recombinant expression of the brush border myosin i heavy chain

Cell Motility and the Cytoskeleton 32:151-161 (1995)

Recombinant Expression of the Brush Border Myosin I Heavy Chain

Kathleen Collins and Paul T. Matsudaira

Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, Cambridge

Although the specific functions of myosin I motors are not known, their localization to membrane structures suggests a function in membrane motility. Dif- ferent myosin I isoforms in the same cell or in different cells can possess different localizations. To determine if the localization and biochemical activity of the best-characterized mammalian myosin I, chicken intestinal epithelium brush border myosin I, was dependent on determinants of the membrane or actin cytoskeleton specific to epithelial cells, we transfected the cDNA for the heavy chain of this myosin into COS cells. Transient transfection of COS cells with the chicken brush border myosin I heavy chain resulted in the production of recombinant myosin I. Recombinant brush border myosin I localized to protrusions of the plasma membrane, particularly at spreading cell edges, and also to unknown cytoplasmic structures. Some cells expressing particularly high levels of brush border myosin I possessed a highly irregular surface. Recombinant brush border myosin I purified from COS cells bound to actin filaments in an ATP-dependent manner and decorated actin filaments to form a characteristic appearance. The recombinant myosin also catalyzed calcium-sensitive, actin-activated MgATPase activity similar to that of the native enzyme. Thus, any cellular factor required for the general membrane localization or biochemical activity of brush border myosin I is present in COS cells as well as intestinal epithelium. 0 1995 Wiley-Liss, Inc.

Key words: membrane localization, ATPase activity, actin binding, calmodulin, motility

INTRODUCTION

Most cells exhibit a constant movement of cellular membranes, including both the plasma membrane and intracellular organelles. Models of the forces which produce membrane movement have incorporated cytoplasmic flow, changes in the polymerization state of actin, or the action of molecular motors. In particular, the myosin family of mechanoenzymes has been predicted to play a role in promoting membrane motility. Myosins of the conventional, filamentous myosin I1 family have been shown to mediate diverse, membrane-associated motility events including cytokinesis, apical constriction of epithelial cells or cell sheets, receptor capping, and contrac- tion of cortical stress fibers [see Warrick and Spudich, 1987; Spudich, 19891. However, cells lacking or depleted of myosin I1 retain mechanisms for membrane

0 1995 Wiley-Liss, Inc.

ruffling, projection of the plasma membrane, and trans- port of membrane-bound organelles.

These types of membrane movement not affected by the loss of myosin I1 may be directed by the myosin I family of molecular motors. Myosin I enzymes from species as diverse as amoeba and mammals are com- posed of a single 110-140 kD heavy chain with unde- fined numbers of approximately 20 kD light chains [see Pollard et al., 19911. Several lines of evidence suggest that myosin I enzymes play a role in membrane motility. Endogenous myosin I isoforms of Acanthamoeba, Dic-

Received April 11 , 1995; accepted June 16, 1995.

Kathleen Collins, Ph.D., is now at 401 Barker Hall, Department of Molecular and Cell Biology, University of California, Berkeley, Ber- keley, CA 94720. Address reprint requests there.

152 Collins and Matsudaira

tyostelium, Aspergillus, F9, MDBK, NRK, CHO, 3T3, and PC12 cells localize to motile intracellular membranes, cell projections, or spreading cell edges [Baines et al., 1992; Fukui et al., 1989; Jung et al., 1993; McGoldrick et al., 1995; Ezzell et al., 1992; Wagner et al., 1992; Conrad et al., 19931. A myosin I isoform first identified in brush borders, the highly invaginated apical domain of absorptive intestine epithelial cells, is also associated with vesicles in the terminal web and with the basolateral cell membrane [Matsudaira and Burgess, 1979; Coudrier et al., 1981; Drenckhahn and Dermiet- zel, 1988; Collins and Matsudaira, 19911. Also, myosin I isoforms including those from Acanthamoeba and chicken brush border bind membranes and phospholipids in vitro [Adams and Pollard, 1986, 1989; Hayden et al., 19901, and chicken brush border myosin I can be purified in association with the plasma membrane or Golgi membrane vesicles [Mooseker et al., 1989; Fath and Burgess, 19931. This association of myosin I enzymes with membranes does not impede motor activity: Acanthamoeba and chicken brush border myosin I isoforms can move membrane fragments in in vitro motility assays [Adams and Pollard, 1986; Mooseker et al., 19891.

Although myosin I isoforms in general are localized to membranes, the distinct localization of different isoforms suggests a specialization of their functions. In Acanthamoeba, the relative distributions of myosins IA, IB, and IC have been quantitated by immunoelectron microscopy [Baines et al., 19921. Although all isoforms associate with the plasma membrane, other localizations are specific: myosin 1A with small, cytoplasmic vesicles; myosin 1 B at the tips of advancing pseudopods; and myosin 1C at the contracile vacuole. The cloning of myosin I isoforms revealed that at least some isoforms differ in sequence predominantly in their non-motor or “tail” domains [see Hammer, 19911. Thus, the specificity of isoform localization could derive from unique targeting or regulation by sequences in the motor’s tail. However, differential interaction of the motor domain with actin could also promote distinct localizations of myosin I isoforms: some myosins might not bind actin filaments with or without particular actin binding proteins such as tropo- myosin [Collins and Matsudaira, 19911.

