quantitative analysis of microrna in blood serum with protein-facilitated affinity capillary...
TRANSCRIPT
![Page 1: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/1.jpg)
Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis
Nasrin Khan, Jenny Cheng, John Paul Pezacki,
and Maxim V. Berezovski*,
analytical chemistry, June 29, 2011
![Page 2: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/2.jpg)
BackGround
MicroRNAs (miRNAs) are gen-
erally characterized by their short
length (21-25 bp), 2 nt 3’ over-han-
ging ends and 5’ phosphate groups.
![Page 3: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/3.jpg)
miRNAs have been identified in
normal and malignant cells and are
predicted to regulate at least one-t
hird of all human genes.
BackGround
![Page 4: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/4.jpg)
miRNAs are frequently deregul-ated in some diseases, especially incancer. miRNAs have shown promise as tissue- and blood-based biomarkers for cancer classification and progn- ostication.
BackGround
![Page 5: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/5.jpg)
miRNAs are in fact present in cl- inical samples of plasma and serum i
n a remarkably stable form and coul
d serve as cancer biomarkers.
BackGround
![Page 6: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/6.jpg)
Authors present a ProFACE assay for rapid quantification of miRNA levels in blood serum using SSB and p19 as sep- aration enhancers.
ProFACE: protein-facilitated affinity capillary electrophoresis
SSB: single-stranded DNA binding protein
p19: double-stranded RNA binding protein
BackGround
![Page 7: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/7.jpg)
Capillary electrophoresis with laser-induced fluorescence detection (CE-LIF) is a promising technique for miRNA det- ection where miRNAs are easily separated from most of the other biomolecules because of their strong negative charge.
BackGround
![Page 8: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/8.jpg)
BackGround
Some advantages of ProFACE-LIF o
ver other methods include high sen- sitivity and selectivity toward target molec
ules, rapidity of detection, and
the ability to screen complex samples.
![Page 9: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/9.jpg)
BackGround
SSB: single-stranded DNA binding protein
p19: double-stranded RNA binding protein
single-stranded DNA/RNA probe
miRNA-RNA probe duplex
![Page 10: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/10.jpg)
Materials and Methods
MicroRNA and Hybridization Probes
• miRNA-122 and hybridization probes were synthesized by IDT DNA Technologies.
the sequence of miR-122:
5’-/Phos/UGGAGUGUGACAAUGGUGUUUG-3’
![Page 11: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/11.jpg)
• The fluorescently labeled DNA and RNA probes were with the following sequences and contained 3’ and 5’ modifications:
5’-/Phos/CAAACACCAUUGUCACACUCCA/36-FAM/-3’
5’-/Phos/CAAACACCATTGTCACACTCCA/36-FAM/-3’
Materials and Methods
![Page 12: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/12.jpg)
Hybridization Conditions
The hybridization was carried out in
PCR thermocycler in the following incub-
ation buffer (50mM TrisAc, 50mM NaCl,
10mM EDTA, pH 8.1).
Materials and Methods
![Page 13: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/13.jpg)
Temperature was increased to a de-
naturing 60℃ for DNA probe (55℃ for
RNA probe) and then lowered to 20 ℃
in decrement steps of 1℃ every 3 s to al-
low annealing.
Materials and Methods
![Page 14: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/14.jpg)
p19 Expression and Purification
• Construction of the pTriEx-p19 plasmid encoding the carnation Italian ring spot
virus p19 protein with a C-terminal oct-
ahistidine tag.
Materials and Methods
![Page 15: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/15.jpg)
• E. coli strain BL21 (DE3) cells harboring
p19 construct were grown at 37℃ until an optical density at 600 nm (OD600) of 0.5-0.6
was achieved.
• Cultures were then grown for an additional
2-3 h at 28℃ or until OD600 reaches 1-1.5.∼
Materials and Methods
![Page 16: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/16.jpg)
• After harvesting, bacterial pellets were re-
suspended in the lysis buffer and lysed by
sonication on ice-bath.
50mM Tris-HCl, 300mM NaCl, 10mM imidazole, 1mM dithiothreitol (DTT), 1×complete protease inhibitor cocktail from Roche, pH 8.0
Materials and Methods
![Page 17: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/17.jpg)
• Cell lysate was then centrifuge at 20 000g for 20 min at 4℃. Soluble lysate fraction containing the His-tagged p19 protein was loaded to a HisTrap FF nickel affinity col- umn (GE Healthcare, Piscataway,U.S.A.).
Materials and Methods
![Page 18: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/18.jpg)
• After protein binding the resin was was- hed with 10 column volumes of the wash buffer.
50 mM Tris-HCl, 300 mM NaCl, 50 mM imidazole, pH 8.0
Materials and Methods
![Page 19: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/19.jpg)
• Elution of His-tagged p19 protein was
carried out using the elution buffer and
10 mM DTT was added immediately to the elute.
50 mM Tris-HCl, 300 mM NaCl, 250 mM imidazole, pH 8.0
Materials and Methods
![Page 20: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/20.jpg)
• Fractions containing the desired p19 prote- in were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis
(SDS-PAGE), combined, and stored at 4℃ .
