MOLECULAR AND CELLULAR BIOLOGY, Feb. 1987, p. 698-707 Vol. 7, No. 20270-7306/87/020698-10$02.00/0Copyright © 1987, American Society for Microbiology

Recognition of Mutant and Cryptic 5' Splice Sites by the Ul SmallNuclear Ribonucleoprotein In Vitro

BENOIT CHABOTt AND JOAN A. STEITZ*Department of Molecular Biophysics and Biochemistry, Howard Hughes Medical Institute, Yale University School of

Medicine, New Haven, Connecticut 06510

Received 18 August 1986/Accepted 28 October 1986

We examined the ability of Ul small nuclear ribonucleoproteins (Ul snRNPs) to recognize mutant andcryptic 5' splice sites on beta-globin pre-mRNA substrates using an RNase T, protection assay. When UlsnRNPs were prebound to anti-(Ul)RNP antibodies, we detected binding to mutant but not to cryptic 5' splicesites on several substrates. By contrast, in a splicing extract at 0°C, neither the mutated nor cryptic 5' splicesites of a human beta-globin transcript were selected as protected fragments with the same antibodies.However, after incubation of the transcript in the extract to yield splicing intermediates, fragments thatincluded a cryptic 5' splice site were detected. The results of our analyses suggest that Ul snRNPs are involvedin recognizing cryptic 5' splice sites but that interactions with other splicing components are required tostabilize the association.

The 5' and 3' splice sites are regions at the ends of intronscontaining conserved sequences essential for splicing. Con-sensus sequences have been derived for both sites: cAG/GTAAGT (5' splice site) and (Pyr),NcAG/ (3' splice site)(25). At the 5' splice site, the G at position + 1 of the intronis absolutely conserved; position +2 is usually U, although Cexceptions have been reported (7, 9, 11, 16, 17, 36). In theremaining positions of the 5' splice site, a large variety ofsequences are compatible with splicing. Yet, alterations canhave various consequences depending on the nature andposition of the modification. In the human globin genes, forexample, a G-to-A transition at position +1 or +5 promotesthe use of cryptic 5' splice sites; only the change at position+1 completely abolishes splicing to the wild-type site (33,36). In other cases (e.g., adenovirus Ela gene), a mutationthat blocks splicing at the original site does not lead to theutilization of cryptic 5' splice sites (23, 24, 30). Cryptic sitescan also be activated by deletion of the normal 5' splice sitesequence (5, 10) or by decreasing the size of an intron below80 nucleotides (nt) (35).Ul small nuclear ribonucleoproteins (snRNPs) recognize

wild-type 5' splice sites from globin (2-4, 26) and adenovirusmajor late (B. Chabot, unpublished observations) tran-scripts. Base-pairing interactions (19, 29) most likely occurbetween the 5' end of Ul RNA and the 5' splice site.Experiments with a suppressor Ul RNA gene to rescuesplicing activity of a mutated Ela 5' splice site stronglysupport this notion (37). Analysis of cryptic 5' splice sitesequences (33, 36) reveals homology to the 5' splice siteconsensus although there is no obvious correlation betweenthe efficiency of utilization and the match. In general, thereappears to be a bias toward use of cryptic sites locatedupstream rather than downstream of the mutated normal 5'splice site. How cryptic splice sites are recognized and usedonly after alteration of other regions of the pre-mRNA is animportant question that has not been previously addressed.

* Corresponding author.t Present address: Division of Molecular and Developmental

Biology, Mount Sinai Research Institute, Toronto, Ontario, CanadaM5G 1X5.

Here we used antibody immunoprecipitation combinedwith RNase T1 digestion to analyze the sites of Ul snRNPbinding to mutant beta-globin transcripts. Our hope was toestablish whether cryptic 5' splice sites are recognized by UlsnRNPs; if so, are Ul snRNPs directed exclusively tocryptic sites after mutation of the normal 5' splice site ordoes the selection between sites take place at a later stage ofthe splicing process? In a splicing extract at 0°C, we foundthat neither the mutated 5' splice site nor the cryptic 5' splicesites are detected as protected fragments selected by anti-bodies to Ul snRNP [anti-(Ul)RNP]. Only after incubationin the extract to yield splicing intermediates are protectedfragments encompassing a cryptic 5' splice site recovered byimmunoprecipitation. We conclude that cryptic splice sitesare recognized by Ul snRNPs even though initial binding isnot detected.

MATERIALS and METHODS

Plasmid constructions. pSP64-HPA6 and -HPA6-IVS1-1Awere gifts from A. Krainer and T. Maniatis. The T7-rabbitglobin recombinants pT7-RP3G-WT and pT7-R3G-IVS2-1Awere constructed by insertion of a TaqI-EcoRI fragment ofthe rabbit beta-globin gene (a kind gift of C. Weissmann) intothe BamHI site of pAR864 (obtained from F. W. Studier)(26) after filling the ends of both DNA fragments withKlenow polymerase (provided generously by C. Joyce).PvuII linker (8 base pairs; New England BioLabs, Inc.,

Beverly, Mass.) insertion recombinants (pHPA6-1P, pH/A6M-1P) were generated by first partially digesting pSP64-HP1A6 and -HPA6-IVS1-1A with BstNI (nine sites). Thedigests were then incubated with Klenow polymerase to fillthe ends, and the random population of full-length linearswas gel purified. Ligation with PvuII linkers was performed,and screening for the desired recombinants was accom-plished through PvuII digestion. The constructs were recutwith PvuII and religated to ensure the presence of only onelinker. To generate large insertion recombinants (pHPA6-lP-113 and pHPA6M-1P-113), both pHPA6-1P and pH3A6M-1Pwere partially digested with PvuII, and a 113-nt-long frag-ment was inserted. This fragment (provided by D. Solnick) isan AluI fragment spanning positions 6234 to 6338 of the

