· regdation of the riionucleutide reductase miall subunit gene in dicpmtelium discoideum pascale...
TRANSCRIPT
-
Reguiation of the nhnucleotide reductase small subtmit gene in Dictyostelim d i m i d m
Pascale Gaudet
A Thesis
in
The Department
of
C hemistry and Biochemistry
Prrsented in P d a l FulfiIment of the Recpirements for the Degree of Doctor of PhiIosphy at
Concordia Univers@ Monaeal, Quebec, Canada
@Pascale Gaudet, 2001
-
National Library 1*1 ofcanada ûb(iothèque nationale du Canada
The author has m t e d a non- L'auteur a accordé une licence non exclusive licence allowhg the exchisive pexmettant à la National Library of Canada to Bibliothèque nationale du Cana& de reproduce, Ioan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in rnicrofom, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfichdfilm, de
reproduction sur papier ou sur format eIectronique.
The author retainR ownership of the L'auteur consewe la propriété du copyright m this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantid extracts from it Ni la thése ni des extraits substantiek may be printed or otherwise de ceîle-ci ne doivent être Snprimés reprodnced without the author's ou autrement reproduits sans son pefmission. autorisation,
-
Regdation of the riionucleutide reductase miall subunit gene in Dicpmtelium discoideum
Pascale Gaudet, Ph. D. Concordia University, 2001
Ribonucleotide reductase catdyzes the reduction of ninucleotides to
deoxyribonucleotides, providing precursors for the synthesis of DNA. Expression of
ribonucleotide reductase is conelated with DNA synthesis: it is upregulated during the
DNA syn&esis phase of the cell cycle and in the coune of DNA repair.
We have examined the regulation of expression of the ribonucleotide reductase
small subunit gene of DictyostelBmt discoideum, mrB, during the ceil cycle, in response
tu DNA-daniiigllig agents and d m g development. ûur results suggest that nvB is
exprrssed during two periods of the ceil cycle in Dictyostelim, with one expression peak
in mid-G2 and one in late G2. A cis-acting element refened to as box A appears to be
able to confer ceU-cycle-reguiated expression.
We have shown that the level of m B transcxîpt inmeases when ceIIs are treated
with mutagens and with hydroxyurea, an inhitor of nbucleotide reductase. The
respow is @id, transient and independent of protein synthesis. A DNA m e n t
consisting of the 450 bp upstream of the start codon of RPB has been shown to be
suffiCient to confer DNA-damage inducibiüty on heteroIogous genes. We have osed
detetion analysis to dehe the ch-acting eiements of the rmB promota requkd for the
respow to two different DNA-damaging agents, methyl methane donate and 4-
nitrcquhohe-l-oxide. ûur d t s hdicate that box C can confer response to both drngs,
-
while box A and box D confer response to rnethyf methane suifonate and 4-
nitroqyholine-lsxide, respectiveiy. We have studied the phenotype of a mutant in
which part of the mrB promoter has been deleted by gene replacement. The mutant strain
fails to upregulate the m B gaie in response to DNA-damaging agents. This mutant
displays increased sensitivity to mutagens as weii as prolonged ceIl cycle anest upon
exposure to mutagens.
Our laboratory has shown by histochemical staining that the mrB gene is
expressed oniy in the posterior, prespore zone during development. We have identined
by deletion analysis and site-directed mutagenesis c i s h g elements responsible for
ceii-typaspecinc expression of rnrB chiring development. Preventiag the expression of
nvB does not appear to cause morphologieal defects in Dictyosteiium development.
Ushg electrophoretic mobility shift assays, we have detected cellular factors that may
regdate the expression of the mrB gene.
-
The writing of this thesis conchides an important part ofmy üfe that many people
have helped make worthy and fdf ihg . My greatest thaaks go to rny supervisor, Dr.
Adnan Tsang, for his puidance, his encouragement and his trust. I especiaiiy enjoyed his
critical sense and his taste for argumentation. It's been great to work with him.
1 would Like to express my gratitude to the members of my thesis cornmitteet Dr. Claire
Cupples and Dr. Paul Joyce, for their heipful suggestions and nippor~ The facdty
members of the Departments of Chemistry & Biochemistry and Biology, including Dr.
Paul Albe* Dr. Ann English, Dr. Patrick Guiick, Dr. Muriel Herrington, Dr. Ragai
Ibrahim, Dr. Justin Polowski, Dr. Reginald Storms, Dr. Luc Varia have been extremely
helpful throughout this project, generously piving me advice and reagents whenever I
needed.
1 would also iike to thank di the past and present members of the labonitory for
theu help, advice, and niendship, in pattidar Nathalie Brodeur, Kristopher Clarke,
Kimchi Doquang, Jonathan Gisser, Sarah MacPherson, Zeina Saikali and Abraham
Shtevi. 1 am especidy indebted to Claire Bonnls, who has been extreme1y helpful as a
CO-wodrer and immensely stimdating in teUedy . Many thanks to Amalia Martînez-
Perez and Dr. Bruce WiiIiams who have teached me almoa everythiag when 1 started in
the iab.
Special thanks go to Dr. tiarry MacWrlliams h m Mumchen University, my
collaborator and Eend. Much of th% work wodd not have been possible without his
ideas, ddh, and patience. It is very inspiring to work with a sàeatist such as him.
-
1 am grateful to the members of the Dictyosteiium research commtmity for
stimulating conversations, invaluable advice and gr- fun at meetings. In pafticulat, I
thank Dr. Robert lnsd from Birmingham University for his technicd help with the
construction of the naB-promoter knock-out strain.
FinalIy 1 would Like to express my gratitude to my famiy and &iends. In
particda., 1 appreciated the support of Eiizabeth Cadieux and Dr. Georgina MacIntyre,
my training and dMking buddies, who have always been avaiiable to help me and advise
me.
Part of the work presented here has ken published in the foilowing articles:
-Gaudet, P., MacWiams, H. and Tsang, A (2001). inducible expression of exogenous
genes in Dictyosteiium discoideum ushg the ribonucleotide reductase promoter. 1Vucieic
Acids Res., 29, ES.
-MacWiams, H., Gaudet, P., Deichsel, H., Bonf~Is, C. and Tsang, A. (2001) Biphasic
expression of W B during G2 in DicryostellMn discoideum suggests a direct relatiooship
between ceii cycle control elements and cell differentiation.. D@erentiation, 67, 12-24.
-Gaudet, P. and Tsang, A. (1999) Regdation of the nionucfeotide reductase snall
subimit gene by DNA-damaging agents in Dictyostelium disfoidem. Nucieic AcicLF Res.,
27,3042-3048.
- B o a s , C., Gaudet, P. and Tsang* A. (1999) Ident5cation of clr-reguiating elements
and PQICS-acting factors reguiating the expression of the gene encoding the d subunit
of ninuc1emtide nductase in D i c t p s t e ~ ~ discodm J. Biol. Chem., 274,20384-
20390.
-
AU the data presented in this thesis is the work of the author, except for the
foIIowing:
-The naB promoter was sequenced by Dr. Carohe Grant (Tsang et al., 1996).
Sequencing of the nvB promoter mutants was done by Nathaiie Brodeur at the Centre
for S t r u W and Functional Genomics, Concordia University.
-The RnrB-ubi465TGFP and RnrB-ileapgal cctnstructs were made and transfomed into
Dictyostelium by Dr. Harry MacWilliams.
-Tdormation of A-280/A17 A-280/A2, A-450fA 1 and A450/A2 c o m c t s into
Dictyostelium as weii as histochemical stainlligs (Figure 20) were done by Dr, Hany
Mac Williams.
-CeU cycle synchronizations, BrdU assays, p-galactosidase assays and RNA extraction
for synchronized ceUs were done by Dr. Harry Macw'iams.
-P-gaiactosidase assays (Figure 12) were done by Dr. Hany MacWilliams.
-Deletions of the W B promoter were made in collaboration with Claire B o a , Zeina
Saikali and Abraham Shtevi.
-Developmentd stainings (Figure 19) done by Claire Bonnls and pictures were taken by
Dr. Adrian T'sang.
