ravi kumar singhal - uppsala...
TRANSCRIPT
![Page 1: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/1.jpg)
Analysis of ELOVL2-ablatad mice - a survey on diet and gene
expression
Ravi Kumar Singhal
Degree project in biology, Master of science (2 years), 2012Examensarbete i biologi 15 hp till masterexamen, 2012Biology Education Centre, Uppsala University, and The Wenner-Gren Institute, Department ofPhysiology, Stockholm UniversitySupervisor: Prof. Anders Jacobsson
![Page 2: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/2.jpg)
1
ABSTRACT
Very long-chain fatty acids (VLCFA) including polyunsaturated acids (PUFA) are essential
lipids whose function diversity is made possible by variation in their chain length and degree of
unsaturation. VLCFA, monounsaturated and PFUAs are synthesized by elongation and
desaturation reaction that is carried out in the endoplasmic reticulum of the cell. Proper
elongation and desaturation of fatty acids are crucial to maintain lipid homeostasis and disruption
of these processes may have devastating consequences. Fatty acids can be produced directly
from daily diet or can be synthesized by denovo process known as lipogenesis. Fatty acids up to
18 carbon length are synthesized in the cytosol by fatty acid syntheses, beyond 18 carbon length
is synthesized by elongation of very long chain fatty acids (ELOVLs). We have recently
identified the fatty acid elongase Elovl2 as a key enzyme in the production of PUFA in mice.
Elovl2 mutant mice show impaired fertility as well as resistance to diet induced obesity and
hepatic steatosis. These effects are strongly correlated with the level of Elovl2 expression in liver
and the relative amount of C22 PUFA in plasma. By evaluating the importance of ELOVL2 and
the validity of the specific PUFA docosapentaenoic acid and docosahexaenoic acid as
biomarkers of genetic contribution to PUFA concentrations and consequently to common
diseases, the potential modifying effect of both dietary fatty acids and genetics on the
relationship between fatty acid and disease risk will be investigated. The underlying mechanism
can be explained on the basis of PUFA attenuating lipogenesis via a complex positive-negative
feedback loop in which sterol regulatory element binding protein induced lipogenesis is
suppressed by elevated levels of n-3 and n-6 PUFAs. Sterol regulatory element binding proteins
are transcription factors which regulate genes involved in the fatty acid synthesis. The aim of the
project is twofold, first to study the gene expression patterns in liver of wild type and null mice
exposed to high fat diet and normal diet. Secondly it is to reveal whether the level of active
SREBP-1c in liver is affected by Elovl2-ablated mice under different dietary conditions. In this
thesis I elucidate the expression of Elovl2 in mice liver.
![Page 3: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/3.jpg)
2
Table of Contents:
1. Introduction--------------------------------------------------------------------------------------- 6
2. Fatty Acid Synthesis----------------------------------------------------------------------------- 6
2.1 Elongation of very long chain fatty acids
2.1.1 Elovl 1--------------------------------------------------------------------------------- 7
2.1.2 Elovl 2--------------------------------------------------------------------------------- 8
2.1.3 Elovl 3--------------------------------------------------------------------------------- 8
2.1.4 Elovl 4--------------------------------------------------------------------------------- 9
2.1.5 Elovl 5--------------------------------------------------------------------------------- 9
2.1.6 Elovl 6-------------------------------------------------------------------------------- 10
2.1.7 Elovl 7-------------------------------------------------------------------------------- 10
3. Desaturation of fatty acids------------------------------------------------------------------- 10
3.1. Stearoyl- CoA desaturases (SCD) ------------------------------------------------------- 10
3.2. Fatty acid desaturases (FADs) ------------------------------------------------------------ 11
4. Transcriptional factors controlling the fatty acid metabolism------------------------- 11
4.1. Sterol regulator element binding protein (SREBP) ----------------------------------- 12
4.2. Peroxisomes proliferator-activated receptors PPARs --------------------------------- 13
5. Influence of food intake of fatty acid metabolism---------------------------------------- 13
6. Aims: ---------------------------------------------------------------------------------------------- 13
6.1. Analysis of the gene expression pattern in liver of WT and Elovl ablated mice
under high fat diet and normal diet. --------------------------------------------------------- 13
6.2. Understanding of the physiological regulation of lipogenic gene SREBP-1 by
fasting and refeeding in Wt and KO mice in STD chow diet. ----------------------------14
7. Materials and Methods
7.1. Animals. ----------------------------------------------------------------------------------- 15
7.1.1. Fasting and refeeding experiment ----------------------------------------------- 15
![Page 4: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/4.jpg)
3
7.2. High-fat diet experiment. --------------------------------------------------------------- 16
7.2.1. RNA Isolation----------------------------------------------------------------------- 16
7.2.2. cDNA Synthesis ------------------------------------------------------------------- 16
7.2.3. Primer Designing ----------------------------------------------------------------- 16 7.2.4. Quantitative Real time PCR------------------------------------------------------- 18
7.3. Isolation of subcellular protein fraction ---------------------------------------------- 18
7.4. SDS PAGE-------------------------------------------------------------------------------- 18
7.5. Immunoblotting: -------------------------------------------------------------------------- 19
8. Results ------------------------------------------------------------------------------------------- 19
8.1 Generation of Elovl2 KO and genotyping--------------------------------------------- 19
8.2 Elovl2 KO mice resistance to diet induced weight gain ---------------------------- 19
8.3 Gene expression for lipogenic markers ------------------------------------------------ 20
8.4 Gene profiling of lipogenic transcription factor -------------------------------------- 21
8.5 Induction of SREBP-1 protein expression in wild-type and Elovl2 KO mice --- 22
8.6 Regulation of SREBP protein and lipogenic gene expression in liver of fasted and refed wild-type and Elovl2 KO mice-------------------------------------------------------- 22
8.7 The effect of fasting and refeeding at mRNA level ---------------------------------- 23
9. Discussion---------------------------------------------------------------------------------------- 25
10. Result figures ---------------------------------------------------------------------------------- 27
11. Acknowledgements---------------------------------------------------------------------------- 38
12. References--------------------------------------------------------------------------------------- 38
![Page 5: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/5.jpg)
4
ABBREVIATIONS
AA Arachidonic acid
ACC Acetyl-CoA carboxylase
ACS Acetyl-CoA synthetase
AMPK 5’-AMP protein kinase
BAT Brown adipose tissue
ChREBP Carbohydrate response element binding protein
DAG Diacylglycerol
ELOVL Elongation of very long chain fatty acids
ER Endoplasmatic reticulum
EPA Eicosapentaenoic acid
FA Fatty acid
FAS Fatty acid synthase
FABP Fatty acid binding protein
GLUT Glucose transporter
LXR Liver X receptor
PPAR Peroxisome proliferator-activated receptor
PUFA Polyunsaturated fatty acid
TAG Triacylglycerol
TCA-cycle Tricarboxylic acid cycle
SCD Stearoyl-CoA desaturase
SREBP Sterol regulatory element-binding protein
VLCFA Very long chain fatty acids
VLCPUFA Very long- chain polyunsaturated fatty acid
WAT White adipose tissue
![Page 6: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/6.jpg)
5
1 Introduction
Lipids are fat soluble molecules which involve a wide variety of cellular function which are
certain for life and have not been thoroughly studied. There are several different types of lipids
primarily functioning as major components of biological structures such as cellular membranes
and lipid droplets, interacting in a complex in a dynamic fashion. Lipids can be generally
classified into different range of compounds, such as are oils, waxes, sterols,
glycerophospholipids, sphingolipids, mono-, di-, triglycerides. The miscellaneous function of
lipids is reflected by the fact that most cells have the ability to synthesize and modify fatty
acids, which are one of the major constituents of most lipids (Cao H et al., 2008, Dupius E et
al., 2002).
