regulation of erythropoiesis by the neuronal transmembrane protein lrfn2

Experimental Hematology 35 (2007) 724–734

Regulation of erythropoiesis by the neuronal transmembrane protein Lrfn2

Andres Castellanosa,*, Georgina Langa, Jonathan Framptonb, and Kathleen Westona

aInstitute of Cancer Research, CR-UK Centre for Cell and Molecular Biology, London, UK;bInstitute of Biomedical Research, The Medical School, University of Birmingham, Edgbaston, Birmingham, UK

(Received 28 September 2006; revised 26 January 2007; accepted 7 February 2007)

Objective. The transgenic mouse line MEnTCD2.5 expresses a dominant interfering Mybprotein in a T-cell–specific fashion. When MEnTCD2.5 animals are crossed to a second lineubiquitously expressing Myc, they develop a rapid onset, fatal disease characterized byenlarged lymph nodes full of nonlymphoid cells. This study aimed to elucidate the reasonfor this anomalous non-T–cell phenotype.

Materials and Methods. We studied the cells by morphological analysis, surface marker stain-ing, mRNA expression studies and in vitro colony-forming assays.

Results. Aberrant cells in MEnTCD2.5 lymph nodes are erythroblasts, and cooperation be-tween MEnTCD2.5 and Myc causes severe erythroblastosis, but not erythroleukemia.MEnTCD2.5:Myc and MEnTCD2.5 animals have pronounced extramedullary erythropoiesisin their lymph nodes, and some increase in bone marrow–derived erythroid progenitors; noother MEnTCD2 transgenic line cooperates in this fashion with Myc, suggesting that theMEnTCD2.5 integration site, in intron 2 of the Lrfn2 gene, is of importance. To confirmthis, in in vitro colony-forming assays, expression of wild-type Lrfn2 phenocopies theMEnTCD2.5 defect. Finally, Lrfn2 expression also causes the outgrowth of a bizarre celltype in colony-forming assays that stains positively for both early hematopoietic and fibro-blast/fibrocyte surface markers.

Conclusions. The Lrfn2 protein, a transmembrane adhesion-type molecule, is able to subverthematopoietic differentiation to increase erythropoiesis. In cooperation with Myc, this leads toerythroblastosis. Lrfn2 may also be involved in colony forming units-fibroblast regulation. AsLrfn2 expression is detectable in wild-type bone marrow, it likely plays a novel role duringnormal hematopoiesis. � 2007 International Society for Experimental Hematology. Pub-lished by Elsevier Inc.

Erythropoiesis is a highly regulated process whereby the redcell component of the bloodstream is modulated through de-cisions by multipotent and committed erythroid progenitorsto divide, differentiate or apoptose. In adult mice, the earliestdetectable committed erythroid progenitors occur in bonemarrow and spleen, and are defined by invitro colony-formingassays as the early burst-forming units erythroid (BFU-E) andthe more mature colony-forming units erythroid (CFU-E)[1,2]. Following a series of four to five cell divisions, CFU-E cells become erythroblasts, and progress through fourmorphologically distinct stages that can be broadly defined

Offprint requests to: Kathleen Weston, Ph.D., Institute of Cancer

Research, 237 Fulham Road, London SW3 6JB, UK; E-mail: kathy.weston@

icr.ac.uk

*Dr. Castellanos current address: Department de Genetica i de Microbio-

logia, Fac. Ciencies, Campus Bellaterra, Edifici C, Universitat Autonoma

de Barcelona, Barcelona 08030, Spain.

0301-472X/07 $–see front matter. Copyright � 2007 International Society for

doi: 10.1016/j.exphem.2007.02.004

by acquisition of the red cell marker Ter119 and decreasingexpression of the transferrin receptor CD71 [3]. Finally, eryth-roblasts extrude their nuclei to become reticulocytes and thenmature circulating erythrocytes.

Erythrocyte numbers can be rapidly expanded in re-sponse to stresses such as blood loss, hypoxia, or anemiavia tight regulation of BFU-E and CFU-E progenitors.This occurs via the cooperation of the stem-cell factor re-ceptor Kit, which is expressed on immature cells up tothe CFU-E stage, the erythroid lineage-specific erythropoi-etin receptor (Epor) and the glucocorticoid receptor, whichtogether regulate expansion, differentiation, and survival oferythroid progenitors [4–6]. The rapid changes in signalingeffected by extracellular events are converted into cell fatedecisions by activation of networks of transcription factors[7]. In erythroid differentiation, key factors include Tal1/SCL, important for the commitment and differentiation of

Experimental Hematology. Published by Elsevier Inc.

mailto:[email protected]

mailto:[email protected]

725A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

erythroid progenitors [8], Gata1, which is crucial for laterstages of development [9–11], Gata2, required for the sur-vival and proliferation of immature cells [12,13], andKlf1(EKLF) [14,15], which regulates activation of theHbb (b-globin) gene [16]. Conversely, the Ets-family factorPU.1 is an antagonist of Gata-mediated transcription, andits expression blocks erythropoiesis [17–19].

Dysregulation of erythropoiesis is also initiated by sur-face receptor activation. For example, in Friend disease,the initial stage of uncontrolled erythroid proliferationand erythroblastosis is induced by the viral glycoproteingp55, which sensitizes the EpoR to activation by erythro-poietin, thereby triggering activation of multiple down-stream signal transduction pathways [20]. Stresserythropoiesis is targeted by the v-erb-a (thyroid hormonereceptor) and v-erb-b (epidermal growth factor receptor)oncoproteins of avian erythroblastosis virus, which simulta-neously induce proliferation and block terminal differentia-tion [21].

We report here the identification of Lrfn2, which en-codes a glycosylated transmembrane protein previously de-scribed in relation to the neurological synapse, as a geneable to increase erythropoiesis by increasing numbers ofprogenitors and subsequently erythrocytes. Infection ofmurine bone marrow with a retrovirally expressed Lrfn2gene causes an increase in BFU-E and CFU granulocyte-erythrocyte-monocyte-megakaryocyte (GEMM) numbersin colony-forming assays, and also generates an aberrantpopulation of cells, which we suggest may arise fromhematopoietic-derived fibroblast colony-forming cells(CFU-F).

Materials and methods

MiceAll mice were maintained in the Institute of Cancer Research an-imal facility in accordance with local guidelines. Strains usedwere MEnTCD2.5 [22], H2-K-Myc [23], C57B1/10, and MF1-nude (Harlan).