We desired to investigate whether any determinants of brush border myosin I localization were present in a non-epithelial cell type. This had been investigated previously by microinjection of purified brush border myosin I into NIH 3T3 cells [Footer and Bretscher, 19941. Microinjection resulted in localization of the myosin I to microvilli and to peripheral actin-containing structures. However, it is not known whether these localizations of the myosin I were determined by previous association or modification of the myosin at brush border membranes, or whether the microinjected myosin I remained bio-

chemically active. Also, we wanted to determine if the biochemical activities of brush border myosin I would be similar for recombinant protein expressed in a heterologous cell compared with the native brush border enzyme. In contrast with myosin I1 proteins, which possess spe- cialized light chain subunits, the light chains of brush border myosin I are the ubiquitous regulatory protein calmodulin. Cell-heterologous calmodulin can function- ally substitute for calmodulin purified with the chicken brush border myosin I heavy chain [Conzelman and Mooseker, 1987; Collins et al., 19901. Thus, the recombinant brush border myosin I heavy chain could be sta- bilized and activated by association with calmodulin from a heterologous cell type.

In this manuscript we describe the cloning of the complete chicken brush border myosin I coding region and its expression in COS cells by transient transfection. COS cells were chosen for these studies due to their high efficiency of transfection and their highly motile nature. This dynamic cell motility is in contrast with the stable polarity of an intestine epithelial cell. Thus, we could examine whether brush border myosin I, without any brush border-specific associations or modifications, would adopt a localization similar to the myosin I isoforms normally expressed in motile cells. We observed the localization of recombinant brush border myosin I to protrusions of the plasma membrane and to unknown cytoplasmic structures reminiscent of membranous organelles. Some cells expressing the highest levels of brush border myosin I appeared to develop extremely extended or irregular membranes. Recombinant brush border myosin I purified from COS cells catalyzed the ATP-dependent actin-binding and actin-activated MgATPase activities of the native enzyme. Thus, the concentration of myosin I at protrusions of the plasma membrane and intracellular structures may reflect a re- cruitment of the active motor to sites of myosin I-mediated motility in COS cells.

MATERIALS AND METHODS Cloning of the Chicken Brush Border Myosin I Heavy Chain

To isolate a full-length cDNA for the heavy chain of chicken brush border myosin I, we screened a random-primed, chicken intestine epithelial cell cDNA library. This library [deArmda et al., 19901 was ligated with Eco RI linkers in XgtlO. A total of lo6 unamplified phage plaques were blotted to nylon filters, denatured, and baked [Sambrook et al., 19891. Probe for hybridiza- tion was made by polymerase chain reaction (PCR) am- plification of a 268 bp fragment near the 5‘ end of the reported partial chicken brush border myosin I cDNA [Garcia et al., 19891. Oligonucleotide primers were syn-

Recombinant Brush Border Myosin I 153

myosin I heavy chain (approximately 20% of the popu- lation). However, immunofluorescence of transfected cells (see Results), a more sensitive assay, indicated that at least 50% of cells expressed some level of the chicken brush border myosin I heavy chain. Approximately 1 pg of recombinant heavy chain was expressed per 35 mm plate of cells (see Results).

thesized to correspond to nucleotides 49-73 of the coding strand and nucleotides 293-317 of the non-coding strand of the published sequence [Garcia et al., 19891. Total intestine epithelial cell mRNA was reverse tran- scribed to produce template for the PCR reaction according to kit instructions (Boehringer-Mannheim, Indiana- polis, IN). PCR was performed with approximately 1 pg total intestine epithelial cell cDNA, 200 pM dNTPs ex- cept dCTP, 100 pM dCTP, 30 pCi (0.1 pM) a3,P- labeled dCTP, and 25 pmol of each primer. The expected product of 268 bp was gel purified and used for hybrid- ization. Filters were hybridized and washed at 65°C in 3X SSC (450 mM NaCl, 45 mM sodium citrate, pH 7.0). Four positive clones were isolated after two rounds of replating from the original library. Inserts from the four clones were subcloned into MI3mp19. Both strands of all four clones were sequenced by dideoxy chain ter- mination methods according to kit instructions (USB, Cleveland, OH). The resulting 3,480 bp of contiguous sequence, including the complete open reading frame, can be obtained from GenBank with accession number U04049.

Expression Vector Construction Vector pLENBAP (Gene Huh and Richard Hynes,

M.I.T.; see text for description) was linearized at the Bam HI cloning site. A 3.2 kb fragment containing coding and 3‘ untranslated regions of the chicken brush border myosin I heavy chain was obtained as a single fragment by restriction digestion of the largest cDNA with Nco I (a single site occurs at the myosin I start codon) and Eco RI (added to the ends of cDNAs during library construction). After restriction digestion, vector and cDNA fragment ends were repaired to fill in single- stranded DNA overhangs with Klenow and the desired fragments were gel purified. The fragments were ligated and transformed into DHSa. The recovered plasmid used for transfection was subject to restriction digestion analysis and resequencing, verifying that the clone retained the authentic myosin I start codon.

Transfection of COS Cells COS-7 cells were plated to a density of 106/100

mm plate (60 cm2 area) 12-24 h before transfection. Transient transfection with DEAE-dextran was performed according to standard procedures [Cullen, 19871, with 5 pg of DNA in 2 ml of PBS (pH 7.4) for each 100 mm (60 cm2) culture of cells. Cells were harvested for protein purification approximately 70 h after transfection. Efficiency of transfection was determined by par- allel transfections with a P-gal expression vector as described [Lim and Chae, 19891. Transfection efficiency determined in this manner corresponded to the number of cells expressing high levels of the chicken brush border

Purification of Recombinant Myosin I After trypsinization and washing in PBS, cells

were resuspended in buffer for lysis: SO mM Tris HCI, pH 7.5, 100 mM NaCl, 1 mM EGTA, 1 mM MgCI,, 3 mM NaN,, 1% NP-40, 20 pg/ml leupeptin, 100 pg/ml aprotinin, and 100 pg/ml PMSF. Cells were allowed to lyse on ice for 10 min, then were centrifuged for 10 min in a microcentrifuge. The supernatant was diluted with an equal volume of buffer (1 0 mM imidazole, pH 7.3, 10 mM NaCl, 1 mM EGTA, 0.1 mM MgCl,, 10% sucrose, and 1 mM NaN,). MgCI, (10 mM) and NaATP (10 mM) were added before recentrifugation at 40,OOOg for 20 min .