-
TABLE OF CONTENTS
.............................. LIST OF FIGURES ................................................................... xi
LIST OF ABBREWATIONS ...... .. ................................................................................. xiv 1 . INTRODUCTION .......................................................................................................... 1
1.1 . CeU cycle control of gene expression ......... .... ............................................. 2 1 3 . CeUular responses to DNA damage ............. ... ......................................... 3
................................................................. ...................... 13.1. Cell-cycle arrest .. 4 1.2.2. Apoptosis ......................... ... ..................................................................... 6
1 .2.3. Modifications in gene expression dining genotoxic stress ..................... .... 7
1.2.1 . Mechanisms mediating the nanscriptional response to DNA damage ............. 9
1 2.5. Ribonucleotide reductase expression in response to DNA damage ............... 1 4
................................ 1.3. Developmental control of gene expression in Dictyostelim 16
............ L 3.1. Role of riionucleotide reductase during Dicryostelium development 17
................ 1.3.2. RrguIation of cebtype specinc gene expression in Dicyostelium 17
................................................................................. 2 . MATERIALS AND METKODS 20
..................... . 2 L . Growth, development and transformation of Diciyosteliwn ceIIs .... 20
....................................................... . 2 3 Generation of deletions of the m B promoter 20
...................................................................................... 2.3. Siteairected mutagenesis 23
...... ............ 2.4. Dimption of the m B promoter by homologous recombination ... 26
.................. 2.5. Treatment of Dic~yosteIium cek with dnigs and ce11 survivaI assays 26
........................................................................................................ 2.6. RNA anaiyses 28
2.7. Assay for fbgalactosidase ...................................................................................... 31
-
................................................. 2.9. E1ecti.ophoretic mobiIity shift assays (EMSAs) 32
TABLE 1 . Sequence of the synthetic oligonucleotides used for EMS& ................ 34
3 . RESWTS ..................................................................................................................... 35
5.1. D e M g the naB promoter ................................................................................... 35
5.2. Expression of the nrB gene is cell cycle-regulated ..... ... ............................. 35
3.2.1. Role of box A in regdakg the ceU-cycle expression of nrB ................+...... 38
.................... 3 -3 . Response of the rnrB gene to DNA-damaging agenrs ...................... 42
.......... 3.3.1. DNA-damaging agents stimulate the accumulation of m B transcript 43
3 3 .2 . Hydroxyurea causes upregulation of m B expression in vegetative ceus .... 45 3.3.3. EfTect of DNA-damaging agents on m B expression is independent of
developmentai stage ................................................................................................ 4 5
.................... 3.3.4. Up-regulation of n v B is independent of protein synthesis ..... 18
....................... 3.3.5. Conferring DNA-damage inducibility on heterologus genes 50
3.3.6. Tirne course of the DNA-damage response .................................................... 52
3.3.7. rmB-driven gene induction results in upregulation at the protein level ..... :52
3.3.8. Identification of cis-acting eiements conwlling the DNA damage response 55
........... 3.3.9. Construction of a mutant defective in the mrB response to mutagens 61
3.3.10. Physiological eEects of a genomic deletion of the DNA-damage response
.................................................................................................................... elements 62
.................................................... 3 .4 . Developmentaliy-re@ated expression of rmB 71
3 -4.1. Identification of ci$-acMg eIements c o n m b g the developmental expression
...................................................................................................................... of nirB 71
......................... 3 .4. 2. Mutational anal* of the prespore-spdc element box A 74
-
..... 3.4.3. Effect of a genomic deletion of the ceiI-type-specinc response elernetlts 74
3.5. Factors regulating the expression of nul3 ............................................................ 7 8
........... 3.5.1. GBF, a known hanscription factor, does not bind the r m B promoter 78
3.52. Cellular fmors binding to box A ................................................................... 80
3.5.3. Cellular factors binding to box B ................................................................... 83
4 . DISCUSSION ............................................................................................................... 85
4.1. CeIl cycle regdation of n v B .................................................... ... .................... 88 1.2. Response of rnrB to DNA-damaging agents ............. ................ .................. 89
42.1. Change in m B transcript level in respow to DNA-damaging agents ......... 89
4 2 3 . Response of m B to the inhibitor hydioxyurea ........ .. ................................. 90
42.3. Regulation of the DNA-damage response ....................... .................. . . . 91
4.2.4. The rnrB promoter as an inducible expression system for Dictyosteiiwn ...... 93
..................... 4.2.5. Promoter elements driMng the DNA damage response in rmB 94
..................... 42.6. Physiologicai role of the DNA damage induction .............. .. 95
4.3. Developmentai regulation of n a B .................................................... 97
.................................. 4.3.1. Elements conferring ceiï-type-specific expression 97
........................... . 4.3 2 Tram-acting factors controhg developmentd expression 99
1.4. Box A may be a generd repressor ...................................................................... 100
5 . CONCLUSIONS ...................................~.................................................................... 102
6 . REFERENCES ......................................................................................................~.... 103
-
LlST OF FIGURES
FIGURE 1. Strategy for site-directed mutagenesis of box A of the ml3 promoter. ....... 25
FTGURE 2. Strategy for repIacement of the nuB promoter by the blasticidin-resistance
...................................................................................................................... e 27
........................................ FIGURE 3. 5' upstream region of m 8 . .................... .... 36 .................... FIGURE 4. Cell cycle regdation of rmB after synchronization. ....... 39
FIGURE 5. Celi-cycle regdated expression directeci f?om wiid-type and mutated
........................................................................... versions of box A .................. ... 41 FlGURE 6- Effect of DNA-damaging agents on the accumulation of the m B transcript..
...................................................................................................................... $3
FIGURE 7. Enect of hydroxyurea on the accmuiation of the naB tramscript, ........... ... 46 FIGURE 8. Regdation of nvB by DNA-damaging agents during growth and
development ........................................................................................................ 47
FIGURE 9. Effect of 4NQO and cyclohelamide on the accumulation of the nrB - transcript. .................................................................. ................................... 49
FIGURE 10. Effect of DNA-damaging agents on the accumulation of the nuB and GFP
transcripts durhg growth and development. ............................................................ 5 l
..... FIGURE 1 1. Time course of DNA-damage induction of the n v B and GFP genes. 53
ïIGURE 12. B-galactosidase activity of AX2 cells aansformed ~5th a RmB-ile-czpgai
................................ fusion cormruct upon matment with D N A - d m e g agents. 56
FIGURE 13. Transcriptionai response directeci by the deletion comtructs in the
presence of DNA-damaging agents. ................................................................ . . 5 9
-
FIGURE 14. Southem blot showing bat the rnrB p r o m o t e r l o c ~ by
the BSR marker. ..................... .. ...... ......-......................*...... ...................... 63 FIGURE 15. Wect of DNA-damaging agents on the accumulation of the W B
0 . trans~flpt ia RnrB-P-KO mutants. ................................................................... . . 6 4 FIGURE 16. Survivai of the RnrB-P-KO strain to DNAaamagllig agents. ................. 65 FIGURE 17. Giowth nites of the RnrB-P-KO mutant strain and the control strain
foLIoWmg treatment with MMS. ...................................................................... ......67
FIGURE 18. Number of viable cek in RnrB-PX0 and control cultures treated with
MMS. .................................................................................................................. 69
FIGURE 19. Histochemicai staining of fbgalactosidase activity oCDictyoselium ceiis
trandormed with various RnrB-lac2 consanicts ....................................................... 72
FIGURE 20. Histochemicd staining of P-gdactosidase activity of ceus transformed
with constructs bearing mutations in the box A element ........................................ 75
................ FIGURE 21. Expression of m B in AX2, RnrB-P-KO and a control strain. 77
FIGURE 22, Electrophoretic mobility shif? assay testing the ability of the m B
promoter elements to bind GBF. .............................................................................. 79
FIGURE 23. Electrophoretic mobility shift assay with box A in the presence of
....................................................................... unlabelied cornpetitors ......................8 1
FIGURE 24. Electrophoretic mobility shift assa. showing the deveIopmental regdation
..................................................................................... of the box A bmdmg &or. 82
FIGURE 25. Electrophoretic mobility shift assays with box A in the pRsence of
...................................................................................... udabeUed Al and A2. 8 4
-
FIGURE 26. Electmphoretic m o b m s h i . assay wiih box B in the presence of
imtabeiled cornpetitors .............................................................................................. 85
FIGURE 27. Electmphoretic mobility shift assay showing the activity of the box B
binding factor d h g the Dicryosteliurn üfe cycle. .................................................. 86
FIGURE 28. Electrophoretic mobility shin assay showhg the developmental regdation
....................................................... of the box B binding factor in nuclear extractS. 87
-
LIST OF ABBREVIATIOIYS
A: Adenine
AT: Ataxia teiengiectasia
ATM: Atavia telengiectasia mutated
AX: axenic
P-gal: B-galactosidase
Bp: Base pairs
BrdU: Bromodeoqwidine
BRCA: Breast cancer
BSR: Blasticidin S resistance . BSA: Bovine serum albumin
C: Cytosine
CAE: ClA-rich element
CHX: Cycloheximide
DAPI: 4.6-Diamidino-2-phenylindole
DNA: deoxyribonucleic acid
6MP: deo~onucleotide triphosphate
DTT: Dithio threitol
EDTA: Ethylenediaminetetraacetic acid
EGTA: Ethykne glycol-bis@-aminoethyl ether)
EMSA: Eiemphoreàc mobility shift assay
G: Guiinine
-
GBF: G-box binding factor
GFP: Green fluorescent protein
HU: Hydroxyurea
KO: Knock-out
MMS: Methyi methane donate
4NQO: 4-Nitroquinoline l-oxide
PCR: Polymerase chain reaction
PK: Protein kinase
RNA: Ribnncleic acid
EGC: Replication factor C
EUU: Relative light uni&
RNR: Ribonucleotide reductase
RPA: Repücation protein A
SDM: Standad deviation of the mean
SDS: Sodium dedocyl d a t e
STAT: Signai traosducer and activator of transcription
T: Thymidine
TCA: Trichloroacetic acid
UV: UItTaviolet
X-gai: 5-brom0-4-chloro-3-indolyl-~-D-gdactoside
-
1. INTRODUrnON
AU living organisms possess the information necessary for sumival and
reproduction in their genome. The genome must be qlicated for c e k to divide; it must
also be protected h m agents that damage DNA such as radiation, chemicais present in
the environment, or cellular metabolites. Synthesis of DNA r q k about IO diffemt
proteins, including DNA helicase, primase, DNA polymerase and DNA l i g e (reviewed
by S t h a n in 1994). The enyme riboaucleotide reductase catalyzes the reduction of
ribonucleotides to deoxynionucleotides, providing precursors for synthesis of DNA. A
bdanced pool of ai l four d N ï P s is necessary for faithfirl replication of DNA and for this
reason the expression and activity of ribonucfeotide reductase are highly regulated
(reviewed in Reichard, 1 988). Expression of ribonucleotide reductase is comlated with
DNA synthesis. Ribonucleotide reductase is only expressed in actively growing ceils and
is not expressed in diffantiated cells (Engstr6m et al., 1984). Expression of
nionucleotide reductase, as weU as several other genes involved in DNA irynthesis,
peaks in the DNA synthesis (S) phase of the celi cycle. FinaiIy, ribonucleotide reductase
expression is increased in response to DNA damage.
The gene that encodes the m a i l subunit of ribonucleotide reductase in
Dictyostelium dfseoideta, rmB, has been isolated in our laboratory (Tsang et al., 1996).
The work presented in this thesis examines the reguiaiion and the role ofri~nucleotide
ductase expression drning the ce11 cycle, in response to DNA-damghg agents and
dirring multicelidar deveiopment in Dfcsosteliuin.
-
1.1. Celi mcIe control of zene tsnression
The ceii cycle is divided h o four phases: M phase, during which mitosis md
cytokinesis take place; G1 (fia gap), S phase, qharaaerized by replication of the
genome, and G2 (second gap). Cell cycle progression is mediated by cyclins and cyclin-
dependent kinases (CDKs). The actMty and substrate-spdcity of the CD& are
regulated by cychs. The levels of the clBerem cyclins vary during the ceil cycle and are
reguiated transcriptionally and post-traaslationally by protein turnover. In mammaiian
ceiis, cyclins A and B are involved in reguiation of G2 events (B-type cychs in yeast),
while cyclins C, D and E are responsible for progression through G1 (cyclins 1,2 and 3
in yeast). Degradation of the cyclins is mediated by the ubiqyitin pathway (Lodish et al.,
1999).