Fatty acids are the major source of energy in the cell and also involved in the regulation of
cellular signaling and by such they reflect the cellular homeostasis. The metabolic state of cells
influences the lipid pool in two different ways; on one hand it alters the lipid storage lipid and
on the other hand it alters fatty acid oxidation in order to generate energy.
In the present thesis, I will focus on the role of very long chain fatty acids in cellular
metabolism and feedback mechanism.
2 Fatty acid synthesis
Fatty acids can be derived in different ways i.e. from the diet or they can be synthesized de
novo through lipogenesis. Lipids, carbohydrates and amino acids can all be metabolized into
acetyl CoA, thus serve as precursor for lipogenesis (Figure 1).
Synthesis of fatty acids involves acetyl CoA, which is carboxylated by the enzyme acetyl CoA
carboxylase (ACC) into malonyl- CoA. Malonyl -CoA then donates 2 carbons to acetyl-CoA in
order to elongate during its de novo lipogenesis. This reaction takes place in cytosol by fatty
acid synthase (FAS) and is repeated seven times in a cyclic manner, with the end product of
palmitic acid C16:0 (Wakil et al., 1983).
During the fatty acid synthesis pathway, carboxylation of acetyl- CoA to malonyl- CoA by
ACC is considered as a rate limiting step. FAS products can be tissues specific, due to variation
in the specific substrate in certain cell types (Kim et al., 1997). FAS are predominantly formed
in liver and adipose tissues; they are also highly expressed during oxidation of tissues in heart
and skeletal muscle (J Ha et al., 1996).
![Page 7: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/7.jpg)
6
Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be absorbed from the diet or
synthesized de novo from glucose by the production of acetyl-CoA, which is transformed into malonyl-CoA by the
ACC. Malonyl-CoA is used as substrate by FAS to produce palmitic acid. Carbon chain up to 16 is synthesized in
ER and very long chain fatty acid is further elongated in Cytosol.
Figure 2: Steps involved during fatty acid synthesis (Adopted from Damir Z et al., 2011 Thesis).
2.1 Elongation of very long chain fatty acids
As described earlier, the synthesis of fatty acid up to 16 carbons long chains are synthesized in
cytosol by multifunction enzyme know as FAS (Jakobsson A et al., 2006, Wakil et al., 1983).
FAS is 540 kDa which functions as a homodimer and the main reactions taking place during
synthesis are condensation, reduction, dehydration and reduction again (figure 2).
![Page 8: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/8.jpg)
7
Fatty acids taken up from the diet and produced by FAS undergo further elongation into long
chain fatty acid. Synthesis of long chain fatty acids (VLCFA) beyond 16 carbons length are in
contrast to FAS elongation synthesized in the endoplasmatic reticulum (ER). VLCFA are
separate membrane bound enzyme including the rate limiting elongation enzymes which
functions in elongation of very long chain fatty acid (ELOVL).VLCFA elongation enzymes
have been identified in several different organism like yeast, fungus (Mortiella alpine),
nematodes, mouse and humans.
Presently there are seven different types of ELOVL protein found in mammals (figure 3),
which includes both enzymes ubiquitously expressed and some which are tissues specific
enzymes. They are characterized as monosaturated and polysaturated fatty acid elongases.
ELOVl3, ELOVL6, ELOVL1 and ELOVL7 belong to the saturated and monounsaturated fatty
acid elongases and ELOVL2, ELOVL4 and ELOVL5 are classified into polysaturated fatty
acid elongases (Leonard et al 2004). The Elovl proteins identified are highly hydrophobic and
the property makes them difficult to purify and characterize in depth (Brolinson et al., 2009).
2.1.1 Elovl 1
Elovl1 is ubiquitously expressed on the mRNA level, but highly expressed in myelinated parts
of human brain tissues (Asadi and Jacobsson unpublished data). Elovl1 gene was identified on
the basis of sequence similarity of Elovl3,which was the first Elovl gene to be identified.
Elovl1 is involved in production of saturated long chain fatty acid up to 26 carbons in length.
Expression of Elovl1 in liver is not directly regulated by nutritional supplements or other
modifications (Wang et al., 2006).
2.1.2 Elovl2
Elovl2 is highly expressed in testis and liver, and to a minor extent in kidney, white adipose
tissue and brain. Elovl2 gene was also identified as SSC2 (Sequence similarity to Cig 30-2) on
the basis of homology sequence match with Elovl3 (Tvrdik et al., 2000). The role of the
enzyme in elongation of poly unsaturated fatty acid (PUFA) is up to 26 carbons in length. The
substrate specificity arachondic acid (C20:4n-6), docosatetraenoic acid (22:4n-6),
eicosapentaenoic acid (C20:5n-3) and docosapentaenoic acid (C22:5n-3) in order to produce
(C24:4n-6) and (C24:5n) (Wang et al., 2008). According to Horton et al, the regulation of
Elovl2 genes elucidates some evidence of lipogenic transcription factor SREBP-1a involvement
in lipogenesis (Horton et al., 2003). The over expression of SREBP-1ac in rat hepatocytes
induces the expression of Elovl2 (Wang et al., 2006).
![Page 9: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/9.jpg)
8
Figure 3: Pathway of fatty acid substrate and products from different membranes of Elongase family (Adopted
from Brolinson A et al., 2009).
2.1.3 Elovl3
Elovl3 is expressed in liver, skin and brown and white adipose tissues of rodents. The gene
expression of Elovl3 increases in response to cold stimulation in brown adipose tissue. The role
of Elovl3 is elongation of saturated and monounsaturated fatty acid up to 24 carbon in length
by promoting lipid droplet formation. (Tvrdik et al 2004).
2.1.4 Elovl4
Elovl4 has mainly been studied in Stargardt- like macular dystrophy in humans. Elovl4 is
involved in elongation of PUFAs in brain, retina, skin and testis (Mandal et al., 2004). Elovl4
synthesize C28 and C30 saturated VLCFA in skin and C28 to C38 in retina (Agbaga et al.,
2008).
![Page 10: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/10.jpg)
9
2.1.5 Elovl5
The Elovl5 gene is expressed to an extent in all tissues with the highest level of expression in
liver, testis and adrenal glands (Leonard et al., 2000). Elovl5 is involved in elongation of PUFA
substrate from 18 to 20 carbons in length. Over-expression of Elovl5 in primary rat hepatocytes
increases the elongation of arachondonic acid (20:4, n-6) into adrenic acid (22:4.n-6) and of
EPA (20:5, n-3) into DPA (22:5, n-3) (Wang et al 2008). Deletion of the Elovl5 gene in
transgenic mice leads to hepatic steatosis and an increase in cholesterol and triglycerides level
by increasing the activity of sterol regulatory element binding protein-1c (SREBP-1c) (Moon et
al., 2008).
2.1.6 Elovl6
Elovl6 is expressed in all tissues analyzed like Elovl1 and Elovl5 with high expression in
mouse liver and adipose tissue. Elovl6 is involved in elongation of saturated and
monounsaturated C16 to C 18 long chain fatty acids. The end product of FAS is palmitic acid
(C16:0) which can be further elongated to stearic acid (C18:0) and oleic acid (C18:1 n-9)
respectively by Elovl6 (Shimano and Matsuzaka, review 2009).