The supernatant from recentrifugation was mixed overnight with 2/3 volume of S-Sepharose (Pharmacia, Piscataway , NJ) equilibrated in the dilution buffer above. Unbound proteins were removed by washing in batch with buffer, then bound proteins were eluted. Two elutions in batch were done, each equal in volume to the resin volume: one elution was in buffer with 1 M NaCl (thus 0.5 M NaCl final); the second elution was in dilution buffer with 0.5 M NaCl. Eluted proteins were pooled and dialyzed into dilution buffer for 4 h , centrifuged to remove precipitate, adjusted to 5 mM dithio- threitol (DTT), filtered through a 0.22 pm syringe-tip filter, and loaded on a Mono Q HR 5/5 fast protein liquid chromatographic (FPLC) column (Pharmacia). Bound proteins were eluted with a gradient to 1 M NaC1.

Some fractions containing myosin I were additionally purified by chromatography on ATP agarose [Barylko et al., 19921. Pooled fractions were desalted on a PD-10 column (Pharmacia) into buffer containing 10 mM imidazole, pH 7.3, 0. I mM MgCI,, 1 mM EGTA, 10% sucrose, 3 mM NaN,, and 0.1 M NaCl. ATP agarose (N-6 linkage; Sigma, St. Louis, MO) was equilibrated, loaded, and washed in this buffer. Bound proteins were eluted with buffer supplemented to 1 M NaCl. The ATP agarose column (4 ml) was run at 10 ml/h and stored at -20°C in buffer mixed with an equal volume of glycerol.

All chromatography was done at 4°C and all chromatography resins were used only for COS cell extracts. The protein concentration of myosin in purified samples was determined by comparison of the intensity of silver staining of samples from COS cells with the silver stain-


ing of a dilution series of native chicken brush border myosin I of known concentration.

Western Blotting Proteins from 5 to 20% sodium dodecyl sulfate-

polyacrylamide gel electrophoresis (SDS-PAGE) gradient minigels were transferred to nitrocellulose at 0.5 A for 1.5 h in 10 mM 3-[cyclohexylamino~-l-propane sul- fonic acid (CAPS) with 20% methanol, pH 11. The nitrocellulose was incubated in 3% bovine serum albumin (BSA) in PBS (pH 7.4) at 37°C for approximately 1 h, then incubated in a 1 : 1,000 dilution of rabbit polyclonal antiserum raised and affinity purified against chicken brush border myosin I [rabbit 7-87; Collins et al., 19901 in 3% BSA/PBS at 37°C for approximately 2 h. Three washes of 15 min each in PBS and PBS + 0.05% NP-40 were done, then the blot was incubated in a 1:1,000 dilution of alkaline phosphatase-conjugated goat anti- rabbit IgG (ICN, Costa Mesa, CA) in 3% BSA/PBS at 4°C overnight. Washes were repeated, then the blot was developed with 250 pg/ml 5-bromo-4-chloro-3-indolyl phosphate and 500 pg/ml nitro blue tetrazolium in 100 mM Tris HCl, pH 9.5, 100 mM NaCl, and 5 mM MgCI,.

Silver Staining Five to 20% gradient SDS-PAGE minigels were

soaked twice for 10 rnin in 50% methanol, once for 5 rnin in 5% methanol, and washed twice with water briefly. Gels were then incubated for 20 rnin with 5 pg/ml DTT and for 20 min with fresh 0.1% silver nitrate. After two brief rinses in water, gels were rinsed and developed in fresh 3% sodium carbonate with 0.01 85% formaldehyde. One fifth volume of 2.3 M citric acid was used to quench development.

Actin Binding Assays Actin was purified from acetone powder of rabbit

skeletal muscle as described [Taylor and Weeds, 19761, with concentration determined by absorbance at 290 nm. For pelleting, actin (8 pM final concentration) diluted in Mono Q chromatography buffer and recombinant myosin, as purified from the Mono Q column, were mixed with 2 mM MgCl, with or without 1 mM ATP, incubated on ice for 20 min, and centrifuged at 100,000 rpm in a TL-100 centrifuge (Beckman, Palo Alto, CA) for 10 min. Pellets were resuspended to initial volume, 1/5 volume of sample buffer was added to supernatants and pellets, and equal volumes of each were run on 5-20% SDS-PAGE minigels. For electron microscopy, actin (2 pM final concentration) was added to myosin purified over the Mono Q column. The sample was incubated on ice for 20 min, applied to a carbon-coated copper grid, and stained with 2% uranyl acetate.

MgATPase Activity Hydrolysis of A3,P-labeled ATP was assayed by

organic extraction as previously described for brush border myosin I [Collins et al., 19901. For each assay, four time points were taken at 15 rnin intervals to calculate rates and errors by linear regression. Reactions were performed at 37°C in buffer of 10 mM imidazole, pH 7, at 37"C, 2 mh4 MgCl,, 1 mM DTT, 1 mM ATP, 0.2 mM EGTA +- 0.2 mM CaCl,. Myosin eluted from the ATP agarose column was dialyzed against 10 mM imidazole, pH 7, at 37"C, 2 mM MgCl,, and 0.2 mM EGTA immediately before use in this assay.