In S cerevisiae, a cornplex composed ofthe Cdc28p kinase and CMp activates
two replication factors in late G1, SBF and MBF (composed of Swi4p/Swi6p and
Mbp l p/Swi6p7 respectively), that regulate transcription of the C M and C M 2 genes as
weii as other genes required for DNA replication, includhg DNA polymerase and DNA
tigase (Lodish et al., 1999). During S-phase, interaction of Cdc28p with B-type cychs
stimuiates the initiation oPDNA replication B-type c y c h Clblp and Clb2p are
comptexed with Cdc28p during the G2 phase of the cell cycle and promote entq into
mitosis. Similar events take place in other eukaryotes.
In marnmalia ceiis, expression of S-phase genes is controlled by the
transcription nictors E2F, which are negativeiy regulated by the retinoblastoma (Rb) gene
produa. In late G1, Rb is phosphorgiated by cdk4-cych D and cdk2-cyciin E (G1
-
cychs), therehy releasing E2F fictors and allowing transcription to take place (reviewed
by Kohn in 1999).
The Dicty~~feliitmi cell cycle is strikingiy different fiom that of other well-
characteaked eukaryotes in that no G1 phase is detenable. DNA synthesis (S phase)
takes place immediately f ier ceIl division (M phase), so that most of the ceii cycle is G2
(Weijer et al., 1984). How DicfvosteIium cells monitor cell cycle progression remahs to
be ducidated.
The absence of a Gt phase brings forward the question of how expression of the
"G1 genes" in Dictyostelium is regulated. The study of ribomcleotide reductase
expression is particularly interesting, because this gene is expressed in GllS in other
species. One possibility is that the DictyosteIium G2 phase is divided into subphases that
are anaiogous to G1 and G2 in mammalian cells and yeast. Altematively, the genes
expressed in G1 could be expressed during the M phase, which in Dictyosteliuni precedes
the S phase.
1.2. Cellular responses to DNA damape
The presewation of genome inte& is of crucial importance for the &val O:
any h g ceii. The preseace of an intact genetic code ensures that the cell encodes
hct ional proth, md that it traosmits the correct genetic information to iu progeny.
For these reasons, a large -ber of cellular pathways are aimed at responding to
chemicd and physical modifications to the genome. In Aikaryotes, DNA damage wi
cause celi-qcie arrest, chanses in gene expression, as weii as apoptosis.
-
1.2.1. CelGcyrle arrest
In the presence ofDNA damage, celIs stop dividing for a certain period of the.
Ceil-cycle arrest is believed to be required to allow DNA repair to occur before
chromosome replication or segregation takes place, thereby reducing the kelihood of
transmitting erroneous information to the progeny of the damaged ceil. In S. cerevisiae,
several factors involved in recognition and transduction of the DNA damage signai have
been identined. Recognition ofDNA damage leadhg to cell-cycle arrest appears to be
performed by DNA-bindhg protek. Examples of these Eictors include DNA
polymerase e (Navas et ai., 1996). the product of the RAD1 7 gene, that bears similarity to
a 3' to 5' DNA exomclease (Lydd and Weinert, 1995, 1997), as weil as RfcSp, a
component of the replication factor C (Sugimoto et aL, 1997).
Using S. cerwisiae, screens have been perfiormed to idente mutants that do not
undergo cell-cycle amest in the presence of DNA damage or blacks in DNA replication.
The mutants identined in these screem continue to divide in the presence of damageci
DNA and die &er a f i doublings. Genes identined in these screens include r d , mecl,
and r d 3 (Padovich and HartweU, 1995; Weinert et aL, 1994; Weinert and Hartwell,
1988, 1990). The products ofthe MECi and RAD53 genes are beiieved to be involved in
the transduction ofthe DNA damage signal because they contain kinase domains (Lydd
and Weinert, 1997; Sidorova and Breedeq 1997; Sanchez et aL, 1996; Paulovich and
HartweU, 1995). The product ofthe W 9 gene is ais0 thought to be a aapsducer ofthe
DNA damage signal and has been proposed to act on cell-cycle progression proteins such
as Cdc28p (Siede et a&, 1993). Ra@ becomes phosphorplateci upon DNA damage, and
-
phosphorylated Rad* cm interact with Rad53p to mediate ceii-cycle anest (Emili,
1998; Sun et aL, 1998).
Thus far, ffew effectors of ceii-cycle mest have been identined in S. cetevisiiae.
One of them is the anaphase inhibitor Pdslp. Progression into anaphase remes the
degradation of Pds l p (Cohen-Fix et al., 1996). Cds harbouting mutations in PDSI
undergo mitosis abnormaiiy foilowing y-irradiation (Yamamoto et al, 1 996).
Interestingiy, Pds 1 p is phosphorylated by the Chkl p kinase upon DNA damage in a
Mecl p- and Rad9p-dependent manner (Sanchez et ai., 1999). Pds l p phosphorylation
upon DNA damage renders it more resistant to proteolysis, therefore mediating M phase
anest (rhker-Kulberg and Morgan, 1999). . In mamrnals and in Schizosaccharomycespombe, at least one of the DNA-
damage checkpoints appuirs to be mediated by the Chkl kinase. Chkl is phosphorylated
upon DNA damage, and in tum phosphorylates Cdc25. Phosphorylated Cdc25 is
believed to be unable to activate the Cdc2 kinase, preventing entxy into mitosis (Liu et
al , 2000; Sanchez et aL, 1997). This ttnis connects the DNA-damage checkpoint with the
normal ceii-cycle progression machinery, as Cdc2 is responsible for G1 and G2
progression
In mnmmalian ce&, the best chcterized ceil-cycle control protein is the tumour
suppressor protein p53. in the presence of DNA damage, the stability of p53 increases
and its aaivity is enhanceci by codent modEcation. Activated p53 r d t s in increased
expression of the pZl/wafl/cip 1 gene, which binds to and inhiits qch-dependent
protein kinases, resuiting in G1 arrest (Wg, 1998; Kubbutat and Vousden, 1998; Ko
and P k s , 1996; M e n 1995).
-
Another important reguiator of ceil cycle progression in response to DNA-
damaging agents in mnmmnliaa ceiis is the ATM gene product. Dysf'unctional ATM
protein r d t s in a disease caiied ataxia telengiectasia (AT), which is characterized by
predisposition to cancer and sensitnnty to ionking radiation (Savitsky et al., 1995). ATM
has homology to the buddiag yeast Mecl p, Tell p and Rad53p proteins, which are
involveci in the DNA-damage checkpoints (see above). ATM is activated in response to
DNA damage and is responsible for activation of p53 in response to certain types of
damage.
1.2.2. Apoptosis
In cases of extensive DNA damage, eukaryotic ceus undergo apoptosis. This
highly coordinated process of ceii elimination can mediate the specinc removal of
damaged cells. The moa characteristic events that take place during programmed ceIi
death are cbromatin condensation and degradation, as weIl as condensation ofthe
cytopIasmic contents (Staunton and Gaffney, 1998; ScIrwart~nan and Cidlowski, 1993).
Apoptosis r-es the expression of specinc factors. In mammalian ceiis, the tumour-
suppressor gme p53 appears to play a cenpal role in programmed cell death h response
to genotoxïc stress. This is supporteci by the fàct that certain ceII hes deficient in p53 are
more resistant to mutagens (Levine, 1997). Ln addition, ceus deficient in p53 tolerate
genetic a b n o d t i e s more than cells that possess wiid-type p53 (Ko and Prives, 1996;
LeYine, 1997; ELDeiry, 1998). The p53 gene is mutated in more than half of human
tumours (Levine, 1997). Furthermore, mice lacking p53 are more prone to tumors
(Donehower et aL, 1992). The gened consensus is that these phenornena are the
c o q e n c e of the fàhre of dydbnctiod p53 to induce apoptosis.
-
The mechaniSm by whkh p53 îriggas programmed ceii death is not knowa It
has been proposed that the relative amounts of two gene products, bcl-2 and bax, are
important for determining the propensity of a celi to undergo apoptosis. Although blc-2
and bax are homologs, they have opposite activities: bcl-2 is an anti-celi death protein,
whereas bax promotes apoptosis. High amoimts of bax redt in a low threshold for the
induction of programmed ceii death, and vice versa (Sam et al., 1994; Oltvai et al.,
1993). n ie promoter of the biuc gene contains p53-binuhg sites (Miyashita and Reed,
1995). In addition, p53 has negative effects on the expression of the anti-death gene bcl-2
(reviewed by Basu and Haidar, 1998). Therefore, it is plausible that p53 triggers
apoptosis by activating the expression of bm while l o w e ~ g that of bcl-2.
The ultimate step of prognunmed celi death is the activation of proteases that
mediate the degradation of the cellular contents (reviewed in Favrot et al., 1998;
Thomberry and Lazebnik, 1998).
1.23. Modifications in gene expression during genotoxic stress
A change in the expression of a number of genes is another primary response of
ceiis to damaged DNA. In bacteria this response is referred to as the SOS respome and
involves the recA and le& proteins. The products of the target genes for the recA system
are involved in DNA repaïr, DNA synthesis and inhicbition of cell division (Friedberg et
al.. 1995).
In eukaryotes, many genes whose expression leveis are modi;fied by the presence
of DNA-damaging agents have ken i d e n a d In yeast the genes activateci by D M -
damaping agents inciude those hvolved in nucIeotide excision repair, pst-replication
-
repair, and double-strand break repaù. Also induced by DNAdam@ng agents are some
of the genes thought to play a dual mie in nucieic acid metaboh and DNA pair, for
example, the gens encoding DNA ligase 1, DNA polymerase 1, and ribonucleotide
reductase (Friedberg et al., 199 5).
The devebpment of the microarray technology, which allows the simultaneous
monitoring of the expression of thousands of genes, suggests that the transcriptional
response to DNA-damaging agents in S. cerevLFiae may be more cornplex than
previously thought Samson and coUeagues (1999,2000) have monitored the expression
of ab09 6,200 gens after treatment of S. cerevisiae with MMS. ïhey have found that
the Ievel of about 5% of the transcripts increase by more than 4-fold (Jelinsky and
Samson, 1999) and IO% were induced by 3-fold or more (Jelinsb et al., 2000). In
addition to genq hvoived in DNA repair and DNA synthesis, many other genes were
upregulated, including genes involved in stress response and detoxification, ce11 cycle
control, carbohydrate metaboiism, signalling, celI wall biogenesis, and protein
degradation. This may be expIained by the fact that MMS causes signincant damage to
protek, in addition to damghg nucleic acids. The upregulation of a number of these
pups of genes may be causeci by "protein-damage respome" rather than by "DNA-
àamage response". These indude genes involved in protein degradation and amino acid
metabolism, detoxincation, and ceil wd i biogenesis.