698

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

Ul snRNP SPLICE SITE RECOGNITION 699

1 2 3 4 5 6 7 8 9101112

131415161718619

489 EIX -339C*-0-

* 300 *

291 [j-4 - - []-I [1-4 -E1-I 280EMEEl-

7A171

158 LI -

133 ( -

_A0 -149

-_ 167[]-_. -3142 133 Q:)-- 130C -

-O 120

U,) U,o C1d6

1 In s ._- - .-NCo 0*. CM _ No o

HPA6 H*AG HPAG-1P HPASM-1P H A6 HpASMIVSI-IA 1P-113 iP-1 13

FIG. 1. Time course of in vitro splicing of several SP6-human beta-globin transcripts. 32P-labeled transcripts extending to the Fnu4H site(lanes 1 to 12) or the BamHI site (lanes 13 to 18) were incubated in splicing extracts at 30°C, and at the times indicated (in hours), the reactionswere stopped, and the RNA was isolated and resolved on a denaturing 5% polyacrylamide gel. Identification of the products of the first stepof the splicing reaction was based on comparison of their electrophoretic mobilities with those of the Hl36-Fnu4H transcript (lanes 1 to 3)(4). The nature of each eluted band was confirmed by analysis of its T1 digestion products on a denaturing 20% polyacrylamide gel (notshown). The RNA species carrying the mutation (G to A at position +1 of the intron) are indicated with an asterisk (*). Next to each RNAspecies is indicated its size in nucleotides. The splicing products of sizes 171,120 and 149,142 (Hl36IVS1-lA, lanes 4 to 6) are generated bythe use of cryptic sites 1 (C-1) and 2 (C-2), respectively (see Fig. 5).

adenovirus 2 genome with filled EcoRI sites at each end andhas been described by Solnick (31, 32).SP6 and T7 transcripts and in vitro splicing reactions. SP6

plasmids were linearized for transcription by cleavage withBstI (an isoschizomer of BamHI, generously provided by C.Joyce), AccI, or Fnu4H (New England BioLabs). T7 plas-mids were cut with NcoI (New England BioLabs) andtranscribed (26). SP6 RNA substrates were capped duringtranscription (2, 21) in reaction mixtures (25 ,ul) containing50 ,uCi of [a-32P]-GTP when making substrates for theantibody-bound snRNP assay or 125 ,uCi for substrates usedin splicing extracts. All transcripts were gel purified (4). Thesplicing reactions were set up (18) with nuclear extractsprepared as described previously (6, 14).

T, protection experiments. The anti-(U1)RNP (Ag), anti-(U2)RNP (Ya), and anti-Sm (Y12) antibodies have beendescribed previously (2-4, 22). Binding assays with anti-body-bound snRNPs were performed on ice (3) with about100,000 cpm (Cerenkov) per assay. Immunoprecipitationand RNase T1 (Calbiochem-Behring, La Jolla, Calif.) diges-tion of splicing reactions and the recovery, fractionation,and analysis by T1 RNase fingerprinting (1) of T1-resistantfragments were performed as described previously (2-4).

RESULTS

Recognition of mutated 5' splice sites by antibody-bound UlsnRNPs. To optimize the possibility of detecting Ul snRNPbinding to mutant or cryptic 5' splice sites or both, we firstperformed experiments using snRNPs selected from a cellextract by binding to anti-(U1)RNP antibodies (3). Thismethod produces higher recoveries of wild-type splice site(15% yield relative to input RNA) than binding experiments

done in splicing extracts at 0°C (4%; see reference 2). Thesubstrate was a human beta-globin transcript (HPA6-IVS1-1A) that carries a 5' splice site mutation, a G-to-A transitionat position + 1 of the intron. In vivo, this mutation abolishessplicing at the normal site and promotes utilization of threecryptic 5' splice sites located at positions -38, -16, and + 13relative to the wild-type 5' splice site (33). In vitro, thecryptic 5' splice site at position -16 (c.2 in Fig. 5), is usedpredominantly (18) (Fig. 1, lanes 4 to 6). Binding and RNaseT1 protection experiments on the mutant (H1A6-IVS1-1A)compared with the wild-type (HPA6) transcript were done inthe presence of carrier DNA to reduce nonspecific interac-tions (Fig. 2A). Under these conditions, single fragments, Aand Am, from the wild-type and mutant transcripts, respec-tively, were detected. Fingerprint analyses (not shown)revealed that fragment A contained UUG, whereas fragmentAm contained AUUG. Thus, fragment Am corresponds to themutant and A to the wild-type 5' splice site (see Fig. 5). Therecovery of the mutated 5' splice site protected fragment wastwofold lower than that of the wild-type fragment (mutant,18%; wild type, 30%).We also investigated the interaction of antibody-bound Ul

snRNPs with both a wild-type and a mutant T7-rabbitbeta-globin RNA substrate (R3G-WT and R,BGIVS2-1A,respectively; Fig. 2B). The rabbit mutant RNA similarlycarries a G-to-A mutation at position + 1 but in the secondintron of the gene (Fig. 2C). In vivo, this mutation blockssplicing to the original 5' splice site and promotes the use ofthree cryptic sites (-135, -52, and +4) (36). The protectionprofiles obtained for the mutant and wild-type transcriptswere again similar (Fig. 2B), and fingerprint analyses con-firmed the identity of the various fragments (Fig. 2C).Fragments that contained the wild-type or mutant 5' splice

VOL. 7, 1987

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

700 CHABOT AND STEITZ

0A >

I

1 2 3 4 5

MOL. CELL. BIOL.

0~~~BaoI S.

12 3 4 5

-T-u

ro o

y-

e

A- 40 .1" AM

0-

I

- xm

a - v

o0 -w

- ym

Y- e rv

00a0 0 0N N N- NO

0 0 ooo carrier

0O -C24 DNA

tpg/imI

C~~~~~~~~~~~~~T (mutant onliy)

C.

wc.4 C.Z

5'ss

AGAAC ..... .... . . ....X

Y.YM

FIG. 2. Binding and proteCtion assays on globin transcripts with antibody-bound Ul snRNPs. (A) Wild-type (HPA6, lanes 1 to 3) andmutant (HPA6-IVS1-1A, lanes 4 and 5) SP6-human beta-globin transcripts extending to the Accl site (301 nt) were allowed to bind in the

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

Ul snRNP SPLICE SITE RECOGNITION 701

site were bound even when high amounts of carrier DNAwere present, confirming the results obtained with the hu-man beta-globin transcripts. At low concentrations of carrierDNA, four additional protected fragments were im-munoprecipitated (T, U, V, W; Fig. 2B, lanes 1 and 3). Theiridentities are illustrated in Fig. 2C.