lmmunofluorescence Cells were replated onto coverslips 48 h after trans-

fection, 20 h before fixation. Cells were rinsed with PHEM (60 mM PIPES, pH 6.1,25 mM HEPES, 10 mM EGTA, 2 mM MgCl,), fixed for 5 rnin with 4.2% para- formaldehyde in PHEM (pH 6.9), then immediately placed in cold acetone for 5 min [Schliwa and van Blerkom, 19811. Coverslips were washed twice and incubated once for 10 rnin with 1% BSA in PBS (pH 7.4), then incubated with a 1 : 10 dilution of rabbit polyclonal affinity-purified antiserum specific for brush border myosin I [rabbit 7-87; Collins et al., 19901 in 1% BSA/PBS for 1 h at 37°C. Coverslips were washed 3 times for 5 rnin in 1% BSNPBS, then incubated with a 1:100 dilution of Texas red-conjugated anti-rabbit secondary anti- body in 1% BSA/PBS for 30 min at 37°C. Three 5 min washes were repeated, and coverslips were either rinsed directly in PHEM (pH 6.9) twice or incubated at 20°C with 165 nM fluorescein-conjugated phalloidin in PHEM (pH 6.9) for 7 min before rinsing. Coverslips were mounted in PHEM (pH 6.9). Fluorescence was imaged with a MRC-500 confocal scanning microscope.

RESULTS Isolation of a Full-Length Chicken Brush Border Myosin I Heavy Chain cDNA

A partial sequence of the chicken brush border myosin I heavy chain cDNA has been reported [Garcia et al., 19891. Using primers within the reported sequence, a 268 bp fragment of the gene was amplified by PCR from total chicken intestine epithelial cell cDNA (see Materials and Methods). This probe was used to screen a random-primed, chicken intestine epithelial cell AgtlO cDNA library [deArruda et al., 19901. Four independent positive clones were obtained from screening approximately lo6 phcge plaques (see Materials and Methods). Two distinct clones included the entirety of a 1,045 amino acid open reading frame. Among the four clones, some differences in sequence at the third base of a codon


ogous cell type, we transfected monkey-derived COS cells. COS cells lack a myosin I isoform cross-reactive by Western blot or irnmunofluorescence with pol yclonal antiserum raised against brush border myosin I, and are highly motile. Thus, a myosin I expressed in COS cells would be expected to perform different functions and adopt a different localization than a myosin I expressed predominantly in epithelial cells with a highly special- ized brush border cytoskeleton. We used an expression vector, pLENBAP, consisting of an SV-40 enhancer el- ement, p-actin promoter, human growth hormone poly- adenylation signal, and pUC8 backbone (vector courtesy of Gene Huh and Richard Hynes, M.I.T.). The entire coding and 3' untranslated region of the myosin I cDNA was inserted at the vector cloning site to create a construct, pLENBAPmI, which should produce a recombinant myosin heavy chain initiated and terminated at sites identical to translation of the native protein (see Materi- als and Methods).

Expression of the recombinant myosin protein was assayed after transient transfection of the pLENBAPmI construct into COS cells (see Materials and Methods). Only transfected cells contained a polypeptide at 110 kD immunoreactive with an affinity-purified antiserum [Col- lins et al., 19901 against the myosin I heavy chain (Fig. 2A, lane 1 ) . By comparing the immunoreactive signal of recombinant myosin from COS cells on the same blot with a dilution series of purified chicken brush border myosin I, we conclude that the transfected cells express approximately 1 pg of the brush border myosin I heavy chain per 35 mm plate of cells (not shown).

Localization of Recombinant Myosin I To determine the cellular localization of the recom-

binant brush border myosin I heavy chain, cells were fixed 48 h after transfection and stained with antiserum specific for brush border myosin I [Collins et al., 19901 (see Materials and Methods). Untransfected COS cells or COS cells transfected with vector pLENBAP alone were not labeled by this antiserum (not shown, but note the subset of cells in Figs. 3 and 4 which are invisible or faintly outlined by myosin I staining but can be stained by phalloidin). Thus, neither Western blot (Fig. 2A, lane 2) nor immunofluorescence (e.g., the cell at the middle left of Figure 3, top left panel) detected a brush border myosin I-like myosin I isoform endogenous to COS cells.

In contrast with untransfected or mock transfected cells, at least 50% of cells transfected with vector containing the myosin I gene expressed cross-reactive myosin I protein. Most cells concentrated the recombinant myosin I in one of two distributions, shown in comparison with the distribution of filamentous actin (Fig. 3). If cells were thinly spread, whether a relatively high or low

.M..T..L..L..E..G..S..V..G. Bovine ggac . . . . . . . . . ATGACCCTTCTGGAAGGTTCCGTGGGG Chicken ~ ~ ~ ~ c c T c T c T G C T G G A T G C T G C G G C C

.M..E..A..T..T..S..L..L..D..A..A..A.

.V..E..D..L..V..L..L..E..P..L..E..Q..E.. GTGGAGGACCTTGTGCTCCTGGAACCCCTGGAGCAGGAGT

TGCTGGACCCGCTCAGCGAGGAGT .V..G..D..L..V..M..L..D..P..L..S..E..E..

S..L..I..R..N..L..Q..L..R..Y..E..K..K..E CTCTGATCAGGAACCTCCAGCTGCGCTATGAAAAGAAGGA CCCTCCTCCGCACCCTGC AGGAGCGCTTCAGCCGCGGGG A

S..L..L..R..T..L..Q..E..R..F..S..R..G..E

..I..Y..T..Y..I..G..N..V..L..V. GATTTATACCTACATTGGGAACGTGTGTTGGTC AATCTACACG TACATTGGGGAGGTGGTGA TC ..I..Y..T..Y..I..G..E..V..V..I.