Another study that examined the respoiise to several DNA-damaging agents
supports this interpretation. S. cerevisiae ceils were treated with ~wmethyl-Ai'-nitro-N-
nitrosoguanidine (MNNG), If -b~2chloroethyl)-l-nimsourea (BCMI), rert-butyI
hydroperoxide (t-BuOOH), 4NQO or y Madiation, and the global gene expression profile
-
was monitored using microarrays. Overail, about one thkd of d the genes in S.
cerevisiue were found to respond to one or more DNA-damaging agents. However ody
21 genes were regulated by ail the agents tested: 12 were consistently up-regdateci, and 9
were down-regulatd Genes up-regulated include those encoding the DNA-damage
inducible large subunit of ribonucieotide reductase and glutathioae transferase. Genes
down-regdated include genes coding for histone 'tI2B and RNA helicase (JeIinsky et al.,
2000).
The response to DNA-damagllig agents in mammalian ceils is complex and
involves many genes and proteins. These genes and proteins are assotiated with diverse
cellular fiinctions including not only those implicated in DNA repair and its related
processes, but also transcription factors, growth factors. growth factor receptors, tumor
suppressor proteins, protein kinases, G-protein, responses to tissue injury, inflammation
and proteciive responses, and différentiation-specific proteins (reviewed by Bender et ai.,
1997). The produas of sorne ofthese genes are thought to be needed to fuel DNA
synthesis during repair. The expression of other faaors presumably refi ects the
requirement for coordination of reguiated respoases between ceHs in multicelluiar
organisms.
1.2.4. Mechanîsms rnediating the truiscriptionai response to DNA damage
A Activation of gene expression in the presence of DNA damage
In bacteria, the traoscnptiod response to DNAaamaging agents is mediated by
the iexA and the recA proteinseins Under n o d conditions, the recA protein is rnaidned
at low Ieveis and lexA represses the expression of the target gews of the SOS response.
-
In the presence of DNA damage or blocks in DNA repücatioq the protease fùnction of
recA is activated. LexA is cleaved by r e d , thus removing it from the promoter of its
target genes. Transcription of these genes cm then take place (Friedberg et al., 1995).
Eukaryotes appear to lack a generaiized response system for DNA damage-
induced transcription sudi as the recA system found in prokaryotes. The promoters of
severai DNA-damage responsive genes in S. cerwisiae have been d y z e d . A consensus
DNA-damage response element @RE) has been identined in several of these genes (Liu
et d, 1997; Wolter et al., 1996; Singh and Samson, 1995; Sancar et aL 1995; Xiao etai
1993; Siede and Frïedberg, 1992; Sebastian et al., 1990). In the case of the M D 2 gene,
deletion of DREl, the cis-acting element involved in the DNA damage response, has
been shown to have a deleterious effect on swivai following treatment with mutagens
(Siede and Friedberg, 1992). However, this element is not present in all DNA damage-
responsive promoters, and is presem in a =ber of non-inducible genes. A possible
explmation for these obsematioos is that the response to DNA-damaging agents has
different reguirements depending on the promoter.
Several studies have made attempts to identify the transcription factors that are
involved in the DNA damage response in yeast. In one of these -dies mutants were
isolated that constitutively eqressed RMU, the gene encoding the DNA-damage
inducible large subunit ofribonucleotide reductase (Zhou and Elledge, 1992). This has
lead to the identification of CRTl (çonstinitive @tR3 -transcription 1) which encodes a
DNA-binding proteie Upon DNA damage Crtlp becornes phosphorylated, which
reduces its afnnay for its target site and aliows increased branscription of iu target g a ~ ~ ,
including RNRZ, RMU and RMU ( E h q et d, 1998). ûther nt mutants W u d e
-
and Sm6, two 0th repressors of transcription (Zhou and Elledge, 1992). Crtlp appears
to recruit Ssn6p and Tup Lp to the promoters of the RMU and RMU genes (Huang et d,
1998).
M e r transcription factors that have b e n associated with the transcnptiond
response to DNA damage include RPA, or replication protein A, Swi4p and Swi6p, as
weii as Ume6p. RPA is a m u i ~ c t i o n a i protein, which has been implicated in many
varied processes such as DNA replication, nucleotide excision repair and homologous
recombination (Bd and Stillmaq 199 1; Coverley et al., 1991; Bums et a%, 1996; Nani
et d, 1992). RPA is phosphorylated in response to DNA damage in a Meclp-dependent
fashion ('rush et cd, 1996). RPA has been shown to bind a DNA hgment comprishg
the consensus DREl elernent described above Eom the promoters of several DNA repair
genes, includiagMG, MGTI and PHRI. Also, RPA was found to bind to the DRE
element of seved R4D genes: RADI, RAD2, RAD+ R4DI0, RAD16 and R4D51.
Elements in the promoters of other DNA damage-respoosive gmes also bind R P 4
including RMU and RMU (Singh and Samson, 1995). Not d these genes, however,
respond to DNA damage. Another transcriptionai factor that has been implicated in the
transcriptional response to DNA damage is the Ume6p repressor. Ume6p-bhding sites
have been found in the promoters of severai DNA damage-responsive genes, inciuding
PHRI, R4D2, R4D?, and MD.53. Deletion of the W 6 gme has beui shown to
inaease sensitivity to W irradiation (Sweet et aL, 1997). The Swi4p and Swi6p
transcriptionai activators have also been associated with the transcriptional respome in
the presence of DNA-damaging agents. Cek that have rrmfations in the SBT4 or SWId
genes have recfuced ability to hmice RMU and RNR3 in the presence of DNAdamaging
-
agents (Ho et al., 1997). Furthemore, swi6 mutants have higher sensitivity to DNA-
damaguig agents than wild-type cek (Johnston and Johnson, 1995).
Recentiy, global changes in gene expression folIowing treatment with several
DNA-damaging agents have been monitored using DNA microarrays (Jehsky et al.,
2000). The large amount of data generated by this method allowed grouping of genes that
are nmilarly regdated. The promoters of the members of these groups have been
d y z e d for the presence of similar cisachg elements. One such element is found in a
group comprishg the M G 1 gene, encoding a methyl-DNA-glycosylase known to vair
lesions causeci by MMS. This element is the target site for the transcription factor Rpn4p.
InterestingIy, deletion of the RPNl gene rendered many of the genes of that group
unresponsive to MMS, without having any effect on genes of other cituters. Rpn4p is
known to regulate expression of genes encoding proteins involved in protein degradation,
suggesting that it is involved in the protein damage response pathway rather than in the
DNA-damage response pathway. Other known binding motifs that have been recognized
include those of the Raplp and the StelZp proteins, reguiating the expression of genes
encocüng ribosomal proteins and proteins q u K e d for mating, respectively. These factors
are lmlikely to be respoasible for the DNAdarnage response. Binding sites for the DNA-
chnage-specinc factor Crtlp have not yet been identined using this method.
B. Si@ transduction cascade leadhg to the DNA-damage-induced transaiptiond
reSpO=e
The signal transduction pathway leadhg to gene activaton in nsponse to DNA-
damaging agems has aiso been analyzed in yeast Cells carrying mutations in the POU
-
gene, encoding DNA polymerase E, as weU as in the MECI and RAD53 genes, encoding
kinases, are defeaive in the induction ofRMU, one of the genes that encode the large
subunit of ribonucieotide reductase in yeast (Navas et aL, 1995,1996). r d mutants are
also defeaive in RMU induction, as wefl as for inductioa of several 0th- DNA damage-
responsive genes, including RMU, RMU, CDC9, DUNI, RADSI and R4DS4
(Aboussekhra et aL, 1996). PolZp, Mec1 p, Rad53p and Rad9p afso appear to be involved
in ceil-cycie arrest, indicating that they couid have a central roie in signai tfa~l~duction
durhg the DNA damage response that Ieads to ceii-cycle arrest as w d as changes in
gene expression. A protein kinase re@ed for high level of induction of RMU and
RNIU by DNA damage in yeast, hl p, has been idenrineci. hl p, however, is not
required for induction of (IB14 and DDR48, two other DNA damage-responsive genes,
suggesting that more than one pathway is responsible for DNA damage induction in
yeast (Zhou and Elledge, 1993).
The pathway mediating the DNA damage-induced transcriptionai response in
mammalian ceils appears to be very cornplex It is believed to comprise general signal
transducers such as INK, EXR, p38 MAP, MM kinases, ras, src (reviewed by Bender et
cd, 1997; F i i and Kaina, 1997) as weH as transcription factors such as c-Jun and CREB
(Bender et al., 1997). However, it is not known whaher any of these factors is diredy
involved in the response. Transcription fàctors ultimate1y r d e d by this response are
thought to include p53 and the breast cancer nisceptibitity gene BRCAI .
One of the main transcriptionai activators known to cause increased expression of
DNA damage-responsive genes is p53 (reviewed by L~hIer, 1996). The si@
tfansduction pathway Ieadmg to p53 activation is very complex Normally, p53 has a
-
rehiveiy short haKi&, and is targeted for ubiqyïh-mediated degradation by the
MDM2 protein, which has a ubicpih-ligase a&ty. In the presence of DNA-damage,
p53 is phosphorylated by several kinases, including ATM (a homolog ofthe cerevisiae
EL1 gene), A m DNA* MK and the Cbk2 kinase (a homolog of the Si cerevhiue
M D 5 3 gene) (Lohnun and Vousden 1999; Giaccia and Kastan, 1998; Hirao et al.,
2000). These modincations reduce the afniiiN of MDM2 for p53. As a result, p53
becomes more stable and inneases in concentration. MDM2 can ais0 be phosphorylated
by DNA-PK, and this also causes a reduction in its binding nffiriitv for p53.
The histone acetyl transferases p300 aad PCAF cm acetyiate pS3 in the presence
of DNA damaging agents, which aaivates the transcriptionai hc t ion of p53 (Liu et al.,
1999; Sakaguchi et al., 1998). This acetylation stabilizes p53 in a MDM-2 independent
manner (Yuan et aL, J999).