Identification of transgene integration siteThe integration site of the MEnTCD2.5 transgene was determinedusing the method of Collins and Weissman [24] using the oligonu-cleotide primers GCAGAAGTCCCAGAATAGCCAA and ATTT-CATCGTCTTGTCCAAGCT, specific for the CD2 LCR sequencewithin the transgene. A 1.3-kb fragment was amplified and se-quenced. The sequence not contained within the transgene wasscreened against the mouse genome using the National Centerfor Biotechnology Information Basic Local Alignment SearchTool, and the integration was localized to NT_039649, nt35090040, which corresponds to a position on chromosome 1739.673kb 50 of exon 2 of Lrfn2.

Flow-cytometric analysis and stainingWhole cell preparations from lymph node and bone marrow wereincubated with fluorescein isothiocyanate (FITC), phycoerythrin

(PE), or PC5-conjugated antibodies or with biotinylated antibodiesand the appropriate secondary antibody. Live cells were identifiedby the absence of staining with TO-PRO-3 iodide (MolecularProbes, Carlsbad, CA, USA). Four-color staining was used to an-alyze the heterogeneity of cell preparations. Antibodies were fromBD Pharmingen (San Jose, CA, USA): anti-Ter119 PE (553673),anti-CD2 FITC (01174D), anti-CD11b PE (017158), anti-CD34FITC (553733), anti-CD44 FITC (553133), anti-CD45R PE(553089), anti-CD71 FITC (553266), anti-CD144 (28091D),from e-Bioscience: anti-Ter119 FITC (11-5921-82), anti-CD14FITC (11-0141-81), anti-CD31 FITC (11-0311-87), anti-CD45FITC (11-0451-82), anti-CD48 FITC (11-0481-81), anti-CD54 bi-otin (13-0541-81), anti-CD117 (11-1171-81), anti-CD90 biotin(13-0900-8), anti-CD105 biotin (13-1051-81), anti-CD106 biotin(11-1061-81), anti-CD133 FITC (11-1331-82), anti-CD140a bio-tin (13-1401-80), anti-CD140b biotin (13-1402-80), anti-CD150PE (12-1501-80), AA4.1 FITC (11-5892-81), anti-Sca1 PE (),Serotec: anti-CD13 FICT (MCA2183F). Streptavidin-PE (BD13025D) or -FITC (BD 554060) were used to visualize the bio-tin-conjugated antibodies. Rabbit preimmune serum and anti-CD248 was a kind gift from C. Isacke, Institute of CancerResearch, London. Samples were run on a BD FACSCalibur orsorted on a BD FACSVantage, and data were analyzed usingFlowJo software.

May and Grunwald (BDH 350255S) and Wright Giemsa(Sigma WG16) staining was performed following manufacturer’sinstructions. Diaminobenzidine staining of cells was performed onmethanol fixed cells by incubating preparations for 1.5 minutes in1% 3,30 dimethoxybenzidine (Sigma D9143) in methanol and 1.5minutes in 1% H202 in 50% ethanol followed by 30 seconds inH20. Hematoxylin and eosin (Ehrlich, Fluka, 02992) stainingwas performed following manufacturer’s instructions.

Cell-cycle analysisHarvested cells were washed in phosphate-buffered saline (PBS),fixed in cold 70% ethanol, incubated for 30 minutes at 4�C,washed in PBS, incubated in 50 mL 100 mg/mL RNase followedby the addition of 200 mg (50 mg/mL) propidium iodide and anal-ysis by flow cytometry.

Reverse transcriptase-polymerasechain reaction of cDNA samplesAmplified cDNA bands were produced using gene-specific oligo-nucleotide sequences and Taq PCR Master Mix (Qiagen, 201445)following manufacturer’s instructions. Oligonucleotide sequencesand polymerase chain reaction (PCR) conditions are availableupon request. For semi-quantitative reverse transcriptase PCR(SQ-RT-PCR), linearity of PCR reactions was confirmed by sam-pling and visualization by gel electrophoresis at 15, 20, 25, 30, and35 cycles. For Q-RT-PCR, amplified cDNA bands were producedusing specific oligonucleotide sequences and Quantitect SYBRgreen PCR master mix (Qiagen 1017340). Samples were amplifiedfor 40 cycles using a Prism 7900HT system (Applied Biosystems),and analyzed using Applied Biosystems software.

Preparation of mRNA/cDNA from cell preparationsCell preparations were pelleted, the pellets dissociated, resus-pended in Trizol (Gibco BRL, 15596-026), and mRNA preparedfollowing manufacturer’s instructions. cDNA was produced using

726 A. Castellanos et al. / Experimental Hematology 35 (2007) 724–734

oligo dT (Sigma, C110A) and Moloney murine leukemia virusreverse transcriptase (Invitrogen, 28025-013).

CFU assaysCells were plated in M3434 methyl cellulose (Stem Cell Technol-ogies, Vancouver, BC, Canada) following manufacturer’s instruc-tions. Colonies were counted and typed to 14 days.

Cloning of Lrfn2 cDNA into MSCV-IRES-GFPForward and reverse primers specific for 50 (GGTACCGAGCTCGGATCCATGGAGACTCTGCTTGGTGGG) and 30 (GGCCGTTACTAGTGGATCCCTACACAGTACTTTCCATTAC) sequencesof Lrfn2 cDNA were used to amplify cDNA produced from wild-type thymus mRNA. DNA was digested with EcoRI (MSCV-IRES-GFP) and SacI (Lrfn2), blunt-ended using T4 DNA polymerase anddigested with XhoI. Ligation of the fragments produced resulted inthe cloning of Lrfn2 downstream of the 50 LTR of MSCV-IRES-GFPand upstream of the 30 IRES sequence in MSCV-IRES-GFP.

Production of retrovirusPhoenix-Eco cells were obtained from the laboratory of G No-lan and used to produce and titer virus, and infect bone mar-row following the instructions provided (available at: www.stanford-edu/group/nolan/protocols2).

Cell cultureUnclassifiable (UC) cells were grown in RPMI 1640 mediacontaining 10% fetal calf serum, 2 mM L-glutamine, 1 U mL�1

penicillin, and 1 U mL�1 streptomycin.