2.1.7 Elovl7
Elovl7 is highly expressed in kidney, pancreas, adrenal glands and prostate. Elovl7 elongase is
the most recently identified Elovl enzyme and its function is similar to Elovl 2, Elovl3 and
Elovl4 (Tamura et al., 2009).
3 Desaturation of fatty acids
Stearoyl-CoA desaturases (SCD) are the enzymes, which inserts double bonds into acyl chain
and generate, mono- and polyunsaturated fatty acid.
3.1 Stearoyl- CoA desaturases (SCD)
There are four isoforms of SCDs identified until now in mouse, of which SCD-1 is the most
extensively studied in white and brown adipose tissues and in the liver (Zheng et al., 2001).
SCDs, introduce a cis double bond at position delta 9 in C16:0 and C18:0, which produces the
monosaturated fatty acid C16:1n-7 and oleic acid C18:1n-9.
![Page 11: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/11.jpg)
10
3.2 Fatty acid desaturases (FADs)
FADS1 and FADS2 are major FADs isoforms which are involved in formation of double bond
at delta 5 and delta 6 respectively (Cho et al, 1999). FADS1 (delta 5 desaturase) desaturation of
C20:3n-6 leads to C20:4n-6 and FADS2 catalyses the preliminary step in the biosynthesis of
C20:4n-6, C20:5n-3 and C22:6n-3, which are major substrate for the most of biological
signaling molecules (Matsuzaka et al, 2002, Stoud et al, 2009).
4 Transcriptional factors controlling the fatty acid metabolism
The elongation activities of the Elovl enzymes are mostly regulated on the transcriptional level
by transcription factors, and not by protein modification similarly to the activity of FAS. The
major transcription factors involved in control of regulation of Elovl gene expression are sterol
regulatory element binding protein (SREBP), liver X receptor, peroxisomes proliferator
activated receptor PPARα and PPARγ(table 1).
Gene
Expression (Tissue
specific or ubiquitously
expressed)
Transcription factors
Involved.
ACC1 Liver, adipose Increase in LXR
Increase in SREBP
Increase in PPAR alpha
FAS Ubiquitous Increase in LXR
Increase in SREBP
Increase in PPAR alpha
Elovl1 Ubiquitous Increase in LXR
Increase in PPAR alpha
SREBP
Elovl2 Testis, Liver, brain,
kidney, white adipose
tissue
Increase in SREBP
Elovl5 Ubiquitous Increase in SREBP-1a
Increase in SREBP-1c
Increase in LXR
Elovl 6 Ubiquitous Increase in SREBP-1, Increase in PPAR alpha
Table 1: Gene expression and transcription factors involved during fatty acid elongation.
![Page 12: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/12.jpg)
11
4.1 Sterol regulator element binding protein (SREBP)
SREBP regulates multiple genes involved in both synthesis of fatty acids and cholesterol as
well as the uptake of fatty acids and triglycerides synthesis (Horton et al., 2002). The SREBP
regulation has been seen both on transcriptional and posttranscriptional level (Goldstein et al,
2002). There are three different isoforms of SREBP i.e, SREBP-1a, SREBP-1c and SREBP-2
were SREBP-1a and 1c are derived from the same gene with variation in the transcription of
the gene (Hua et al., 1993). SREBP-1c regulates genes involvement in fatty acid synthesis and
SREBP-2 regulates the genes involved in cholesterol synthesis.
SREBP belongs to the basic helix- loop-helix leucine zipper class of transcription factors. The
SREBP protein is present in an inactive state in the endoplasmic reticulum (ER) with a
molecular weight of ~ 120kDa. There are two separate cleavage site present on the protein site
-1 protease (S1P) and site-2 protease (S2P), which are required to release the activated form of
SREBP known as the transcriptional active amino terminal domain. The protease S1P and S2P,
which promote the release of active form of SREBP, is also known as SREBP cleavage
activating protein (SCAP) (Rawson R B review. 2003).
In presence of high sterol level in the cell, SCAP-SREBP complex is intact in the ER
membrane. At low sterol levels, the active form of SREBP is released by sequential proteolytic
cleavage that occurs after the transported to Golgi apparatus where the SREBP- SCAP complex
encounters active S1P. During this step the SREBP precursor protein is released into two
halves and the active form of SREBP is released from the membrane and translocated into the
nucleus where it activated the transcription of target genes (figure 4)(Goldstein et al., 1997). It
is well characterized that SREBP modulates the transcription of genes encoding enzymes like
FAS, SCD-1, lipoproteins, ACC, Elovl6 and as well as the gene expression of Elovl2 and
Elovl5 involved in PUFA elongation (Horton et al., 2003). Overexpression of hepatic SREBP-
1a in mice increases the expression level of HMG-CoA synthase, ACC, SCD-1 and leads to
accumulation of cholesterol and triglycerides (Horton et al., 2003).
4.2 Peroxisome proliferator-activated receptors (PPAR)
PPARs are group of nuclear receptor proteins, which function as transcription factor in
regulation of gene expression. PPAR have 3 isoforms i.e., α, β and γ, which are encoded from
different genes. PPAR alpha is a steroid hormone receptor which is involved in activation of
beta oxidation. It is highly expressed in liver; small amount of expression is seen in adipose
![Page 13: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/13.jpg)
12
tissues, kidney and heart (Wang et al., 2006). PPAR β and γ are controlling genes involved in
lipid droplet formation mainly in liver and adipose tissues respectively.
Figure 4: SREBPs activation during low sterol level in the system (Adopted by D. Eberle et al., 2004)
5 Influence of food intake of fatty acid metabolism The amount of nutrients in the diet specially, the content of fat and carbohydrates regulates the
rate of the fatty acid synthesis. Fasting and refeeding studies explain the physiological
regulation of hepatic lipogenic genes of the animal studies. There is a change in the role flux
during the fasting conditions similar conditions are observed in cholesterol synthesis. During
refeeding, fat free high carbohydrate diet significantly increase the synthesis of fatty acids more
than normal fed state (Horton et al, 1998 review by Goodridge 1995).
The outcome of Elovl2 studies here will institute hepatic Elovl2 activity regulates the
expression of multiple enzyme and transcription factors involved in STD Chow and high fat
diet.
6 Aims:
This thesis follows two surveys with the title of “Analysis of Elovl2- ablated mice – a study of
diet and gene expression.
6.1) Analysis of the gene expression pattern in liver of WT and Elovl ablated mice under high
fat diet and normal diet.
![Page 14: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/14.jpg)
13
Previously reported in the Anders Jacobsson’s group that fatty acid elongase Elovl2, which
plays a key role in formation of C22 chain and long chain polyunsaturated fatty acid. Elovl2
mutant mice suffer from the impairment of fertility as well as the resistance towards diet
induces obesity and liver dysfunction knows as liver steatosis (Zadravec et al., 2011).
6.2) Understanding of the physiological regulation of lipogenic gene SREBP-1 by fasting and
refeeding in Wt and KO mice in STD chow diet.
SREBP-1is a lipogenic transcription factor were PUFA bind to and regulate the transcriptional
activity of several nuclear receptors, including PPARα (Peroxisome Proliferator Activated
Receptor alpha), PPARδ, PPARγ and also possibly LXR (Liver X Receptor). Preliminary data
imply that increased plasma levels of PUFA, EPA and especially DPAn-3 may be protective
against diet induced obesity and hepatic steatosis while reduced levels of the same being a risk
factor for metabolic diseases. The underlying mechanism can be explained on the basis of PUFA
attenuating lipogenesis via a complex positive-negative feedback loop in which SREBP-1c-
induced lipogenesis is suppressed by elevated levels of n-3 and n-6 PUFAs.