BRCAl is phosphorylated upon DNA damage ( S d y et al-, 1997) and has been
shown to physicaiiy intexact with p53 and to increase its transcriptionai a- in vitro
(Zhang et aL, 1998).
12.5. Ribonudeotide reductase expression in response to DNA damage
The enryme ribomcleotide reductase cataiyzes the first reaction in de nwo DNA
synthesis, the conversion of ribomicleotides to deorryriioinicleotides (Reichard, 1988).
Because of its essential role in DNA synthesis this enzyme plays an important part in the
repair of damaged DNA The expression of the gmes mcoding both subunds of
niomcleotide ductase is inc~es~sed in cens treated with DNAaamaging agents in E
cotr, S. cerevr'siae, mrmmnlian c& (revïewed by Elledge et al., 1993) as welI as in
-
Dictyostelium ~ s c o i ~ (Gaudet and Tsang, 1999; our laboratory, unpublished
observations). That induction of ribonucleotide reductase by DNA-damaging agents is
obswed in all species shidied so far underscores the importance of this response.
Another indication of the importance of overexpression of ribonucleotide reductase in the
DNA damage response is the observation that t is one of ody 12 genes out of 6,200
transcripts studied in S. cerevisiae found to be upregulated in the presence of 6 different
DNA-damaghg agents (Jeiinsky et al., 2000).
A number of studies diredy suggea that increased ribonucleotide reductase
expression is advantageous to ceiis with damaged DNA Preventing the up-regdation of
one of the genes encoding the smaii subunit of ribonucleotide reductase foliowing DNA
darnage causes increased cefi death and slows d o m DNA repair in rnammalian ceiis
(Tanaka et al., 2000). Mso, an increase in the mimber of chromosome aberrations was
observed when inadiated human lymphoblastoid ceiis were inaibated with
ribomicleotide reductase inhibitors, nich as hydroxyurea (Antoccia et al, 1994; C o h s
and Oates, 1987) or paracetamol (Honglso et aL, 1993). This effect cm be rnimicked by
deoxyribomcleoside depietion (Huming and Dresler, 1985), and reversed if di four
(INTPs are provided (Honglso et aL, 1993). It has also been shown that a proper balance
ofdNTPs is important for accurate repair (Hohbeqg, 1989).
Inappropriate niomcieotide reductase expression has been implicated in
carcinogenesis. T d o r m e d ceiis express high levels of niomideotide reductase m o r d
et ai., 1970). The expression of this eiuyme cm be aitered by tumour promoters as weU
as transformitlg growth fàctor pi (Hurt8 and Wright, 1992; H m et aL, 1991). In the
presaice of activateci oacogenes, overexpression of the small mbunit of niomdeotide
-
reductase has been showa to affect the rates oftumour formation and metastasis in mice
(Fan et aL, 1996,1997). Inhibitors of nionucleotide reductrrse have been shown to slow
the growth oftinnor ceiis. For these reasons, ribonucleotide reductase is a key target for
chemotherapeutc drugs (reviewed in Szekeres et al., 1997). The factors that regdate the
expression of nionucleotide reductase am potential targets for the design of new
chemotherapeutic dmgs.
The shidy of the regdation of the nionucleotide reductase genes has been
complicated by the ceU-cycle-dependent expression of ribonucleotide reductase. Thus
analysis of the effects of DNA-damaging agents Ui proüferating cells may be
compticated by mechanisms that overlap the repair and p w t h processes. The
developmental phase of the Dicfyostelim Me cycle dows the shidy of DNA-damaging
agents. on gene expression in the absence of cell growth.
The asexual Life cycle of DictyostelMn discoidem consists of two m u W y
exclusive phases. When nutrients are abundant, Dictyos~elnmi grows vegetatively as
single-ceiied amoebae that divide by binary fission. Upon depletion of the food soince,
the amoebae aggregate to form rnuiticeliular structures comisting of approximately 10'
ceiis whifh ultimately form nuiting bodies made up of 20% stalk cens and 80% spore
tek. Completion of the developmental program takes approximately 24 hours. h g
the developrnental phase, DictyosteIium cells corne together to form rnulticellular
aggregates 8 h after the initiation ofdevefopment By 16 h the muItic&uiar aggregates
d e d shgs are differentiated along the anterior-posteor axis. RestaIk cells occupy the
-
anterior one-quarter of the shg and preqore c d s are located in the postexior three-
quarters. These preairsor ceiis UltimateIy differentiate into the stalk ceiis and spores of
the mame fnllting body. Prespore and prestaik ceils can be dassified with respect to the
gene markers they express (reviewed by Loomis in 1996).
1.3.1. Role of ribonudeotide reàuctase during Dictyosteliurun development
At the slug stage of DictyosteZium development, c d s in the prespore region
undergo a wave of DNA synthesis (Zimmerman and Weijer, 1993; Shaulsky and Loomis,
1995; Deering, 1982; hirston and Work, 1978; Zada-Hames and Ashworth, 1978). The
role of this developmentally programmed bunt of DNA synthesis is unknom It has
been suggested by different investigaton to fuel ceU division (Zimmerman and Weijer,
1993; Durston and Work, 1978; Zada-Hames and Ashworth, 1978), mitochondriaf
replication (Shaulsky and Loomis, 1995), or both (Deering, 1982). Tempody and
spatidy correlated with this wave ofDNA syathesis is the efevated expression of the
gene encoding the srnail subunit ofribonucfeotide reductase, mrB (Tsang et al., 1996).
As in other organisms, it appears that fluctuations in the expression ofmrB can be used
to predict changes in the rate of DNA synthesis. It is therefore possible that altering the
pattern of m B expression may be used as a tool to change the profle of DNA synthesis
in evaluating the role of DNA symhesis in development.
1.3.2. Reguiation of cell-type spellfic gene erprcssion in DiciyOStelium
An important question in developmemal biology is to undastand the factors that
control ceIhiIar differentiation Cells of different types express different genes, and one
-
appmach to undet~tatld how cens Merentiate is to study the factors that m a t e ce&
type-specific gene expression. Manipuiating the regdatory regions of promoters provides
a convenient way of changing the pattern of gene expression.
The regulatory regions of several genes that are e q m e d predominantiy in
prespore c e k have b e n characterized. Most of these promoters contain consensus C/A-
rich elements, cded CAEs, which have been show to be important for transcriptional
activity (Powell-Coflhm and Firtel, 1994; Powell-Coffinan et al., 1994; Haberstroh et
al., 1991 ; Haberstroh and Firtel 1990; Fosnaugh and Loomis, 1993). Also required is an
Aiî-rich element located downstream of the CAEs (Powell-Cofian and Firtel, 1994;
P o w e l l - C o h et al., 1994). When joined with a heterologous basal promoter, neither
the CAEs nor the A/T' rich element alone is able to drive expression in prespore cells.
However, expression in prespore ceils can be stimulated when the CAES and the PJT-
rich element are placed together 6th a heterologous basal promoter (Powell-Coffhan
and Firtel, 1994; P o w e l l - C o h et al., 1994). The CAEs exhibit strong affTnity for the
developmentally regulated transcriptional factor GBF (Schnitzler et al., 1 994). CeIls
carrying a nuil mutation in the gene encoding GBF are arrested at the lwse aggregate
stage, befo*e ceU differentiation has occuned (Schnitzler et al., 1994), implying that
besides the interaction between GBF and CAES, prespore gene expression req, the
interaction of otha factors and regdatory elements.
A cis-acting element that is resp011~icbIe for preStaIk-specsc gene expression has
been identified in the promoters of the pnstdk-specifi~ g- e d and e c d Wm00d
et al, 1993). The W o r that binds to this sequace, DdaTATa, has been isolated and
characmïd (Kawata et ai., 1997). Dd-STATa is a member of the STAT f d y of
-
transcriptional regdaton, which in mammalian ceff s are involveci in responses to
cytokines (reviewed by Dmeli in 1997). DdSTAT controis cd-type-speùfic gene
expression through repression of expression in other ceU types (Mohanty et al., 1999).
The expression ofcud4 in pretalk ceUs is aiso reguiated by DdSTAT (Fukuzawa and
williams, 2000)
The regdation o f m B appears to be more complex thaa that of the other known
prespore genes. In addition to expression in prespore ceus, it is expressed during
vegetative growth. A curwry examination of the G/C-Rch seguences in the promoter
region of naB shows the absence of known cis-acting elements. Only one G/C-rich
sequence in the promoter of naB exhibits similarity to W a C/A-rich element. We have
shown by deletion analysis that expression of nrrB in vegetative celis does not require
any of the G/C-rich seqyences found in the promoter. In addition, we have identified two
WC-rich sequences that utn direct prespore srpression during postaggregative
development. Re& fiom electropbretic mob5ty shift experiments suggest that these
two G/C-rich sequences interact with factors that are distinct f?om the transcriptional
factor GBF (Bonfils et al.. 1999). Charactdtion of the naB promoter may reved
novel fàctors involved in prespore-specinc gene expressioa
-
2. MATERIALS AND ZMETHODS
2.1. Growth, deveio~ment and transformation of Dictvosteiium cells
Cek of the axenie seain AXZ were grown either axenicdy in HL5 medium
(Ashworth and Watts, 1970) or on lawns of Enrerobacter aerogenes on SM agar
(Sussman, 1966). At the logarithmic phase, 2 3 x lu6 celldml in HL5 or when the
bacterial lawns began to clear, the ceus were harvested and washed in ice-cold KKP
buffer (20 mM KH#O&HP04, pH 6-21, and allowed to develop on a soiid substratum
as desdbed previously (Bonnls et al., 1994).
Plasmid DNAs were intmduced into AX2 cells by calcium phosphate
coprecipitation as described previously (Early and Williams, 1987) or by electroporation
(Tuxworth et al., 1997). Transfomiants were selected in HL5 containing 20 pg/d G4l8
(me Technologies) or 10 pg/ml blasticidin S (ICN) as appropriate.