Binding of Ul snRNPs to a mutant 5' splice site is notdetected in splicing extracts without incubation. We nextasked whether we could detect a similar pattern of protec-tion for the mutant human beta-globin transcript in a splicingextract. We limited our analysis to the human transcriptsmainly because their splicing behavior in vitro has beendescribed (18). We first assayed 5' splice site binding at 0 min(0°C) on truncated wild-type and mutant human beta-globintranscripts (Fnu4H series [291 nt]; 4). Surprisingly, in splic-ing extracts, we found that the same anti-(U1)RNP antibod-ies that detected 5' splice site binding when snRNPs wereprebound to antibodies did not precipitate any protectedfragment from the mutant transcript. Although 3' splicesite-containing fragments were recovered from this tran-script when the assay was performed with anti-Sm antibod-ies (fragments B, B', and B"; Fig. 3A, lanes 2 and 4), only aweak band comigrating with the wild-type 5' splice sitefragment (A) was observed (Fig. 3A, lanes 4, 9, and 10).Because of the low yield (about 10% relative to wild type) ofthis 15-nt fragment we were unable to analyze it further.Nonetheless, we asked whether the low recovery of thisfragment might be due the ionic strength of the washingbuffer. We found that the appearance of the mutant band wasmuch more sensitive to increases in salt concentration thanthe wild-type band (A). Fragment A was efficiently retainedat 0.5 M salt, whereas the mutant band was not detected at.0.25 M NaCl (Fig. 3A, lanes 5 to 12). Interestingly, 3'splice site binding was also lost at 0.25 M NaCl (lanes 7, 8and 11, 12).

Interaction of a cryptic 5' splice site with Ul snRNPs duringsplicing. Neither of the assays reported so far revealed anycryptic splice site binding by Ul snRNPs. Yet, in vitro, bothwild-type and mutant transcripts efficiently progress throughthe first step of the splicing reaction (Fig. 1, lanes 1 to 6). Inanother study (4), we took advantage of the fact thattruncating a beta-globin transcript at the Fnu4H site (291 nt,just beyond the 3' splice site) leads to the accumulation ofnormal splicing intermediates. Here, we utilized the same

strategy to analyze the mutant transcript. Upon its incuba-tion in a splicing extract, we observed that the truncatedmutant transcript (H13A6-IVS1-1A-Fnu4H) was cleaved pre-dominantly at position -16 (cryptic site c.2), although somesplicing intermediates were also generated by the use of c.1at position -38 (Fig. 1, lanes 4 to 6).We then analyzed the binding of Ul snRNPs to the

mutated and cryptic 5' splice sites after incubation of thetranscript under splicing conditions. The pattern of T1 pro-tection obtained with the truncated wild-type transcript(H1A6-Fnu4H) after incubation at 30°C is described in detailelsewhere (4). The profile generated with the mutant tran-script, H13A6-IVS1-1A-Fnu4H, differed from that of the wildtype in several ways (Fig. 3B). First, fragment Am, themutant version of the 5' splice site protected band A, wasundetectable (lanes 3 and 4). Second, although fragment E(branch site) was the same in assays with either the wild-typeor mutant transcript, fragment E' (an extended version of the5' splice site [2, 4]) was different for the mutant transcript(E'm, see Fig. 3C and 5). Fingerprint analyses indicated thatfragment E'm, generated upon anti-U1(RNP) (Fig. 4A, lane3) or anti-(U2)RNP or anti-Sm (Fig. 3B, lanes 3 and 4,respectively) immunoprecipitation of the mutant transcript,was displaced upstream relative to E' from the wild-typetranscript (see Fig. 5). Third, only one branch-containingfragment (Hm), but not its shorter version (fragment G), waspresent in the mutant immunoprecipitate. The branch hadformed between the usual adenosine located 27 nt upstreamfrom the 3' splice site and the guanosine residue of thecryptic 5' splice site at -16 (c.2). Fourth, a fragmentcomigrating with K was absent in immunoprecipitates de-rived from the mutant transcript (Fig. 3B). Instead, a newband, Km (26 nt), appeared (see Fig. 3C and 5).Are cryptic 5' splice sites recognized independently of the

mutated site? For the mutant transcript (HP,&6-IVS1-1A-Fnu4H), the shifted protection (fragment E'm) we observedcould indicate that a Ul snRNP had positioned itself at thecryptic site c.2 (-16) before the splicing reaction. Alterna-tively, because the mutated 5' splice site is also containedwithin this protected fragment, it was possible that we weredetecting events occurring at the mutated site and unrelatedto the presence of the nearby cryptic site. To rule out thispossibility, we inserted an 8-nt PvuII linker between thecryptic site and the mutated 5' splice site (total sequence