7 Materials and Methods:
7.1 Animals:
Elovl2 knockout (KO) mice were generated as described by Zadravec. D et al., (2011) (figure
5) heterozygote male offspring were bred with heterozygote 129/SV females and back crossed
for five generations (figure 5). All animal were single caged and housed at 20°c and 12 hrs
light / dark cycle was maintained. Animals were fed ad libitum chow diet (CH) and high fat
diet which was 39.9% in energy %fat and all the mice had free access to water. In this animal
study the mice were sacrificed with CO2. All the studies were performed within the ethical
permission from animal ethics board in Stockholm, Sweden.
![Page 15: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/15.jpg)
14
Figure 5: Elovl2 gene targeting construct, using neomycin resistance gene by replacing major portion of exon
three (Adopted from Zadravec. D et al., thesis 2010).
7.1.1 Diet experiments:
For fasting and refeeding experiment all the female mice were housed in single cages at 22°c
and 12hr light/ dark cycle. For fasting and refeeding experiment, totally 5 female KO and 5
female wild- type mice were used. Mice were fasted for 6 and 12 hours before sacrification and
liver isolation. During the experiment mice were feed ad libitum on chow diet for 6 and 12
hours. As experiment control both wild-type and KO mice were fed ad libitum and sacrificed at
the same time as the fasted or refed mice to collect liver for protein and gene expression
analysis (Table 2).
Type of Mice Non fasted
1 mouse
Fasted mice
2 mice
Refed mice
2 mice
WT CH 0, 6, 12,
+18,24 hours
6, 12 hours 6, 12 hours (Fasted)
and refed for 12
hours
KO Ch 0, 6, 12
+18, 24 hours
6,12 hours 6,12 hours (Fasted)
and refed for 12
hours Table 2: Fasting and refeeding experiment- number of mice and time period for liver isolation.
7.1.2 High-fat diet experiment:
For the 12 weeks high fat diet experiment, totally 14 wild-type and 14 KO male within the age
of 12 weeks mice were used and divided with in different form groups : 7 wild-type, 7 KO and
7 heterozygote (HZ). After high fat diet experiment the mice were sacrificed and tissues were
isolated.
7.2 RNA Isolation:
RNA was isolated from homogenized mice liver with Ultraspec TM RNA isolation kit (Biotex
laboratories Inc Houston TX), protocol given by the manufacturer.RNA was isolated from
around 100mg liver from both wild-type and KO was homogenized in 1 ml of Ultraspec
solution. After 5 minutes of incubation at room temperature, 200 µl of choloform was added
![Page 16: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/16.jpg)
15
and mixed/vortexed for 20 seconds. Prior to the spin the sample were incubated on ice for 5
minutes and centrifuged for 15 minutes at 14,000g. The upper layer supernatant was collected
in an equal amount of isopropanol was added to precipitation. All the tubes were incubated at 4
°c for 20 minutes and centrifuged at 14,000g for 10 minutes. The RNA pellet were washed with
1ml of 75% ethanol and centrifuged again at 14,000g for 10 minutes at 4 °C. After air drying
the pellet, 75 µl of double distilled water was added to the pellet and dissolved at 65 °c.
7.2.2 cDNA Synthesis:
RNA was extracted from mice liver and the concentration of the RNA was measured on a Nano
drop nd-100 Spectrophotometer (Thermo Scientific). cDNA was synthesized by using high
capacity cDNA kit from Applied Biosystems company. Two hundred ng of RNA from each
samples were reverse transcribed (RT). As master mix containing of 2 µl 10X RT buffer, 0.8 µl
25X dNTPs, 2 µl random primers, 1 µl multiscribe RT and 1 µl RNase inhibitor was mixed
together and aliquoted into the RNA sample total volume of 20 µl. cDNA synthesis was carried
out on PCR machine (Eppendorf), the program was set 10 minutes of incubation at 25°c, 60
minutes at 37°c and 5 seconds at 85°c and once the cycle is finished it was incubated at 4°c.
CDNA samples were diluted 1:10 ratio and stored at -20 °c.
7.2.3 Primer Designing:
DNA primers were designed by using the online software Primer Bank and Roche, which is a
universal probe library for mouse-helps in primer designing. There are also manual methods to
design primers by keeping many factors in mind like primer length, melting temperature, GC-AT
ratio etc (table 3).
7.2.4 Quantitative Real time PCR:
Quantitative real time polymerase chain reaction (RT qPCR) is method for the quantification of
the mRNA analysis, since the method is so commonly used for measurement of the gene
expression; real time qPCR is both rapid and sensitive and have the capacity to detect DNA
samples with low copy number. For quantitative measurement of the cDNA samples were
aliquoted in 96- well reaction plate (Applied Biosystem), 2 µl per well. A master mix containing
0.13 µl forward and reverse primers, 0.13 µl of reference dye and 4.11 µl of RNase free water
and measured in duplicate of each sample. Expression analysis was performed using an ABI
prism 7000 sequence detection system (Applied Biosystems) and started with 2 minutes at 50 °C
and then 10 minutes at 95°c followed by 40 cycles with 15 seconds at 95°C and 1 minute at 60°C
Results were calculated by Δ Ct = CT target – CT reference (From Applied Biosystems protocol)
and analyzed in Graphpad Prism.
![Page 17: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/17.jpg)
16
Gene Primers Sequence 5’---3’
TFIIB
Forward
Reverse
GTTCTGCTCCAACCTTTGCCT
TGTGTAGCTGCCATCTGCACTT
ACC1
Forward
Reverse
CGGACCTTTGAAGATTTTGTCAGG
GCTTTATTCTGCTGGGTGAACTCTC
FAS
Forward
Reverse
TGCTCCCAGCTGCAGGC
GCCCGGTAGCTCTGGGTGTA
PPAR γ
Forward
Reverse
AAGACCCAGCTCTACAACAGGC
GCCAACAGCTTCTCCTTCTCGG
ELOVL2
Forward
Reverse
AAC TTG CAG TGT CAG AAT CTC G
ACC ACA AGA CCT TGG CTA CC
ELOVL5
Forward
Reverse
GGT GGC TGT TCT TCC AGA TT
CCC TTC AGG TGG TCT TTC C
ELOVL6
Forward
Reverse
CCC GAA CTA GGT GAC ACG AT
CCA GCG ACC ATG TCT TTG TA
SCD1
Forward
Reverse
CCT ACG ACA AGA ACA TTC AAT CCC
CAG GAA CTC AGA AGC CCA AAG C
FADS1
Forward
Reverse
TCAACATGCACCCCCTCTTC
GATGGTTGTATGGCATGTGCTT
FADS2
Forward
Reverse
TCCAGTACCAGATCATCATGACAA
GGTGTAAGAAGAAACGCATATAGTAGCTG
PPAR alpha Forward
Reverse
ATGCCAGTACTGCCGTTTTC
TTGCCCAGAGATTTGAGGTC
SREBP-1
Forward
Reverse
GGAGCCATGGATTGCACATT
GCTTCCAGAGAGGAGGCCAG
SREBP-2f
Forward
Reverse
GATCACCCCGACGTTCAG
ACTTGAGGCTGCAGGACTTG
HRPL2
Forward
Reverse
TCCTCCTCAGACCGCTTTT
CCTGGTTCATCATCGCTAATC
Table 3: Primers for qPCR designed and obtained using the Universal Probe library.