Results

Doubly transgenicMEnTCD2.5:H2K-Myc mice develop erythroblastosisMEnTCD2 transgenic mice express a dominant negativeMyb construct in a T-cell specific manner [22]. We derivedthree lines of these mice, all of which display the same T-cell phenotype [22]. However, when one of these lines,MEnTCD2.5 (termed MEnT5 hereafter), was crossedwith a second transgenic line, H2K-Myc (termed Myc here-after) [23], in which the Myc oncogene is ubiquitously ex-pressed, all doubly transgenic MEnT5:Myc offspringdeveloped enlarged lymph nodes (LN) between 4 and 10weeks of birth. All mice had to be sacrificed before 14weeks of age because of extreme enlargement of their pe-ripheral LN. Nontransgenic or singly transgenic littermatesdid not have enlarged LN and their survival was not com-promised (data not shown). Postmortem examination ofthe doubly transgenic MEnT5:Myc animals showed en-larged LN and spleens, with some individual LN beingw1 cm in diameter at 8 weeks of age. Total cell numbersin inguinal and axiliary LN had increased to between 5 �108 and 25 � 108 cells, with the greatest increase in olderanimals (Fig. 1A). The LN consisted of large hematomaswith cystic degeneration and diffuse hemorrhage with ne-crosis, and they appeared to have become a site of extrame-

dullary hematopoiesis. However, injection of MF1 nudeanimals either intravenously or subcutaneously with cellsfrom MEnT5:Myc LN did not produce tumors, indicatingthat the abnormal cells were not leukemogenic (data notshown). Blood smears taken from wild-type (wt) litter-mates, MEnT5 and MEnT5:Myc mice and stained with he-matoxylin and eosin and diaminobenzidine showed thepresence in both single transgenic MEnT5 and doublytransgenic MEnT5:Myc blood of aberrant target cells,symptomatic of abnormal erythroid development (Fig. 1B,arrowed). Histological examination of MEnT5:Myc LNshowed that they contained many nonlymphoid cells. Thesmaller aberrant cells stained positively with diaminobenzi-dine, which together with their size and morphologyindicated they were a mixture of late-stage erythroblasts,reticulocytes, and mature erythrocytes. Many of the largercells had morphological characteristics consistent with theirrepresenting earlier stages of the erythroid lineage [3](Fig. 1B, lower left panel). These aberrant cells were alsoobserved to a lesser degree in single transgenic MEnT5mice (Fig. 1B, center left panel). Taken together with theaberrant blood smear, this suggests that the initial aberrationsegregates with the MEnT5 rather than the Myc transgene.

The spleens of diseased MEnT5:Myc animals showedmarked extramedullary hematopoiesis with focally exten-sive necrosis. To determine whether this phenotype alsosegregated with the MEnT5 transgene, we performedcolony-forming assays using MEnT5 and wt spleens. Cellswere plated in methylcellulose supporting the growth ofmurine CFU-GEMM, BFU-E, and CFU-granulocyte mac-rophage (CFU-GM) colonies and colonies were countedand typed to 14 days in culture. Total MEnT5 spleen-derived colony numbers were 2.5-fold higher than fromwt spleen (Fig. 1C, mean total of wt lanes 1, 3, 5, and 7is 305, compared with MEnT5, where mean total of lanes2, 4, 6, and 8 is 748), with the proportion of MEnT5CFU-GEMM (lane 2) increasing to 19% from 10% in wt(lane 1). We also observed novel colonies containing cellsunclassifiable by normal criteria (lane 8; UC cells).

To further classify the aberrant erythroid cells seen inMEnT5 and MEnT5:Myc mice, samples from wt, Myc,MEnT5, and MEnT5:Myc bone marrow (BM) and LNwere stained with antibodies against Ter119 and CD71,which together can be used to distinguish between the dif-ferent stages of erythroid maturation [3]. Results are shownin Figure 2A. The BM of MEnT5:Myc animals contained3.5% of cells falling within gate R2, compared with 1.0%in wt controls, and almost twice the normal number of cellsin gate R3, indicating an overrepresentation of proerythro-blasts (R2) and basophilic erythroblasts (R3). The majorityof aberrant cells in the MEnT5:Myc LN were orthochroma-tophilic erythroblasts or later, but there was a small but sig-nificant proportion of cells falling within gates R2 and R4,indicating that all stages of erythroblasts were present.Fewer than 2% of MEnT5:Myc LN cells expressed the

http://www.stanford-edu/group/nolan/protocols2

http://www.stanford-edu/group/nolan/protocols2


Ace

ll nu

mbe

r x10

e6

0

500

1000

1500

2000

2500

3000

Myc

8

wt 8

MEn

T5 8

MEn

T5:M

yc 6

-7

MEn

T5:M

yc 8

-9

MEn

T5:M

yc 1

2

MEn

T5:M

yc 1

3Genotype and age in weeks

B

wild type

MEnT5

MEnT5:Myc

C

colo

nies

(num

ber)

spleen

colony type/genotype

0

100

200

300

400

500

600

3 4 5 6 7 81 2

*

*

*

*

lymph node

blood

Figure 1. Peripheral phenotypes of MEnT and MEnT:Myc mice. (A) Cell counts from the lymph nodes (LN) of wild-type (wt), MEnT5, Myc, and MEnT5:-

Myc mice of 6 to 13 weeks of age. (B) Blood (right panels) and LN preparations (left panels) from wt (top panels), MEnT5 (center panels) and MEnT5:Myc

(lower panels) mice were stained with hematoxylin and eosin to show morphology, and neutral benzidine to identify erythroid cells. The arrows indicate

target cells. Inset: small benzidine positive cells in MEnT5:Myc LN. (C) Colony-forming assays from wt and MEnT spleens. Mean numbers of colony-

forming unit granulocyte-erythrocyte-monocyte-megakaryocyte (CFU-GEMM) (lanes 1 and 2), burst-forming unit erythroid (BFU-E) (lanes 3 and 4),

CFU-granulocyte macrophage (CFU-GM) (Lanes 5 and 6) and unclassifiable (lanes 7 and 8) are shown for wt spleen (lanes 1, 3, 5, and 7) or MEnT5 spleen

(lanes 2, 4, 6, and 8). *Values significantly different to wt (p ! 0.05).

T-cell markers CD4 or CD8, the B-cell marker B220, themacrophage marker MacI or the granulocyte marker Gr1(data not shown). In MEnT5 animals, changes were lessmarked, although there was a slight increase in proerythro-blasts and basophilic erythroblasts in the BM, and cells fall-ing into the more mature gates R4 and R5 were found in theLN. Myc BM and LN samples were very similar to wtcontrols.

