Supplementary information

Synthetic antimicrobial peptides delocalize membrane bound proteins

thereby inducing a cell envelope stress response

Soraya Omardien, Jan W. Drijfhout, Henk van Veen, Soraya Schachtschabel, Martijn Riool,

Leendert W. Hamoen, Stanley Brul and Sebastian A. J. Zaat

Index

Supplementary methods

Supplementary Fig 1 Time kill curve depicting the CFU/ml over time after the removal of previously treated cells

Supplementary Fig 2 Scatterplots highlighting the key regulons of genes differentially expressed by B. subtilis in response to sub-lethal concentrations of TC19, TC84 and BP2 that elucidates the mode of action

Supplementary Fig 3 Venn diagrams of the number of genes shared between regulators SigB, M, W and X that are differentially expressed by B. subtilis in response to the peptides

Supplementary Fig 4 Localization of B. subtilis strain TNVS175 producing MurG fused to the green fluorescent protein (MurG-GFP) cultured in minimal medium (CMM) and rich medium (LB)

Supplementary Fig 5 Microscopy images of B. subtilis mutants, that have various proteins fused to the green fluorescent protein (GFP), after treatment with LL-37

Supplementary Table 1 Strains used in the study and additional information

Supplementary Table 2 Genes differentially expressed by B. subtilis associated with the two-component systems, and their functions

Supplementary Table 3 Downregulated genes regulated by SigB in response to 120 min of treatment with TC19

Supplementary Table 4 Associated genes of SigM, W, V and X regulons, the Xpf regulon and the Xre regulon, and their functions

Supplementary Table 5 Summary of genes differentially expressed, in response to the AMPs, involved in resistance antimicrobials

Supplementary Table 6 Minimal inhibitory concentration (MIC) of the TC19, TC84 and BP2 against mutants with a loss of function of genes involved in resistance against other compounds

Supplementary Table 7 The expression of genes associated with the proteins used to observe protein delocalization.

References

Supplementary methods

Time-kill assay to observe the killing effect of the AMP on B. subtilis at concentrations close

to the MIC values

To determine whether the AMPs are bound or available in the medium after treatment for 120

min, the survival assay was extended by removing the previously exposed cells and re-

inoculating the medium containing the AMP (supernatant) with previously untreated cells.

The method was similar to the survival assay reported prior, but after the 120 minutes of

incubation with the AMP the B. subtilis cells were removed using centrifugation at 14 000

rpm. The supernatant, containing the CMM and AMP, was re-inoculated with previously

unexposed exponentially growing cells at a final OD600 of 0.2. Aliquots of the cultures were

taken at 0, 5, 30, 60 and 120 minutes. After the 120 minutes, the cells were removed and the

supernatant re-inoculation with previously untreated cells. Aliquots of the new treatment

suspension were taken at 5, 30 and 60 minutes, but are shown at S5, S30 and S60. Graphs

were generated using SigmaPlot 13.0.

Construction of strain TNVS30D, TNVS30D, UG-10, EKB40 and EKB154

B. subtilis TNVS30D (amyE::spc-Pxyl-mGFP-pgsA) was constructed by amplifying the pgsA

gene using the primers pgsA-Fw and pgsA-Re. Information about the primers can be found in

the Table below. The amplified pgsA gene was cloned into the pSG1729 plasmid (carrying

monomeric GFP) using restriction sites XhoI and EagI. B. subtilis 168 was transformed

subsequently with the resulting plasmid pTNV13. Refer to the Table below for information

about the primers.

B. subtilis UG-10 (amyE::spc Pxyl-recA-mgfp) was constructed by amplifying the recA gene

with the primers UG03a and UG04a. The amplified recA gene was cloned into the pSG1729

plasmid1 using the XhoI and EcoRI restriction sites. B. subtilis 168 was subsequently

transformed with the resulting plasmid TNVS-recA-4GS-mgfp. Refer to the Table below for

information about the primers.

B. subtilis EKB40 (aprE::emR-PftsW-ftsW-msfGFP) was constructed using a three fragment

Gibson assembly reaction. The ftsW gene was amplified using primers EKP15 and EKP37.

The pTNV9-emR vector was amplified using the primer pairs EKP35 and EKP36, and

TerS145 and TerS146 into two fragments. B. subtilis 168 was subsequently transformed with

the resulting plasmid pEKC11.1. Refer to the Table below for information about the primers.