![Page 18: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/18.jpg)
17
7.3)Isolation of subcellular protein fraction:
Crude nuclear extracts were isolated according to Gorski et al (Gotski et al., 1986, Sheng et al.,
1995). 1.2- 1.5g of liver is collected and rinsed in cold phosphate buffered saline and suspended
into 8 ml of buffer A, which consists of 10mM Hepes at pH 7.6, 25mM KCL, 1mM sodium
EDTA, 2M sucrose, 10% glycerol (V/V), 0.15mM spermine, 2mM spermidine and protease
inhibitors. The liver was homogenized in Teflon-glass homogenizer subjected to 3 to 4 strokes
equally. The homogenate was filtered by four layers of cheese cloth and in all the samples 10 ml
of buffer A was added to form a layer without disturbing the filtered homogenate and
centrifugated using beckham rotor at 24,000 rpm for 1 hr at 4 °c. After the centrifugation small
amount of supernatant is collected in form of whole cell lysate (cytoplasmic phase) and rest is
discarded. The resulting nuclear pellet was resuspended in 2ml of buffer B, which consist of
10mM Hepes at 7.6 pH, 100mM KCL, 2mM MgCl2, 1mM DDT and 10% (V/V) glycerol and
Proteinsae inhibitor. After adding 0.1 V of ammonium sulfate at pH 7.9 for salting out, each
mixture was gently agitated for 40 minutes at 4°c and centrifuge at 75,000 rpm in Beckman TLA
100.3 rotor for 45 minutes at 4°c. The supernatant is collected as nuclear extract and protein
estimation is done by Lowry method (Hartree E.F et al., 1971) and the protein is been quantity
by spectrophotometer at 750nM absorbance.
7.4) Western blot:
For preparation of SDS gel, the gel plates were washed and assembled (0.75mm separation
width). 10% of separation gel consists of 3.3ml of 30% acryl amide; 2.5ml of Tris buffer pH
8.8, 4.1ml of distilled water, 70µl of AMPS and 14 µl of TEMED were poured 2/3 full into the
gel assembly and 30-40 minutes of incubation time for polymerization. Stacking gel consists of
0.8ml 30% acryl amide, 1.25ml Tris buffer pH 6.8, and 2.9ml distilled water, 35µl AMPS, 7µl
TEMED and 7µl of bromophenol blue solution. Combs were set on the top gel and allow to set
approx. 30-40 minutes. Around 20 µg of protein samples were loaded to the gel and run at
100V for 1.5 hours in SDS electrophoresis buffer.
7.5) Immunoblotting:
The gels were soated into the transfer buffer 2 for 5-10 minutes with gentle shaking. The gel
proteins were electrotransfer into PVDF membrane (Amersham Hybound C extra pore size of
0.45 µm) by using a semi-dry electroblotter for 30 minutes at 2.5 mA/cm2 of membrane. After
transfer the membrane then washed with 20ml 1X TBST for 5 minutes at room temperature,
incubate the membrane with the blocking agent for 1 hour at room temperature with gentle
![Page 19: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/19.jpg)
18
agitation. Membrane was washed with TBST for 5 minutes at least 3 times, later the membrane
was incubate in the SREBP-1 primary antibody (Santa Cruz Inc.), 1:1000 dilutions in 10ml
primary antibody dilution buffer with gentle agitation over night at 4 °c. Wash the membrane
with TBST for 3 times for 5 minutes. Incubate membrane with HRP- conjugated secondary
anti- mouse (1:2000) and anti-biotin antibody (1:1000) in 10 ml blocking buffer with gentle
agitation for 1 hour at room temperature. Wash the membrane again with TBST 3 times for
5minutes and detect the proteins by Amersham ECl plus development kit. 1ml of reagent A and
25 µl of reagent B is used for membrane size 5*8.5cm2. Pour the ECl plus mixer for 5 minutes
and develop with CCD-camera.
8) Results:
8.1) Generation of Elovl2 KO and genotyping:
Previously Elovl2 KO mice were generated by Zadravec et. al by using ES cells by replacing
the major portion of exon three gene in Elovl2 (Figure 5)(Zadravec D et al.,2011 , Zadravec D
et al., 2010 Thesis). DNA analysis was performed by PCR to confirm the genotype of the
individual animal using tail DNA or DNA from ear punches of the mice. Wild type sized
around 2113 bp fragment and 3012bp fragment after ablated allele as seen in figure 6.
8.2) Elovl2 KO mice resistance to diet induced weight gain:
High fat diet (HF) studies for 12 weeks was recently performed by Jacobosson in the lab
(unpublished results by A. Jacobsson), and body weight was measured. HF wild-type mice
increases its body weight compare to HF KO mice, (figure 7a), whereas in the HF wild-type
mice increases the body weight compare to wild-type chow diet (Figure 7b).
Figure 6: Genomic DNA analysis of tail DNA from the wild-type and Elovl2 Ko mice.
![Page 20: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/20.jpg)
19
Figure 7: Body weight was measured from 0 to 12 weeks of wild-type and Elovl2 KO mice fed with chow diet and
high fat diet (unpublished results by A. Jacobsson).
Elovl2 enzyme is involved in the elongation of the Elovl5 products i.e. long chain fatty acids of
C 20, C20:4n-6 docosatetraenoic acid, eicosapentaenoic acid (20:5n-3; EPA) which are further
elongated into C24:4n-6 and C24:5n-3 (moon et al 2001, Wang et al 2008).
8.3) Gene expression for lipogenic markers:
PUFA are suggested to control gene expression of enzyme involved in lipogenesis as well as
lipolysis. To estimate the mRNA levels involved during the synthesis of fatty acid, we
examined the expression levels of different genes encoding the enzyme involved in lipogenesis
by using real time qPCR in Elovl2 KO and wild-type mice in two different diet conditions.
From our results there is an increase of mRNA levels in ACC-1, FAS and SCD in Elovl2 KO
under the influence of HF vs. chow diet (figure: 12, 13, 15 section: 10), but SCD-2 have very
low expression in both HF and CH diet (figure: 14, section: 10).
8.4) Gene profiling of lipogenic transcription factor:
Gene expression profiling in liver of wild-type and Elovl2 KO exposed to high fat diet shows a
difference between KO HF to wild-type HF (figure: 19 section: 10). The fatty acid synthetic
gene (Horton et al., 2002), mRNA level of SREBP-1 was down regulated in wild-type
compared to KO in high fat conditions.
Elovl5 gene is involved in making fatty acid substrate of 18 to 20 carbons in length, mRNA
expression of Elovl5 in wild-type CH is lower compare to the expression in HF wild-type and
Elovl 2 KO CH is higher compared to KO HF (figure: 16 section: 10). According to Wang et al
there is an up-regulation seen in Elovl2 and Elovl5 in high fat diet conditions and PUFA
enriched diet (Wang et al., 2005). Our data quantifies that Elovl5 gene in Elovl2 KO is
![Page 21: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/21.jpg)
20
suppressed in high fat diet resulting in decrease of arachidonic acid and also acts as feedback to
SREBP-1c.
Figure 8: Pathways for PUFA synthesis, illustrating the co-relationship between Elovl5 and Elovl2. (Courtesy to
Damir Zadravec, Thesis 2010).
8.5) Induction of SREBP-1 protein expression in wild-type and Elovl2 KO mice:
In order to check the loss of Elovl2 expression selectively altered the abundance of the cleaved
and transcriptional active nuclear form of SREBP-1. We verify the effects of SREBP-1c
mRNA level with protein level in wild-type and Elovl2 KO under chow diet. We used the
purified nuclear protein with the follow up of protocol Sheng et al (Sheng et al., 1995) with
small modifications and immunoblotting assay was performed with anti-mouse SREBP-1
antibody. The nuclear form of SREBP-1 was highly expressed in Elovl2 KO mice in the liver
compared to wild-type mice (Figure 9: lanes 1 and 2).