presence of the indicated amounts of carrier DNA to antibody-bound Ul snRNPs on protein A-Sepharose beads. The globin-derived RNAfragments which remained bound to Ul snRNPs after digestion with 1,500 (lanes 1, 4, and 5), 3,000 (lane 2), or 9.000 (lane 3) U of T1 RNaseper ml were fractionated on a 15% polyacrylamide-8 M urea gel. Fingerprint analyses (not shown) of fragments A and Am indicated that theyshared oligonucleotides CAG and UAUCAAG. In addition, fragment A contained the oligonucleotide U UG, whereas the mutant fragment Amcontained AUUG (see reference 2 for sequence of HPlA6). (B) T7-rabbit beta-globin transcripts extending to the NcoI site (344 nt) and carryingeither the wild-type (RPG-WT, lanes 1 and 2) or the mutant (RPG-IVS3-1A, lanes 3 to 5) 5' splice site were incubated as described above inthe presence of antibody-bound Ul snRNPs and the indicated amounts of carrier DNA. T, digestion was performed at 1,500 U/ml. Bands Uand V for the mutant and W for the wild type are seen here as doublets but have also been observed as a single (top) band in other experiments.Thus, additional nuclease trimming seems to be responsible for the appearance of the doublets. (C) The sequence of the T7-rabbit beta-globinRNA used for the binding experiment in panel B is taken from van Ooyen et al. (34) and Dunn and Studier (8). The changes affecting themutant transcript, RPAG-IVS2-1A, are shown above the sequence of the wild-type construct. A GG dinucleotide (UC in the wild type) hasarisen due to a cloning artifact at the junction of the T7 and mutant rabbit globin sequences. The positions of the cryptic sites c.1, c.2, andc.3, used when the gene carrying the G-to-A transition at position + 1 of the 5' splice site is expressed in vivo (36), are indicated. Cryptic sitesc.4 and c.1 are used when an intron of 69 nt or smaller is generated (35). The protected regions are underlined and correspond to theTl-resistant fragments obtained in panel B and analyzed by T, RNase fingerprinting (data not shown). Note that protected fragments V andW include a sequence (AAGGUGCUG) with homology to the 5' splice site consensus (six of nine match) and that fragment U contains oneof the cryptic sites (c.4) at position -65 that is used when introns shorter than 80 nt are artificially generated (35). Fragment T, which wasobtained only with the mutant transcript, has a sequence that resembles the 5' splice site consensus except for the C at position +2 (sevenof nine match). When the concentration of carrier nucleic acid (either DNA or RNA) was increased in binding experiments with both thewild-type and mutant rabbit transcripts, band U disappeared first, followed by bands V and W (data not shown). Fragment T was specificallyretained along with fragments Xm and Ym (X and Y in the wild type) at 1 mg of carrier RNA per ml (data not shown) or 0.2 mg of carrier DNAper ml (panel B, lanes 2 and 5). ss, Splice site.

VOL. 7, 1987

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

702 CHABOT AND STEITZ

Ca

Aj- U

i _

1 2 34wild-type mutant

5 6 7 8 9101112

H - f

G--S

S

M M 3ss_en- - 5'ss

E §E low- -E §E'

K- as -m

B+B~-

A-. a-E- E °

In °in a ° ,02 NaCI [m,ni

Sm

N E N En (A = (a

C E+E'G

.A

AG:

CAG

ACAG *

CCCCCCUG 1

UG4a

UUGak.

22

UAUCAAG ^

UUACAAG

3 * 86-40 O5- 4

AG

CAG AAG * .0Is9

CCCUG 1 <

. UAUCAAGF

Htm

0 GUG

ep

AUUG

2

3 D6ACuCUCUCUG eA

4 a4m19-mar WV

0AAG

CAAGAACGS

OUG

AUG UUG

* 9*

* 504

-0

B ,>t-It

1 2

-

E3 4

UG

UUG

0AUUG

* AG

CAG

CCCUG 1

MOL. CELL. BIOL.

G

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

Ul snRNP SPLICE SITE RECOGNITION 703

inserted, 9 nt). This insertion moved the cryptic c.2 to aposition 25 nt upstream of the mutated 5' splice site (see Fig.5). We inserted the same linker at the equivalent position inthe wild-type gene as a control.When the truncated version of the modified wild-type

transcript (HPA6-1P-Fnu4H) was added to a splicing extract,we detected correct and efficient production of splicingintermediates (Fig. 1, lanes 7 to 9). snRNP interactions withthe three intron regions that are normally bound was ob-served (Fig. 4A, lanes 5 to 7); fragments A and B, corre-sponding to the 5' and 3' splice sites, respectively, and a42-nt doublet band were immunoprecipitated with anti-(U1)RNP, anti-(U2)RNP, and anti-Sm antibodies (Fig. 4A,lanes 5 to 7). Fingerprint analyses (Fig. 4C) revealed that thedoublet contained two fragments, the expected branch sitefragment (E) and an extended version of the 5' splice site(EIL). EPL is likely the functional equivalent of the wild-typefragment E' (see Fig. 5), but it differed from E' in thatslightly more sequence downstream and less upstream of the5' splice site was protected. This result suggested that UlsnRNP binding might be slightly altered by insertion of thelinker sequence. Nevertheless, the protection still coveredthe 5' splice site, and the transcript proceeded efficientlythrough the first step of the splicing reaction (Fig. 1, lanes 7to 9). Three other major protected fragments were alsoobserved with HPA6-lP-Fnu4H RNA. Two of them (GL andHL) are derived from the branched intermediate and includesequences surrounding the branch site linked to sequencescoming from the 5' end of the intron (data not shown); theyare analogous to fragments G and H obtained from thewild-type transcript. The third protected fragment analyzedby fingerprinting (KL; Fig. 4C) mapped to exon 1, stopping 3nt short of the splice junction (see Fig. 5). The kinetics ofappearance of this fragment followed those of protectedfragments containing the branch (Fig. 4B), making KL theprobable equivalent of fragment K observed with H1A6-Fnu4H RNA (4) (see Fig. 5).

Results obtained with the mutant transcript containing the9-nt PvuII linker insert (HI3A6M-1P-Fnu4H) were unex-pected. Splicing at the 5' cryptic site c.2 was completelyabolished (Fig. 1, lanes 10 to 12). Disruption of the PvuIIlinker sequence by a 113-base-pair fragment derived from anadenovirus intron (31; see Materials and Methods) did notrescue splicing at cryptic site c.2 in vitro (Fig. 1, lanes 16 to18). Even though splicing intermediates cotild not be de-tected with HI3A6M-lP-Fnu4H, we nevertheless performedT1 RNase protection experiments after incubation in asplicing extract (Fig. 4A, lanes 8 and 9). In addition tonormal 3' splice site (fragment B) and branch site protection(fragments E and D), three bands of 10, 33, and 43 nt (Li,L2, and L3, respectively) were detected in anti-(Ul)RNP

and anti-Sm precipitates. Fingerprint analyses of thesebands revealed that they all map upstream of the mutated 5'splice site (Fig. 3C for L3; data not shown for Li and L2).Fragments L2 and L3 encompass cryptic site c.2 (Fig. 5).Fragment Li maps immediately upstream of but does notinclude the mutated nucleotide. Therefore, the mutated 5'splice site is not part of any of the major protected fragmentsgenerated.