Fig. 1. Sequence of the chicken brush border myosin I heavy chain coding region 5 ' end. The nucleotide and predicted amino acid sequences of bovine [Hoshimaru and Nakanishi, 19871 and chicken (underlined) brush border myosin I in the coding region 5 ' end are shown (uppercase letters). The final four residues of the 5' untranslated sequence are indicated (lowercase letters). The partial sequence reported by Garcia et al. [1989] begins at the last amino acid shown.

were observed, but no clones differed in predicted amino acid sequence. Also, no clones contained the inserted amino acids present in a second, minor isoform of the chicken brush border myosin I heavy chain [Halsall and Hammer, 19901. Alignment of all four clones yielded a total of 3,480 bp of continuous cDNA sequence before the mRNA poly A tail (GenBank accession number U04049).

The coding region cDNA sequence not previously reported by Garcia et al. [1989] is shown with amino acid translation in Figure 1, aligned with amino acid sequence from the same region of bovine brush border myosin I [Hoshimaru and Nakanishi, 19871. Several lines of evidence suggest that translation of the chicken brush border myosin I heavy chain begins at the indicated residue. First, no significant open reading frame was found in the 257 bases sequenced 5' of this residue. Second, comparison of the chicken and bovine sequences suggests that initiation at this residue of the chicken sequence would produce a protein closest in size to the bovine isoform. Third, homology between the predicted amino acid sequences of the chicken and bovine proteins extends to within a few residues of the 5' end of the chicken sequence (Fig. 1).

Expression of the Brush Border Myosin I Heavy Chain in COS Cells

In order to examine the effects of expression of the chicken brush border myosin I heavy chain in a heterol-


Fig. 2. Expression and purification of the recombinant brush border myosin I heavy chain. A. Equivalent volumes of lysates of equal numbers of cells transfected with (lane 1) or without (lane 2) plasmid pLENBAPml were subject to SDS-PAGE, transferred to nitrocellulose, and probed for the presence of brush border myosin I heavy chain by Western blot (see Materials and Methods). Molecular weights are indicated on the left (in kD). B: Polypeptides in fractions from the purification of recombinant brush border myosin I were subject to SDS-PAGE and silver stained (see Materials and Methods). Molecular weights are indicated on the left (in kD). Lanes 1,2: Equal volumes of

level of myosin I was expressed, the recombinant myosin localized predominantly to the perinuclear region and the actin-rich cell periphery (Fig. 3, top two image sets). This localization resembles that described after microinjection of brush border myosin I into NIH 3T3 cells [Footer and Bretscher, 19941. If cells were not thinly spread and a relatively low level of myosin I was expressed, the recombinant myosin localized predominantly at unknown cytoplasmic structures resembling membrane-bound organelles (Fig. 3, bottom two image sets). These structures are not in the focal plane of the basal or apical membrane, and thus are not likely to represent membrane ruffles or arcs. A concentration of actin at these structures was evident only when cells adopted this localization of the brush border myosin I heavy chain. Some punctate myosin I staining was also observed. This could reflect the localization of brush border myosin I to membrane vesicles, as has been noted for brush border myosin I [Drenckhahn and Dermietzel, 1988; Fath and Burgess, 19931 and suggested for other myosin I isofoms [Conrad et al., 1993; Bahler et al., 19941. All COS cells expressing the brush border myosin

lysates from COS cells transfected without or with expression vector pLENBAPmI included, respectively. Lanes 3,4: Equal volumes of protein not bound (lane 3) or bound and eluted (lane 4) from S-Sepharose; both were loaded at twice the equivalent volume of the lysate samples. Lane 5: Proteins not bound to the Mono Q column. Lanes 6-10: The Mono Q elution fractions that contained brush border myosin I as judged by Western blot (not shown). Fractions in lanes 6, 7 , and 10 were pooled, desalted, and loaded on ATP agarose. Lanes 11-13: The fractions eluted from ATP agarose which contained the brush border myosin I heavy chain.

I heavy chain retained actin stress fibers, as did NIH 3T3 cells microinjected with brush border myosin I [Footer and Bretscher, 19941.

Some COS cells appeared by immunofluorescence to express the brush border myosin I heavy chain at a significantly greater concentration than neighboring cells. The amount of recombinant myosin produced in these cells was estimated to be approximately 0.5% of total cell protein, determined as the percentage of cells expressing this level of recombinant protein (about 20%), the percentage of total COS cell protein which is recombinant heavy chain in crude extracts (0.1%; comparing the amount of immunoreactive myosin to the amount of total protein loaded in a lane of a Western blot such as Fig. 2A), and assuming that half the recombinant myosin was produced in highly expressing cells. This level of expression would be approximately 5-10-fold the endogenous expression level of brush border myosin I in intestinal epithelium. Cells “over” expressing recombinant myosin I often had very irregular and exten- sive membrane contours (Fig. 4, top two images). Some cells appeared to develop unusual morphologies (Fig. 4,


Fig. 3. Localization of the brush border myosin I heavy chain expressed in COS cells. Cells were stained with fluorescein-conjugated phalloidin (left half of each set) and with antiserum specific for brush border myosin I (right half of each set) which were imaged simultaneously (see Materials and Methods). The expressed brush border myosin I heavy chain localized to actin-rich edges of spreading cells (top two image sets) or to unknown structures in the cytoplasm (bottom two image sets). Note the cell not expressing brush border myosin I but stained with phalloidin in the top left image set. Scale bars are in microns.

bottom left) and/or appeared to migrate on top of other cells (two cells each in Fig. 4, top left and bottom right). The size of cells expressing high levels of recombinant myosin I was frequently much smaller than cells expressing no or relatively less recombinant myosin I (cf. the size of cells expressing brush border myosin I in Figs. 3 and 4).