Expression of the erythroid-specific genes Gata1 [9],Klf1 [16], Epor [25], and Hbb (b-globin) was examinedusing SQ-RT-PCR on RNA samples derived from totaland Ter119þ flow-sorted wt BM, or from total and

Ter119þ sorted LN and thymic cells from wt andMEnT5:Myc animals (Fig. 2B). As would be expected,wt total or Ter119þ sorted BM samples expressedGata1, Klf1, Epor, and Hbb (Fig. 2B, lanes 1 and 2),whereas expression of these genes, with the exception ofa low level of expression of Hbb, was absent from wtLN and thymus samples (Fig 2, lanes 3 and 6). Incontrast, MEnT5:Myc total and Ter119þ sorted LN andthymus samples expressed Gata1, Klf1, Epor, and Hbb(Fig 2, lanes 4, 5, 7, and 8). Levels of expression lookedvery similar to that seen in normal BM. Taken together,these data show that the erythroblastosis observed in the


Figure 2. Increased numbers of erythroid cells in the bone marrow and lymphoid tissues of MEnT and MEnT5:Myc animals. (A) Cells from wild-type (wt),

Myc, MEnT, and MEnT5:Myc bone marrow (BM) and lymph nodes (LN) were incubated with anti-CD71 and anti-Ter119 antibodies and analyzed by flow

cytometry. The percentage of cells in each of sectors R1–R5 (schematic on right) is shown. (B) Semi-quantitative reverse transcriptase-polymerase chain

reaction of erythroid genes Gata1, Klf1, erythropoietin receptor (Epor), and Hbb with Act b as a loading control is shown for: wt BM (lane 1); Ter119þwt BM (lane 2); wt LN (lane 3); MEnT5:Myc LN (lane 4); Ter119þ MEnT5:Myc LN (lane 5); wt thymus (lane 6); MEnT5:Myc thymus (lane 7), and

Ter119þ MEnT5:Myc thymus (lane 8).

periphery of MEnT5:Myc animals is also evident in theBM, and that the peripheral erythroblasts express genesappropriate to their cell type.

Increased numbers of erythroidprogenitors in MEnT5 and MEnT5:Myc BMHematopoietic progenitor numbers within the BM of wt,Myc, MEnT5, and MEnT5:Myc animals were determinedusing colony-forming assays. BM cells were plated inmethylcellulose supporting the growth of murine CFU-GEMM, BFU-E, and CFU-GM colonies and colonieswere counted and typed to 14 days in culture. Total num-bers of colonies (expressed as an average) are shown inFigure 3A. MEnT5:Myc BM was able to generate almosttwice as many colonies as any other BM type (comparelane 4 with lanes 1–3). Significant biases toward CFU-GEMM and BFU-E colony formation were observed in cul-tures from both MEnT5 and MEnT5:Myc BM (Fig. 3B, toptwo panels, lanes 3 and 4) compared to wt or Myc BM(Fig. 3B, top two panels, lanes 1 and 2). These data suggestthat, as in vivo, in in vitro assays, the Myc transgene cancombine with MEnT5 to cause increased proliferation lead-ing to greater colony numbers. However, BM from MEnT5

contains a greater than normal proportion of erythroid pro-genitors, irrespective of the presence of the Myc transgene.

Insertional activation of theLrfn2 gene in MEnT5:Myc miceThe erythroblastosis phenotype in MEnT5:Myc animalswas not observed when other lines of MEnTCD2 transgenicanimals, or the MTCD2.5 line (which expresses a differentMyb dominant negative protein [22]), were crossed with theMyc line. This was not due to a difference in expression ofthe Myb transgene, as SQ-RT-PCR demonstrated that alltransgenes were expressed in Ter119þ cells, albeit at verylow levels (data not shown). We therefore investigated thepossibility that the MEnT5 transgene had integrated intoa locus such that it disrupted a gene involved in erythropoi-esis. Cloning, sequencing, and database analysis deter-mined that in the MEnT5 line, the transgene hadintegrated in the reverse orientation into the first intron ofthe Lrfn2 gene (GeneID: 70530) on chromosome 17 C,before the translation start site in exon 2 (Fig. 4A).

Lrfn2 expression was examined in total and Ter119þ

sorted BM, LN, and thymic cells from wt and MEnT5:Mycanimals by Q-RT-PCR using primers spanning exons 2 and


3, which comprise the coding region of the Lrfn2 gene.Lrfn2 mRNA was detected at low levels in wt total andTer119þ BM relative to an Actb control (Fig. 4B lanes 1and 2), and was undetectable in wt LN and thymus samples(Fig. 4B, lanes 3 and 6). In contrast, Lrfn2 expression wasobserved in MEnT5:Myc total LN and thymus (Fig. 4B,lanes 4 and 7), and the level of expression was more thansixfold greater in Ter119þ cells from both MEnT5:MycLN and thymus than in Ter119þ wt BM (Fig. 4B lanes 5and 8; compare to lane 2). This increase could be due to in-sertional activation of Lrfn2, but might reflect the fact thatthe predominant Ter119þ population in MEnT5:Myc LN isat a later developmental stage than in wt BM (Fig. 2A), andthat this population has a naturally higher Lrfn2 expressionlevel. To compare more closely equivalent populations, wealso looked by Q-RT-PCR at Lrfn2 expression in Ter119þ

sorted BM samples from wt, Myc, MEnT5, and MEnT5:

Figure 3. Increased erythroid progenitors and unclassifiable (UC) cells in

MEnT5, MEnT5:Myc, or Lrfn2-transduced bone marrow. (A) Mean total

colonies from bone marrow (BM) of wild-type (wt) (n 5 15; lane 1); Myc

(n 5 7; lane 2); MEnT5 (n 5 13; lane 3); MEnT5:Myc (n 5 5; lane 4);

wt transduced with control virus (n 5 10; lane 5); Myc transduced with con-

trol virus (n 5 3; lane 6); wt transduced with v-Lrfn2 virus (n 5 11; lane 7);

Myc transduced with v-Lrfn2 virus (n 5 3; lane 8),and MEnT5 transduced

with v-Lrfn2 virus (n 5 3; lane 9). (B) Percentages of colony-forming unit-

granulocyte-erythrocyte-monocyte-megakaryocyte (CFU-GEMM), burst-

forming unit-erythroid (BFU-E), CFU-granulocyte macrophage (CFU-

GM) and colonies of unknown type (UC) were determined in colony-form-

ing assays. Numbering as for (A). *Values significantly different to wt (p !0.05).

