pure.knaw.nl · a/lvcol. res. 101 (2): 210—214 (1997) printed in great britain delineation of...

5

Upload: others

Post on 07-May-2020

1 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Page 1: pure.knaw.nl · A/lvcol. Res. 101 (2): 210—214 (1997) Printed in Great Britain Delineation of Cylindrocladium species with 1-3-septate conidia and clavate vesicles based on morphology

Page 2: pure.knaw.nl · A/lvcol. Res. 101 (2): 210—214 (1997) Printed in Great Britain Delineation of Cylindrocladium species with 1-3-septate conidia and clavate vesicles based on morphology

Page 3: pure.knaw.nl · A/lvcol. Res. 101 (2): 210—214 (1997) Printed in Great Britain Delineation of Cylindrocladium species with 1-3-septate conidia and clavate vesicles based on morphology

Page 4: pure.knaw.nl · A/lvcol. Res. 101 (2): 210—214 (1997) Printed in Great Britain Delineation of Cylindrocladium species with 1-3-septate conidia and clavate vesicles based on morphology

Page 5: pure.knaw.nl · A/lvcol. Res. 101 (2): 210—214 (1997) Printed in Great Britain Delineation of Cylindrocladium species with 1-3-septate conidia and clavate vesicles based on morphology

pure.knaw.nl · 2015-07-01 · oxygenase pathway of their substrate these agents are effective as anti—inflammatory drugs (fig. 1). ... keratitis was studied. The lipoxygenase inhibitors

pure.knaw.nl · Netherlands Central Institute for Brain Research, Amsterdam-O, The Netherlands With 6 Figures ... or bastards, Centr. Lab. of the Neth. Red Cross Blood Transfusion

pure.knaw.nl · contusio cerebri, lung embolism bronchopneunomia medullar mamma- carcinoma, multiple cerebral and meningeal metastases polymyalgia rheumatica; endocarditis; mitralis-

pure.knaw.nl · 2 Department of Plant Pathology, University of Tsukuba, Tennodai, Tsukuba, Ibaraki, 305, Japan 3 Department of Plant Pathology, University of Stellenbosch, Shellenbosch,

pure.knaw.nl fileof cells into the right developmental pathway. During lymphoid development, ... this results in intra- uterine death of the developing ... fetal liver cells can be

Morphological analysis, phylogenies and classification in ... · B. ignea and B. markgrafii the indument of the lamina. In other respects, such as the clavate stigma, B. markgrafii,

pure.knaw.nl · analogues. Diabetes insipidus shows clinical variability both within and between families in respect of onset and severity of the symptoms (Martin, 1959). The few

Calonectria species and their Cylindrocladium anamorphs ... species and their... · STUDIES IN MYCOLOGY 50: 415–430. 2004. Calonectria species and their Cylindrocladium anamorphs:

Calonectria Cylindrocladium) Leaf Spot of Palmplant health by decreasing pathogen infection. Another critical part of leaf spot management is moisture control. High humidity and moisture

A new remarkable species of Probles with clavate antennae

Cylindrocladium buxicola Research 2014: effective strategy · 2019-12-06 · Research 2014: effective strategy 9 October 2014 ... • Independent research in a neutral location. •

pure.knaw.nl · S. Afr. J. Bot. 1997, 63(5) Figure 3 Conidia and vertical section through an acervulus of 10 Vim). Phaeophloeosporel/a ekebergiae (Scale bar = Conidiogenous cells

pure.knaw.nl · pothalamic pathway, or changes in environmental lighting conditions were found to influence the rhythm of the suprachiasmatic pacemaker, and con- sequently the synthesizing

Calonectria species and their Cylindrocladium anamorphs: species

Glandular hairs of the ovary: a helpful character for ... · ular in T. parthenium (Fig. 3A) to fungiform in E. cannabinum (Fig. 3B), more or less clavate in B. perennis (Fig. 1)

pure.knaw.nl · 1985) and described theqlltrastructure of Elschnig's pearls in humans (Kappelhof et al. 1986). Materials and methods Eleven human autopsy eyes, all treated for senile

pure.knaw.nl · Web viewThe design of Experiment 1 consisted of two distributions of soils (heterogeneous vs. homogeneous). The heterogeneous treatment consisted of four plant species

pure.knaw.nl€¦ · Web viewActivating Senior Potential in Ageing Europe: an Employers’ Perspective. Wieteke Conen, Harry van Dalen, Kène Henkens, Joop Schippers. European Commission

pure.knaw.nl P. GOLD* , HANS CLEVERS* BALBINO ALARCON*, SABRINA DUNLAP* , JIRI NOVOTNY t ALAN F. WILLIAMS$, AND Cox TERHORST* …

Basteria - pure.knaw.nl · Basteria TIJDSCHRIFT VAN DE NEDERLANDSE MALACOLOGISCHE VERENIGING VOL. 26, NO. 5 en6, PAG.61—88 28-XII-1962 Thelifecycle of thewatersnailAplexa hypnorum

pure.knaw.nl · Web viewPlant-soil feedback studies assess the consequences of plant induced changes in the soil’s biotic as well as abiotic conditions for plant performance (Bever

pure.knaw.nl€¦ · Web viewCombined effects of carbon, nitrogen and phosphorus on CH 4 production and denitrification in wetland sedimentsSang Yoon Kim1, Annelies J. Veraart1, Marion

pure.knaw.nl · National Museum in Jakarta. Calvinism was initially the only permitted religion for Europeans. In the course of the eighteenth century Lutheranism was also recognized

FIVE NEW CLAVATE-STIGMA WALTHERIA SPECIES ENDEMIC TO

A biomimetic accelerometer inspired by the cricket’s …rsif.royalsocietypublishing.org/content/royinterface/11/... · A biomimetic accelerometer inspired by the cricket’s clavate

pure.knaw.nl Georgopoulos,¶ Frits Meijlink,S and Hans Clevers ... GGGCAAGTAGGGCACCCTTTGAAGCTCT annealed to CCC- AGAGCTTCAAAGGGTGCCCTACTTG. All oligonucleotides

pure.knaw.nl€¦ · Web viewRelationships between plant traits, soil properties and carbon fluxes differ between monocultures and mixed communities in temperate grassland. Jonathan

pure.knaw.nl · an increased level of physical activity may improve circadian rhythms in elderly. In the study, 10 healthy elderly males were admitted to a fitness training program

pure.knaw.nl · fundus reflex, have been seen. We investigated the Mizuo phenomenon by determining the region of the eye and the fundus demonstrating maximum golden reflex on indirect

pure.knaw.nl · visual pathway, the geniculohypothalamic tract (GHT) from the intergeniculate leaflet (IGL) of the lateral geniculate, containing neuropeptide-Y, which projects

MIOCENE PHOLADID BORING S 87 - Decapoda · MIOCENE PHOLADID BORING S 87 Fig. 4. Infille clavate boringds intersperse d with horizonta burrowl osf Thalassinoides alon ing situ basal

pure.knaw.nl · Tulane University, Department of Medicine, and Veterans Administration Hospital, New Orleans, USA Summary. Using antibodies against A VT, ot-MSH, LHRH and somatostatin,

pure.knaw.nl · PDF filewijkingen: 3', placenta-insufficiëntie: 2; solutio placentae: y, placenta praevia: 5; placenta circumvallata: 3', constrictie + torsie navelstreng: 1 ;

pure.knaw.nl · Web viewIntegrating quantitative morphological and qualitative molecular methods to analyze soil nematode community responses to plant range expansion . Stefan Geisen1,2,*,

pure.knaw.nl file · Web