Purification of Recombinant Myosin I Recombinant brush border myosin I might have

localized to COS cell membranes with or without a functional actin-binding site. To determine whether the recombinant myosin possessed the actin-binding properties of the native enzyme, we first purified the recombinant myosin by at least 103-fold from cells harvested after large-scale transfections (see Materials and Methods). Briefly, cells from 60, 100 mm plates were harvested,

washed in PBS, and lysed with detergent. Supernatant from centrifugation of the lysed cells was fractionated by chromatography on S-Sepharose and Mono Q columns. Some fractions were additionally purified by chromatography on ATP agarose [Barylko et al., 19921. The polypeptides present after elution from S-Sepharose (lane 4), Mono Q (lanes 6-10), and ATP agarose (lanes 11-13) chromatography are shown in Figure 2B.

The polypeptide at approximately 110 kD is the recombinant heavy chain, which comigrates with the native heavy chain (cf. lane 1 and lanes 3-6 in Fig. 5A) and is recognized by antiserum against brush border myosin I (not shown). Contaminants of the recombinant myosin preparation differed from fraction to fraction, although myosin activities did not. Silver staining of SDS gels was required, due to the low concentration of recombinant brush border myosin I in crude and purified


Fig. 4. Localization of the brush border myosin I heavy chain expressed at high levels of COS cells. Cells were stained with antiserum specific for brush border myosin I (see Materials and Methods). Note the highly invaginated or extended membrane areas. Scale bars are in microns.

samples (1-20 pg/ml). Although the calmodulin light chains of brush border myosin I do not stain with silver, even using native brush border myosin I (Fig. 5A, lane l ) , several lines of evidence suggest that the recombinant heavy chain is associated with a complement of calmodulin light chains (see Discussion).

Actin-Binding and Actin-Activated MgATPase Activity of the Recombinant Myosin I

We assayed the interaction of recombinant brush border myosin I with actin, using recombinant myosin purified over the Mono Q column. As with chicken brush border myosin I and other myosins, the recombinant myosin bound to actin filaments in an ATP-dependent manner, pelleting with actin in the absence of ATP and re- maining in the supernatant in the presence of ATP (Fig. 5A). No other contaminants of the recombinant myosin purification behaved in a similar manner (note the lack of ATP-dependent actin binding by the approximately 180 kD polypeptide). Also, recombinant brush border myo-

sin I bound to actin filaments in the absence of ATP to decorate the actin (Fig. 5B). Brush border myosin I does not decorate actin filaments with as arrowhead-like an appearance as the S1 fragment of myosin I1 [Coluccio and Bretscher, 1987; Collins and Matsudaira, 19911. However, the appearance of recombinant brush border myosin I-decorated actin filaments was indistinguishable with native chicken brush border myosin I [Collins and Matsudaira, 19911.

To additionally test the actin-binding properties of the recombinant myosin, we assayed ATP agarose-purified myosin for actin-activated MgATPase activity. The rates of MgATP hydrolysis by recombinant myosin were similar to the native chicken enzyme [Conzelman and Mooseker, 1987; Collins et al., 1990; Wolenski et al., 19931. In 0.2 mM EGTA, recombinant myosin I catalyzed hydrolysis of MgATP at 0.033 ? 0.036 s-l in the absence of actin and 0.19 -+ 0.12 s-' in the presence of 40 pM actin. If 0.2 mM calcium was added to the buffer of 0.2 mM EGTA, recombinant myosin I catalyzed hy-


intestine epithelium [Matsudaira and Burgess, 19791. Other localizations of myosin I in intestinal epithelial cells have been determined by immunofluorescence [e.g., Coudrier et al., 1981; Collins and Matsudaira, 19911 and immunogold labeling [e.g., Drenckhahn and Dermietzel, 19881. These techniques reveal an association of brush border myosin I with apial and basolateral membranes, vesicles in the terminal web, and unknown components in the cytosol. Brush border myosin I is also associated with vesicles derived from the Golgi appara- tus [Fath and Burgess, 19931.

In COS cells, recombinant brush border myosin I adopted localizations previously observed for other myosin I isoforms endogenous to motile cells. Most brush border myosin I, either microinjected into NIH 3T3 cells as described previously [Footer and Bretscher, 19941 or expressed as recombinant protein in COS cells as described here, localized to actin-rich cell edges and membrane protrusions. This localization resembles that of other myosin I isoforms endogenous to motile cells [Fukui et al., 1989; Baines et al., 1992; Ezzell et al., 1992; Wagner et al., 1992; Conrad et al., 1993; Jung et al., 1993; McGoldrick et al., 19951. Some recombinant brush border myosin I expressed in COS cells also localized to unknown cytoplasmic structures reminiscent of membrane-bound organelles. Both endogenous brush border myosin I [Drenckhahn and Dermietzel, 1988; Fath and Burgess, 19931 and other myosin I isoforms [Baines et al., 1992; Conrad et al., 1993; Bahler et al., 19941 have been shown or suggested by localization to associate with Golgi or other membrane vesicles and with the membrane-bound contractile vacuole in Acan- thamoeba. Thus, although brush border myosin I and other myosin I isoforms differ in protein structure, brush border myosin I was able to adopt localizations of myosin I isofoms endogenous to motile cells.

COS cells expressing high levels of brush border myosin I were usually small and often appeared elon- gated by lamellipodia extending in different directions. The irregular membrane surface exhibited by these cells could result from the interaction of myosin I with the plasma membrane, plasma membrane proteins, or membrane-associated actin filaments. Dictyostelium lacking myosin 11 extend cell projections then divide by ripping themselves apart [Spudich, 19891. If this motility is mediated by myosin I motors, an overexpression of myosin I and the accompanying increase in myosin I-mediated motility could directly cause the decrease in cell size and the more highly irregular plasma membranes typical of strongly brush border myosin I-positive cells (Fig. 4). However, the observed cell morphologies could also be due to any of several consequences of recombinant myosin I expression, including decreased cytoplasmic calmodulin concentration.