DISCUSSIONThe experiments reported here were undertaken with the

goal of elucidating how Ul snRNP interaction with thepre-mRNA is related to cryptic splice site utilization aftermutation of a normal 5' splice site. We found that bindingassays performed under different conditions give slightlydifferent answers concerning the ability of Ul snRNPs torecognize mutated 5' splice sites. Strikingly, in splicingextracts at 0°C, when Ul snRNP protection of short frag-ments containing wild-type 5' splice sites is routinely ob-served (2-4), we did not detect significant binding to eitherthe mutated or an active cryptic 5' splice site on a humanbeta-globin transcript. Upon incubation at 30°C, however,extended protected fragments were selected by anti-(U1)RNP antibodies, suggesting that Ul snRNPs do interactwith the active cryptic 5' splice site.

Recognition of mutated but not cryptic 5' splice sites by UlsnRNPs in simple binding assays. Binding assays first per-formed with antibody-bound Ul snRNPs indicated thatseveral 5' splice sites carrying a G-to-A mutation in position+ 1 of the intron could be recognized by Ul snRNPs.Recoveries of protected fragments containing the mutated 5'splice site were twofold reduced compared with the wildtype. Although antibody-bound Ul snRNPs therefore bindmutated 5' splice sites that match the consensus sequence ineither seven or six positions of nine (for the rabbit and thehuman beta-globin, respectively), under the same condi-tions, cryptic 5' splice sites that exhibit a seven of nine fitwith the consensus (cryptic sites c.1 for both the rabbit andhuman globin gene [Fig. 2C and 5]) are not detected as boundfragments. It is possible that the position and nature of themismatch as well as the context of the site (28) differentiallyaffect the interaction with the 5' end of Ul RNA. Thecontnrbution of these factors to splicing of a pre-mRNA areonly now beginning to be probed systematically (28, 37).Mutated 5' splice sites are not detectably bound by Ul

snRNPs in complete splicing extracts. In contrast to theresults obtained with antibody-bound snRNPs, protection ofthe same mutated 5' splice site in a human beta-globintranscript was not obtained either at 0°C or after incubationin a splicing extract. Such behavior was observed with fourdifferent patient anti-(Ul)RNP antisera (data not shown).

FIG. 3. T1 RNase protection of the mutant human beta-globin substrate (HBA6-IVS1-lA) in a splicing extract. (A) Immunoprecipitationof TI-resistant fragments with anti-(U1)RNP (lanes 1 and 3) or anti-Sm (lanes 2 and 4 and 5 to 12) antibodies from splicing extracts incubatedat 0°C with the truncated wild-type HPA6 (lanes 1 and 2 and 5 to 8) or mutant HBA6-IVS1-lA (lanes 3 and 4 and 9 to 12) RNA (291 nt; seereference 4). Washes were performed with buffer containing 150 mM NaCl (lanes 1 to 4) or as indicated. The 32P-labeled RNA fragments wereresolved on denaturing 15% polyacrylamide gels. ss, Splice site. (B) Immunoprecipitation of TI-resistant fragments with anti-(U2)RNP (lanes1 and 3) or anti-Sm (lanes 2 and 4) antibodies. Protected fragments were immunoprecipitated from the splicing reaction incubated at 30°C for90 min with either the truncated wild-type (HOA6-Fnu4H) or mutant (H13A6-IVS1-1A-Fnu4H) beta-globin substrate. Protected fragments werefractionated on a 15% polyacrylamide-8 M urea gel. (C) Fingerprint analyses of some of the Tl-resistant fragments obtained from the wild-type(E/E') or mutant (E/E'm, Hm, Km) transcript from panel B. The analysis was performed on protected fragments derived from anti-(U1)RNP(E + E') or anti-Sm (E + E'm, Hm, Km) immunoprecipitations. Identification of the major spots was confirmed by RNase A secondaryanalyses (data not shown), while that of the minor ones was deduced by analogy with previously published data (4). The numbered spotsidentify common oligomers mapping to the branch-site region: 1, CACUG; 2, AUAG; 3, ACUCUUG; 4, ACUCUCUCUG; 5, CCUAUUG;6, UUUCUG. RNase A secondary analyses performed on a similar fingerprint of E/E'm originating from an [a-32P]CTP-labeled transcriptindicated that oligonucleotide UAUCAAG but not UUACAAG was present in fragment E'm (data not shown). Also, a spot positionedbetween AAG and AUG has not been consistently observed.

VOL. 7, 1987

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

704 CHABOT AND STEITZ

A 1 2 3 4

MOL. CELL. BIOL.