Table Primers used during the cloning procedurePrimer SequencepgsA-Fw 5'gggCTCGAGggctcaggaagcggctcaggatccTTTAACTTACCAAATAAAATCACACTAGCT3'pgsA-Re 5'cccCGGCCGttaGTTAGATGTTTTTAACGCTTCCCA3'UG03a 5’GCGCGCCTCGAGATGAGTGATCGTCAGGCAGCC3’UG04a 5’CGCGCGGAATTCGGATCCTGAGCCGCTTCCTGAGCCTTCTTCAAATTCGAGTTC3’EKP15 5'CCTGAGCCGCTTCCTGAGCCCAGATAAACAGTTTTTTTGA3'EKP35 5'CTGCAGGGTACCCGGTCAAT3'EKP36 5'GGCTCAGGAAGCGGCTCAGGATCCATGAGCAAAGGAGAAGAACT3'EKP37 5'ATTGACCGGGTACCCTGCAGTATAACCGCTATTTTTCTCT3'TerS145 5'ATAAACAAATAGGGGTTCCGCGCA3'TerS146 5'TGCGCGGAACCCCTATTTGTTTAT3'

Bacterial cytological profiling of mutants treated with LL-37

B. subtilis mutants expressing reporter proteins fused to green fluorescent protein (GFP),

were used to determine whether the LL-37 cause delocalization of proteins involved in

various cell wall synthesis. Culturing were in CMM containing the required supplements for

induction (Table S1). The MIC for LL-37 were 2 µM in CMM, thus a two-fold MIC value of

4 µM were selected to observe the effects of LL-37 on the B. subtilis mutants. Treatment with

the LL-37 was for 5 minutes while shaking at 37°C. GFP fused proteins were visualized

using the Nikon Eclipse Ti fluorescent microscope at an excitation wavelength of 395 ± 5 nm

and emission wavelength of 509 ± 5 nm. Microscopy slides were prepared by transferring

0.5µl culture onto a thin 1.5 % w/v agarose pad on a microscopy slide. These experiments

were performed in duplicate.

Legends of Supplementary Figs

Fig S1. Time-kill curves of surviving cells after treatment with various concentrations of

peptide TC19, TC84 and BP2. Aliquots of the cultures were taken at 0, 5, 30, 60 and 120

minutes. After 120 minutes the exposed cells were removed and the supernatant re-inoculated

with previously unexposed cells. Aliquots of the new treatment suspension were taken at 5

(S5), 30 (S30) and 60 (S60) minutes. Numbers of surviving cells were expressed as colony

forming units (CFU) per ml. All three peptides caused a decline in numbers of CFU/ml at an

early time point of 5 minutes, indicating the rapid activity of the peptides. After 5 minutes,

the numbers of CFU/ml increased again indicating growth of unaffected cells. Only for the

lethal concentration of 56 µM TC19 and TC84 a decline was observed, but the decrease in

numbers of CFU/ml in the supernatant was far less in the second cycle than in the first cycle

with the “fresh peptide”. These observations suggest that the peptides were no longer

available in the incubations. The results represent three biological repeats. The initial

inoculum was 10 times higher than the concentration of bacteria used for the MIC assay,

which is ± 1 x 108 CFU/ml (OD600 0.2). Zero values were substituted with one, to allow

display of the values in graphs.

Fig S2. Scatterplots highlighting the key regulons involved in determining the mode of action

of TC19, TC84 and BP2. The genes expressed by B. subtilis are shown, including the genes

that showed a significant difference in log expression ratio with a p > 0.05 (non-significant).

Thus regulons that are not significantly differentially expressed are highlighted in the

scatterplots, but are not mentioned in Table S2.

Fig S3. The Venn diagrams depicting the number of common differentially expressed genes

regulated by Sigma Factors, SigB, M, W or X.

Fig S4. B. subtilis strain TNVS175 producing MurG fused to the green fluorescent protein

(MurG-GFP) cultured in minimal medium (CMM) and rich medium (LB). Differences in

MurG-GFP localization can be observed in the cells in the exponential phase cultured in the

two different media.

Fig S5. The delocalization of proteins involved in cell wall synthesis was evaluated after

treatment with lethal concentrations of LL-37 (4 µM) using B. subtilis mutants. B. subtilis

mutants producing proteins (MurG, MraY, Pbp2B, PonA, MreB and FtsW) fused to the green

fluorescent protein (GFP) showed to be delocalized after treatment with LL-37 when

compared with the normal localization of the proteins in untreated cultures.