Myc animals. Relative to wt (Fig. 4C, lane 1), Lrfn2 expres-sion was increased by less than twofold in Myc cells(Fig. 4C, lane 2), by threefold in MEnT5 cells (Fig. 4C,lane 4), and by more than fivefold in MEnT5:Myc cells(Fig. 4C, lane 5). Again, while it is possible that subset dif-ferences are responsible, it seems likely that expression ofLrfn2 is increased at least in part because of insertionalactivation by the MEnT5 transgene.

To determine whether insertion of the MEnT5 transgenehad resulted in a modified form of Lrfn2 mRNA being pro-duced, we performed on MEnT5 BM and LN cDNAs usingprimers abutting the start of the coding region of Lrfn2 inexon 2. Several novel bands were observed, all containing

A Chr 17

exon3

ATG STOP

B

C

0

5

10

15

20

25

30

35

1 2 3 4 5 6 7 8

Lrfn

2/Ac

t bLr

fn2/

Act b

0

2

4

6

8

10

12

14

1 2 3 4

95.2 kb 39.7 kb 25.1 kbexon 2exon1

Figure 4. Integration into and anomalous expression of the Lrfn2 gene.

(A) Schematic of the insertion point of the MEnT5 transgene. Lrfn2 exons

1, 2, and 3 are depicted by white boxes and the MEnT transgene and di-

rection of insertion by a gray arrow. (B) Quantitative reverse transcriptase-

polymerase chain reaction (Q-RT-PCR) comparison of Lrfn2 expression

relative to that of Act b for: wild-type (wt) bone marrow (BM) (lane 1);

Ter119þ wt BM (lane 2); wt lymph nodes (LN) (lane 3); MEnT5:Myc

LN (lane 4); Ter119þ MEnT5:Myc LN (lane 5); wt thymus (lane 6);

MEnT5:Myc thymus (lane 7), and Ter119þ MEnT5:Myc thymus (lane

8). (C) Q-RT-PCR comparison of Lrfn2 expression relative to that of Act

b for: Ter119þ wt BM (lane 1); Ter119þ Myc BM (lane 2); Ter119þMEnT5 BM (lane 3), and Ter119þ MEnT5:Myc BM (lane 4).


a fusion product in which sequences from part of the trans-genic control region, namely the reverse orientation of HBBexon 3 [22], were joined to the splice acceptor sequence ofLrfn2 exon 2, preserving the Lrfn2 initiating methionine(data not shown). Examination of the sequence at the fusionpoint showed stop codons in all three frames immediatelyupstream of the Lrfn2 initiating methionine, strongly sug-gesting that these fusion mRNAs still translate a normalLrfn2 protein product.

Erythroid phenotype can be replicatedby overexpression of normal Lrfn2To resolve the issues regarding insertional activation andpotential mutagenesis of Lrfn2 in MEnT5 transgenics, we

Figure 5. Subset definition and cell-cycle analysis of v-Lrfn2–infected

bone marrow–derived unclassifiable (UC) cells. (A) Flow cytometry plot

of side-scatter and forward-scatter characteristics of UC cells. Three sub-

populations of cells (P1, P2, and P3) were identified. The percentages of

cells in each population is shown. (B) Cells were sorted into populations

P1, P2, and P3 by forward and side scatter and the cell cycle of the total

culture or each of these populations determined by staining with propidium

iodide followed by flow cytometry. The percentage of cells in each stage of

the cell cycle is shown.

decided to determine whether the expression of normalLrfn2 alone was sufficient to induce the observed changein erythroid progenitor numbers. Therefore, we cloneda full-length wt Lrfn2 cDNA from mouse thymus, and in-serted it into the MSCV-IRES-GFP retroviral vector [26]to make the construct v-Lrfn2. Wt, MEnT5, or Myc BMwas transduced with either empty vector or v-Lrfn2. As be-fore, BM cells were plated in methylcellulose supportingthe growth of CFU-GEMM, BFU-E, and CFU-GM murinecolonies, and colonies were counted and typed to 14 days.We assessed the efficiency of retroviral transduction bymaking RNA from multiple individual colonies from bothempty vector and v-Lrfn2 vector plates, and looking byRT-PCR for GFP expression; for both viruses, approxi-mately 80% of colonies were infected. Mean total colonynumbers were increased in v-Lrfn2-infected wt, Myc andMEnT5CD2.5 BM relative to control-infected wt or MycBM (Fig. 3A, compare lanes 7, 8, and 9 with lanes 5 and6). Expression of Lrfn2 in wt, Myc, or MEnT5 BM cells(Fig. 3B, top panels, lanes 7, 8, and 9) resulted in significantincreases in BFU-E and CFU-GEMM colony formationwhen compared to empty vector controls (Fig. 3B, toppanels, lanes 5 and 6) or uninfected wt BM cells(Fig. 3B, top panels, lane 1). This increase resembled thatseen in colony assays using uninfected MEnT5 andMEnT5:Myc BM (Fig. 3B, top panels, lanes 3 and 4). How-ever, transducing MEnT5 BM with the v-Lrfn2 virus(Fig. 3B, top panels, lane 9) did not increase the bias towardan erythroid fate when compared to MEnT5 (Fig. 3B, toppanels, lane 3) or MEnT5:Myc BM alone (Fig. 3B, toppanels, lane 4), although the ratio of CFU-GEMM toBFU-E was changed in favor of the less mature CFU-GEMM colony type. Therefore, in summary, these datashow that overexpression of normal Lrfn2 in an in vitrocolony-forming assay is sufficient to replicate the in vitrophenotype of MEnT5 and MEnT5:Myc BM, providingstrong evidence that the transgenic phenotype is dependentupon insertional activation of the endogenous Lrfn2 geneand overproduction of normal Lrfn2 protein, rather thanexpression of the MEnTCD2 transgene.