5 6 7

as - HL

&HLSub 0L

8 9 B1 2 3 4

_w-~ -H L

00- -GL-o

~ L2E+V-'- w-_E+E'm Is---E+ESL __,L

o _. L 2

e-B5B' em- B+B'

--A

-LI

-1T

- E --3 D 0l

"All Hose!VS$_IA

C EG

02

r- - T

_i E5 D V)

3 to

_ 0514

E+EIL

- E

145Au- P

L3

* AG

I AAG

AACGCAAG

CCCUCCAG

KL

UG

de

CUG0

#2@ 1

.*4fUAUCAAG

UUACAAG

UUG

UUUAAG *

.4~~~~*3 V 5

,* 4

1*

rp G

w AGCUG

0o

UG

S

0

CCC UCCAG

FIG. 4. RNase T, protection of SP6-human beta-globin RNA substrate after incubation in a splicing extract. (A) Immunoprecipitation ofT,-resistant fragments with anti-(U1)RNP (lanes 1, 3, 5, and 8), anti-(U2)RNP (lane 6), or anti-Sm (lanes 2, 4, 7, and 9) antibodies. Tl-resistantfragments were immunoprecipitated from splicing reactions incubated with truncated (Fnu4H series) HPA6 (lanes 1 and 2), HPA6-IVS1-1A(lanes 3 and 4), HPA6-1P (lanes 5 to 7), and HPA6M-1P (lanes 8 and 9) for 90 min at 30°C. After immunoprecipitation in the presence of T,

EE.EL

A-_

.O

6 -K L

e- -B+5'

-A

4356-IP

UG

AUGUUG

0

CAG

ACAG 4

wibw A&

4b 40

____WO -KL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

Ul snRNP SPLICE SITE RECOGNITION 705

K

HBA6

HBA6IVS1-1A

Ac.1 c.2 Ss c.3

.CGUUACUGCCCUGUGGGGCAAG AGUGAACGUGGAUGAAGUUGGUG GUGAGGCCCUGGGCAGVGUUGGUAUCAAG GUUACAAGACAGGUUUAAG ....A A

E'mK

KL

HBA6-1P

HBA6M-IP

C.1 c.2 Pu 111 5 's C.3

.CCUGUGGGGCAAG GUGAACGUGGAUGAAGUUGGUG GUGAGGCCCUbAIGGGGCAG GUUGGUAUCAAG GUUACAAGACAGGUUUAAGG..A

L2LI

FIG. 5. Sequence of the region containing the human beta-globin wild-type, mutated, and cryptic 5' splice sites showing regions protectedon various RNA substrates. The wild-type sequence is taken from the same sources as previously (2, 4). The change in the mutant transcriptis shown below the sequence. The insert sequence present on H36M-1P and HP6-1P is shaded, and the Pw',II site is indicated. The positionsof the cryptic sites used in vivo are indicated by white arrows. The 5' splice site(s) used in vitro by each transcript is indicated by blackarrowheads. Fragments K, Km, and KL are shown as open bars to suggest that they map on excised 5' exons (4). ss, Splice site.

Among possible explanations are the following: (i) A fac-tor(s) that is washed away from the Ul snRNPs bound tobeads via antibody, but present in the extract, may contrib-ute to the selectivity of binding by endowing the Ul snRNPwith discriminatory (proofreading?) ability. (ii) The bindingof antibodies might stabilize weak interactions between theUl snRNP and the template; thus, a weakly bound sitewould be more likely to be recovered if antibodies wereadded before rather than after the substrate. (iii) Some othersplicing component present in extracts might selectivelybind mutated 5' splice sites preventing access by UlsnRNPs. Whatever the correct reason, several observationsare consistent with the idea that additional factors in splicingextracts may associate with Ul snRNPs. First, we noted thatpreincubating an extract at 30°C for an hour is sufficient toabolish the very weak binding of the mutated 5' splice sitethat is detected only with anti-Sm antibodies (data notshown). Second, we found that some nuclear extracts (madefrom frozen cells) cannot splice a mutant globin transcript(H13A6-IVS1-1A) but do splice wild-type substrates (data notshown). Third, Mayeda et al. (20) have reported that afactor(s) associated with Ul snRNPs can enhance theirRNA-binding ability.

Cryptic 5' splice sites do interact with Ul snRNPs duringactive splicing. Protection experiments performed on mutanttranscripts incubated at 30°C in a splicing extract indicatedthat Ul snRNPs do associate with a cryptic 5' splice site.For the H13A6-IVS1-1A-Fnu4H substrate, the extended pro-tection at the 5' splice site was shifted upstream relative tothe corresponding protection on the wild-type substrate (Fig.5). This displacement was even more pronounced when alinker sequence was inserted between the cryptic site and

the mutated site (HPA6M-1P; Fig. 5). Thus, the locations ofprotected fragments which are immunoprecipitable withanti-(U1)RNP antibodies correlate with the position of thecryptic site c.2 and argue that Ul snRNPs interact with thisregion directly and independently of the mutated site. Wehave shown recently that extended 5' splice site protectedfragments from a wild-type globin substrate (fragment E' inH1A6-Fnu4H) are recovered exclusively from the spliceo-some fractions of a glycerol gradient (4). Hence, it is likelythat the corresponding fragments obtained from the mutanttranscripts (H,BA6-IVS1-1A-Fnu4H and HPA6M-lP-Fnu4H)are also derived only from spliceosome complexes.

Also found in spliceosome fractions is fragment K, whoselocation and kinetics of appearance are consistent with theidea that it originates from the excised 5' exon (4). Here, it isinteresting that similar protected fragments (KMand KL forHPA6IVS1-1A and Hf3A6-1P, respectively [Fig. 5]) are foundmapping at equivalent positions and therefore indicatingsnRNP interactions with excised 5' exons.Our deduction that the Ul snRNP is a component of the

spliceosome (4) rests both on the specificity of the anti-(U1)RNP antisera used in protection experiments and on theassumption that (U1)RNP antigens are stably associatedwith Ul RNA. The patient serum used here (Ag) has beenshown in Western blots to react exclusively with polypep-tides unique to the Ul snRNP (27). Many of our results werealso confirmed with another highly monospecific anti-(U1)RNP antiserum (Do)(data not shown). We know fromfractionation experiments (15) that antigenic polypeptidesremain bound to Ul RNA after exposure to a variety ofconditions, including 2 M urea. These observations do notprove but argue strongly that Ul snRNPs, rather than

RNase, 32P-labeled protected fragments were resolved on a denaturing 15% gel. Fragment D is a branch site protected fragment that has beendescribed by Black et al. (2). Fragment T has been described previously and corresponds to the capped 5' end of the RNA substrate (4). Notethat about fivefold-fewer counts for HPA6 RNA than for the other substrates were used in this assay. (B) Time course immunoprecipitationof TI-resistant fragments produced during splicing of HIIA6-1P-Fnu4H RNA. Splicing reactions were stopped at the times indicated andimmunoprecipitated with anti-Sm antibodies in presence of RNase T1. The recovered RNA fragments were fractionated as described above.(C) Fingerprint analyses of some TI-resistant fragments (E, L3, E + EL. and KL). The directions of the first and second dimensions areshown. Analyses were performed on protected fragments generated by anti-(U1)RNP immunoprecipitation (in the presence of RNase T1) ofHPA6-lP-Fnu4H (fragment E + EIL, KL) and HPzA6M-1P-Fnu4H (fragments E and L3) labeled with [a-32P]GTP. The identities of the spotswere deduced solely by comparing spot migration with well-characterized patterns obtained with similar transcripts (Fig. 3C) (2 and 4).