Materials and Methods
![Page 21: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/21.jpg)
Capillary Electrophoresis Separation
• Capillary electrophoresis analyses were performed on a ProteomeLab PA 800 capillary electrophoresis system (Beckman- Coulter, Brea, U.S.A.) with laser-induced fluorescence detection.
Materials and Methods
![Page 22: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/22.jpg)
• The separations were conducted by
applying an electric field of 400 V/cm (positive charge at the inlet and ground at the outlet). The temperature of the
capillary was 15℃ .
Materials and Methods
![Page 23: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/23.jpg)
• The run buffer was 25 mM sodium tetrab- orate at pH 9.2.
• The run buffer was supplemented with SSB in concentrations ranging from 0 to 100 nM
or with the p19 protein in concentrations ranging from 0 to 500 nM.
Materials and Methods
![Page 24: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/24.jpg)
MicroRNA Preconcentration from
Serum Using p19 Beads
Materials and Methods
![Page 25: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/25.jpg)
The MBP helps in p19 purification, and the CBD allows p19 to bind very tightly to chitin magnetic beads.
• The MBP-p19-CBD fusion protein was obtained from New England BioLabs.
The p19 has the N-terminal fusion of the maltose binding protein (MBP) and the C-terminal fusion of the chitin binding domain (CBD).
Materials and Methods
![Page 26: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/26.jpg)
1mL of 100% fetal bovine serum, 200μL of the p19 binding buffer spiked with 100nM masking DNA, 100nM tRNA, 1μL of murine RNase inhibitor, 0.5fM to 500pM miRNA-122, and 1.25nM miR-122 probe.
•The p19 beads were incubated with the mixture.
The binding reaction was then incubated by shaking on a benchtop shaker for 2h at 23℃ .
Materials and Methods
![Page 27: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/27.jpg)
• Unbound RNA was removed by washing 10 times with 500μL of 1×wash buffer that was preheated to 37℃.
For each wash, the beads were shaken for 5min at room temperature.
20mM Tris-HCl, 100 mM NaCl, 1mM EDTA, 100μg /mL BSA, pH 7.0
Materials and Methods
![Page 28: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/28.jpg)
• The bound miRNA was eluted from beads in 10μL of 1×p19 elution buffer by shaking for 10min at 23℃ followed by another 10min of incubation at 37℃.
The eluted 10μL miRNA was analyzed by capillary electrophoresis.
20mMTris-HCl, 100mM NaCl, 1mMEDTA, 0.5%SDS, pH7.0
Materials and Methods
![Page 29: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/29.jpg)
1.Application of SSB for miRNA ProFACE Separ- ation and LIF Detection.
RESULTS AND DISCUSSION
![Page 30: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/30.jpg)
The optimum resolution of the probe and duplex is achieved when the concentration of SSB is in the range of 10-50 nM.
SSB increases the seperation between the excess probe and miRNA-probed uplex.
RESULTS AND DISCUSSION
![Page 31: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/31.jpg)
2.ProFACE Assay of miRNA with p19.
RESULTS AND DISCUSSION
![Page 32: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/32.jpg)
RESULTS AND DISCUSSION
![Page 33: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/33.jpg)
The use of SSB and p19 proteins enhanced the baseline CE separation and allowed for the measurement of the exact amount of miR-122. Without a baseline separation, the excess of a probe cannot be used because of significant overlap with the miRNA duplex peak.
RESULTS AND DISCUSSION
![Page 34: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/34.jpg)
3.MicroRNA Detection in Serum.
The p19 bead precipitation and CE sta- cking helped enrich the miRNA greater than 1000-fold from serum compared with CE experiments without the preco- ncentration.
RESULTS AND DISCUSSION
![Page 35: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/35.jpg)
The use of p19 beads brings two major benefits:
miRNA-selective extraction
Sample enrichment
RESULTS AND DISCUSSION
![Page 36: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/36.jpg)
Conclusion
1.The authors developed a simple techniquefor miRNA analysis in blood serum involving four steps:
ⅳ. CE-based separation and quantitation.
ⅰ. Hybridization with a RNA probe
ⅱ. Precipitation with p19 magnetic beads
ⅲ. Injection with the sample stacking into a capillary
![Page 37: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/37.jpg)
2. SSB and p19 proteins can work as enhanc-ers of the magnetic bead microRNA isolation and CE separation.
3. Without PCR amplification, the ultralow amounts of miRNA in serum can be measu-red by ProFACE.
Conclusion
![Page 38: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/38.jpg)
4. This method can be parallelized to qu- an
titatively detect multiple miRNA-based bio
markers in different biological samples.
Conclusion
![Page 39: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/39.jpg)
![Page 40: Quantitative Analysis of MicroRNA in Blood Serum with Protein-Facilitated Affinity Capillary Electrophoresis Nasrin Khan, Jenny Cheng, John Paul Pezacki,](https://reader035.vdocument.in/reader035/viewer/2022062408/56649e4f5503460f94b4602f/html5/thumbnails/40.jpg)
• The elutes were combined and concentrated to 0.5 mL using the Amicon Ultra 10 kDaMWCO
centrifugal filter device (Millipore, Concord, MA).
• The concentrated sample was then additionally
purified on a Superdex 200 size exclusion col- umn (GE Healthcare, Piscataway,U.S.A.)
Materials and Methods