8.6) Regulation of SREBP protein and lipogenic gene expression in liver of fasted and
refed wild-type and Elovl2 KO mice:
In this experiment, I try to look into the SREBP gene and protein expression during fasting and
refeeding of wild type and Elovl2 KO mice. The proposed in a paper by Horton et al, explains
the importance of SREBP protein in cytosol and nucleic and its expression during non fasting,
fasting and refeeding conditions (Horton et al 1998 and 2002). Mice were fasted for 12 hrs and
![Page 22: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/22.jpg)
21
refed for 12 hr on chow diet. The liver was collected for mRNA expression studies and
immunoblotting for analyzing nuclear forms of SREBP-1.
To confirm physiological regulations of hepatic lipogenic gene, fasting and refeeding
experiments were conducted to analysis the pattern of SREBP-1 expression in fatty acid
synthesis pathway. When the mice were fasted for 6 and 12 hours, there was an increase of
protein expression level seen at 6 hours fasting leading marked decline in the nuclear form of
SREBP at compared with 12 hours (Figure 10: lanes 4 and 6). When the mice were refed for 6
and 12 hours the nuclear form of SREBP returned to normal level, but in 12hr refeeding there is
a hyper induced level of nuclear SREBP-1 protein expression (Figure 11: lanes 8 and 10).
12hr fasted (lane 5 wild-type and 6 KO), 6hr refed (lane 7 wild-type and 8 KO), 12hr refed
(lane 9 wild-type and 10 KO) and Biorad ladder.
Figure 9: Immunoblot analysis of SREBP-1 (lane 1- wild type nuclei, lane 2- KO nuclei, lane 3- wild-type
cytoplasmic, lane 4- KO Cytoplasmic and lane 5- Biotin ladder) in membrane, nuclear extract (lane 1 and 2),
Cytoplasmic extract (lane 3-4) and biotin ladder (lane 5). Immunoblot analysis was carried out with anti mouse
SREBP-1 (Santa Cruz Inc.).
8.7) The effect of fasting and refeeding at mRNA level:
Expression level in FAS in wild-type and KO control mice the expression of Elovl 2 is
increased compare to control wild-type mice. During 6 hr fasting condition there were no major
![Page 23: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/23.jpg)
22
changes between wild-type and KO mice. In 12 hrs fasting in KO expression is higher in
compared to wild-type mice (figure: 22 section: 10).
In basal level of FAS by refeeding is slightly elevated in KO compare to wild-type but it is
decreased in 12 hrs refeeding SREBP-1ac mRNA expression level showed little changes in as
expected from 6 hours than 12 hours. 12hr fasting in KO and but after 6hr mRNA level was
decreased, but the expression levels increased on refeeding (figure: 20 section: 10). According
to Paulina et al (Paulina P et al., 2009) up regulation of SREBP-1 in obese patients was
observed with a co-relation of down regulation of hepatitis PPAR alpha was observed however,
the mRNA level of relative PPAR alpha in fast and reefed Elovl KO and Wild type mice was
not changed (figure: 21 section: 10).
Figure 10: Immunoblot analysis of SREBP-1 protein in the liver of mice in non fast, lane 1- control wild-type, lane
2- control KO, lane 3- 6 hours fast wild-type, lane 4- 6 hours fast KO, lane 5- 6 hours refed wild-type, lane 6-
6hours refed KO and lane 7- biotin ladder (lane 1and 2), 6 hr fasted mice (lane 3 and 4), 6hr refed mice (lane5 and
6) and biotin ladder (lane7).
![Page 24: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/24.jpg)
23
Figure 11: Immunoblot analysis of SREBP-1 protein in the liver of mice in wild-type and Elovl2 KO in non fasted
(lane 1wild-type and 2 KO), 6hr fasted (lane 3 wild-type and 4 KO), 6hr refed (lane 5 wild-type and 6 KO), 12hr
fasted (lane 7 wild-type and 8 KO), 12hr refed (lane 9 Wild-type and 10 KO) and ladder (lane 11).
9) Discussion:
Liver plays a critical role in lipid metabolism; in order to understand the role of endogenous
PUFA synthesis and its importance of the enzymes involved in production of lipid metabolism
Elovl2 Ko mice were produced. Previously it has been shown that the fatty acid elongase
Elovl2 plays a key role in the synthesis of C20- C24 PUFA elongation of PUFA from C22 to
substrate specific 20:4n-6, 22:4n-6, 22:5n-3, C24:4n-6 and C24:5n-3 (figure 8)(Zadrevec et al.,
2011, Moon et al., 2008, Wang et al., 2005).
Expression of Elovl2 is highest in the testis and liver but mRNA expression can be detected at
lower levels in brain, white fat and kidney (Tvrdik et al., 2000). Male mice, deficient in Elovl2
show impaired fertility with a loss of normal spermatogenesis (Zadrevec et al., 2010). The
effect of Elovl5 KO mice is the inability to elongate C18:3n-6 to C20:3n-6 and C18:4n-3 to
C20:4n-3, which results in accumulation of C18 products and lower production of
arachondonic acid and DHA in liver. Interestingly this leads to overproduction of SREBP-1c
and an increase of lipogenic gene expression in the liver (Moon et al 2005). These fatty acids
produced by Elovl5 and Elovl2 have negative feedback to transcription factor SREBP-1ac,
which is involved in production of monosaturated fatty acids. Elovl5 and Elovl2 may have
same substrate (figure 8); the sequence similarity of both Elovl5 and Elovl2 is close to each
other.
![Page 25: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/25.jpg)
24
The liver of Elovl5 KO mice shows an increase in activity of elongation of Elovl2 substrate
such as 20:4n-6 and 20:5n-3. According to these findings not only production of PUFA by
Elovl5, but also those obtained by Elovl2 catalyzed elongation may significantly influence
SREBP-1c regulated lipogenesis (A.Jacobosson 20011 review).
In the present study we have looked into the gene expression under the conditions of chow diet
and high fat diet in our Elovl2 KO and wild-type mice. Lipogenic genes like FAS, ACC-1, and
SCD-1 are involved in synthesis of saturated and monounsaturated fatty acids. Theoretically in
the KO of Elovl2 mice these lipogenic genes should increase because there is no negative
feedback to the transcription factor SREBP-1 due down regulation of the enzyme which is
responsible of producing EPA, DHA they function as inhibitor to SREBP-1.
In Elovl5 KO mice mRNA level of genes involved in saturated and monosaturated fatty acid
synthesis, ACC-1, FAS, SCD-1 and Elovl6 is increased from in the liver. In these mice the
Elovl5 enzymes are not able to function due to the ablated gene and there is no further
elongation of C18:3n-6 to C20:3n-6 and C18:n-3 to C20:4n-3. The resulting consequence of
this KO, there is no feedback response to the transcription factor SREBP-1 and an over
expression of lipogenic genes is observed. (Moon et al 2005). According to Horton et al (2005)
Elovl5 KO mice mRNA level in ACC-1, FAS and SCD-1 increases compare to the Wild type
mice liver. Transcription regulating factor like SREBP-1ac, chREBP mRNA level changes in
Elovl5 KO, involved in production of ACC-1, SCD-1, FAS and Elovl6 (Moon et al 2005).