VOL. 7, 1987

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

706 CHABOT AND STEITZ

dissociated antigenic polypeptides or some other cross-reacting agent, are responsible for the protection of bothsmall and more extended regions containing 5' splice sites,as reported here and previously (2-4).The fact that we were not able to recover a small protected

fragment (equivalent to the wild-type 5' splice site fragmentA) mapping to a cryptic 5' splice site (Fig. 5) indicates thatthe binding of Ul snRNPs to this region is too weak to bedetected by our assay. Weak binding can be reconciled withthe following model for cryptic splice site utilization. First,we lknow that conversion of bound snRNPs into largercomplexes occurs very rapidly in a splicing reaction; ex-tended 5' splice site fragments can be detected as early as 2min after incubation at 30°C (4). Moreover, we can assume,as suggested by Reed and Maniatis (28), that a rate-limitingstep in splicing follows spliceosome formation. This is cer-tainly true in vitro since complexes form before the appear-ance of splicing intermediates (12, 13). Therefore, when anauthentic 5' splice site is mutated or absent, complexescommitted to cryptic splice site utilization accumulate, giv-ing rise to extended cryptic splice site protection (E'm andL3; Fig. 5). The proposed rate-limiting step ensures thatinitial differences in binding affinity do not have dramaticconsequences on the overall rate of splicing (28).

According to the above model, competition is likely toplay an important role in splice site selection. Mutations thatdecrease the affinity of Ul snRNPs for a 5' splice sitewithout interfering with other processes might still allowsplicing while permitting cryptic sites to compete for com-plex formation and thus splicing; this is possibly the situationwith changes at positions +5 or +6 in the human beta-globinfirst intron (33). A similar scenario may be responsible forthe effect of a double mutation at positions +5 and +6 of the5' splice site of the adenovirus Ela 12S gene. Splicing at the12S site is completely abolished when a functional 13S splicesite is present (30) but becomes moderately used when the13S site is inactivated (37). In other cases, mutated sitescould remain strong binding sites and block splicing bypreventing complex formation at potential cryptic sites.

Sensitivity of cryptic splice site use to surrounding se-quences. It was not expected that the 5' splice site mutanttranscript (HPA6M-1P) carrying a small insertion (9 nt)would be unable to splice, whereas its wild-type equivalent(HPA6-1P) can do so efficiently (Fig. 1, lanes 7 to 12). Thus,the linker insertion dramatically affects splicing to a nearbycryptic site (c.2) but not to a nearby wild-type site. Eventhough no splicing intermediates were formed with theHp,A6M-1P transcript containing the 9-nt insertion, the pro-tection profiles indicates that snRNP binding was normal(Fig. 4). Such observations reiterate the importance ofcontext to splice site utilization and demonstrate that dis-crimination can occur at multiple stages of the splicingprocess. Perhaps it is not surprising that cryptic sitesare more sensitive to changes in their environment thannormal splice sites, which have evolved to interact optimallywith the many components required to carry out intronexcision.

ACKNOWLEDGMENTS

We thank Adrian Krainer, Tom Maniatis, Tsuneyo Mimori, DavidSolnick, Bill Studier, and Charles Weissmann for generously pro-viding materials; Nouria Hernandez and Doug Black for theircomments on the manuscript; and Donna Villano for her typingskills.

This work was supported by a grant from the National ScienceFoundation.

LITERATURE CITED

1. Barrell, B. G. 1971. Fractionation and sequence analysis ofradioactive nucleotides, p. 751-759. In G. L. Cantoni and D. R.Davies (ed.), Procedures in nucleic acids research, vol. 2.Harper & Row, Publishers, Inc., New York.

2. Black, D. L., B. Chabot, and J. A. Steitz. 1985. U2 as well as Ulsmall nuclear ribonucleoproteins are involved in pre-messengerRNA splicing. Cell 42:737-750.

3. Chabot, B., D. Black, D. LeMaster, and J. A. Steitz. 1985. The 3'splice site of pre-messenger RNA is recognized by a smallnuclear ribonucleoprotein. Science 230:1344-1349.

4. Chabot, B., and J. A. Steitz. 1987. Multiple interactions betweenthe splicing substrate and small nuclear ribonucleoproteins inspliceosome. Mol. Cell. Biol. 7:281-293.

5. Dierks, P., B. Wieringa, D. Marti, J. Reiser, A. van Ooyen, F.Meyer, H. Weber, and C. Weissmann. 1981. Expression ofbeta-globin genes modified by restructuring and site-directedmutagenesis. ICN-UCLA Symp. Mol. Cell. Biol. 23:347-366.

6. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accu-rate transcription initiation by RNA polymerase II in a solubleextract from isolated mammalian nuclei. Nucleic Acids Res.11:1475-1489.

7. Dodgson, J. B., and J. D. Engel. 1983. The nucleotide sequenceof the adult chicken alpha-globin genes. J. Biol. Chem. 258:4623-4629.

8. Dunn,, J. J., and F. W. Studier. 1983. The complete nucleotidesequence of bacteriophage T7 DNA, and the locations of T7genetic elements. J. Mol. Biol. 166:477-536.