A

200

116 95

6 7

4 2

1 2 3 4 5 6

Fig. 5 . ATP-dependent actin-binding properties of recombinant brush border myosin I. A: Samples from pelleting of recombinant brush border myosin I with actin in the presence and absence of ATP were subject to SDS-PAGE and silver staining (see Materials and Methods). Lane 1: Brush border myosin I purified from chicken intestine epithelial cells. Lane 2: Markers with molecular weights indicated on the left (in kD). Lanes 3,4: Equal volumes of supernatant and pellet, respectively, for binding of recombinant brush border myosin I to actin in the absence of ATP. Lanes 5,6: Equal volumes of supernatant and pellet, respectively, for binding of recombinant brush border myosin I to actin in the presence of ATP. B: Electron micrograph of recombinant brush border myosin I bound to actin in the absence of ATP. Note the myosin I-like decoration of actin filaments. Scale bar = 150nm.

drolysis of MgATP at 0.11 ? 0.05 s-' in the absence of actin and 0.30 ? 0.09 s-' in the presence of 40 p.M actin. Fractions across columns from later stages of the purification (Mono Q or ATP agarose elution fractions) catalyzed rates of actin-activated MgATPase activity proportional to the concentration of brush border myosin I heavy chain in the fraction. These fractions (e.g., lanes 8, 9, and 11 in Fig. 2B) had distinct polypeptide impu- rities. The calcium-sensitive MgATPase activities described suggest that recombinant brush border myosin I possesses biochemical activities similar to the native enzyme.

DISCUSSION Myosin I Localization and Function

Brush border myosin I is predominantly localized as a membrane-microfilament linkage to the microvilli of


Production of Recombinant Myosin I Recombinant myosin was first produced in Dicty-

ostelium lacking endogenous myosin I1 [Manstein et al., 19891. However, expression in Dictyostelium of a myosin motor domain other than that of Dictyostelium myosin I1 has not been achieved. Our production of recombinant chicken brush border myosin I heavy chain in COS cells, a cell line derived from monkey, demon- strates that biochemically active myosin can be expressed in and purified from a heterogous cell type. Re- combinant brush border myosin I demonstrated ATP- dependent actin binding and decorated actin filaments in the absence of ATP. Recombinant myosin I also catalyzed the calcium-sensitive, actin-activated MgATPase activity characteristic of native brush border myosin I. Unfortunately, the amount of recombinant myosin produced by transient transfection was insufficient to ob- serve reliable movement of actin filaments in an in vitro motility assay.

Several lines of evidence suggest that the recombinant myosin heavy chain associates with COS cell calmodulin subunits to reconstitute an active brush border myosin I complex. Because the light chains of brush border myosin I comprise nearly one third of the mass of the complex (3-4 light chains of 16.7 kD per heavy chain; for a recent discussion of stoichiometry, see Wo- lenski et a]. [1993]), the structural similarity of actin filaments decorated with native or recombinant brush border myosin I suggests that the recombinant heavy chain was purified in association with light chains. Also, the actin-activated MgATPase activity of chicken brush border myosin I requires purification of the heavy chain in association with calmodulin subunits. This is evident in the failure of early, calmodulin-depleted preparations of brush border myosin I to catalyze significant actin- activated MgATPase activity, and in the loss of actin- activated MgATPaes activity upon depletion of calmodulin from the myosin I complex by calcium [Collins et al., 1990; Wolenski et al., 19931. Calcium itself is not the cause of actin-activated MgATPase activity inhibi- tion, because if MgATPase assays in high calcium con- centrations are supplemented with calmodulin, activity and a full complement of calmodulin subunits are re- stored [Collins et al., 1990; Wolenski et al., 19931. However, the stoichiometries of heavy and light chains in both the recombinant and native brush border myosin I complexes need to be more precisely determined before the exact composition of either complex is known. It is possible that different calmodulin contents influence the localization of brush border myosin I to cytoplasmic or plasma membrane sites.

ACKNOWLEDGMENTS

This work was supported by NIH grant CA44737 to P.T.M. and was submitted in part for the Ph.D. thesis of K.C.

REFERENCES

Adams, R.J., and Pollard, T.D. (1986): Propulsion of organelles isolated from Acanthamoeba along actin filaments by myosin I . Nature 340:565-568.

Adams, R.J., and Pollard, T.D. (1989): Binding of myosin I to membrane lipids. Nature 322:754-756.

Bahler, M., Kroschewski, R., Stoffler, H.-E., and Behrmann, T. (1994): Rat myr 4 defines a novel subclass of myosin I: Iden- tification, distribution, localization, and mapping of calmodulin-binding sites with different calcium sensitivity. J. Cell Biol.

Baines, I.C., Brzeska, H., and Korn, E.D. (1992): Differential localization of Acanthamoeba myosin 1 isoforms. J. Cell Biol. 119:

Barylko, B., Wagner, M.C., Reizes, O., and Albanesi, J.P. (1992): Purification and characterization of a mammalian myosin I. Proc. Natl. Acad. Sci. U.S.A. 89:490-494.

Collins, K., and Matsudaira, P. (1991): Differential regulation of ver- tebrate myosins I and 11. J. Cell Sci. (Suppl.) 14:ll-16.

Collins, K . , Sellers, J.R., and Matsudaira, P. (1990): Calmodulin dissociation regulates brush border myosin I (1 10 K-calmodulin) activity in vitro. J. Cell Biol. 110:1137-1147.

Coluccio, L.M., and Bretscher, A. (1987): Calcium-regulated coop- erative binding of the microvillar 1 10 K-calmodulin complex to F-actin: Formation of decorated filaments. J . Cell Biol. 105: 325-333.

Conrad, P.A., Guiliano, K.A., Fisher, G., Collins, K., Matsudaira, P.T., and Taylor, D.L. (1993): Relative distribution of actin, myosin I , and myosin I1 during the wound healing response of fibroblasts. J . Cell Biol. 120:1381-1391.