Our results suggest that the Elovl2 acts the same way as Elovl5, since they are not able to
function and elongate the carbon chain further, the mRNA levels in FAS, SCD-1, and ACC-1
increase in high fat KO compare to wild-type. ACC and FAS elongates beyond C16 on the
effect of diet intake, high fat diet and n-3 PUFA rich diet alters the hepatic Elovl2 and Elovl5
gene in mice. Elovl2 gene is up-regulated in high fat diet and n-3 PUFA rich, whereas in Elovl5
gene is suppressed by decreasing the arachidonic acid to linoleic acid (Wang et al., 2006,
Bianchi et al., 1990).
The effect of chow diet on SREBP-1 activity in our reported data, mRNA expression level of
SREBP-1c and the precursor from SREBP-1 were increased in Elovl2 KO mice liver,
indicating the activation of SREBP-1c transcription proteolytic processing, by increasing
stability of nuclear SREBP-1. In our current fast and refeeding experiment, the amount of
SREBP-1 expression in liver increases during 6 hr reduces at 12hr fasting in SREBP-1 level
and 6hr expression is twice the level above the non fasted mice (control mice). When the mice
were ab libitum refed a chow diet, the change in response of SREBP-1c in 12 hr increased
![Page 26: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/26.jpg)
25
compare to nonfasted mice. According to Horton et al increase in the nuclear expression of
SREBP-1c in refeeding indicates that increase in the cleavage of SREBP-1c precursor (Horton
et al., 1998). The pattern of nSREBP-1 level in Elovl2 Ko mice follows the pattern same in
wild-type, however the absolute level is much higher in KO mice.
![Page 27: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/27.jpg)
26
10) Appendix with extra figures:
Figure 12: Relative FAS/TFBii mRNA expression in liver from male Elovlo2 Ko mice fed with
Chow diet and high fat diet compared with wild type mice.
![Page 28: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/28.jpg)
27
Figure 13: Relative SCD1/TFBii mRNA expression in liver from male Elovl2 KO mice fed
chow diet and high fat diet compared with wild type mice.
![Page 29: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/29.jpg)
28
Figure 14: Relative SCD2/TFBii mRNA expression in liver from male Elovlo2 Ko mice fed
with Chow diet and high fat diet compared with wild type mice.
![Page 30: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/30.jpg)
29
Figure 15: Relative FAS/TFBii mRNA expression in liver from male Elovl2 KO mice fed chow
diet and high fat diet compared with wild type mice.
![Page 31: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/31.jpg)
30
Figure 16: Relative Elovl5/TFBii mRNA expression in liver from male Elovl2 KO mice fed
chow diet and high fat diet compared with wild type mice.
![Page 32: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/32.jpg)
31
Figure 17: Relative FADS1/TFBii mRNA expression in liver from male Elovl2 KO mice fed
chow diet and high fat diet compared with wild type mice.
![Page 33: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/33.jpg)
32
Figure 18: Relative FADS2/TFBii mRNA expression in liver from male Elovl2 KO mice fed
chow diet and high fat diet compared with wild type mice.
![Page 34: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/34.jpg)
33
Figure 19: Relative SREBP-1/TFBii mRNA expression in liver from male Elovl2 KO mice fed
chow diet and high fat diet compared with wild type mice.
![Page 35: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/35.jpg)
34
Figure 20: SREBP-1ac mRNA expression in liver from female nonfasted (Control), mice fasted
for 12 h (F), or mice fasted for 12h and refed a STD chow diet for 12h (R) as measured by
qPCR analysis in Elovl2 KO and WT mice.
![Page 36: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/36.jpg)
35
Figure 21: PPAR ALPHA mRNA expression in liver from female nonfasted (Control), mice
fasted for 12 h (F), or mice fasted for 12h and refed a STD chow diet for 12h (R) as measured
by qPCR analysis in Elovl2 KO and WT mice.
![Page 37: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/37.jpg)
36
Figure 22: Relative FAS/Hrpt2 mRNA expression in liver from female nonfasted (Control),
mice fasted for 12 h (F), or mice fasted for 12h and refed a STD chow diet for 12h (R) as
measured by qPCR analysis in Elovl2 KO and WT mice.
![Page 38: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/38.jpg)
37
11) Acknowledgements:
I would like to take an opportunity to thank everyone who has contributed to this thesis. I
would to thank.
My supervisor Prof. Ander Jacobsson for giving an opportunity to work as a master student and
letting me do a project with complete liberty and helping time to time. Second mentor Abbe
Asadi for helping me understand the concepts in molecular biology and inspiring in the lab
work. People at physiology department, I thank Anna, Amanda and Anastasia for helping in
during my experiments and a fun time in the lab. Robert and Anette for sharing the room with
me and all the enthusiastic talks, Massa and Nodi for helping me during the trouble with
protein work, Ida for being a really good friend and sharing the room, Natasa, Anna and
Yanling for helping with SDS gels and western blots.
I would like to thank my friends Emil, Clémentine, Simonas, Meit, Ramnath, Mona, Jonas,
Meher, and Ling for helping me focus and motivate for travel everyday to Stockholm.
12). References:
Agbaga M.P., Brush R.S., Mandal M.N., Henry K., Elliott M.H. and Anderson R.E. 2008. Role
of stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of very long chain fatty
acids. Proc. Natl. Acad. Sci. U. S. A. 105:12843-12848.
Brown M.S. and Goldstein J.L. 1997. The SREBP pathway: Regulation of cholesterol
metabolism by proteolysis of a membrane-bound transcription factor. Cell 89:331-340.
Bianchi A., Evans J.L., Iverson A.J., Nordlund A.C., Watts T.D. and Witters L.A. 1990.
Identification of an isozymic form of acetyl-CoA carboxylase. J. Biol. Chem. 265:1502-1509.
Cao H., Gerhold K., Mayers J.R., Wiest M.M., Watkins S.M. and Hotamisligil G.S. 2008.
Identification of a lipokine, a lipid hormone linking adipose tissue to systemic metabolism. Cell
134:933-944.
Duplus E. and Forest C. 2002. Is there a single mechanism for fatty acid regulation of gene
transcription. Biochem Pharmacol 64:893-901
![Page 39: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/39.jpg)
38
Eberle D., Hegarty B., Bossard P., Ferre P. and Foufelle F. 2004. SREBP transcription factors:
master regulators of lipid homeostasis. Biochemie 86:839-848.
Gorski K., Carneiro M. and Schibler U. 1986. Tissue-specific in vitro transcription from the
mouse albumin promoter. Cell 47,767-776.
Horton J.D., Shimomura I., Ikemoto S., Bashmakov Y. and Hammer R.E. 2003.
Overexpression of sterol regulatory element-binding protein-1a in mouse adipose tissue
produces adipocyte hypertrophy, increased fatty acid secretion, and fatty liver. J. Biol. Chem.
278:36652-36660.
Horton J.D., Shah N.A., Warrington J.A., Anderson N.N., Park S.W., Brown M.S. and
Goldstein J.L. 2003. Combined analysis of oligonucleotide microarray data from transgenic and
knockout mice identifies direct SREBP target genes. Proceedings of the National Academy of
Sciences of the United States of America 100:12027-12032.
Horton J.D., Bashmakov Y., Shimomura I. and Shimano H. 1998 Proceedings of the National
Academy of Sciences of the United States of America 95: 5987-5992.
Horton J.D., Shimomura I., Ikemoto S., Bashmakov Y. and Hammer R.E. 2003.
Overexpression of sterol regulatory element-binding protein-1a in mouse adipose tissue
produces adipocyte hypertrophy, increased fatty acid secretion, and fatty liver. J. Biol. Chem.
278:36652-36660.
Horton, J. D., Goldstein, J. L. and Brown, M. S. 2002. SREBPs: activators of the complete
program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125-1131.