Supplementary tables

Table S1. Strains used in this study and additional informationStrains Abbreviation Genetype or description Medium supplement Reference

168 168 trpC2; wild type None BGSCa

1981 MinD-GFP erm spc minD::ermC amyE::Pxyl-gfp-minD; SpR (SG38) 0.1 % w/v xylose [2]

TNVS175 MurG-GFP amyE::spc-Pxyl-murG-msfgfp (168) 0.05 % w/v xylose [3]

TNVS284 MraY-GFP amyE::spc-Pxyl-mraY-msfgfp (168) 0.1 % w/v xylose [3]

EKB44 PBP2b-GFP amyE::spc-Pxyl-msfgfp-pbpB (168) 0.1 % w/v xylose [3]

TNVS45 PonA-GFP amyE::spc-Pxyl-msfgfp-ponA (168) 0.1% w/v xylose [3]

YK405 MreB-GFP amyE::spc-Pxyl-msfgfp-mreB (168) 0.1% w/v xylose [4]

EKB40 FtsW-GFP aprE::emR-PftsW-ftsW-msfGFP (168) None this study

2020 FtsZ-GFP apr::spc Pspac-gfp-ftsZ (168) 0.1 mM IPTG [5]

BMK21 DivIVA-GFP amyE::scp Pxyl-divIVA-sfgfp (168) 0.5 % w/v xylose [3]

TNVS30D PgsA-GFP amyE::spc-Pxyl-mGFP-pgsA (168) 0.5 % w/v xylose this study

TNVS29D PlsX-GFP amyE::spc-Pxyl-mgfp-plsX (168) 0.5 % w/v xylose [3]

BS23 AtpA-GFP atpA-gfp Pxyl-'atpA cat (168) 0.1 % w/v xylose [6]

BS112 SdhA-GFP cat sdhA-gfp:Pxyl-'sdhA (168) 0.5 % w/v xylose [6]

1048 RpoC-GFP cat rpoC-gfp Pxyl-'rpoC (168) 1 % w/v xylose [7]

1049 RpsB-GFP amyE::spc Pxyl-rpsB-gfp (168) 1 % w/v xylose [7]

HM771 DnaN-GFP dnaN::gfp-dnaN cat (168) 0.5% xylose [8]

UG-10 RecA-GFP amyE::spc Pxyl-recA-mgfp (168) 0.5% xylose this study

BKE02310 ΔYbfO ΔybfO::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE04590 ΔYdbS ΔydbS::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE08580 ΔYfhL ΔyfhL::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE17840 ΔFosB ΔfosB::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE21490 ΔSunI ΔsunI::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE24170 ΔYqjL ΔyqjL::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE25370 ΔYqfB ΔyqfB::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE25380 ΔFloA ΔfloA::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE25390 ΔYqeZ ΔyqeZ::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

BKE36530 ΔBcrC ΔbcrC::erm trpC2 (168) 0.5 µg/ml erythromycin BGSCa

aBacillus Genetic Stock Center (http://www.bgsc.org/)

Table S2. Differentially expressed genes of the two-component systems and their functions. Positive values represent upregulation and negative values downregulation of the indicated genes.

Regulator Gene ID

Expression level (logFC)Function*

TC19 (5 min) TC19 (120 min) TC84 (5 min) BP2 (5 min)

LogFC adj.p-value LogFC adj.

p-value LogFC adj.p-value LogFC adj.

p-valueLiaR liaI 4.4 0.0012 4.5 0.0029 permease

liaH 4.2 0.0012 4.5 0.0029 modulator of liaIHGFSRliaG 2.8 0.0025 3.0 0.0062 conserved hypothetical proteinliaF 2.4 0.0032 2.7 0.0087 integral inner membrane proteinliaS 2.1 0.0045 2.3 0.0148 LiaS two-component sensory histidine kinaseliaR 1.8 0.0094 1.8 0.0249 LiaR two-component response regulator

BceR bceB 2.0 0.0020 1.4 0.0216 ABC transporterbceA 2.0 0.0021 1.0 0.0008 1.2 0.0421 bacitracin ABC efflux transporterbceS 2.1 0.0010 1.3 0.0230 BceS two-component sensory histidine kinasebceR 2.4 0.0008 1.4 0.0197 BceR two-component response regulator

YxdJ yxeA 3.2 0.0010 2.2 0.0171 conserved hypothetical proteinyxdM 3.0 0.0021 1.8 0.0472 ABC transporter; efflux of cationic peptidesyxdL 3.0 0.0015 ABC transporter; efflux of cationic peptidesyxdK YxdK two-component sensory histidine kinaseyxdJ YxdJ two-component response regulator

