-visited: recent developments. Mol. Microbiol. 5:2315–2321.

19. Gerlach RG, Hensel M. 2007. Protein secretion systems and adhesins: themolecular armory of Gram-negative pathogens. Int. J. Med. Microbiol.297:401– 415.

20. Geukens N, Parro V, Rivas LA, Mellado RP, Anne J. 2001. Functionalanalysis of the Streptomyces lividans type I signal peptidases. Arch. Micro-biol. 176:377–380.

21. Geukens N, et al. 2006. Surface plasmon resonance-based interactionstudies reveal competition of Streptomyces lividans type I signal peptidasesfor binding preproteins. Microbiology 152:1441–1450.

22. Goodier RI, Ahmer BM. 2001. SirA orthologs affect both motility andvirulence. J. Bacteriol. 183:2249 –2258.

23. Gorg A, et al. 2000. The current state of two-dimensional electrophoresiswith immobilized pH gradients. Electrophoresis 21:1037–1053.

24. Gustin JK, Kessler E, Ohman DE. 1996. A substitution at His-120 in theLasA protease of Pseudomonas aeruginosa blocks enzymatic activity with-out affecting propeptide processing or extracellular secretion. J. Bacteriol.178:6608 – 6617.

25. Hastie AT, Hingley ST, Higgins ML, Kueppers F, Shryock T. 1986.Rhamnolipid from Pseudomonas aeruginosa inactivates mammalian tra-cheal ciliary axonemes. Cell Motil Cytoskeleton 6:502–509.

26. Hoang HH, et al. 2011. Outer membrane targeting of Pseudomonas aerugi-nosa proteins shows variable dependence on the components of Bam and Lolmachineries. MBio 2:e00246–11. doi:10.1128/mBio.00246-11.

27. Jacobs MA, et al. 2003. Comprehensive transposon mutant library ofPseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 100:14339 –14344.

28. Kavanaugh JS, Thoendel M, Horswill AR. 2007. A role for type I signalpeptidase in Staphylococcus aureus quorum sensing. Mol. Microbiol. 65:780 –798.

29. Kessler E, Safrin M, Peretz M, Burstein Y. 1992. Identification of cleav-age sites involved in proteolytic processing of Pseudomonas aeruginosapreproelastase. FEBS Lett. 299:291–293.

30. Kohler T, Curty LK, Barja F, van Delden C, Pechere JC. 2000. Swarmingof Pseudomonas aeruginosa is dependent on cell-to-cell signaling and re-quires flagella and pili. J. Bacteriol. 182:5990 –5996.

31. Kulanthaivel P, et al. 2004. Novel lipoglycopeptides as inhibitors of bac-terial signal peptidase I. J. Biol. Chem. 279:36250 –36258.

32. Kurioka S, Liu PV. 1967. Effect of the hemolysin of Pseudomonas aerugi-nosa on phosphatides and on phospholipase c activity. J. Bacteriol. 93:670 – 674.

33. Lambert PA. 2002. Mechanisms of antibiotic resistance in Pseudomonasaeruginosa. J. R. Soc. Med. 95(Suppl. 41):22–26.

34. Lammertyn E, et al. 2004. Molecular and functional characterization oftype I signal peptidase from Legionella pneumophila. Microbiology 150:1475–1483.

35. Latifi A, Foglino M, Tanaka K, Williams P, Lazdunski A. 1996. Ahierarchical quorum-sensing cascade in Pseudomonas aeruginosa links thetranscriptional activators LasR and RhIR (VsmR) to expression of thestationary-phase sigma factor RpoS. Mol. Microbiol. 21:1137–1146.

36. Lewenza S, Gardy JL, Brinkman FS, Hancock RE. 2005. Genome-wideidentification of Pseudomonas aeruginosa exported proteins using a con-sensus computational strategy combined with a laboratory-based PhoAfusion screen. Genome Res. 15:321–329.

37. Luo C, Roussel P, Dreier J, Page MG, Paetzel M. 2009. Crystallographicanalysis of bacterial signal peptidase in ternary complex with arylomycinA2 and a beta-sultam inhibitor. Biochemistry 48:8976 – 8984.

38. Muller P. 2004. Use of the multipurpose transposon Tn KPK2 for themutational analysis of chromosomal regions upstream and downstreamof the sipF gene in Bradyrhizobium japonicum. Mol. Genet. Genomics271:359 –366.