9. Erbil, C., and J. Niessing. 1983. The primary structure of theduck alpha-globin gene: an unusual 5' splice junction sequence.EMBO J. 2:1339-1343.

10. Felber, B. K., S. H. Orkin, and D. H. Hamer. 1982. AbnormalRNA splicing causes one form of alpha-thalassemia. Cell29:895-902.

11. Fischer, H. D., J. B. Dodgson, S. Hughes, and J. D. Engel. 1984.An unusual 5' splice sequence is efficiently utilized in vivo.Proc. Natl. Acad. Sci. USA 81:2733-2737.

12. Frendewey, D., and W. Keller. 1985. The stepwise assembly ofa pre-mRNA splicing complex requires U-snRNPs and specificintron sequences. Cell 42:355-367.

13. Grabowski, P. J., S. R. Seiler, and P. A. Sharp. 1985. Amulti-component complex is involved in the splicing of messen-ger RNA precursors. Cell 42:345-353.

14. Heintz, N., and R. G. Roeder. 1984. Transcription of humanhistone genes from synchronized HeLa cells. Proc. Natl. Acad.Sci. USA 81:2713-2717.

15. Hinterberger, M., I. Pettersson, and J. A. Steitz. 1983. Isolationof small nuclear ribonucleoproteins containing Ul, U2, U4, U5and U6 RNAs. J. Biol. Chem. 258:2604-2613.

16. Jongeneel, C. V., R. Sahli, G. K. McMaster, and B. Hirt. 1986.A precise map of splice junctions in the mRNAs of minute virusof mice, an autonomous parvovirus. J. Virol. 59:564-573.

17. King, C. R., and J. Piatigorsky. 1983. Alternative RNA splicingof the murine alpha A-crystallin gene: protein-coding informa-tion within an intron. Cell 32:707-712.

18. Krainer, A. R., T. Maniatis, B. Ruskin, and M. R. Green. 1984.Normal and mutant human beta-globin pre-mRNAs are faith-fully and efficiently spliced in vitro. Cell 36:993-1005.

19. Lerner, M. R., J. A. Boyle, S. M. Mount, S. L. Wolin, and J. A.Steitz. 1980. Are snRNPs involved in splicing? Nature (London)283:220-224.

20. Mayeda, A., K. Tatei, H. Kitayama, K. Takemura, and Y.Ohshima. 1986. Three distinct activities possibly involved inmRNA splicing are found in a nuclear fraction lacking Ul andU2 RNA. Nucleic Acids Res. 14:3045-3057.

21. Melton, D. A., P. A. Krieg, M. R. Rebagliati, T. Maniatis, K.Zinn, and M. R. Green. 1984. Efficient in vitro synthesis ofbiologically active RNA and RNA hybridization probes fromplasmids containing a bacteriophage SP6 promoter. NucleicAcids Res. 12:7035-7056.

22. Mimori, T., M. Hinterberger, I. Pettersson, and J. A. Steitz.1984. Autoantibodies to the U2 small nuclear ribonucleoprotein

MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.

Ul snRNP SPLICE SITE RECOGNITION

in a patient with scleroderma-polymyositis overlap syndrome. J.Biol. Chem. 259:560-565.

23. Monteli, C., and A. J. Berk. 1984. Elimination of mRNA splicingby a point mutation outside the conserved GU at 5' splice sites.Nucleic Acids Res. 9:3821-3827.

24. Montell, C., E. F. Fisher, M. H. Caruthers, and A. J. Berk.1982. Resolving the functions of overlapping viral genes bysite-specific mutagenesis at a mRNA splice site. Nature (Lon-don) 295:380-384.

25. Mount, S. M. 1982. A catalogue of splice junction sequences.Nucleic Acids Res. 10:459-472.

26. Mount, S. M., I. Pettersson, M. Hinterberger, A. Karmas, andJ. A. Steitz. 1983. The Ul small nuclear RNA-protein complexselectively binds a 5' splice site in vitro. Cell 33:509-519.

27. Pettersson, I., M. Hinterberger, T. Mimori, E. Gottlieb, andJ. A. Steitz. 1984. The structure of mammalian small nuclearribonucleoproteins: identification of multiple protein compo-

nents reactive with anti-(U1)RNP and anti-Sm autoantibodies.J. Biol. Chem. 259:5907-5914.

28. Reed, R., and T. Maniatis. 1986. A role for exon sequences andsplice site proximity in splice site selection. Cell 46:681-690.

29. Rogers, J., and R. Wall. 1980. A mechanism for RNA splicing.Proc. Natl. Acad. Sci. USA 77:1877-1879.

30. Solnick, D. 1981. An adenovirus mutant defective in splicingRNA from early region 1A. Nature (London) 291:508-510.

31. Solnick, D. 1985. Trans splicing of mRNA precursors. Cell42:157-164.

32. Solnick, D. 1985. Alternative splicing caused by RNA secondarystructure. Cell 43:667-676.

33. Treisman, R., S. H. Orkin, and T. Maniatis. 1983. Specifictranscription and RNA splicing defects in five cloned beta-thalassemia genes. Nature (London) 302:591-596.

34. van Ooyen, A., J. van den Berg, N. Mantei, and C. Weissmann.1979. Comparison of total sequence of a cloned rabbit beta-globin gene and its flanking regions with a homologous mouse

sequence. Science 206:337-344.35. Wieringa, B., E. Hofer, and C. Weissmann. 1984. A minimal

intron length but no specific internal sequence is requiredfor splicing the large rabbit beta-globin intron. Cell 37:915-925.

36. Wieringa, B., F. Meyer; J. Reiser, and C. Weissmann. 1983.Unusual sequence of cryptic splice sites utilized in the beta-globin gene following inactivation of an authentic 5' splice siteby site directed mutagenesis. Nature (London) 301:38-43.

37. Zhuang, Y., and A. Weiner. 1986. A compensatory base changein Ul snRNA suppresses a 5' splice site mutation. Cell 46:827-835.

VOL. 7, 1987 707

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 28

Oct

ober

202

1 by

211

.108

.99.

177.