PsdR psdB 2.2 0.0043 ABC transporterpsdA 2.0 0.0056 1.0 0.0035 ABC transporterpsdS PsdS two-component sensor histidine kinasepsdR PsdR two-component response regulator

YtrA ywoB 3.5 0.0004 1.2 0.0292 1.7 0.0197 putative efflux transporterywoC 3.6 0.0003 1.4 0.0076 1.7 0.0166 putative hydrolaseywoD 3.8 0.0004 1.1 0.0146 1.7 0.0197 putative integral inner membrane proteinytrA 3.4 0.0005 1.7 0.0153 1.5 0.0371 transcriptional regulator YtrA (GntR family)ytrF 3.2 0.0006 2.1 0.0148 1.7 0.0471 metabolite permeaseytrE 3.2 0.0006 2.0 0.0171 ABC transporter

ytrB 3.1 0.0006 1.4 0.0377 1.6 0.0297 ABC transporterytrD 3.0 0.0006 1.8 0.0183 ABC transporterytrC 3.0 0.0006 1.7 0.0191 ABC transporter

YvrHb dltA 1.1 0.0006 2.9 0.0003 1.0 0.0029 D-alanylation of teichoic aciddltB 2.9 0.0003 D-alanylation of teichoic aciddltC 2.7 0.0004 D-alanylation of teichoic aciddltD 1.0 0.0007 2.7 0.0003 D-alanylation of teichoic aciddltE 1.0 0.0006 2.8 0.0003 D-alanylation of teichoic acid

wprA 1.5 0.0011 Protein quality controlwapA 1.1 0.0044 1.1 0.0043 Cell wall associated proteinyxxG 1.1 0.0029 1.1 0.0027 Immunity protein against WapAsunA Sublancin lantibioticsunT 2.6 0.0005 Sublancin lantibiotic ABC transporter

bdbA 1.8 0.0009 Thiol-disulfide oxidoreductase for sublacin production

yolJ 1.7 0.0011 Sublancin S-glycosyltransferase

bdbB 1.8 0.0007 Thiol-disulfide oxidoreductase for sublacin production

yvrI -1.1 0.0022 RNA polymerase sigma factoryvrHa -1.2 0.0013 RNA polymerase sigma factorsigX 1.3 0.0005 1.2 0.0029 RNA polymerase sigma factorrsiX 1.3 0.0005 control of SigX activitylytA -1.2 0.0006 secretion of major autolysin LytClytB -1.1 0.0006 modifier protein of major autolysin LytClytC -1.1 0.0005 -1.0 0.0029 N-acetylmuramoyl-L-alanine amidase

*References for functions can be found in the online database SubtiWiki (http://subtiwiki.uni-goettingen.de/)

Table S3. Downregulated genes associated with SigB after 120 min of treatment with TC19

Gene ID

Expression level (logFC)

Function*TC19 (120 min)LogFC adj. p-value

bmr -1.0 0.002 multidrug resistancebmrU -1.3 0.001 multidrug resistancecorA -1.8 0.001 unknowncsbA -1.0 0.004 protection against paraquat stresscsbC -1.6 0.001 protection against paraquat stresscsbD -1.2 0.008 survival of salt stress and at low temperaturescsbX -1.3 0.001 unknownctsR -1.3 0.001 regulation of protein degradationcypC -1.3 0.002 biosynthesis of beta-hydroxy fatty acid for lipopeptidesgspA -1.7 0.001 unknownguaD -2.7 0.004 deamination of guanine to xanthine, purine salvage and interconversionkatE -1.0 0.004 detoxification (degradation) of hydrogen peroxidemcsA -1.1 0.002 control of CtsR activitymcsB -1.0 0.001 control of CtsR activitymgsR -1.0 0.006 controls a subset of general stress genesnhaX -1.3 0.002 unknownohrB -1.1 0.003 organic peroxide resistance

rpmEB -1.0 0.002 survival of salt stressspx -1.1 0.003 negative and positive regulator of many genesyaaI -1.5 0.002 survival of ethanol stressycbP -2.1 0.000 unknownycdF -1.3 0.002 survival of ethanol stress and low temperaturesycdG -1.1 0.005 unknownydaD -1.1 0.004 unknown

ydaS -1.1 0.003 unknownydaT -1.1 0.006 survival of ethanol stress and low temperaturesydeC -1.8 0.000 unknownyerD -1.5 0.002 protection against paraquat stressyfhE -1.3 0.001 survival of stress conditions and low temperaturesyfhF -1.5 0.001 survival of ethonol stress and at low temperaturesyfkM -1.1 0.003 detoxification of methylglyoxalyflA -1.5 0.001 protection against paraquat stressyflT -1.3 0.002 survival of ethanol stress