2.2. Generation of deIetions of the mrB promoter
The XbaYBamHI genomic hgment (Grant et al., 1990) contains two-thirds of the coding
region and 450 bp of 5' noncodiag region of rmB. This hgment was cloned in-fiame to
kzcZ imo the XbuVBgm sites of pDdW 16 (Harwood and Diny, 1990) to genenite
co~l~trtlct A-450. To coxutruct the other 5' deletions, sequences werr progrrssively
removed with Balj l (Sambrook et al., 1989) h m the Xbd site. The cleaved DNA
fragments were excised with B d and cloned into the Bgm site and the end-Eilled
HindIII site o f pDdGal16. The end points of the deletions were detamined by
sequencing ushg the primer 5'-GAGAATTGG-CAATGAATG-3', complementary to
positions +26 to +45 of the sew snand of mB. WWith the exception of A-450, ail the 5'
-
deletion constructs retained the XbaIIk5>>nI- EcoN multiple clonhg site of pDdGall6.
The 5' deletion conskucts are designated A-y, where y refers to the nucleotide at the 5'
deletion end-point. Base +1 is the A residue in the initiation codon ATG.
Intemai deletions were comtructed using two different PCR products of the mrB
prornoter. The 5' primer for borh products was
5'-TTACTAGTGMTACCTGCACCTCC-3', where the imderiined base corresponds
to a mimatch in the primer to its complementary sequence that generates a SpeI site to
d o w cloning in the Xbai site of the deletion consaicts. This primer is located in the
capA open-reading fiame, from base -1779 to base -1755 with respect to the A o f the ht
ATG of m B . The sequences of the two 3' primers are as follows: box B primer:
5'-TTGAATTC.WTACACACACATTCCCGG3', and box C primer:
5'-TTGAATTCATGATGGAATCACCGTTCC-3'. The engineered EcoRi sites in these
primers, as shown by the tmderlined bases, were used for clonhg in the deletion
constructs. Polymerase chah reactioas were performed with Expandm (Boerhinger
Mannheim) according to the manufacturer's instructions, using an anneaLing temperature
of 5j°C. The internai deletions are designated -?Gî-Y, where X and Y indicate the
nucleotides 5' and 3' h m the deleted regions, respectively. AU internai deletions main
the EcoRl site from the polylinker of the vector. For constmct -444A-212, one of the
PCR products was digesteci with SpeI and XbaI and insated into the XbaI site of
con~tnict A-2 12.
The constmcts used for testing the response to DNA-damaging agents were made
as foUows. Deletions 429A-340, -429h-280 and 429A-212 werp constmcted ushg the
PCR product genei.ated with the 3' box C prima, digestecl with SpeI and Qni, and
-
inserted hto the XbaI and r@d sites of the 5' deletion constmcts A-340, A-280 and
A-212, nspectively. Deletions -444A-3 1 1 and M A - 2 8 0 were obtained by inserting the
SpeYXbaI higrnent of the above PCR product into the XbaI site of A-3 1 1, A-280 and
A-2 12, rrspectively. Deletions -359A-280 and -3596-21 2 were produced with the same
PCR fitagrnent digested with SpeI and EcoRI and cioned into the XbaI and EcoRI &es of
coostnicts A280 and A-2 12, respectively. Finally, deletion -29U-2 12 was constructed
with the PCR product obtained with the 3' box B primer, digested with SpeI and EcoRI,
and inserted into the BaI and EcoRI sites of the deletion coastnict A-21 2 (Gaudet and
Tsang, 1999).
The constnicts used for testing the developmental expression directed by the nrB
promoter were constructed in a similar way, except that the PCR products were digested
with XboI rather than SpeI, which m o v e d d the sequences upstream h m the Ba1 site
of the rnrB promoter, located 450 bp upstream fkom the ATG site.
For the c o ~ c t s containing individual G/C-rich boxes in A-2 12, pairs of
oligonucleotides were designed in such a way that, after annealing* there would be on
both sides ovahging ends, GATC, that are compatible with a Bgm site. The seqyences
of the oligonucleotides for recondtuting the boxes are as follows: for box B, 5'-
GATCmCGGGAATGTGTGTGTA-3' and 5'-
GATCTAATACACACACATTCCCGAAAG-3'; for box C, 5'-
GATCCArnGGAACGGTGATTCCATCAA-3' and 5'-
GATCTTGATGGAATGATûGAATCACCGTI:CCAATG-3'; and for box D: 5'-
GATCCTCTAGAATCWAGTGGTACCCAAAA-3' and 5'
GATCTITGGGTACCACTCCGATTCTAGAG-3'. The m e n t piacmid, A-212, was
-
modifieci to accommodate the GATC overhang of the annealed oligonucleotides by
replacing the X6alalK&d-EcoRI sites with Spel-Bgm-EcoRI, obtained from the multiple
cloning site of the vector pPC86 (Chévray and Nathans, 1992).
Box A of the naB promoter was mutagenized using the strategy shown in Figure
1 (Higuchi; 1990). These constructs were made using a modifieci p-galactosidase
reporter, üe-apgal, that is more active and more labile than the version present in the
pDdGall6 vector. The reporter is a fitrther development of the "N-terminal-de" reporter
"ile-gd" (Detterbeck et al., 1994) in which the originally N-terminally tnmcated beta-
galactosidase (Brake et al., 1978) has been replaced with an enzyme containing a
complete alpha peptide; it shows 1 O- to 100-fold increased activity with an unchanged
protein halflife (H. K. MacWüliams, personal communication).
To construct A450lAl-ile-qgd and A-450/A2-ile-apgd, the template was a
genomic clone of m B in BlueScript (Strategene) (Grant et d, 1990). For A28O/Al -ile-
apgal and AD280/A2-ile-apgal, the template was the intemal deletion -444A-280. The
seqyences of the fout phers used for mutagenesis are (1): reverse primer (in
BlueScript) 5-AGCGGATAACAATnCACACAGG-3' (for the A 4 0 coIlStructs) or 5'-
CTTGTCTAACACCAGAGTCTGo3r (which anneals to bases -696 to -676 of the rm8
promoter) for the A-280-ile-apgal c o a ~ t ~ c t s , (2): Al sense: 5'-
G A A A ~ A A ~ A T A ~ A A C C A A A A T T G C G C - 3 ' or A2 sense: 5'-
GGAACCwnmATAAAAATTTAAAAAAAA-3', (3) Al antiserise: 5'-
GCGCAAmGGmMTATAAAAAATTAATTC-3'or A2 antisense: 5'-
-
~ A A A ~ A ~ G C A A ~ G G T T C C - 3 ' , and (4) 5'-
C C A G A T C T C A ~ A ~ A T T I T I T A A T - 3 t , which overlaps the stm codon of
m B and introduces a Bgm restriction site. Mutations relative to the wiid-type sequence
are indicated by the underfine. In the fkst round of PCR, two products were genuated
that contain the mutation at one end. Tbe PCR conditions were as follows: lx PCR buffir
(20 mM Tris pH 9.5,25 mM KCI, 0.05% Tween-20,O.I mglml BSA with 2.5 mM
Mgch), 50 pM dNTP rn.ix, 50 pM dATP, 50 pM dTTP, 50 ng of template, 100 nM each
primer, and 5 units of Taq DNA polymerase. Cychg conditions were: denaturation at
94°C for 30 seconds, anneaihg at 52OC for 30 seconds and extension at 72°C for 1
minute. The template was then removed by digestion with DpnI, a restriction enzyme
that only cuts methylated DNA, and therefore that does not digest m M@o-generated
products. The PCR products were cleaned using Qiaquick PCR purification columns
(Qiagen) and used as template for a second round of PCR with primers 1 and 4 using the
same conditions as described above.
The PCR products were deaned with Q i w c k columns and digested withXoaI
and Bgm. They were then iigated to WB-ile-apgal (MacWilliams et al., 2001) that had
dso been digested with X6aI and BgA and gel purifieci with the GeneClean kit (BioCan).
The resdting products were sequenced to confirm that the mutation had been introduced.
The A-450/Al-ileapgal and A-45O/A.-üe-apgd mutants were sequmced nom the 5'
end with an oligonucleotide overlapping box D of the fouowing sequuice: 5'-
TTTCTAGAATCGGAGTGGTACCC-3'. The A-280/AI and Aœ280/A2 constmcts were
seqllenced with an antisense oligomcieotide in the codiag region ofthe reporter gene
with the primer: 5*-CTTTG?TGATCTGGAGGGATACC-3'.
-
1 TARGET SEOUENCE 1
1 First round of PCR
1 Remove primes and template
1 Generation of full-length product with the desked mutation
FIGURE 1. Strategy for site-directed matagenesis of box A of the mrB promoter.
The template is amplineci in two independent reactions, one using primers 1 and 3, and
the second one using primers 2 and 4. The two products are thai used as template using
primers 1 and 4 for the ampMcation. This results in a W-Iength product containing the
desired mutation
-
2.4. Dhm~tion of the mrB promoter bv homolo~ous recombination
The stzategy for disuption of the rmB promoter by homologous recombination
is depicted in Figure 2. The pRHIl O0 plasmid (a gift fiom Robert H. Insall) was digesteci
with Ba1 and EcoEü to generate a fragment containing the blasticidin resistance gene as
weil asPrornoter and termiaator sequences. This ficapent was cioned into the XbaI and
EcoRl sites of the internal deletion -359A-212 (Gaudet and Tsang, 1999; Section 2.2) in
such a way that the fragment between -2 12 and -450 of the m B promoter was replaced
by the blasticidin resistance f ' p e n t The resulting constnict was linearized at SpeI and
BamHI sites and cleaned by phenol: chloroform extraction. The Linearized DNA was
introduced in Dictyostelium by electmporation (Tuxworth et al., 1997) and selected with
10 pg /d blasticidin S (ICN). Genornic DNA was extracted as descnid (Nellen et al.,
1987) from approximately 50 different clones and andyzed by Southeni blot (Sambrook
et al., 1989).
2.5. Treatment of DicîvosteIium cells with dru= and ceIl survival assavs
For treatrnent of vegetative cens, stock solutions of the drugs were added directiy
to growing cek in HL5 medium. For treatment with chemicai agents during early
development, the cens were deveioped in suspensions of= for 4 h pnor to the
addition of dnig solutions. Cens madiated with UV aad c e b treated with genotoxic
agents during late development were developed on aters saturated with KKP at lu6
c e w d . For treamients with chemical agents, the mters were pîaced on pads of blotting
papa that had been saturated wini KKP containhg dnigs at the s p d e d concentrations.
W treatments were perfonned with a UV cross-linker (Stratalinka 1800, Stratagene).