Characterization of unclassifiable coloniesA significant number of colonies unclassifiable by normalcriteria (UC) were observed in colony-forming assayswhen any of wt, Myc, or MEnT BM were infected withv-Lrfn2, and also in MEnT5 and MEnT5:Myc BM(Fig. 3B, lower right panel, lanes 3,4, 7–9). Growth ofMEnT5, MEnT5:Myc BM or normal BM infected with v-Lrfn2 in unsupplemented (fetal calf serum only) mediumresulted in the expansion of UC cells, with this expansioncontinuing over a period of more than 9 months. However,UC cells injected into nude mice failed to produce tumors(data not shown). We examined the cells derived from wtBM infected with v-Lrfn2 in more detail. All cells wereGFP-positive, and hence retrovirally infected (data not


shown). Flow cytometric analysis showed that the cellscould be split into three subsets based on forward andside-scatter parameters (Fig. 5A). When sorted into thesethree populations, termed P1, P2, and P3, and culturedfor 3 days, it was evident from time-lapse studies that thecells were able to interconvert freely between the threestates (data not shown). P3 cells were also cycling rapidly(Fig. 5B) with a division time of approximately 10 hours(data not shown), whereas the P1 and P2 populationswere not in cycle (Fig. 5B).

P3 cells were large adherent stellate cells (Fig. 6A, broadarrow), which did not exhibit contact inhibition and werehighly mobile, while P1 and P2 cells were smaller and non-adherent (Fig. 6A, thin arrows). Morphologically, P3 cellsseemed to share some of the characteristics of fibroblasts.To further phenotype the cells, we stained them with a vari-ety of antibodies. Figure 6B shows flow cytometry plotsgated on P3 cells, demonstrating that O75% of cellsstained positively for Sca1, CD44, CD54, and CD105,with 60% of cells also being positive for the fibroblastmarker CD248 and approximately 35% to 40% being pos-itive for CD11b, CD34, and CD117. A list of all antibodiesused and the staining patterns of all three populations P1-P3is shown in Table 1. SQ-RT-PCR analysis of the cells alsodemonstrated that they lacked Gata1 expression, but ex-pressed both Gata2 and Gata3 (Fig. 6C), a combinationnormally associated in hematopoiesis with the T cell line-age [27] . However, they also expressed Epor, althoughthey did not require erythropoietin for growth. This patternof marker staining and gene expression does not correspondto any known lineage. However, based on morphology, thepresence of the leukocyte marker CD45 [28] and the hema-topoietic stem/progenitor cell markers Sca1, CD34, andCD117 [29], and the fibrocyte/fibroblast markers CD11b,CD14, CD54 [30], CD140b, and CD248 [31], we provision-ally suggest the cells may be fibroblasts derived from hema-topoietic stem cells (HSCs).

DiscussionWe describe here a novel erythroblastosis whose genesisrequires either overexpression or insertional activation ofthe Lrfn2 gene. Lrfn2, also called SALM1, belongs to afive-member protein family of type 1 glycosylated trans-membrane proteins whose highly conserved extracellular

Figure 6. Morphology and staining profile of v-Lrfn2–infected unclassifi-

able (UC) cells. (A) UC culture at �40 magnification. Small arrows mark

examples of the smaller cells and the large arrows examples of the larger

cells in the culture. (B) Surface phenotype of P3 cells analyzed by flow cy-

tometry. The percentage of positive cells is shown in each case. (C) Semi-

quantitative reverse transcriptase-polymerase chain reaction of Kit, Klf1,

erythropoietin receptor (Epor), Sca1, LRFN2, Gata1, Gata2, Gata3 with

Act b as a loading control is shown for: wild-type bone marrow (lane 1)

and cultured cells shown in A (lane 2).

=


N-terminal regions all have six leucine-rich repeats (LRRs),an immunoglobulin (Ig) C2-type domain with a cysteine-rich flanking region and a fibronectin type 2 (Fn) domain[32]. This combination of structural motifs suggests theyare cell-adhesion molecules capable of making multipleprotein-to-protein interactions. The LRR-Ig-FN extracellu-lar domain organization of the Lrfn family is common toa number of other protein families, most of which are ex-pressed in the mammalian nervous system (reviewed in[32]). Based on studies of these other proteins the LRR-Ig-Fn motif has been proposed to provide a molecular an-chor for the elongating neurite [33]. However, an additionalfeature of the Lrfn family is that the cytoplasmic domainsof Lrfn1, 2 and 4 terminate in a class 1 PDZ-binding motif,which can interact in vitro with the postsynaptic proteinPSD95 [32,33]. A combination of an LRR-Ig extracellulardomain together with an intracellular PDZ-binding motifalso has precedent in the nervous system, being found inthe NGL1 and LRRC4 proteins. NGL1 is the ligand for Ne-trin G1, and its overexpression forces outgrowth of thala-mocortical axons [34], while LRRC4, whose bindingpartner is currently unknown, is a putative tumor suppressorthought to inhibit proliferation of gliomas by repressing sig-nal transduction through multiple pathways [35].

Lrfn2 itself has been proposed to be involved in forma-tion and maintenance of the neuronal synapse. Lrfn2 canassociate with the N-methyl-D-aspartate (NMDA) receptorin neuronal cells both via its cytoplasmic interaction with

Table 1. Surface phenotype of unclassifiable cells

% Positive cells

Marker Total P1 P2 P3 Entrez gene

Sca-1 95.5 93.7 94.6 99.9 110454

CD44 88.8 41.7 62.1 98.5 12505

CD105 72.7 75.8 64.0 97.3 13805

CD54 59.1 67.2 52.5 86.0 15894

CD248 41.1 1.9 2.5 60.2 70445

CD34 17.5 1.3 4.4 41.6 12490

CD117 21.0 0.3 2.2 40.0 16590

CD11b 18.9 0.7 3.0 34.2 16409

CD14 17.6 0.9 3.7 29.3 12475

CD45 15.4 0.9 6.2 27.6 19264

Ter119 12.2 3.3 9.5 23.3 104231

CD31 15.2 2.9 3.0 18.5 18613

CD106 7.0 0.5 0.5 15.4 22329

CD140b 9.2 0.2 0.7 15.3 18596

CD133 12.5 1.2 13.7 14.1 19126

CD2 8.2 5.6 24.7 13.1 12481

CD144 8.7 2.8 9.0 10.9 12562

CD140a 17.3 0 2.8 9.1 18595

CD48 2.3 0.2 0.2 6.2 12506

CD71 2.6 0 0.1 5.7 22042

AA4.1 6.9 11.1 9.6 3.1 17064

CD45R 8.0 0 5.9 3.1 19264

CD13 2.9 0.2 4.5 2.8 16790

CD150 0.1 0 0.6 1.8 27218

CD90 0.1 0.1 0 0.1 21838

PSD95 and also via its extracellular domains, and is ableto recruit PSD95 to the cell periphery [32,33]. Like otherLRR-Ig-Fn proteins, overexpression of Lrfn2 promotesneurite outgrowth in cultured hippocampal neurons [33].Recently, the related protein Lrfn1 (SALM2) has alsobeen shown to associate with PSD95 and both the NMDAand AMPA receptors, increasing the number of excitatorysynapses and dendritic spines if overexpressed [36].