yhcM -1.2 0.003 unknownyhdF -1.4 0.001 unknownyhdN -1.4 0.001 detoxification of methylglyoxalyjgB -1.0 0.007 survival of ethanol stressyjgC -1.1 0.005 unknownykgA -1.6 0.001 survival of salt and ethanol stressesykzI -1.5 0.001 unknownyoaA -1.0 0.003 unknownyoxC -1.5 0.002 survival of ethanol stressyqhB -1.5 0.002 protection against stress conditionsyqhP -1.3 0.001 unknownyqhQ -1.1 0.001 survival of stress conditionsysnF -1.1 0.005 survival of ethanol stressytaB -1.3 0.001 survival of ethanol and salt stressesyuzA -1.1 0.009 unknown

yvyD -1.1 0.001dimerization of ribosomes in the stationary phase, protection against paraquat stress

ywmE -1.7 0.001 survival of ethanol stressywsB -1.1 0.003 survival of ethanol and salt stressesywtG -2.0 0.001 unknownywzA -1.4 0.002 unknown

yxaB -1.2 0.002 biofilm formation, survival of salt and ethanol stressyxbG -1.5 0.002 unknownyxjJ -1.3 0.002 survival of stress conditions

yxnA -1.5 0.002 survival of ethanol stressyxzF -1.2 0.002 unknownyycD -1.5 0.003 survival of ethanol stress

*References for functions can be found in the online database SubtiWiki (http://subtiwiki.uni-goettingen.de/)

Table S4. Differentially expressed genes associated with SigM, W, V and X, the Xpf and Xre regulons, and their functions. Genes are considered to be differentially expressed when the expression ratio exceeds a factor of two and shows a significant different in log expression ratio (p ≤ 0.05). Positive values represent upregulation and negative values downregulation of the indicated genes.

Regulator Gene ID

Expression level (logFC)

FunctionTC19 (5 min) TC19 (120 min) TC84 (5 min) TC84 (120 min) BP2 (5 min)

LogFC adj.p-value LogFC adj.

p-value LogFC adj.p-value LogFC adj.

p-value LogFC adj.p-value

SigM coaX 1.1 0.0003 biosynthesis of coenzyme A

disA 1.2 0.0004 DNA integrity scanning protein

divIB 1.0 0.0009 septum formation; cell-division protein

mreC 1.0 0.0068 cell shape-determining protein

mreD 1.0 0.0068 cell shape-determining protein

murB 1.8 0.0007 peptidoglycan precursor biosynthesis

recU 1.6 0.0003 Holliday junction resolvase

rodA 1.0 0.0003 1.4 0.0007 SEDS family peptidoglycan glycosyltransferase

sigM 1.2 0.0009 1.2 0.0003 SigM

ydaH 3.0 0.0000 2.3 0.0015 2.0 0.0015 1.7 0.0011 lipid II flippase, export of lipid II

yfnI 1.3 0.0019 minor lipoteichoic acid synthetase

sbp 1.3 0.0008 unknown

ycgQ 1.4 0.0006 unknown

ycgR 1.2 0.0013 unknown

yebC 1.4 0.0008 1.8 0.0013 unknown

ypbG 2.0 0.0004 1.3 0.0016 1.4 0.0464 unknown

ypuA 2.8 0.0000 3.6 0.0004 1.8 0.0015 1.5 0.0014 unknown

yrhH 2.7 0.0004 2.8 0.0005 1.3 0.0191 2.5 0.0243 unknown

SigM,W yqjL 3.2 0.0003 1.8 0.0063 1.4 0.0293 putative hydrolase

ywaC 1.8 0.0003 1.1 0.0011 (p)ppGpp synthetase

SigM,W,X bcrC 1.8 0.0000 2.3 0.0003 1.1 0.0008 1.2 0.0243 1.1 0.0003 produces the carrier lipid for cell wall synthesis

spx 1.3 0.0021 -1.1 0.0026 transcriptional regulator Spx

yjbC 1.3 0.0012 unknown

yrhJ 1.4 0.0006 fatty acid metabolism

fatR 1.5 0.0006 unknown

ywnJ 1.5 0.0006 1.0 0.0049 unknown

pspA 1.5 0.0047 2.7 0.0026 1.1 0.0480 unknown

SigM,X abh 1.6 0.0004 1.8 0.0005 1.3 0.0029 transcriptional regulator of transition state genes