-
ATG +1
of wïid type cens
Vector sequence
Homolonous recombinatioo
ATG +l
-3722 -2396 -2118 -1507
BSK Genomic DNA :.:.:O:-:-:O:. of disuption
mutant
FIGURE 2. Shtegy for replncement o f the nuB promoter by the biasticidin-
resistpnce gene,
The d a s indicate the distance in bp using the A of the k s t codon of the m B coding
sequeme as a reference, shown as +1. Restriction enzyme sites are abbreviated as
foiiows: EcoRI RI; EcoRV: RV, B M : B; Bal: X;, SpeI: S.
-
Calibration of the UV lamp was verified using inidylic acid as a chernicd actinometer
(Smith, 1977) correcthg for absorption by the solution (Morowitz, 1950). Methyi
methane sulfonate (MMS), 4-nitroquinoLine-l-oxide (4NQO) and cycIoheximide were
purchased h m Sigma Hydroxyurea was obtained h m ICN.
Following matment with genotoxic agents, the ceHs were diluted in KKP bufTer.
Aiiquots of the various dilutions were spread together with Enterobacter aerogenes on
SM plates. Sumivon were scored by counting the number of plaques on the SM plates
(Gaudet and Tsang, 1999).
2.6. RNA anabses
CeUs were collected by centrifugation and washed once with cold KKP bufEer.
The ceii pellets were frozen on dry ice and kept at -70°C until the RNA was extracted
according to Franke et al. (1987). Ceil pellets containhg up to 2 x 10' ceUs were
renispended by vortexing in 200 @ of GSEM bufTer (50% guanidine thiocyanate, 0.5%
sarkosyl, 25 mM EDTA, 0.1% 2-mercaptoethanol, pH 7.0). One volume of phenol and
one volume of chlorofom were added. The sample was voaexed vigorously for 1 min
and centrifbged for 5 min. The aqueous phase was aansfemed to a nesh tube. The
phenol: chlorofom extraction was repeated two more thes, and then the nucleic acids
were extracted twice with chloform only. The nucleic acids were precipitated with 0.3 M
sodium acetate and 2 volumes of 95% ethanol at -70°C, centrifuged for 10 minutes and
rinsed with 70% ethanol. The pe11ets were air-dried and resuspended in DEPC-treated
water. The nucleic acids were qnantifîed spectmphotornetricaUy.
-
For Northern blot anaiysis, 10 pg of RNA were mixed with ethidium bromide and
resolved on fomialdehyde gels as descnaed (Fourney et al.. 1988). Mer electwphoresis,
tht gels were visualized under a UV illimiinator to ensure even loading. Nucleic acids
were traasferred onto Nytnin membranes (Schleicher & Schuell) in 10x SSC and cross-
linked using a UV cross-Liaker (Stratalinker 1800, Stratagene). Radioactive probes were
generated by random priming following the manufacturer's protocol (Pharmacia).
Briefly, 25 ng of DNA were denatured by boiling and chilled on ice. The labelling
reaction contained 15 pI of random primers b a e r (0.67 M HEPES, 0.17 M Tris-CI, 17
m i MgCl& 33 mM 2-mercaptoethanol,1.33 m g / d BSA containing 18 ObM) WIits
hexamers/ml, pH 6.8), 20 pM of each dGTP, dATP and dTTP, 5 pl of [O~-~~P]~CTP
(ICN) (3000 CVmmol) and 10 Mits of Klenow DNA polymerase (MBI Fermentas) in a
final volume of 50 @.'The reaction was incubated at room temperature for several hours.
Unincorporated nucleotides were removed by passage through a Sephadex G-50
(Pharmacia) size exclusion column. The DNA was denahired again before addition to the
prehybridization solution. The n v B probe was the EcoRI-Dra1 fiagrnent of the naB
coding sequence, a region not present in the mB/IacZ reporter constmct used to make
the deletions of the m B promoter (Tsang et aL , 1996). AIternativeIy, for RNA extracted
f?om celis not bearing these constructs, we used a fuiMength cDNA clone encoding nuB
(SSF884) obtained firom the University of Tsukuba (Japan) (Morio et al, 1998).
Hybridizations wae conducted in Denhardty s hybridization solution (6x SSC (0.9 M
NaCI, 0.09 Na3citrate), 5x Denhardts' reagent (0.1% BSA, 0.1 % Ficou, 0.1%
polyvinylpyrrolidone), 0.5% SDS, 100 Mm1 denatrned, sonicaUed haring sperm DNA)
containing 50% formamide (Sambrook et al., 1989). Hybridizations and strhgency
-
washes were performed as follows: the blots were hybridized at 40°C overnight and
washed twice for 30 minutes in lx SSC, 0.1% SDS at 6S°C; except for the l a d and the
capA probes, for which hybridization temperatme was 4S°C and the washes were done
in 0. lx SSC, 0.1% SDS at 65OC. Blots were exposed to Kodak X-ûmat nIms with
i n t e m g screens. For each experiment, the same blot was hybridized with cliffixent
probes. Between each hybridization, the probe was stripped h m the membrane by
incubahg twice for 1 5 minutes in a boiling solution of 0.1 x SSC and 0.5% SDS.
For dot blot analysis, IO pg of total RNA were treated with 0.3 units of RQ1
Mase-fkee DNase (Promega) for 30 minutes at 37OC. 'This suspension was mked with 3
volumes of denaturation solution (37% fonnaldehyde, 100% formamide and 20x SSC, in
a 7:20:2 ratio), heated at 65°C for 15 minutes, and chiiied on ice. Two volumes of 20x
SSC were then added to the solution. The RNA samples were spotted in duplicates (5 pg
per spot) onto Nyhsui membranes that had been washed with 10x SSC. The membrane
was washed again with 10x SSC and nnally the nucleic acids were cross-iinked.
To d e t h e the leveI of expression of the reporter transcript, blots were
quantified ushg a phosphorimager (BioRad GS-363) and the signal intensities were
determhed using Molmilar AaalysPf software (BioRad). The fold-induction of nrrS
was detennined by dividing naB transcript level in treated ceiis by that of untreated
ceus. On average, induction for 25 mM MMS and 10 pg/d 4NQO was 7.5-fold and 15-
fol4 rapectively. To compensate for variations among experiments, a correction factor
was used to calculate the fold induction for the reporter gene activity- The correction
kctor was obtained by dividing the average induction level for r d by that of the
observeci induction Ievei. Thus, if the observed induction for 4NQO was 30-foià, the
-
correction factor wouid be 15/30 or 0.5. The foId-induction of the reporter traasctipt was
caldated by dMding the Ievel of IacZ message in eeated c d s by that of the untreated
cek, then multiplying this value by the correction factor (Gaudet and Tsmg, 1999).
2.7. Assav for B~~aIactosidase
B-gaiactosidase actMty was assayed using Galacton-Light lus^', a
chduminescent substrate propix). Cells were harvested in KKP buffer, pH 8.0 and
lyzed by freezing. Ceiis were thawed in 100 mM NaP04 containing 1 mM DTT and
cenmfuged for 10 min at 4'C to remove membranes. The supernatant was traasferred
into a kesh tube, and protein concentration was determined using Bradford assay
(Bradford, 1976). The protein was diluted to 500 pg/d. The substrate, Galacton-Light
Pius, was diluted 1 : 100 and 10 pi of sample were added to 60 @ of substrate. Mer a
reaction tirne of30 min, 100 pi of Light Emission Accelerator were added to each sample
and the cherniluminescent product was detected with a Berthold Lumat LB9501
luminometer (MacWfiams et al., 200 1).
2.8. Histolonid staininns
Ceiis were grown on bacteria and developed on pre-boiled nitrocelluiose mers
restiiig on KKP-saturateci pads at a density of about 2 x 106 cells/cm2. At the siug stage,
the .Eifters supporthg the slugs were fixed in O. 1% ghaaraldehyde in Z b e e t (containing
60 mM Na2HPOs. 40 mM NaE12P04 and 1 mM MgS02, pH 7.0) for 10 min and assayed
for B-galactosidase activity by incubahg in Dingermaun's cockw (5 mM K3Fé(W6],
5 mM &Fe(CN)s], 1 mM EGTA and 1 mM X-gai in Z-buffer) d staining was
-
observable under a Iight microscope @ingermami et al , 1989). The reaction was stopped
with 3% TCA. The nIters were washed in water, mounted on microscopie slides tmder
coverslips, and examined on a Zeiss Axiophot microscope with a 10X objective. Pictures
were taken on Kodak Royal Gold ASA 25 fîlm (Bonfils et ai., 1999).
2.9. EIectro~horetic mobilitv shift assavs (EMSA)
The cytosolic and nuclear extracts were prepared as described (Schnialer et al.,
1994). Celis were resuspended in Lysis birffer (50 mM Tris-CL pH 7.5,40 mM MgCl2, 20
mM KCI, 2 mM DIT, 5% sucrose, 0.15 mM spennine? 0.15 &f spermidine and 10%
percoll) containhg protease inhibitors (0.1 m g / d phenylmethyl sulfonyl fluoride, 10
pg/d adpain, 1 p g / d pepstatin A, 0.1 mghl beozamidiie) and lysed by passiag
through a 5 plM polycarbonate fïiter. The suspension was centrifuged, and the
supernatant fcraction was saved as the cytoplasmic fiaction and dialyzed in 4x binding
buffer (20 m M Tris pH 8.4,240 mM KCl, 0.1 miM EDTA, 1 m M DTT, 0.05% Triton X-
100). The nuclei were renispended in 25 m M Tris pH 7.5,12.5 mM MgCb, 100 mM
KCI, 0.1 mM EDTA, 1 mM DTT, 20% giycerol and 0.35 M (NH4)2S04, and nuclear
proteins were extracted by incubating at 4OC with gentle rocking. The saltsxtracted
materid was cleared by centrifugation at 100,000g. The supernatant was concentrated by
a 60% (NH4hS04 precipitation, folIowed by dialysis Ui 4x binding buffer (see above).
The probes were oiigonucleotides recoIlStinrting boxes A and B of the naB
promoter as weU as the CAE-1 fimm the SP60 promoter (Haberstroh et al., 1991).