Conzelman, K.A., and Mooseker, M.S. (1987): The 110 kD protein- calmodulin complex of the intestinal microvillus is an actin- activated MgATPase. J. Cell Biol. 105:313-324.

Coudrier, E., Reggio, H., and Louvard, D. (1981): Immunolocaliza- tion of the 110,000 molecular weight cytoskeletal protein of intestinal microvillus. J. Mol. Biol. 152:49-66.

Cullen, B.R. (1987): Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152:

deArmda, M.V., Watson, S. , Lin, C.S., Leavitt, J., and Matsudaira, P. (1990): Fimbrin is a homologue of the cytoplasmic phos- phoprotein plastin and has domains homologous with calmodulin and actin gelation proteins. J . Cell Biol. 111:1069-1079.

Drenckhahn, D., and Dermietzel, R. (1988): Organization of the actin filament cytoskeleton in the intestinal brush border: A quanti- tative and qualitative immunoelectron microscope study. J . Cell Biol. 107:1037-1048.

Ezzell, R.M., Leung, J., Collins, K., Chafel, M.M., Cardozo, T.J., and Matsudaira, P.T. (1992): Expression and localization of villin, fimbrin, and myosin in differentiating mouse F9 terato- carcinoma cells. Dev. Biol. 151575-585,

Fath, K.R., and Burgess, D.R. (1993): Golgi-derived vesicles from developing epithelial cells bind actin filaments and possess my-

126:375-389.

1193-1203.

692-693.


Matsudaira, P.T., and Burgess, D.R. (1979): Identification and organization of the components in the isolated microvillus cytoskeleton. J . Cell Biol. 83:667-673.

McGoldrick, C.A., Gruver, C., and May, G.S. (1985): MyuA of Aspergillus nidulans encodes an essential myosin I required for secretion and polarized growth. J. Cell Biol. 128:577- 587.

Mooseker, M.S., Conzelman, K.A., Coleman, T.R., Heuser, J.E., and Sheetz, M.P. (1989): Characterization of intestinal microvillar membrane disks: Detergent-resistant membrane sheets enriched in associated brush border myosin 1 ( I 10 K-calmodulin). J . Cell Biol. 109:1153-1161.

Pollard, T.D., Doberstein, S.K., and Zot, H.G. (1991): Myosin I. Annu. Rev. Physiol. 53:653-681.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989): “Molecular Cloning.” Vol. 1. Cold Spring Harbor, NY: Cold Spring Har- bor Laboratory Press, pp. 2.109-2.11 1.

Schliwa, M., and van Blerkom, J. (1981): Structural interaction of cytoskeletal components. J. Cell Biol. 90:222-235.

Spudich, J.A. (1989): In pursuit of myosin function. Cell Regul. 1:l-11.

Taylor, R.S., and Weeds, A.G. (1976): The magnesium ion-dependent adenosine triphosphate of bovine cardiac myosin and its subfragment- 1. Biochem. J . 159:30 1-3 15.

Wagner, M.C., Barylko, B., and Albanesi, J.P. (1992): Tissue distribution and subcellular localization of mammalian myosin I . J. Cell Biol. 119:163-170.

Wanick, H.M., and Spudich, J.A. (1987): Myosin structure and function in cell motility. Annu. Rev. Cell Biol. 3:379-421.

Wolenski, J.S., Hayden, S.M., Forscher, P., and Mooseker, M.S. (1993): Calcium-calmodulin and regulation of brush border myosin 1 MgATPase and mechanochemistry. .I. Cell Biol. 122: 613-621.

osin I as a cytoplasmically oriented peripheral membrane protein. J. Cell Biol. 120:117-128.

Footer, M., and Bretscher, A. (1994): Brush border myosin-I microinjected into cultured cells is targeted to actin-containing surface structures. J. Cell Sci. 107:1623-1631.

Fukui, Y. , Lynch, T.J., Brzeska, H., and Korn, E.D. (1989): Myosin I is located at the leading edges of locomoting Dictyostelium amoeba. Nature 341:328-331.

Garcia, A , , Coudrier, E., Carboni, J . , Anderson, J., Vanderkhove, J . , Mooseker, M., Louvard, D., and Arpin, M. (1989): Partial deduced sequence of the 110 kD-calmodulin complex of the avian intestinal microvillus shows that this mechanoenzyme is a member of the myosin1 family. J. Cell Biol. 109:2895-2903.

Halsall, D.J., and Hammer, J.A. (1990): A second isoform of brush border myosin I contains a 29-residue inserted sequence that binds to calmodulin. FEBS Lett. 267:126-130.

Hammer, J.A., 111 (1991): Novel myosins. Trends Cell Biol. 1:SO-56. Hayden, S.M., Wolenski, J.S., and Mooseker, M.S. (1990): Binding

of brush border myosin I to phospholipid vesicles. J . Cell Biol. 111:443-451.

Hoshimaru, M., and Nakanishi, S. (1987): Identification of a new type of mammalian myosin heavy chain by molecular cloning. Overlap of its mKNA with preprotachykinin mRNA. J. Cell Biol. 262: 14625-14632.

Jung, G., Fukui, Y., Martin, B., and Hammer, J.A., 111 (1993): Sequence, expression pattern, intracellular localization, and targeted disruption of the Diciyosrelium myosin ID heavy chain isoform. J . Biol. Chem. 268:14981-14990.

Lim, K. , and Chae, C.-B. (1989): A simple assay for DNA transfection by incubation of the cells in culture dishes with substrates for beta-galactosidase. BioTechniques 7577-579.

Manstein, D.J., Ruppel, K.M., and Spudich, J.A. (1989): Expression and characterization of a functional myosin head fragment in Dictyostelium discoideum. Science 246:656-6%.

recombinant expression of the brush border myosin i heavy chain

Documents