dltA 1.1 0.0006 2.9 0.0003 1.0 0.0029 D-alanylation of teichoic acid

dltB 2.9 0.0003 D-alanylation of teichoic acid

dltC 2.7 0.0004 D-alanylation of teichoic acid

dltD 1.0 0.0007 2.7 0.0003 D-alanylation of teichoic acid

dltE 1.0 0.0006 2.8 0.0003 D-alanylation of teichoic acid

pbpX 1.2 0.0019 3.7 0.0003 1.1 0.0097 penicillin-binding protein X

SigV oatA 1.1 0.0010 O-acetyl transferase

rsiV 1.3 0.0009 1.3 0.0004 anti-sigma factor to SigV

sigV 1.0 0.0010 1.1 0.0010 SigV

SigW floA/yqfA 1.1 0.0069 flottilin-like protein

floT 1.7 0.0040 1.3 0.0430 control of membrane fluidity

fosB 2.3 0.0010 1.7 0.0152 1.5 0.0320resistence against antimicrobial compounds from B. amyloliquefaciens

pbpE 1.6 0.0012 1.3 0.0097 penicillin-binding protein PBP 4*

(spore cortex)racX 1.5 0.0021 1.3 0.0157 production of D-amino acids

rsiW 1.3 0.0015 1.2 0.0037 control of SigW activity

sigW 1.3 0.0022 1.1 0.0035 adaptation to membrane active agents

spo0M 2.1 0.0013 1.6 0.0078 1.6 0.0155 sporulation-control gene

sppA 2.0 0.0077 required for efficient processing of pre-proteins

ybfO 2.1 0.0014 1.6 0.0163 unknown, similar to erythromycin esterase

ybfP 1.2 0.0144 unknown, similar to chloroperoxydase

ydbS 1.1 0.0079 2.2 0.0079 unknown product

ydbT 2.0 0.0057 unknown product

yfhL 1.2 0.0032 survival at low temperature (4°C) and during ethanol stress

yfhM 1.3 0.0027 1.2 0.0161 survival of ethanol stress

yknW 1.6 0.0006 1.3 0.0128 1.2 0.0063modulates assembly of the YknX-YknY-YknZ ABC transporter for the export of the SdpC toxin

yknX 1.3 0.0041 2.7 0.0024 1.2 0.0191ABC-type antimicrobial peptide transporter (permease) for the export of the SdpC toxin

yknY 1.4 0.0025 2.3 0.0032 1.2 0.0166ABC transporter (ATP-binding protein, exporter) for the export of the SdpC toxin

yknZ 1.5 0.0021 1.9 0.0056 1.3 0.0124 ABC transporter (permease) for the export of the SdpC toxin

yqeZ 1.3 0.0065 1.0 0.0480 resistence against sublancin and cefuroxime

yqfB 1.1 0.0097 resistence against sublancin and cefuroxime

yteJ 1.7 0.0115 stress protein of unknown function

ythP 1.9 0.0013 1.6 0.0101 1.4 0.0155 ABC transporter (ATP-binding protein)

yuaF 1.8 0.0037 1.2 0.0480 control of membrane fluidity

yuaI 1.6 0.0044 1.2 0.0434 unknownxpaC 1.4 0.0021 unknown

yaaN 1.0 0.0019 unknown

ydjP 2.0 0.0015 1.1 0.0330 unknown

yeaA 2.3 0.0014 1.4 0.0231 1.5 0.0195 unknown

yjoB 2.2 0.0016 2.9 0.0019 1.7 0.0166 unknown

yoaG 1.0 0.0136 2.5 0.0044 unknown

yobJ 1.7 0.0025 1.6 0.0091 unknown

yozO 1.4 0.0105 unknown

ythQ 1.8 0.0027 1.8 0.0105 1.4 0.0216 unknownyvlA 1.3 0.0029 1.5 0.0102 unknownyvlB 1.0 0.0183 unknownyvlC unknownyvlD unknownywrE 2.1 0.0020 2.0 0.0099 1.4 0.0297 unknownyxjI 1.4 0.0022 1.0 0.0230 unknownyrhH 2.8 0.0005 2.5 0.0243 unknown

SigX psd 1.0 0.0003 biosynthesis of phospholipids

rsiX 1.2 0.0005 1.5 0.0003 1.2 0.0029 1.4 0.0003 control of SigX activity

sigX 1.3 0.0005 1.8 0.0003 1.2 0.0029 1.4 0.0007 resistance against cationic antimicrobial peptides