We show in this article that Lrfn2 transcripts can bedetected in total BM and Ter119þ sorted BM cells fromnormal mice, and that its overexpression affects the differ-entiation of normal BM, making it likely that Lrfn2 hashad, until now, an unreported role in hematopoiesis. Previ-ous studies have focused on expression of the Lrfn genefamily in the brain, but analysis of available microarraydata shows that in addition to Lrfn2, Lrfn4 is also of partic-ular interest with respect to early hematopoiesis, as itis found at high levels in mouse BM, and in humans, ishighly expressed in bone-marrow–derived CD105þ endo-thelial cells and CD34þ cells [37]. In support of the latterobservation, human CD34þCD33�CD38�Rholokitþ hema-topoietic stem/progenitor cells show a 3.5-fold enrichmentof LRFN4 mRNA when compared with an HSC-depletedCD34þCD33�CD38�Rhohikitþ population [38]. Whileany discussion of the role of these two proteins in hemato-poiesis is clearly speculative at this stage, by extrapolationfrom their proposed function in neuronal development, itseems likely that they are acting as bridging molecules be-tween as yet unidentified extracellular structures and intra-cellular scaffold proteins, functioning as mediators in thetranslation of extracellular stimuli into intracellular signal-ing. It is possible that Lrfn proteins may interact with estab-lished molecules such as Epor, Kit, or the glucocorticoidreceptor whose dysregulation is known to lead to erythro-blastosis (reviewed in [39]), but equally that it is acting ina completely novel way. Interestingly, the erythroblastosisphenotype of MEnT5:Myc mice relies upon cooperationbetween the MEnT5 integration into the Lrfn2 locus andthe ubiquitously expressed Myc transgene, with the latterlikely acting in its well-established role as a proliferativeagent [40]. However, MEnT5 single transgenic LN alreadycontain a significant proportion of abnormal erythroid cells,and it is not clear how these abnormal cells enter the lym-phatic system. A role for Lrfn2 in this aberrant localization,perhaps by means of its function as an adhesion-like mole-cule, is therefore a possibility.

In addition to the in vivo erythroblastosis phenotype,a population of cells that we have been unable to classifyunequivocally, and which we have termed UC cells, canbe cultured from MEnT5 and MEnT5:Myc BM and lym-phoid organs, or from wt BM transduced with Lrfn2. Al-though they do not correspond to any characterized celltype, the presence of markers for both early hematopoieticcells and fibroblasts leads us to suggest that they may rep-resent a novel intermediate in the differentiation series from


an HSC-derived CFU-F to fibrocytes/fibroblasts [41–43].Whether these cells transiently exist in normal BM, andhave been ‘‘frozen’’ by overexpression of Lrfn2, or are anabnormal result of Lrfn2 expression, remains to be defined.

AcknowledgmentsThis work was supported by Cancer Research UK. We thank De-melza Bird and LuAnn McKinney for technical assistance, andClare Isacke, John MacFadyen, Hugh Paterson and Bob Paulsonfor protocols and helpful discussions.

References1. Gregory CJ, Eaves AC. Three stages of erythropoietic progenitor cell

differentiation distinguished by a number of physical and biologic

properties. Blood. 1978;51:527–537.

2. Gregory CJ, Eaves AC. Human marrow cells capable of erythropoietic

differentiation in vitro: definition of three erythroid colony responses.

Blood. 1977;49:855–864.

3. Socolovsky M, Nam H, Fleming MD, Haase VH, Brugnara C, Lodish

HF. Ineffective erythropoiesis in Stat5a(�/�)5b(�/�) mice due to de-

creased survival of early erythroblasts. Blood. 2001;98:3261–3273.

4. Guillemin K, Krasnow MA. The hypoxic response: huffing and HIF-

ing. Cell. 1997;89:9–12.

5. Broudy VC, Lin NL, Priestley GV, Nocka K, Wolf NS. Interaction of

stem cell factor and its receptor c-kit mediates lodgment and acute ex-

pansion of hematopoietic cells in the murine spleen. Blood. 1996;88:

75–81.

6. Bauer A, Tronche F, Wessely O, et al. The glucocorticoid receptor is

required for stress erythropoiesis. Genes Dev. 1999;13:2996–3002.

7. Cantor AB, Orkin SH. Hematopoietic development: a balancing act.

Curr Opin Genet Dev. 2001;11:513–519.

8. Hall MA, Slater NJ, Begley CG, et al. Functional but abnormal adult

erythropoiesis in the absence of the stem cell leukemia gene. Mol Cell

Biol. 2005;25:6355–6362.

9. Fujiwara Y, Browne CP, Cunniff K, Goff SC, Orkin SH. Arrested de-

velopment of embryonic red cell precursors in mouse embryos lacking

transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996;93:

12355–12358.

10. Suwabe N, Takahashi S, Nakano T, Yamamoto M. GATA-1 regulates

growth and differentiation of definitive erythroid lineage cells during

in vitro ES cell differentiation. Blood. 1998;92:4108–4118.

11. Takahashi S, Komeno T, Suwabe N, et al. Role of GATA-1 in prolif-

eration and differentiation of definitive erythroid and megakaryocytic

cells in vivo. Blood. 1998;92:434–442.

12. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in

mice lacking the transcription factor GATA-2. Nature. 1994;371:

221–226.

13. Kitajima K, Tanaka M, Zheng J, et al. Redirecting differentiation of

hematopoietic progenitors by a transcription factor, GATA-2. Blood.

2006;107:1857–1863.

14. Hodge D, Coghill E, Keys J, et al. A global role for EKLF in definitive

and primitive erythropoiesis. Blood. 2006;107:3359–3370.

15. Perkins AC, Sharpe AH, Orkin SH. Lethal beta-thalassaemia in mice

lacking the erythroid CACCC-transcription factor EKLF. Nature.

1995;375:318–322.