39. Muller P, Ahrens K, Keller T, Klaucke A. 1995. A TnphoA insertionwithin the Bradyrhizobium japonicum sipS gene, homologous to prokary-otic signal peptidases, results in extensive changes in the expression ofPBM-specific nodulins of infected soybean (Glycine max) cells. Mol. Mi-crobiol. 18:831– 840.

40. Neuhoff V, Arold N, Taube D, Ehrhardt W. 1988. Improved staining ofproteins in polyacrylamide gels including isoelectric focusing gels withclear background at nanogram sensitivity using Coomassie Brilliant BlueG-250 and R-250. Electrophoresis 9:255–262.

41. Nielsen H, Engelbrecht J, Brunak S, von Heijne G. 1997. Identificationof prokaryotic and eukaryotic signal peptides and prediction of theircleavage sites. Protein Eng. 10:1– 6.

42. Nouwens AS, Willcox MD, Walsh BJ, Cordwell SJ. 2002. Proteomiccomparison of membrane and extracellular proteins from invasive(PAO1) and cytotoxic (6206) strains of Pseudomonas aeruginosa. Pro-teomics 2:1325–1346.

43. Paetzel M, Dalbey RE, Strynadka NC. 2000. The structure and mecha-nism of bacterial type I signal peptidases. A novel antibiotic target. Phar-macol. Ther. 87:27– 49.

44. Paetzel M, Karla A, Strynadka NC, Dalbey RE. 2002. Signal peptidases.Chem. Rev. 102:4549 – 4580.

45. Palacin A, Parro V, Geukens N, Anne J, Mellado RP. 2002. SipY Is theStreptomyces lividans type I signal peptidase exerting a major effect onprotein secretion. J. Bacteriol. 184:4875– 4880.

46. Parmely M, Gale A, Clabaugh M, Horvat R, Zhou WW. 1990. Proteo-lytic inactivation of cytokines by Pseudomonas aeruginosa. Infect. Immun.58:3009 –3014.

47. Qiu D, Damron FH, Mima T, Schweizer HP, Yu HD. 2008. PBAD-basedshuttle vectors for functional analysis of toxic and highly regulated genesin Pseudomonas and Burkholderia spp. and other bacteria. Appl. Environ.Microbiol. 74:7422–7426.

48. Rao S, et al. 2009. Enzymatic investigation of the Staphylococcus aureustype I signal peptidase SpsB: implications for the search for novel antibi-otics. FEBS J. 276:3222–3234.

49. Rashid MH, Kornberg A. 2000. Inorganic polyphosphate is needed forswimming, swarming, and twitching motilities of Pseudomonas aerugi-nosa. Proc. Natl. Acad. Sci. U. S. A. 97:4885– 4890.

50. Roberts TC, Schallenberger MA, Liu J, Smith PA, Romesberg FE. 2011.Initial efforts toward the optimization of arylomycins for antibiotic activ-ity. J. Med. Chem. 54:4954 – 4963.

51. Roberts TC, Smith PA, Cirz RT, Romesberg FE. 2007. Structural andinitial biological analysis of synthetic arylomycin A2. J. Am. Chem. Soc.129:15830 –15838.

52. Rust L, Messing CR, Iglewski BH. 1994. Elastase assays. Methods Enzy-mol. 235:554 –562.

53. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a labora-tory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

54. Schweizer HD. 1993. Small broad-host-range gentamycin resistance gene




http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

cassettes for site-specific insertion and deletion mutagenesis. Biotech-niques 15:831– 834.

55. Schweizer HP. 1991. Escherichia-Pseudomonas shuttle vectors derivedfrom pUC18/19. Gene 97:109 –121.

56. Schweizer HP, Hoang TT. 1995. An improved system for gene replace-ment and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158:15–22.

57. Siegmund I, Wagner F. 1991. New method for detecting rhamnolipidsexcreted by Pseudomonas species during growth on mineral agar. Biotech-nol. Techniques 5:265–268.

58. Simon R, Priefer U, Pühler A. 1983. A broad host range mobilizationsystem for in-vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Biotechnology 1:784 –791.

59. Slaney JM, Gallagher A, Aduse-Opoku J, Pell K, Curtis MA. 2006.Mechanisms of resistance of Porphyromonas gingivalis to killing by serumcomplement. Infect. Immun. 74:5352–5361.

60. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW. 1990. Use of T7RNA polymerase to direct expression of cloned genes. Methods Enzymol.185:60 – 89.

61. Swift S, et al. 1997. Quorum sensing in Aeromonas hydrophila and Aero-monas salmonicida: identification of the LuxRI homologs AhyRI andAsaRI and their cognate N-acylhomoserine lactone signal molecules. J.Bacteriol. 179:5271–5281.

62. Tjalsma H, et al. 1997. Bacillus subtilis contains four closely related type Isignal peptidases with overlapping substrate specificities. Constitutive andtemporally controlled expression of different sip genes. J. Biol. Chem.272:25983–25992.

63. Toder DS, Ferrell SJ, Nezezon JL, Rust L, Iglewski BH. 1994. lasA andlasB genes of Pseudomonas aeruginosa: analysis of transcription and geneproduct activity. Infect. Immun. 62:1320 –1327.

64. Toder DS, Gambello MJ, Iglewski BH. 1991. Pseudomonas aeruginosaLasA: a second elastase under the transcriptional control of lasR. Mol.Microbiol. 5:2003–2010.

65. Tusnady GE, Simon I. 2001. The HMMTOP transmembrane topologyprediction server. Bioinformatics 17:849 – 850.

66. Tusnady GE, Simon I. 1998. Principles governing amino acid composi-tion of integral membrane proteins: application to topology prediction. J.Mol. Biol. 283:489 –506.

67. Tuteja R. 2005. Type I signal peptidase: an overview. Arch. Biochem.Biophys. 441:107–111.

68. Van Delden C, Iglewski BH. 1998. Cell-to-cell signaling and Pseudomo-nas aeruginosa infections. Emerg. Infect. Dis. 4:551–560.

69. van Roosmalen ML, et al. 2004. Type I signal peptidases of Gram-positivebacteria. Biochim. Biophys. Acta 1694:279 –297.

70. Venturi V, Rampioni G, Pongor S, Leoni L. 2011. The virtue of temper-ance: built-in negative regulators of quorum sensing in Pseudomonas.Mol. Microbiol. 82:1060 –1070

71. von Heijne G. 1989. The structure of signal peptides from bacterial lipo-proteins. Protein Eng. 2:531–534.

72. Waite RD, Curtis MA. 2009. Pseudomonas aeruginosa PAO1 pyocin pro-duction affects population dynamics within mixed-culture biofilms. J.Bacteriol. 191:1349 –1354.

73. Waite RD, et al. 2006. Clustering of Pseudomonas aeruginosa transcrip-tomes from planktonic cultures, developing and mature biofilms revealsdistinct expression profiles. BMC Genomics 7:162.

74. Waite RD, Papakonstantinopoulou A, Littler E, Curtis MA. 2005.Transcriptome analysis of Pseudomonas aeruginosa growth: comparisonof gene expression in planktonic cultures and developing and mature bio-films. J. Bacteriol. 187:6571– 6576.

75. Walsh AG, et al. 2000. Lipopolysaccharide core phosphates are requiredfor viability and intrinsic drug resistance in Pseudomonas aeruginosa. Mol.Microbiol. 35:718 –727.

76. West SE, Schweizer HP, Dall C, Sample AK, Runyen-Janecky LJ. 1994.Construction of improved Escherichia-Pseudomonas shuttle vectors de-rived from pUC18/19 and sequence of the region required for their repli-cation in Pseudomonas aeruginosa. Gene 148:81– 86.

77. Winson MK, et al. 1998. Construction and analysis of luxCDABE-basedplasmid sensors for investigating N-acyl homoserine lactone-mediatedquorum sensing. FEMS Microbiol. Lett. 163:185–192.

78. Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18and pUC19 vectors. Gene 33:103–119.

79. Zhang YB, Greenberg B, Lacks SA. 1997. Analysis of a Streptococcuspneumoniae gene encoding signal peptidase I and overproduction of theenzyme. Gene 194:249 –255.

80. Zhbanko M, Zinchenko V, Gutensohn M, Schierhorn A, Klosgen RB.2005. Inactivation of a predicted leader peptidase prevents photo-autotrophic growth of Synechocystis sp. strain PCC 6803. J. Bacteriol. 187:3071–3078.

Waite et al.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org

http://jb.asm.org/

pseudomonas aeruginosa possesses two putative type i ... · pseudomonas aeruginosa possesses two...

Documents