Hua X., Yokoyama C., Wu J., Briggs M.R., Brown M.S., Goldstein J.L. and Wang X. 1993.
SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that stimulates transcription
by binding to a sterol regulatory element. Proceedings of the National Academy of Sciences of
the United States of America 90:11603-11607.
Jakobsson A.,Westerberg R, Jacobsson A.2006. Fatty acid elongases in mammals: Their
regulation and roles in metabolism. Progress in lipid research 45(2006)-237-249.
J Ha, J K.L., K S.K., L A.W. and K H.K. 1996. Cloning of human acetyl-CoA carboxylase-beta
and its unique features. Proceedings of the National Academy of Sciences of the United States
of America 93:11466-11470.
![Page 40: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/40.jpg)
39
Kim K.H. 1997. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr.
17:77-99.
Leonard A.E., Pereira S.L., Sprecher H. and Huang Y.S. 2004. Elongation of long-chain fatty
acids. Prog. Lipid Res. 43:36-54.
Leonard A.E., Bobik E.G., Dorado J., Kroeger P.E., Chuang L.T., Thurmond J.M., Parker-
Barnes J.M., Das T., Huang Y.S. and Mukerji P. 2000. Cloning of a human cDNA encoding a
novel enzyme involved in the elongation of long-chain polyunsaturated fatty acids. Biochem. J.
350 Pt 3:765-770.
Mandal M.N.A., Ambasudhan R., Wong P.W., Gage P.J., Sieving P.A. and Ayyagari R. 2004.
Characterization of mouse orthologue of ELOVL4: Genomic organization and spatial and
temporal expression. Genomics 83:626-635.
Matsuzaka T., Shimano H., Yahagi N., Yoshikawa T., Amemiya-Kudo M., Hasty A.H.,
Okazaki H., Tamura Y., Iizuka Y., Ohashi K., Osuga J., Takahashi A., Yato S., Sone H.,
Ishibashi S. and Yamada N. 2002. Cloning and characterization of a mammalian fatty acid
acyl- CoA elongase as a lipogenic enzyme regulated by SREBPs. J.Lipid Res. 43:911-920.
Moon Y., Hammer R.E. and Horton J.D. 2008. Deletion of ELOVL5 leads to fatty liver
through activation of SREBP-1c in mice. J. Lipid Res.
Moon Y.A., Shah N.A., Mohapatra S., Warrington J.A. and Horton J.D. 2001. Identification of
a mammalian long chain fatty acyl elongase regulated by sterol regulatory element-binding
proteins. J. Biol. Chem. 276:45358-45366.
Paulina P., Pozo TD., Araya J., Rodrigo R., Aray A.V., Smok G., Csendes A., Gutierrez L.,
Rojas J., Korn O., Maluenda F., Diaz J.C., Rencoret G., Braghetto I., Castillo J., Poniachik J.,
Videla L.A. 2009. Enhancement in liver SREBP-1c/ PPAR alpha ratio and steatosis in obese
patients: Correcelation with insulin resistance and n-3 long chain polyunsaturated fatty acid
depletion. Biochimica et Biophysica Acta 1792:1080-1086.
Stroud C.K., Nara T.Y., Roqueta-Rivera M., Radlowski E.C., Lawrence P., Zhang Y., Cho
B.H.,Segre M.,Hess R.A., Brenna J.T., Hascjek W.M and Nakamura M.T. 2009. Disruption of
FADS2 gene in mice impairs male reproduction and causes dermal and intestinal ulceration. J.
Lipid Res. 50:1870-1880.
![Page 41: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/41.jpg)
40
Sheng Z.,Otani H.,Brown S.M. and Goldstein L. J 1995. Independent regulation of sterol
regulatory element-binding protein 1 and 2 in hamster liver. Proc. Natl. sci. Vol 92, pp.935-
938.
Tvrdik P., Westerberg R., Silve S., Asadi A., Jakobsson A., Cannon B., Loison G. and
Jacobsson A. 2000. Role of a new mammalian gene family in the biosynthesis of very long
chain fatty acids and sphingolipids. J. Cell Biol. 149:707-718.
Tamura K., Makino A., Hullin-Matsuda F., Kobayashi T., Furihata M., Chug S., Ashida S.,
Miki T., Nakamura Y. and Nakagawa H. 2009. Novel lipogenic enzyme ELOVL7 is involved
in prostate cancer growth through saturated long chain fatty acid metabolism. Caner Res.
69:8133-8140.
Westerberg R., Tvrdik P., Unden A.B., Mansson J.E., Norlen L., Jakobsson A., Holleran W.H.,
Elias P.M., Asadi A., Flodby P., Toftgard R., Capecchi M.R. and Jacobsson A. 2004. Role for
ELOVL3 and fatty acid chain length in development of hair and skin function. J. Biol. Chem.
279:5621-5629.
Wakil S.J., Stoops J.K. and Joshi V.C. 1983. Fatty acid synthesis and its regulation. Ann. Rev.
Biochem. 52:537-579
Wang Y., Torres-Gonzalez M., Tripathy S., Botolin D., Christian B. and Jump D.B. 2008.
Elevated hepatic fatty acid elongase-5 (elovl-5) activity affects multiple pathways controlling
hepatic lipid and carbohydrate composition. J. Lipid Res.
Wang Y., Botolin D., Xu J., Christian B., Mitchell E., Jayaprakasam B., Nair M.G., Peters
J.M., Busik J.V., Olson L.K. and Jump D.B. 2006. Regulation of hepatic fatty acid elongase
and desaturase expression in diabetes and obesity. J. Lipid Res. 47:2028-2041.
Wang Y., Botolin D., Christian B., Busik J., Xu J. and Jump D.B. 2005. Tissue-specific,
nutritional, and developmental regulation of rat fatty acid elongases. J. Lipid Res. 46:706-715.
Zheng Y., Prouty S.M., Harmon A., Sundberg J.P., Stenn K.S. and Parimoo S. 2001. Scd-3a
novel gene of the Stearoyl- CoA desaturases family with restricted expression in skin.
Genomics 71:182-191.
Zadravec D, Jakobsson A . 2011. ELOVL2 controls the level of n-6 28:5 and 30:5 fatty acids in
testis, a prerequisite for male fertility and sperm maturation in mice , The Journal of Lipid
Research. doi: 10.1194/jlr.M011346.
![Page 42: Ravi Kumar Singhal - Uppsala Universityfiles.webb.uu.se/uploader/271/1819-Singhal-RaviKumar-report.pdf · Figure 1: Fatty acid synthesis and elongation of VLCFA. Fatty acid can be](https://reader034.vdocument.in/reader034/viewer/2022042120/5e99fbda24be714e2a0f856e/html5/thumbnails/42.jpg)
41
Reviews:
Rawson B Robert.2003. The SREBP pathway- Insights from INSIGS and INSECTS. Mol cell
biology Vol 4.
Hillgartner F.B., Salati M. L. and Goodridge. G. 1995. Physiological and molecular
mechanisms Involved in nutritional regulation of fatty acid synthesis. Physiological reviews
Vol. 75, No.1.
Shimano H. And Matsuzaka T. 2009. Elovl6: a new player in fatty acid metabolism and insulin
sensitivity. J. Mol Med 87:379-384.
Theses
Jakobsson A. 2005. Elovl3 and very long chain fatty acids, Role in metabolism.
Bronlinson A. 2009 Regulation of Elovl and fatty acid metabolism.
Zadravec D. 2010 Metabolic significance of fatty acid elongation.
Report:
Singhal R .K, 2011. The role of Elovl2 in fatty acid metabolism in mammalian cells. Research
training report 20hp.