Xpf xkdE 1.7 0.0021 1.7 0.0003 1.3 0.0191 1.7 0.0298 unknown (PBSX prophage)

xkdF 1.7 0.0032 1.8 0.0003 1.4 0.0207 1.8 0.0243 unknown (PBSX prophage)

xkdG 1.7 0.0030 1.9 0.0003 1.5 0.0191 1.9 0.0243 unknown (PBSX prophage)

xkdH 1.7 0.0030 1.8 0.0003 1.5 0.0183 1.8 0.0251 unknown (PBSX prophage)

xkdI 1.8 0.0028 1.9 0.0003 1.5 0.0183 1.9 0.0243 unknown (PBSX prophage)

xkdJ 1.8 0.0028 1.9 0.0003 1.4 0.0197 1.9 0.0243 unknown (PBSX prophage)

xkdK 1.8 0.0029 2.1 0.0003 1.5 0.0183 2.1 0.0243 unknown (PBSX prophage)

xkdM 1.8 0.0026 2.1 0.0003 1.5 0.0177 2.1 0.0243 unknown (PBSX prophage)

xtmA 1.7 0.0019 1.7 0.0004 1.3 0.0176 1.7 0.0340 PBSX terminase (small subunit), Phage DNA replication

xtmB 1.7 0.0021 1.7 0.0003 1.3 0.0183 1.7 0.0300 PBSX terminase (small subunit), Phage DNA replication

Xre xtrA 1.5 0.0098 1.4 0.0013 unknown (PBSX prophage)

xkdB 1.5 0.0070 1.7 0.0006 unknown (PBSX prophage)xkdC 1.5 0.0098 1.5 0.0005 1.1 0.0350 unknown (PBSX prophage)xkdD 1.6 0.0066 1.4 0.0005 1.3 0.0480 1.1 0.0300 unknown (PBSX prophage)

Table S5. Summary of genes, differentially expressed in response to the AMPs, involved in resistance against other antimicrobials

Strains Deletedgene

TC19 (5 min) TC19 (120 min) TC84 (5 min) TC84 (120 min) BP2 (5 min) BP2 (120 min)

LogFC adj.p-value LogFC adj.

p-value LogFC adj.p-value LogFC adj.

p-value LogFC adj.p-value LogFC adj.

p-value

168 none - - - - - - - - - - - -

BKE17840 fosB 2.3 0.0010 - - 1.7 0.0152 - - 1.5 0.0320 - -

BKE24170 yqiL 3.2 0.0003 - - 1.8 0.0063 - - 1.4 0.0293 - -

BKE25370 yqfB 1.1 0.0097 - - - - - - - - - -

BKE08580 yfhL 1.2 0.0032 - - - - - - - - - -

BKE02310 ybfO 2.1 0.0014 - - 1.6 0.0163 - - - - - -

BKE04590 ydbS 1.1 0.0079 2.2 0.0079 - - - - - - - -

BKE25380 floA 1.1 0.0069 - - - - - - - - - -

BKE25390 yqeZ 1.3 0.0065 - - 1.0 0.0480 - - - - - -

BKE21490 sunI 1.6 0.0032 - - - - - - - - - -

BKE36530 bcrC 1.8 0.0000 2.3 0.0003 1.1 0.0008 1.2 0.0243 1.1 0.0003 - -

Table S6. Minimal inhibitory concentration (MIC) of mutant with a loss of function of genes involved in resistance against other compounds

Strains Deleted geneMIC (in µM)

Additional informationTC19 TC84 BP2

168 none 9.3 ± 3.3 9.3 ± 3.3 5.8 ± 1.6

BKE17840 fosB 11.7 ± 3.3 11.7 ± 3.3 4.7 ± 1.7 confers resistance against antimicrobial compounds from B. amyloliquefaciens

BKE24170 yqiL 9.3 ± 3.3 11.7 ± 3.4 4.7 ± 1.7 resistance against oxidative stress and paraquat and survival of low temperatures

BKE25370 yqfB 9.3 ± 3.3 11.7 ± 3.5 4.7 ± 1.7 resistance protein (against sublancin), accessory role in resistance to cefuroxime

BKE08580 yfhL 9.3 ± 3.3 11.7 ± 3.6 3.5 ± 0.0 resistance protein (against toxic peptide SdpC)

BKE02310 ybfO 9.3 ± 3.3 11.7 ± 3.7 4.7 ± 1.7 similar to erythromycin esterase

BKE04590 ydbS 11.7 ± 3.3 11.7 ± 3.8 4.7 ± 1.7 resistance against antimicrobial compounds from B. amyloliquefaciens