UnIabeUed oligonucieotides corresponciing to these sequences dong with box C and box
D, as weII as two mutant forms of box 4 named box Al and box A2, were used in
-
cornpetition assays. The sequences of dl the synthetic oligonucleotides used in =SA
are shown in Table 1. Box A l and box A2 are the same oügonucIeotides as those used
for sîte-directed mutagenesis (Section 2.3)- The oligonucleotides were quantified
spectrophotomeaicaüy, and eguimolar ratios of sense and antisense strands were
aanealed in 10 mM Tris and 200 m i l NaCl by b o h g the solution and lethg it cool
down at room temperame. Ten mits of polynucleotide kinase (MBI Fermentas) were
used to end-label O. 1 pmol o f oligonucleotide in lx fornard b&er (70 mM TN-Cl pH
7.6,100 mM KCl, 10 mM MgC12, 5 rnM 2-mercaptoethanol) containing 5 pi of [y-
"PIATP (3000 Ci/mmol). The reaction was carried out at 37OC for 30 min and stopped
by adding EDTA to 10 mM. The unincorponited nudeotides were removed by passage
through a Sephadex G-50 column.
For the binding assays, 10 pg of protein extract were hcubated with 3000 cpm of
end-labelled probe (0.1 to 0.5 ng), 500 ng of double-stranded poly[dI-dC] (Sigma), and I
pg of BSA in a final volume of 20 pi of Ix binding b u f k (see above). The components
were aiiowed to bind at room tempera- for 30 minutes, immediately applied on a 4.5%
acrylamide-TBE gel and resolved at 4OC at 140V until the unbound probe reached the
bottom of the gel. Following etectrophoresis, the gel was fixed in 10% acetic acid, dried,
and exposed to X-ray films (Kodak X-Omat) (Bonfils et al., 1999).
-
TABLE 1. Sequence of the synthetic oligonudeotides used for EMS&
(sense) BOX B 1 5'-GATCTAATACACACACATTCCCGAAAG-3'
(sense) BOX A (antisense) BOX B
(antisense) 1 Box C 1 5'-GATCCATTGGAACGGTGATTCCATCAA-3'
5'-GATCTTAGCGCAAmGGnCCTATG-3"
5'-GATCCTTTCGGGAATGTGTGTGTATTA-3'
1 Box C 1 5'-GATCTTGATGGAATCACCGTTCCAATG-3' 1 (antisense) 1 I (sense) BOX D 5'-GATCTTITGGGTACCACTCCGATTCTAGAG-3' (antisense) BOX A-M 1 5'-GAAATrL\Um.4TAmMCCA-L4ATTGCGC-3' I
(antisense) BOX A M 2 5 ' - G G M C C A A A A I T G C T A T A A U - 3 '
(antisense) CAL1 5'-GATC'TTTM'CACACACCCACACACTAATTTACCCCA~G-3' (sense) I , CAE-1 (antisense)
j'-GATCCAPPLAATGGGGTAAATfAGTGTGTGGGTGTGTGAAAAA-3'
-
3.1. Defininp the mrB Dromoter
Similar to other Dictyosteiliuni promoters, the 5' untramaibed region of the naB
gene contains over 85% A and T residues with chuters ofG/C-rich sequences of
approximateiy 15-20 bp in length. The sequence of the 450 bp upstream of the open
reading hune making up the m B promoter is shown in Figure 3 ('ïsang et aï., 1996). In
severai Dictymtehm promoters that have been analyzed previously, G/C boxes have
been shown to be important for control of gene expression (Habentroh et aL, 199 1; Pears
and Williams, 1987). This 450-bp fhgment of the nuB gene is sufficient to CO&
regdation on reporter genes during the ceil cycle, in response to DNA damaging agents
and during multiceliular deveiopment. The positions of the four G/C-rich boxes
containeci in the mrB promoter me indicated in Figure 3. We refer to these sequences as
boxes 4 B, C and D, fiom the most proximal to the transcription stan site to the most
distal, respectively (Bonfils et aï., 1999).
32. Eh~ression of the W B pene is ceIl cvcie-re~ulated
In aU species studied until now, the genes coding for nionucfeotide reductase are
regdateci during the ceil cyde. They n o d y begin expression at the GUS transition
point. Since the Dictycasteliimr c d cycle lada a daectable G1 phase it is dinicuit to
predict how rmB is regulated during the c d cyde. In coiiaboration with Dr. Hany
MacWrlliams (MacWfiams et d , 2001), we have examineci the ceil cycle regdation of
the mi3 gene uSiag AX2 ceiis transformeci with a plasmid, RnrB-iieapgaI, that contains
the 45Mp mrB promota fiised to an mstabIe vasion of f3-gdactosidase.
-
box D ~TCTAGAATCG GAGTGGTACC-TATAGC TTTTTTTTTT TTTTTTGAAA
CAAATAAAAT
TTAATTTTTT
AAAATTCAAA
ATTATTTATA
box C ATTTAATTTA TT#ZGARCGGT GATTCCATC~ TAAACAAAAA
AAATAAAATT TTAATATTTT
AAAAAAAAAA AAATATTCTG box A
AT$GAACCA AAATTGCG~T
TTTTTTTTTT TTTTTTTTTT
ACAAATAAAT ATTATTTTTT
box B TTTCTT~CGG GAATGTGTGT~
TTTTTTTTAA
AAAAATTTAF,
ACTTTTTTTT
AATTTTATTA
TTTTTTTATT
TTCATATTAT
-100 ATAATTTTGG ATTGATTTCA AAACTTAATA AAATCTCATT GTACATTAAA
-50 TTTTATAAAA TAAAATAAAA AAAAAAAAAA TTAAAAAATA AAAAATAAAA
+l ATG
D C B A
FIGURE 3.5' upstreaxxt region of mrB.
Panel A shows the sequence of the 450 bp upstream of the start codon o f m B . The
boxed sequences show the G/C-rich regions refend to as boxes A, B, C, and D in the
text A schematic representation of the rmB gene is depicted in panel B, hcluding the
position of boxes A, B, C and D, as weU as the position of the gene flaniàng d,
CM. The transcription sunt site is indicated by an arrow.
-
The ceiis were synchronized by the coId shock method in which ceiis are maintained at
Iow temperature (9.SQC) for 14-16 4 then warmed nipidiy to room temperature. Samples
were taken every hour for 9 hours, the approxhate duration of one ceIi cyde. The
fhction of cek in S-phase was detennined by bromodcoxyuridine (BrdU) labeiling, and
samples were taken for measurement of P-paiactosidase aamty and for RNA extraction
Afier she separation by formaldehyde gel eIectrophoresis and blotting, the RNA was
probed for bath the endogenous nuB message and the lac2 message. The levels of
transcripts were quantified with a Phosphorimager and loading was corrected by dividing
by the level ofcqA transcript, which in these experiments corresponded closefy to that
ofthe ribosomal RNA (data not shown) (MacWilliams et cd., 2001).
The BrdU incorporation curve and the B-galactosidase activity peaked 4 h &er
release nom the cold shock (Figure 4A). Both the endogenous mrB message and the
reporter message were highest fkom 2.5 to 3 h h Dictyosfelium, mitosis lasts about 15
minutes and the S phase has been estimated at 30 minutes (Weijer et al., 1984). Shce G1
is undetectable, and the rest of the ceil cycle is G2, the interval h m the beginning of M
until the midpoint of S is about 30 minutes. The approximate I I delay berneen the naB
message peak and the S phase maximum thus places nirB message peak in late G2.
S i d a r resuits were obtained with unûansformed ceIIs (data not shown).
We wished to confirm the ceU-cycle dependent expression of m B us@ an
independent method. C d s were thus synchroaized by the high density method in which
c d s are aiiowed to go into stationary phase. These c d s stop dMding, and when
transferred to Eesh medium they start dividing synchrowusly. Samples were taken at 1-h
imerwls wer a period of 12 h for measutexnent o f d promoter activity and BrdU
-
incorporation Shce the RnrB-iagd reporter levds accurately reflected the rnrB message
(see Figure 4A) and is considerably easier to assay, we used the reporter to assay
promota advity. The results of this expriment are show in Figure 4B. The hction of
ceils in S phase peaked 4 h after release from high de*, as we had seen for the cold
shock. After high-density synchronization, however, the mrB promoter advity was
maximal about 3 h after the S phase (Figure 4B). This was seen in most individual
experiments as weii as in the overd average. These r d t s suggest that there are two
peaks of naB expression during the DictyosteZium ceU cycle. This is supported by other
experiments done with unsynchronized ceiis (see Discussion; MacWilliams et al., 2001).
33.1. RoIe of box A in regulating the ceU-cycle expression of rnrS
Since box A bean homology to the M M box involved in ceii cycle controi of
gene expression in S. cerevisiae (rwiewed by Andrews and Herskowitz in 1990). we
examined the abiiity of a tnincated m B promoter, containhg only 280 bp upstream from
the ATG site and including box 4 to direct cd-cycle regdation on the ileapgai
reporter gene. Ceiis were cold synchrooized and assayed for p-gaiactosidase activity.
Figure 5 shows that the A-280-deupgd constnict cxhibts ceII-cycle-regulated activby,
sïmiIar to that of the entire rmB promoter (Figure 4). Two mutations have been inserted
in the 4-280 consmict, Al and A2, rdting in A-2801A1-iieotpgal and A-280/AZ-de-
apgal (see Figure 5). Celis transforrned with these constructs were tested for expression
of fi-galactosidase during the c d cyde (Figure 5).
-
FIGURE 4. Ceil cycle regiiiation of mrB after synchronization.
AX2 cells transfomed with the RruB-ile-apgal plasmid were synchronized. Samples
were taken every hour to assay the proportion of S phase ceils as indicated by the number
of BrdU Iabeiied ceiis, the j3-galactosidase activity directed by the mrB promoter, as weil
as the levels of 1ucZ and endogenous rnrB transcripts. CeUs were synchronized by the
cold shock method (panel A) or by the high density rnethod @anel B).
-
A CoId synchronized celis
-
Time after reiease fiom cobd
box A l : 5'-ATAEAACCAAAATTGCGCTT-3
box A.2: SWAGGAACCAAAATTGCUT-'3
FIGURE S. CeII-cycle reguiated expression directed from wiid-type and mutated
versions of box A.
T d o n n a n t s bearing the A-280-ilespgd, the A-28OIAl-iIe-apgaI or the A0280/A2-
h p g d coll~tfucts were synchronized by coId