16. Miller IJ, Bieker JJ. A novel, erythroid cell-specific murine transcrip-

tion factor that binds to the CACCC element and is related to the

Kruppel family of nuclear proteins. Mol Cell Biol. 1993;13:2776–

2786.

17. Rao G, Rekhtman N, Cheng G, Krasikov T, Skoultchi AI. Deregu-

lated expression of the PU.1 transcription factor blocks murine er-

ythroleukemia cell terminal differentiation. Oncogene. 1997;14:123–

131.

18. Rekhtman N, Choe KS, Matushansky I, Murray S, Stopka T, Skoultchi

AI. PU.1 and pRB interact and cooperate to repress GATA-1 and block

erythroid differentiation. Mol Cell Biol. 2003;23:7460–7474.

19. Rekhtman N, Radparvar F, Evans T, Skoultchi AI. Direct interaction

of hematopoietic transcription factors PU.1 and GATA-1: functional

antagonism in erythroid cells. Genes Dev. 1999;13:1398–1411.

20. Zhang J, Randall MS, Loyd MR, et al. Role of erythropoietin receptor

signaling in Friend virus-induced erythroblastosis and polycythemia.

Blood. 2006;107:73–78.

21. von Lindern M, Deiner EM, Dolznig H, et al. Leukemic transfor-

mation of normal murine erythroid progenitors: v- and c-ErbB act

through signaling pathways activated by the EpoR and c-Kit in stress

erythropoiesis. Oncogene. 2001;20:3651–3664.

22. Badiani P, Corbella P, Kioussis D, Marvel J, Weston K. Dominant in-

terfering alleles define a role for c-Myb in T-cell development. Genes

Dev. 1994;8:770–782.

23. Jonkers J, Korswagen HC, Acton D, Breuer M, Berns A. Activation

of a novel proto-oncogene, Frat1, contributes to progression of mouse

T-cell lymphomas. Embo J. 1997;16:441–450.

24. Collins FS, Weissman SM. Directional cloning of DNA fragments at

a large distance from an initial probe: a circularization method. Proc

Natl Acad Sci U S A. 1984;81:6812–6816.

25. Longmore GD, Watowich SS, Hilton DJ, Lodish HF. The erythropoi-

etin receptor: its role in hematopoiesis and myeloproliferative dis-

eases. J Cell Biol. 1993;123:1305–1308.

26. Van Parijs L, Refaeli Y, Lord JD, Nelson BH, Abbas AK, Baltimore D.

Uncoupling IL-2 signals that regulate T cell proliferation, survival,

and Fas-mediated activation-induced cell death. Immunity. 1999;11:

281–288.

27. Burch JB. Regulation of GATA gene expression during vertebrate

development. Semin Cell Dev Biol. 2005;16:71–81.

28. Trowbridge IS, Thomas ML. CD45: an emerging role as a protein ty-

rosine phosphatase required for lymphocyte activation and develop-

ment. Annu Rev Immunol. 1994;12:85–116.

29. Wognum AW, Eaves AC, Thomas TE. Identification and isolation of

hematopoietic stem cells. Arch Med Res. 2003;34:461–475.

30. Quan TE, Cowper S, Wu SP, Bockenstedt LK, Bucala R. Circulating

fibrocytes: collagen-secreting cells of the peripheral blood. Int J Bio-

chem Cell Biol. 2004;36:598–606.

31. Macfadyen J, Savage K, Wienke D, Isacke CM. Endosialin is ex-

pressed on stromal fibroblasts and CNS pericytes in mouse embryos

and is downregulated during development. Gene Expr Patterns.

2007;7:363–369.

32. Morimura N, Inoue T, Katayama K, Aruga J. Comparative analysis of

structure, expression and PSD95-binding capacity of Lrfn, a novel

family of neuronal transmembrane proteins. Gene. 2006;380:72–83.

33. Wang CY, Chang K, Petralia RS, Wang YX, Seabold GK, Wenthold

RJ. A novel family of adhesion-like molecules that interacts with

the NMDA receptor. J Neurosci. 2006;26:2174–2183.

34. Lin JC, Ho WH, Gurney A, Rosenthal A. The netrin-G1 ligand NGL-1

promotes the outgrowth of thalamocortical axons. Nat Neurosci. 2003;

6:1270–1276.

35. Wu M, Huang C, Gan K, et al. LRRC4, a putative tumor suppressor

gene, requires a functional leucine-rich repeat cassette domain to inhibit

proliferation of glioma cells in vitro by modulating the extracellular

signal-regulated kinase/protein kinase B/nuclear factor-kappaB path-

way. Mol Biol Cell. 2006;17:3534–3542.

36. Ko J, Kim S, Chung HS, et al. SALM synaptic cell adhesion-like mol-

ecules regulate the differentiation of excitatory synapses. Neuron.

2006;50:233–245.

37. Su AI, Cooke MP, Ching KA, et al. Large-scale analysis of the human

and mouse transcriptomes. Proc Natl Acad Sci U S A. 2002;99:4465–

4470.


38. Eckfeldt CE, Mendenhall EM, Flynn CM, et al. Functional analysis of

human hematopoietic stem cell gene expression using zebrafish. PLoS

Biol. 2005;3:e254.

39. Dolznig H, Grebien F, Deiner EM, et al. Erythroid progenitor renewal

versus differentiation: genetic evidence for cell autonomous, essential

functions of EpoR, Stat5 and the GR. Oncogene. 2006;25:2890–2900.

40. Hoffman B, Amanullah A, Shafarenko M, Liebermann DA. The proto-

oncogene c-myc in hematopoietic development and leukemogenesis.

Oncogene. 2002;21:3414–3421.

41. Castro-Malaspina H, Gay RE, Resnick G, et al. Characterization of

human bone marrow fibroblast colony-forming cells (CFU-F) and their

progeny. Blood. 1980;56:289–301.

42. Ebihara Y, Masuya M, Larue AC, et al. Hematopoietic origins of fibro-

blasts: II. In vitro studies of fibroblasts, CFU-F, and fibrocytes. Exp

Hematol. 2006;34:219–229.

43. Perkins S, Fleischman RA. Stromal cell progeny of murine bone mar-

row fibroblast colony-forming units are clonal endothelial-like cells

that express collagen IV and laminin. Blood. 1990;75:620–625.

regulation of erythropoiesis by the neuronal transmembrane protein lrfn2

Documents