BKE25380 floA 9.3 ± 3.3 10.5 ± 4.9 5.8 ± 1.6 resistance protein (against sublancin), accessory role in resistance to cefuroxime

BKE25390 yqeZ 9.3 ± 3.3 15.2 ± 10.0 5.8 ± 1.6 resistance protein (against sublancin), accessory role in resistance to cefuroxime

BKE21490 sunI 9.3 ± 3.3 8.2 ± 4.4 5.8 ± 1.6 bacteriocin producer immunity protein, immunity to sublancin

BKE36530 bcrC 7.0 ± 0.0 5.8 ± 1.6 5.8 ± 1.6 cell wall synthesis, resistance to bacitracin and oxidative stress

Table S7. Expression of genes encoding the proteins fused the green fluorescent protein (GFP) in B. subtilis strains used to observe protein delocalization after AMP treatment (see Fig 7)

Gene ID ofproteins observed

Gene ID ofassociated proteins

TC19 (120 min)Description

LogFC adj. p-value

MreB 1.0 0.0080 cell-shape determining protein

Mbl 1.5 0.0006 MreB-like morphogen

MreBH 4.6 0.0003 cell-shape determining protein

MurG 1.8 0.0006 N-acetylglucosamine transferase

MurB 1.8 0.0007 UDP-N-acetylenolpyruvoylglucosamine reductase

SpoVE 1.8 0.0013 factor for spore cortex peptidoglycan synthesis (stage V sporulation)

DivIB 1.0 0.0009 cell-division initiation protein

Sbp 1.3 0.0008 putative integral inner membrane protein

MraY 1.9 0.0011 phospho-N-acetylmuramoyl-pentapeptide transferase

Pbp2B 1.0 0.0007 penicillin-binding protein 2B

AtpA 1.0 0.0131 ATP synthase (subunit alpha, component F1)

RpsB 1.8 0.0008 ribosomal protein S2

References

[1] W. Eiamphungporn, J.D. Helmann, The Bacillus subtilis sigma(M) regulon and its

contribution to cell envelope stress responses, Mol. Microbiol. 67 (2008) 830–848.

doi:10.1111/j.1365-2958.2007.06090.x.

[2] A.L. Marston, H.B. Thomaides, D.H. Edwards, M.E. Sharpe, J. Errington, Polar

localization of the MinD protein of Bacillus subtilis and its role in selection of the mid-

cell division site, Genes Dev. 12 (1998) 3419–3430. doi:10.1101/gad.12.21.3419.

[3] A. Müller, M. Wenzel, H. Strahl, F. Grein, T. Saaki, B. Kohl, T. Siersma, J. Bandow,

H. Sahl, T. Schneider, L. Hamoen, Daptomycin inhibits bacterial cell envelope

synthesis by interfering with fluid membrane microdomains, Proc. Natl. Acad. Sci. U.

S. A. 113 (2016) E7077–E7086. doi:10.1073/pnas.1611173113.

[4] Y. Kawai, R. a Daniel, J. Errington, Regulation of cell wall morphogenesis in Bacillus

subtilis by recruitment of PBP1 to the MreB helix, Mol. Microbiol. 71 (2009) 1131–

1144. doi:10.1111/j.1365-2958.2009.06601.x.

[5] N.R. Stokes, J. Sievers, S. Barker, J.M. Bennett, D.R. Brown, I. Collins, V.M.

Errington, D. Foulger, M. Hall, R. Halsey, H. Johnson, V. Rose, H.B. Thomaides, D.J.

Haydon, L.G. Czaplewski, J. Errington, Novel inhibitors of bacterial cytokinesis

identified by a cell-based antibiotic screening assay, J. Biol. Chem. 280 (2005) 39709–

39715. doi:10.1074/jbc.M506741200.

[6] A.S. Johnson, S. van Horck, P. J. Lewis, Dynamic localization of membrane proteins

in Bacillus subtilis, Microbiology. 150 (2004) 2815–2824. doi:10.1099/mic.0.27223-0.

[7] P.J. Lewis, S.D. Thaker, J. Errington, Compartmentalization of transcription and

translation in Bacillus subtilis, EMBO J. 19 (2000) 710–8.

doi:10.1093/emboj/19.4.710.

[8] M. Su’etsugu, J. Errington, The replicase sliding clamp dynamically accumulates

behind progressing replication forks in Bacillus subtilis cells, Mol. Cell. 41 (2011)

720–732. doi:10.1016/j.molcel.2011.02.024.